>Feature sequence001 1326 532 gene locus_tag LOCUS_00010 1326 532 CDS product discoidin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002359839.1 protein_id gnl|my_center|LOCUS_00010 3132 1342 gene locus_tag LOCUS_00020 3132 1342 CDS product heparinase II/III-family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201967.1 protein_id gnl|my_center|LOCUS_00020 3231 4406 gene locus_tag LOCUS_00030 3231 4406 CDS product glycoside hydrolase family 88 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922040.1 protein_id gnl|my_center|LOCUS_00030 6004 4415 gene locus_tag LOCUS_00040 6004 4415 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002304851.1 protein_id gnl|my_center|LOCUS_00040 7758 5989 gene locus_tag LOCUS_00050 7758 5989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00050 8001 9284 gene locus_tag LOCUS_00060 8001 9284 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776865.1 protein_id gnl|my_center|LOCUS_00060 9351 10229 gene locus_tag LOCUS_00070 9351 10229 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356840.1 protein_id gnl|my_center|LOCUS_00070 10240 11073 gene locus_tag LOCUS_00080 10240 11073 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002383582.1 protein_id gnl|my_center|LOCUS_00080 11077 13077 gene locus_tag LOCUS_00090 11077 13077 CDS product heparinase II/III family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922036.1 protein_id gnl|my_center|LOCUS_00090 13734 13661 gene locus_tag LOCUS_t00010 13734 13661 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 14465 13806 gene locus_tag LOCUS_00100 14465 13806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00100 14546 16120 gene locus_tag LOCUS_00110 gene lysS 14546 16120 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680521.1 protein_id gnl|my_center|LOCUS_00110 16159 16770 gene locus_tag LOCUS_00120 16159 16770 CDS product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966613.1 protein_id gnl|my_center|LOCUS_00120 17660 16767 gene locus_tag LOCUS_00130 gene era 17660 16767 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679589.1 protein_id gnl|my_center|LOCUS_00130 17784 18356 gene locus_tag LOCUS_00140 17784 18356 CDS product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002667667.1 protein_id gnl|my_center|LOCUS_00140 18371 20596 gene locus_tag LOCUS_00150 18371 20596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00150 20629 21621 gene locus_tag LOCUS_00160 20629 21621 CDS product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680574.1 protein_id gnl|my_center|LOCUS_00160 22257 21622 gene locus_tag LOCUS_00170 22257 21622 CDS product redox-sensing transcriptional repressor Rex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287954.1 protein_id gnl|my_center|LOCUS_00170 22432 22911 gene locus_tag LOCUS_00180 22432 22911 CDS product NAD(P)H-dependent oxidoreductase subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868903.1 protein_id gnl|my_center|LOCUS_00180 22919 23467 gene locus_tag LOCUS_00190 22919 23467 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869297.1 protein_id gnl|my_center|LOCUS_00190 23499 23903 gene locus_tag LOCUS_00200 23499 23903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082448.1 protein_id gnl|my_center|LOCUS_00200 23903 25690 gene locus_tag LOCUS_00210 gene nuoF 23903 25690 CDS product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868905.1 protein_id gnl|my_center|LOCUS_00210 25711 27459 gene locus_tag LOCUS_00220 25711 27459 CDS product NADH-dependent [FeFe] hydrogenase, group A6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393219.1 protein_id gnl|my_center|LOCUS_00220 29551 27512 gene locus_tag LOCUS_00230 29551 27512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00230 29638 30105 gene locus_tag LOCUS_00240 29638 30105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00240 31337 30093 gene locus_tag LOCUS_00250 31337 30093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00250 31487 32035 gene locus_tag LOCUS_00260 31487 32035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00260 32069 32920 gene locus_tag LOCUS_00270 32069 32920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00270 32994 34235 gene locus_tag LOCUS_00280 gene pepT 32994 34235 CDS product peptidase T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723986.1 protein_id gnl|my_center|LOCUS_00280 34235 35185 gene locus_tag LOCUS_00290 34235 35185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00290 35182 36576 gene locus_tag LOCUS_00300 35182 36576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00300 37285 36566 gene locus_tag LOCUS_00310 37285 36566 CDS product glycerophosphodiester phosphodiesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682054.1 protein_id gnl|my_center|LOCUS_00310 38126 37269 gene locus_tag LOCUS_00320 gene nfo 38126 37269 CDS product deoxyribonuclease IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479588.1 protein_id gnl|my_center|LOCUS_00320 38206 41157 gene locus_tag LOCUS_00330 38206 41157 CDS product insulinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257471.1 protein_id gnl|my_center|LOCUS_00330 41505 41161 gene locus_tag LOCUS_00340 41505 41161 CDS product DRTGG domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583279.1 protein_id gnl|my_center|LOCUS_00340 41612 43126 gene locus_tag LOCUS_00350 gene glpK 41612 43126 CDS product glycerol kinase GlpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226257.1 protein_id gnl|my_center|LOCUS_00350 43126 43947 gene locus_tag LOCUS_00360 gene cdaA 43126 43947 CDS product diadenylate cyclase CdaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669723.1 protein_id gnl|my_center|LOCUS_00360 43934 44338 gene locus_tag LOCUS_00370 43934 44338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00370 44338 44715 gene locus_tag LOCUS_00380 44338 44715 CDS product holo-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679605.1 protein_id gnl|my_center|LOCUS_00380 44702 45547 gene locus_tag LOCUS_00390 gene truA 44702 45547 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966380.1 protein_id gnl|my_center|LOCUS_00390 45544 46278 gene locus_tag LOCUS_00400 45544 46278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00400 46278 48242 gene locus_tag LOCUS_00410 gene priA 46278 48242 CDS product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680463.1 protein_id gnl|my_center|LOCUS_00410 48287 48787 gene locus_tag LOCUS_00420 gene def 48287 48787 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669259.1 protein_id gnl|my_center|LOCUS_00420 48751 49728 gene locus_tag LOCUS_00430 gene fmt 48751 49728 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679327.1 protein_id gnl|my_center|LOCUS_00430 49732 51930 gene locus_tag LOCUS_00440 49732 51930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00440 52090 52641 gene locus_tag LOCUS_00450 52090 52641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00450 52583 53452 gene locus_tag LOCUS_00460 52583 53452 CDS product fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002671202.1 protein_id gnl|my_center|LOCUS_00460 53445 53969 gene locus_tag LOCUS_00470 53445 53969 CDS product Fe-S-containing hydro-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393765.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00470 54120 54923 gene locus_tag LOCUS_00480 54120 54923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00480 55599 54907 gene locus_tag LOCUS_00490 55599 54907 CDS product YjjG family noncanonical pyrimidine nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164405296.1 protein_id gnl|my_center|LOCUS_00490 55684 56280 gene locus_tag LOCUS_00500 55684 56280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00500 >Feature sequence002 <1 1482 gene locus_tag LOCUS_00510 <1 1482 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002681149.1:ribonuclease Y 1487 2287 gene locus_tag LOCUS_00520 1487 2287 CDS product TIGR00282 family metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941799.1 protein_id gnl|my_center|LOCUS_00520 2287 3060 gene locus_tag LOCUS_00530 2287 3060 CDS product TlyA family rRNA (cytidine-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942068.1 protein_id gnl|my_center|LOCUS_00530 3568 3050 gene locus_tag LOCUS_00540 3568 3050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00540 3645 5378 gene locus_tag LOCUS_00550 gene ptsP 3645 5378 CDS product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003431795.1 protein_id gnl|my_center|LOCUS_00550 5347 6909 gene locus_tag LOCUS_00560 gene der 5347 6909 CDS product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680939.1 protein_id gnl|my_center|LOCUS_00560 6911 7606 gene locus_tag LOCUS_00570 6911 7606 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002675739.1 protein_id gnl|my_center|LOCUS_00570 7624 9123 gene locus_tag LOCUS_00580 7624 9123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00580 9068 9487 gene locus_tag LOCUS_00590 9068 9487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00590 9652 10230 gene locus_tag LOCUS_00600 9652 10230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00600 10305 12224 gene locus_tag LOCUS_00610 gene dnaK 10305 12224 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681815.1 protein_id gnl|my_center|LOCUS_00610 12405 13340 gene locus_tag LOCUS_00620 gene dnaJ 12405 13340 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002686888.1 protein_id gnl|my_center|LOCUS_00620 13350 14102 gene locus_tag LOCUS_00630 gene rlmB 13350 14102 CDS product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679077.1 protein_id gnl|my_center|LOCUS_00630 14381 15592 gene locus_tag LOCUS_00640 14381 15592 CDS product DUF3798 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868876.1 protein_id gnl|my_center|LOCUS_00640 15727 17361 gene locus_tag LOCUS_00650 15727 17361 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868877.1 protein_id gnl|my_center|LOCUS_00650 17358 18419 gene locus_tag LOCUS_00660 17358 18419 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868878.1 protein_id gnl|my_center|LOCUS_00660 18416 19531 gene locus_tag LOCUS_00670 18416 19531 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868879.1 protein_id gnl|my_center|LOCUS_00670 19528 20004 gene locus_tag LOCUS_00680 19528 20004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00680 21976 20048 gene locus_tag LOCUS_00690 21976 20048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00690 23287 22031 gene locus_tag LOCUS_00700 gene purD 23287 22031 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007334006.1 protein_id gnl|my_center|LOCUS_00700 24322 23336 gene locus_tag LOCUS_00710 gene dusB 24322 23336 CDS product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680788.1 protein_id gnl|my_center|LOCUS_00710 25104 24319 gene locus_tag LOCUS_00720 25104 24319 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680785.1 protein_id gnl|my_center|LOCUS_00720 25379 25846 gene locus_tag LOCUS_00730 25379 25846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00730 25985 27052 gene locus_tag LOCUS_00740 25985 27052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00740 27255 27458 gene locus_tag LOCUS_00750 27255 27458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00750 27515 27829 gene locus_tag LOCUS_00760 27515 27829 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002655986.1 protein_id gnl|my_center|LOCUS_00760 27867 29522 gene locus_tag LOCUS_00770 gene lnt 27867 29522 CDS product apolipoprotein N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679415.1 protein_id gnl|my_center|LOCUS_00770 29519 30784 gene locus_tag LOCUS_00780 29519 30784 CDS product competence/damage-inducible protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142436.1 protein_id gnl|my_center|LOCUS_00780 30924 32744 gene locus_tag LOCUS_00790 30924 32744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00790 32821 33024 gene locus_tag LOCUS_00800 gene rpmE 32821 33024 CDS product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669000.1 protein_id gnl|my_center|LOCUS_00800 33951 33139 gene locus_tag LOCUS_00810 33951 33139 CDS product TIM barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765016.1 protein_id gnl|my_center|LOCUS_00810 34126 35184 gene locus_tag LOCUS_00820 34126 35184 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080120.1 protein_id gnl|my_center|LOCUS_00820 35299 36468 gene locus_tag LOCUS_00830 35299 36468 CDS product galactokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002667821.1 protein_id gnl|my_center|LOCUS_00830 36468 37229 gene locus_tag LOCUS_00840 gene surE 36468 37229 CDS product 5'/3'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082178.1 protein_id gnl|my_center|LOCUS_00840 37222 37572 gene locus_tag LOCUS_00850 37222 37572 CDS product YcgN family cysteine cluster protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943200.1 protein_id gnl|my_center|LOCUS_00850 37637 38797 gene locus_tag LOCUS_00860 37637 38797 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933651.1 protein_id gnl|my_center|LOCUS_00860 38794 39402 gene locus_tag LOCUS_00870 38794 39402 CDS product iron-sulfur cluster assembly scaffold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933650.1 protein_id gnl|my_center|LOCUS_00870 41320 39635 gene locus_tag LOCUS_00880 41320 39635 CDS product nucleoside kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002674349.1 protein_id gnl|my_center|LOCUS_00880 41408 43090 gene locus_tag LOCUS_00890 41408 43090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00890 43569 43036 gene locus_tag LOCUS_00900 gene yfcE 43569 43036 CDS product phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000772458.1 protein_id gnl|my_center|LOCUS_00900 43685 44611 gene locus_tag LOCUS_00910 43685 44611 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679981.1 protein_id gnl|my_center|LOCUS_00910 44590 45855 gene locus_tag LOCUS_00920 44590 45855 CDS product YihY/virulence factor BrkB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943098.1 protein_id gnl|my_center|LOCUS_00920 45891 46367 gene locus_tag LOCUS_00930 45891 46367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00930 46733 46338 gene locus_tag LOCUS_00940 46733 46338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00940 47399 46734 gene locus_tag LOCUS_00950 47399 46734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00950 47490 48158 gene locus_tag LOCUS_00960 47490 48158 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003433947.1 protein_id gnl|my_center|LOCUS_00960 >Feature sequence003 1600 1160 gene locus_tag LOCUS_00970 1600 1160 CDS product YkgJ family cysteine cluster protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002671181.1 protein_id gnl|my_center|LOCUS_00970 1737 1655 gene locus_tag LOCUS_t00020 1737 1655 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 1851 1925 gene locus_tag LOCUS_t00030 1851 1925 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 3253 1964 gene locus_tag LOCUS_00980 gene aroA 3253 1964 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024417.1 protein_id gnl|my_center|LOCUS_00980 3672 3301 gene locus_tag LOCUS_00990 gene aroH 3672 3301 CDS product chorismate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172959.1 protein_id gnl|my_center|LOCUS_00990 4010 3669 gene locus_tag LOCUS_01000 4010 3669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01000 4591 4028 gene locus_tag LOCUS_01010 4591 4028 CDS product thiamine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887197.1 protein_id gnl|my_center|LOCUS_01010 4736 6055 gene locus_tag LOCUS_01020 4736 6055 CDS product DUF1015 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022296.1 protein_id gnl|my_center|LOCUS_01020 6387 6052 gene locus_tag LOCUS_01030 6387 6052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01030 6549 7421 gene locus_tag LOCUS_01040 6549 7421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01040 8341 7418 gene locus_tag LOCUS_01050 8341 7418 CDS product ribonuclease Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679668.1 protein_id gnl|my_center|LOCUS_01050 9537 8368 gene locus_tag LOCUS_01060 9537 8368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01060 10232 9534 gene locus_tag LOCUS_01070 10232 9534 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002668339.1 protein_id gnl|my_center|LOCUS_01070 11385 10216 gene locus_tag LOCUS_01080 11385 10216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01080 12349 11387 gene locus_tag LOCUS_01090 12349 11387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01090 13199 12324 gene locus_tag LOCUS_01100 gene ftsY 13199 12324 CDS product signal recognition particle-docking protein FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002668333.1 protein_id gnl|my_center|LOCUS_01100 14443 13217 gene locus_tag LOCUS_01110 14443 13217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01110 15434 14448 gene locus_tag LOCUS_01120 gene prfB 15434 14448 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014540570.1 protein_id gnl|my_center|LOCUS_01120 17333 15573 gene locus_tag LOCUS_01130 17333 15573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01130 18281 17481 gene locus_tag LOCUS_01140 18281 17481 CDS product Fe-S cluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869100.1 protein_id gnl|my_center|LOCUS_01140 18886 18293 gene locus_tag LOCUS_01150 gene rsxA 18886 18293 CDS product electron transport complex subunit RsxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419046.1 protein_id gnl|my_center|LOCUS_01150 19517 18888 gene locus_tag LOCUS_01160 19517 18888 CDS product electron transport complex subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788152.1 protein_id gnl|my_center|LOCUS_01160 20071 19514 gene locus_tag LOCUS_01170 20071 19514 CDS product RnfABCDGE type electron transport complex subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009902280.1 protein_id gnl|my_center|LOCUS_01170 21162 20068 gene locus_tag LOCUS_01180 21162 20068 CDS product RnfABCDGE type electron transport complex subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761244.1 protein_id gnl|my_center|LOCUS_01180 22469 21162 gene locus_tag LOCUS_01190 gene rsxC 22469 21162 CDS product electron transport complex subunit RsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082948.1 protein_id gnl|my_center|LOCUS_01190 22556 23431 gene locus_tag LOCUS_01200 22556 23431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679695.1 protein_id gnl|my_center|LOCUS_01200 24726 23428 gene locus_tag LOCUS_01210 gene pcnB 24726 23428 CDS product polynucleotide adenylyltransferase PcnB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669419.1 protein_id gnl|my_center|LOCUS_01210 24780 26105 gene locus_tag LOCUS_01220 gene hisS 24780 26105 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679075.1 protein_id gnl|my_center|LOCUS_01220 26102 28615 gene locus_tag LOCUS_01230 26102 28615 CDS product ATP-dependent RNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_044971578.1 protein_id gnl|my_center|LOCUS_01230 29680 28616 gene locus_tag LOCUS_01240 29680 28616 CDS product 3-dehydroquinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680953.1 protein_id gnl|my_center|LOCUS_01240 29727 30902 gene locus_tag LOCUS_01250 29727 30902 CDS product cysteine desulfurase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680952.1 protein_id gnl|my_center|LOCUS_01250 30899 32095 gene locus_tag LOCUS_01260 gene thiI 30899 32095 CDS product tRNA 4-thiouridine(8) synthase ThiI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680552.1 protein_id gnl|my_center|LOCUS_01260 32159 35038 gene locus_tag LOCUS_01270 32159 35038 CDS product acyl-CoA dehydratase activase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016931.1 protein_id gnl|my_center|LOCUS_01270 35035 36276 gene locus_tag LOCUS_01280 35035 36276 CDS product 2-hydroxyacyl-CoA dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016932.1 protein_id gnl|my_center|LOCUS_01280 36332 36982 gene locus_tag LOCUS_01290 gene pgl 36332 36982 CDS product 6-phosphogluconolactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407433.1 protein_id gnl|my_center|LOCUS_01290 36979 38331 gene locus_tag LOCUS_01300 gene zwf 36979 38331 CDS product glucose-6-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393785.1 protein_id gnl|my_center|LOCUS_01300 39389 38397 gene locus_tag LOCUS_01310 gene trpS 39389 38397 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393419.1 protein_id gnl|my_center|LOCUS_01310 39569 39393 gene locus_tag LOCUS_01320 39569 39393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01320 40476 39589 gene locus_tag LOCUS_01330 40476 39589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01330 43573 40481 gene locus_tag LOCUS_01340 gene ileS 43573 40481 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680710.1 protein_id gnl|my_center|LOCUS_01340 43728 45083 gene locus_tag LOCUS_01350 43728 45083 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682344.1 protein_id gnl|my_center|LOCUS_01350 45796 45056 gene locus_tag LOCUS_01360 gene rnc 45796 45056 CDS product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002670498.1 protein_id gnl|my_center|LOCUS_01360 46046 45807 gene locus_tag LOCUS_01370 gene acpP 46046 45807 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002670497.1 protein_id gnl|my_center|LOCUS_01370 46253 46068 gene locus_tag LOCUS_01380 gene rpmF 46253 46068 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002670496.1 protein_id gnl|my_center|LOCUS_01380 >Feature sequence004 768 556 gene locus_tag LOCUS_01390 768 556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01390 1757 918 gene locus_tag LOCUS_01400 1757 918 CDS product carboxylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080508.1 protein_id gnl|my_center|LOCUS_01400 2655 1768 gene locus_tag LOCUS_01410 2655 1768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01410 3306 2659 gene locus_tag LOCUS_01420 3306 2659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01420 4553 3309 gene locus_tag LOCUS_01430 4553 3309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01430 5221 4589 gene locus_tag LOCUS_01440 5221 4589 CDS product exopolysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549867.1 protein_id gnl|my_center|LOCUS_01440 5825 5301 gene locus_tag LOCUS_01450 gene cobO 5825 5301 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972580.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_01450 7018 5834 gene locus_tag LOCUS_01460 7018 5834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01460 8037 7015 gene locus_tag LOCUS_01470 gene pdxA 8037 7015 CDS product 4-hydroxythreonine-4-phosphate dehydrogenase PdxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016238.1 protein_id gnl|my_center|LOCUS_01470 8160 8432 gene locus_tag LOCUS_01480 8160 8432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01480 8615 9613 gene locus_tag LOCUS_01490 8615 9613 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940885.1 protein_id gnl|my_center|LOCUS_01490 9679 10629 gene locus_tag LOCUS_01500 9679 10629 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940886.1 protein_id gnl|my_center|LOCUS_01500 10622 11413 gene locus_tag LOCUS_01510 10622 11413 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_039647756.1 protein_id gnl|my_center|LOCUS_01510 11468 12826 gene locus_tag LOCUS_01520 11468 12826 CDS product EmmdR/YeeO family multidrug/toxin efflux MATE transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816666.1 protein_id gnl|my_center|LOCUS_01520 13161 12823 gene locus_tag LOCUS_01530 13161 12823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01530 13662 13168 gene locus_tag LOCUS_01540 13662 13168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01540 14228 13659 gene locus_tag LOCUS_01550 gene yqeK 14228 13659 CDS product bis(5'-nucleosyl)-tetraphosphatase (symmetrical) YqeK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082149.1 protein_id gnl|my_center|LOCUS_01550 14838 14200 gene locus_tag LOCUS_01560 14838 14200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01560 15849 14848 gene locus_tag LOCUS_01570 gene obgE 15849 14848 CDS product GTPase ObgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679468.1 protein_id gnl|my_center|LOCUS_01570 16117 15866 gene locus_tag LOCUS_01580 gene rpmA 16117 15866 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000940593.1 protein_id gnl|my_center|LOCUS_01580 16443 16129 gene locus_tag LOCUS_01590 gene rplU 16443 16129 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759984.1 protein_id gnl|my_center|LOCUS_01590 16587 17156 gene locus_tag LOCUS_01600 16587 17156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01600 18911 17148 gene locus_tag LOCUS_01610 gene argS 18911 17148 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682282.1 protein_id gnl|my_center|LOCUS_01610 19903 18950 gene locus_tag LOCUS_01620 19903 18950 CDS product biotin--[acetyl-CoA-carboxylase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680895.1 protein_id gnl|my_center|LOCUS_01620 19971 20525 gene locus_tag LOCUS_01630 19971 20525 CDS product biotin transporter BioY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024220.1 protein_id gnl|my_center|LOCUS_01630 20548 21474 gene locus_tag LOCUS_01640 20548 21474 CDS product serine acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194474.1 protein_id gnl|my_center|LOCUS_01640 22789 21476 gene locus_tag LOCUS_01650 gene mtaB 22789 21476 CDS product tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase MtaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679581.1 protein_id gnl|my_center|LOCUS_01650 23577 22786 gene locus_tag LOCUS_01660 23577 22786 CDS product prephenate dehydrogenase/arogenate dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957934.1 protein_id gnl|my_center|LOCUS_01660 24786 23623 gene locus_tag LOCUS_01670 24786 23623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01670 24878 25879 gene locus_tag LOCUS_01680 gene pta 24878 25879 CDS product phosphate acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002666863.1 protein_id gnl|my_center|LOCUS_01680 25919 27316 gene locus_tag LOCUS_01690 25919 27316 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202731.1 protein_id gnl|my_center|LOCUS_01690 28091 27255 gene locus_tag LOCUS_01700 gene rsmA 28091 27255 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682389.1 protein_id gnl|my_center|LOCUS_01700 29394 27994 gene locus_tag LOCUS_01710 29394 27994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01710 30197 29427 gene locus_tag LOCUS_01720 30197 29427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01720 31906 30194 gene locus_tag LOCUS_01730 31906 30194 CDS product phospho-sugar mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679748.1 protein_id gnl|my_center|LOCUS_01730 32561 31896 gene locus_tag LOCUS_01740 32561 31896 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109158.1 protein_id gnl|my_center|LOCUS_01740 32640 33869 gene locus_tag LOCUS_01750 32640 33869 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257135.1 protein_id gnl|my_center|LOCUS_01750 34738 33932 gene locus_tag LOCUS_01760 34738 33932 CDS product YhfC family intramembrane metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233198.1 protein_id gnl|my_center|LOCUS_01760 35420 34803 gene locus_tag LOCUS_01770 35420 34803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01770 35536 36087 gene locus_tag LOCUS_01780 35536 36087 CDS product HDIG domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815839.1 protein_id gnl|my_center|LOCUS_01780 37127 36084 gene locus_tag LOCUS_01790 37127 36084 CDS product dihydroorotase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679913.1 protein_id gnl|my_center|LOCUS_01790 38850 37120 gene locus_tag LOCUS_01800 38850 37120 CDS product dihydroorotate dehydrogenase/oxidoreductase, FAD-binding inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682296.1 protein_id gnl|my_center|LOCUS_01800 39713 38847 gene locus_tag LOCUS_01810 gene pyrF 39713 38847 CDS product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957153.1 protein_id gnl|my_center|LOCUS_01810 40414 39713 gene locus_tag LOCUS_01820 40414 39713 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682319.1 protein_id gnl|my_center|LOCUS_01820 42036 40432 gene locus_tag LOCUS_01830 42036 40432 CDS product bifunctional aspartate carbamoyltransferase catalytic subunit/aspartate carbamoyltransferase regulatory subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002666669.1 protein_id gnl|my_center|LOCUS_01830 44715 42148 gene locus_tag LOCUS_01840 44715 42148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01840 45768 44725 gene locus_tag LOCUS_01850 45768 44725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01850 >Feature sequence005 215 664 gene locus_tag LOCUS_01860 gene rnhA 215 664 CDS product ribonuclease HI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084134.1 protein_id gnl|my_center|LOCUS_01860 661 1209 gene locus_tag LOCUS_01870 661 1209 CDS product chromate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679463.1 protein_id gnl|my_center|LOCUS_01870 1206 1748 gene locus_tag LOCUS_01880 1206 1748 CDS product chromate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679462.1 protein_id gnl|my_center|LOCUS_01880 2292 1732 gene locus_tag LOCUS_01890 2292 1732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01890 3356 2292 gene locus_tag LOCUS_01900 3356 2292 CDS product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002671073.1 protein_id gnl|my_center|LOCUS_01900 4255 3419 gene locus_tag LOCUS_01910 4255 3419 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385216.1 protein_id gnl|my_center|LOCUS_01910 5163 4252 gene locus_tag LOCUS_01920 5163 4252 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014330567.1 protein_id gnl|my_center|LOCUS_01920 6445 5216 gene locus_tag LOCUS_01930 6445 5216 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000182764.1 protein_id gnl|my_center|LOCUS_01930 6659 7288 gene locus_tag LOCUS_01940 6659 7288 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002670667.1 protein_id gnl|my_center|LOCUS_01940 8335 7289 gene locus_tag LOCUS_01950 8335 7289 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009994395.1 protein_id gnl|my_center|LOCUS_01950 8838 8464 gene locus_tag LOCUS_01960 8838 8464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01960 8924 8997 gene locus_tag LOCUS_t00040 8924 8997 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 9070 9837 gene locus_tag LOCUS_01970 9070 9837 CDS product putative ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681579.1 protein_id gnl|my_center|LOCUS_01970 9834 10529 gene locus_tag LOCUS_01980 9834 10529 CDS product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870007.1 protein_id gnl|my_center|LOCUS_01980 10526 10858 gene locus_tag LOCUS_01990 10526 10858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01990 10858 11784 gene locus_tag LOCUS_02000 10858 11784 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927015.1 protein_id gnl|my_center|LOCUS_02000 12325 11738 gene locus_tag LOCUS_02010 12325 11738 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965570.1 protein_id gnl|my_center|LOCUS_02010 12900 12322 gene locus_tag LOCUS_02020 12900 12322 CDS product pentapeptide repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678721.1 protein_id gnl|my_center|LOCUS_02020 12971 13945 gene locus_tag LOCUS_02030 gene rsgA 12971 13945 CDS product ribosome small subunit-dependent GTPase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679106.1 protein_id gnl|my_center|LOCUS_02030 13926 16277 gene locus_tag LOCUS_02040 13926 16277 CDS product endonuclease MutS2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679109.1 protein_id gnl|my_center|LOCUS_02040 16336 17112 gene locus_tag LOCUS_02050 gene udp 16336 17112 CDS product uridine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001182060.1 protein_id gnl|my_center|LOCUS_02050 17481 17080 gene locus_tag LOCUS_02060 17481 17080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02060 17683 18276 gene locus_tag LOCUS_02070 17683 18276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02070 18287 18820 gene locus_tag LOCUS_02080 18287 18820 CDS product DUF2764 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678963.1 protein_id gnl|my_center|LOCUS_02080 18832 20568 gene locus_tag LOCUS_02090 18832 20568 CDS product V-type ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669362.1 protein_id gnl|my_center|LOCUS_02090 20572 21873 gene locus_tag LOCUS_02100 20572 21873 CDS product V-type ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002556695.1 protein_id gnl|my_center|LOCUS_02100 21882 22493 gene locus_tag LOCUS_02110 21882 22493 CDS product V-type ATP synthase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679385.1 protein_id gnl|my_center|LOCUS_02110 22495 24333 gene locus_tag LOCUS_02120 22495 24333 CDS product V-type ATP synthase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023003276.1 protein_id gnl|my_center|LOCUS_02120 24364 24801 gene locus_tag LOCUS_02130 24364 24801 CDS product ATP synthase subunit K inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002556692.1 protein_id gnl|my_center|LOCUS_02130 25328 24870 gene locus_tag LOCUS_02140 25328 24870 CDS product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000017896.1 protein_id gnl|my_center|LOCUS_02140 25484 25894 gene locus_tag LOCUS_02150 25484 25894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02150 25959 27002 gene locus_tag LOCUS_02160 gene ispG 25959 27002 CDS product (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678768.1 protein_id gnl|my_center|LOCUS_02160 26992 29841 gene locus_tag LOCUS_02170 gene uvrA 26992 29841 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010956862.1 protein_id gnl|my_center|LOCUS_02170 29813 32905 gene locus_tag LOCUS_02180 29813 32905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02180 32913 33881 gene locus_tag LOCUS_02190 32913 33881 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678733.1 protein_id gnl|my_center|LOCUS_02190 33878 36058 gene locus_tag LOCUS_02200 33878 36058 CDS product HDIG domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678734.1 protein_id gnl|my_center|LOCUS_02200 36064 36528 gene locus_tag LOCUS_02210 gene ybeY 36064 36528 CDS product rRNA maturation RNase YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002668517.1 protein_id gnl|my_center|LOCUS_02210 36525 37295 gene locus_tag LOCUS_02220 36525 37295 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678735.1 protein_id gnl|my_center|LOCUS_02220 37375 38376 gene locus_tag LOCUS_02230 gene gap 37375 38376 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002658311.1 protein_id gnl|my_center|LOCUS_02230 38453 39631 gene locus_tag LOCUS_02240 38453 39631 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010255334.1 protein_id gnl|my_center|LOCUS_02240 39633 40385 gene locus_tag LOCUS_02250 gene tpiA 39633 40385 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678731.1 protein_id gnl|my_center|LOCUS_02250 40401 40724 gene locus_tag LOCUS_02260 40401 40724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02260 40796 41221 gene locus_tag LOCUS_02270 40796 41221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02270 41218 42264 gene locus_tag LOCUS_02280 41218 42264 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943066.1 protein_id gnl|my_center|LOCUS_02280 >Feature sequence006 855 765 gene locus_tag LOCUS_t00050 855 765 tRNA product tRNA-SeC inference COORDINATES:profile:Aragorn:1.2.38 1848 889 gene locus_tag LOCUS_02290 1848 889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02290 2101 2029 gene locus_tag LOCUS_t00060 2101 2029 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 2267 2195 gene locus_tag LOCUS_t00070 2267 2195 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 2386 2305 gene locus_tag LOCUS_t00080 2386 2305 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 2495 2421 gene locus_tag LOCUS_t00090 2495 2421 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 2595 2522 gene locus_tag LOCUS_t00100 2595 2522 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 2683 2611 gene locus_tag LOCUS_t00110 2683 2611 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 4992 2821 gene locus_tag LOCUS_02300 4992 2821 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928938.1 protein_id gnl|my_center|LOCUS_02300 5111 5449 gene locus_tag LOCUS_02310 5111 5449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02310 5632 6984 gene locus_tag LOCUS_02320 5632 6984 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681233.1 protein_id gnl|my_center|LOCUS_02320 7039 7752 gene locus_tag LOCUS_02330 7039 7752 CDS product Bax inhibitor-1/YccA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210775.1 protein_id gnl|my_center|LOCUS_02330 8441 7749 gene locus_tag LOCUS_02340 8441 7749 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583280.1 protein_id gnl|my_center|LOCUS_02340 8775 8425 gene locus_tag LOCUS_02350 8775 8425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583278.1 protein_id gnl|my_center|LOCUS_02350 9715 8765 gene locus_tag LOCUS_02360 9715 8765 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583276.1 protein_id gnl|my_center|LOCUS_02360 9808 10548 gene locus_tag LOCUS_02370 9808 10548 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682394.1 protein_id gnl|my_center|LOCUS_02370 10559 11674 gene locus_tag LOCUS_02380 10559 11674 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000654729.1 protein_id gnl|my_center|LOCUS_02380 11918 11709 gene locus_tag LOCUS_02390 11918 11709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02390 13117 11915 gene locus_tag LOCUS_02400 gene xseA 13117 11915 CDS product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682333.1 protein_id gnl|my_center|LOCUS_02400 13745 13110 gene locus_tag LOCUS_02410 13745 13110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02410 13967 13800 gene locus_tag LOCUS_02420 13967 13800 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784522.1 protein_id gnl|my_center|LOCUS_02420 14198 16507 gene locus_tag LOCUS_02430 14198 16507 CDS product DNA topoisomerase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462224.1 protein_id gnl|my_center|LOCUS_02430 16623 17852 gene locus_tag LOCUS_02440 16623 17852 CDS product LL-diaminopimelate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940837.1 protein_id gnl|my_center|LOCUS_02440 17849 19114 gene locus_tag LOCUS_02450 gene lysA 17849 19114 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020771.1 protein_id gnl|my_center|LOCUS_02450 19114 19545 gene locus_tag LOCUS_02460 gene ybgC 19114 19545 CDS product tol-pal system-associated acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038138.1 protein_id gnl|my_center|LOCUS_02460 20514 19501 gene locus_tag LOCUS_02470 20514 19501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02470 20595 21218 gene locus_tag LOCUS_02480 20595 21218 CDS product carbohydrate-binding family 9-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762936.1 protein_id gnl|my_center|LOCUS_02480 22002 21205 gene locus_tag LOCUS_02490 22002 21205 CDS product tRNA threonylcarbamoyladenosine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202003.1 protein_id gnl|my_center|LOCUS_02490 22627 21959 gene locus_tag LOCUS_02500 22627 21959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02500 22936 22637 gene locus_tag LOCUS_02510 22936 22637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02510 23631 22936 gene locus_tag LOCUS_02520 23631 22936 CDS product AzlC family ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392755.1 protein_id gnl|my_center|LOCUS_02520 23703 24455 gene locus_tag LOCUS_02530 23703 24455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02530 24575 25000 gene locus_tag LOCUS_02540 24575 25000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02540 26086 25103 gene locus_tag LOCUS_02550 26086 25103 CDS product bifunctional methionine sulfoxide reductase B/A protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932947.1 protein_id gnl|my_center|LOCUS_02550 26565 26143 gene locus_tag LOCUS_02560 26565 26143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02560 27767 26562 gene locus_tag LOCUS_02570 27767 26562 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462283.1 protein_id gnl|my_center|LOCUS_02570 28728 29999 gene locus_tag LOCUS_02580 28728 29999 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258588.1 protein_id gnl|my_center|LOCUS_02580 30069 31178 gene locus_tag LOCUS_02590 30069 31178 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258587.1 protein_id gnl|my_center|LOCUS_02590 31180 32079 gene locus_tag LOCUS_02600 31180 32079 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258586.1 protein_id gnl|my_center|LOCUS_02600 32083 34959 gene locus_tag LOCUS_02610 32083 34959 CDS product glycosyl hydrolase family 65 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804565.1 protein_id gnl|my_center|LOCUS_02610 35921 34956 gene locus_tag LOCUS_02620 35921 34956 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582579.1 protein_id gnl|my_center|LOCUS_02620 36843 35983 gene locus_tag LOCUS_02630 36843 35983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02630 37519 38499 gene locus_tag LOCUS_02640 37519 38499 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545714.1 protein_id gnl|my_center|LOCUS_02640 39674 38496 gene locus_tag LOCUS_02650 39674 38496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02650 40699 39839 gene locus_tag LOCUS_02660 gene dapA 40699 39839 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545135.1 protein_id gnl|my_center|LOCUS_02660 >Feature sequence007 72 902 gene locus_tag LOCUS_02670 72 902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02670 1141 1058 gene locus_tag LOCUS_t00120 1141 1058 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 1653 1177 gene locus_tag LOCUS_02680 gene ispF 1653 1177 CDS product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191369.1 protein_id gnl|my_center|LOCUS_02680 2456 1650 gene locus_tag LOCUS_02690 2456 1650 CDS product IspD/TarI family cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680203.1 protein_id gnl|my_center|LOCUS_02690 2940 2458 gene locus_tag LOCUS_02700 2940 2458 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680200.1 protein_id gnl|my_center|LOCUS_02700 3164 4609 gene locus_tag LOCUS_02710 gene malQ 3164 4609 CDS product 4-alpha-glucanotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479885.1 protein_id gnl|my_center|LOCUS_02710 5568 4606 gene locus_tag LOCUS_02720 gene lplA 5568 4606 CDS product lipoate--protein ligase LplA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368378.1 protein_id gnl|my_center|LOCUS_02720 5567 6334 gene locus_tag LOCUS_02730 5567 6334 CDS product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680775.1 protein_id gnl|my_center|LOCUS_02730 6381 7211 gene locus_tag LOCUS_02740 gene thyX 6381 7211 CDS product FAD-dependent thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681263.1 protein_id gnl|my_center|LOCUS_02740 8091 7195 gene locus_tag LOCUS_02750 8091 7195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02750 8247 10076 gene locus_tag LOCUS_02760 gene uvrC 8247 10076 CDS product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963830.1 protein_id gnl|my_center|LOCUS_02760 11098 10073 gene locus_tag LOCUS_02770 11098 10073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02770 11715 11095 gene locus_tag LOCUS_02780 gene lexA 11715 11095 CDS product transcriptional repressor LexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000413738.1 protein_id gnl|my_center|LOCUS_02780 11983 11720 gene locus_tag LOCUS_02790 11983 11720 CDS product HPr family phosphocarrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002668605.1 protein_id gnl|my_center|LOCUS_02790 12966 11983 gene locus_tag LOCUS_02800 gene hprK 12966 11983 CDS product HPr(Ser) kinase/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000062490.1 protein_id gnl|my_center|LOCUS_02800 13123 13419 gene locus_tag LOCUS_02810 13123 13419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02810 14869 13466 gene locus_tag LOCUS_02820 gene rpoN 14869 13466 CDS product RNA polymerase factor sigma-54 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546561.1 protein_id gnl|my_center|LOCUS_02820 15606 14869 gene locus_tag LOCUS_02830 gene lptB 15606 14869 CDS product LPS export ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681841.1 protein_id gnl|my_center|LOCUS_02830 16219 15599 gene locus_tag LOCUS_02840 16219 15599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02840 16710 16216 gene locus_tag LOCUS_02850 16710 16216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02850 17200 16793 gene locus_tag LOCUS_02860 17200 16793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02860 18006 17179 gene locus_tag LOCUS_02870 18006 17179 CDS product TIGR00282 family metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679190.1 protein_id gnl|my_center|LOCUS_02870 18166 18089 gene locus_tag LOCUS_t00130 18166 18089 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 18423 18929 gene locus_tag LOCUS_02880 18423 18929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02880 19287 20195 gene locus_tag LOCUS_02890 19287 20195 CDS product sugar phosphate nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681782.1 protein_id gnl|my_center|LOCUS_02890 21113 20196 gene locus_tag LOCUS_02900 21113 20196 CDS product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583758.1 protein_id gnl|my_center|LOCUS_02900 21704 21126 gene locus_tag LOCUS_02910 21704 21126 CDS product TIGR00730 family Rossman fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943393.1 protein_id gnl|my_center|LOCUS_02910 21973 22965 gene locus_tag LOCUS_02920 21973 22965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02920 23037 24062 gene locus_tag LOCUS_02930 23037 24062 CDS product 2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795327.1 protein_id gnl|my_center|LOCUS_02930 26290 24059 gene locus_tag LOCUS_02940 gene rlmKL 26290 24059 CDS product bifunctional 23S rRNA (guanine(2069)-N(7))-methyltransferase RlmK/23S rRNA (guanine(2445)-N(2))-methyltransferase RlmL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206819954.1 protein_id gnl|my_center|LOCUS_02940 27229 26297 gene locus_tag LOCUS_02950 gene hslO 27229 26297 CDS product Hsp33 family molecular chaperone HslO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296053.1 protein_id gnl|my_center|LOCUS_02950 29178 27241 gene locus_tag LOCUS_02960 gene ftsH 29178 27241 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002666001.1 protein_id gnl|my_center|LOCUS_02960 29278 30009 gene locus_tag LOCUS_02970 29278 30009 CDS product pteridine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038530.1 protein_id gnl|my_center|LOCUS_02970 30099 31547 gene locus_tag LOCUS_02980 30099 31547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02980 31560 32663 gene locus_tag LOCUS_02990 31560 32663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02990 32665 33339 gene locus_tag LOCUS_03000 32665 33339 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481692.1 protein_id gnl|my_center|LOCUS_03000 33341 34522 gene locus_tag LOCUS_03010 33341 34522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_03010 34567 35871 gene locus_tag LOCUS_03020 34567 35871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03020 35868 37223 gene locus_tag LOCUS_03030 gene atoC 35868 37223 CDS product acetoacetate metabolism transcriptional regulator AtoC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000125298.1 protein_id gnl|my_center|LOCUS_03030 37235 38980 gene locus_tag LOCUS_03040 37235 38980 CDS product M3 family oligoendopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679753.1 protein_id gnl|my_center|LOCUS_03040 38964 40115 gene locus_tag LOCUS_03050 38964 40115 CDS product RsmD family RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680626.1 protein_id gnl|my_center|LOCUS_03050 40419 40628 gene locus_tag LOCUS_03060 40419 40628 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018305998.1 protein_id gnl|my_center|LOCUS_03060 >Feature sequence008 146 1114 gene locus_tag LOCUS_03070 146 1114 CDS product carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337354.1 protein_id gnl|my_center|LOCUS_03070 1152 2432 gene locus_tag LOCUS_03080 1152 2432 CDS product trypsin-like peptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679693.1 protein_id gnl|my_center|LOCUS_03080 2435 4504 gene locus_tag LOCUS_03090 gene uvrB 2435 4504 CDS product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678935.1 protein_id gnl|my_center|LOCUS_03090 5330 4497 gene locus_tag LOCUS_03100 5330 4497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03100 6382 5453 gene locus_tag LOCUS_03110 6382 5453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03110 6930 6379 gene locus_tag LOCUS_03120 6930 6379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03120 7989 6985 gene locus_tag LOCUS_03130 7989 6985 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867920.1 protein_id gnl|my_center|LOCUS_03130 9640 7982 gene locus_tag LOCUS_03140 9640 7982 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146673.1 protein_id gnl|my_center|LOCUS_03140 10680 9655 gene locus_tag LOCUS_03150 gene thiB 10680 9655 CDS product thiamine ABC transporter substrate binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026017959.1 protein_id gnl|my_center|LOCUS_03150 10888 12357 gene locus_tag LOCUS_03160 10888 12357 CDS product bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389422.1 protein_id gnl|my_center|LOCUS_03160 12354 12782 gene locus_tag LOCUS_03170 12354 12782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03170 12793 13206 gene locus_tag LOCUS_03180 12793 13206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03180 15312 13711 gene locus_tag LOCUS_03190 15312 13711 CDS product FGGY-family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760641.1 protein_id gnl|my_center|LOCUS_03190 16132 15332 gene locus_tag LOCUS_03200 16132 15332 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766212.1 protein_id gnl|my_center|LOCUS_03200 17490 16195 gene locus_tag LOCUS_03210 17490 16195 CDS product glucose-1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002674820.1 protein_id gnl|my_center|LOCUS_03210 18935 17493 gene locus_tag LOCUS_03220 gene glgA 18935 17493 CDS product glycogen synthase GlgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679256.1 protein_id gnl|my_center|LOCUS_03220 19931 18993 gene locus_tag LOCUS_03230 gene trxB 19931 18993 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393897.1 protein_id gnl|my_center|LOCUS_03230 20622 19933 gene locus_tag LOCUS_03240 20622 19933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03240 21041 20619 gene locus_tag LOCUS_03250 gene tsaE 21041 20619 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679136.1 protein_id gnl|my_center|LOCUS_03250 22234 21038 gene locus_tag LOCUS_03260 22234 21038 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681112.1 protein_id gnl|my_center|LOCUS_03260 22923 22567 gene locus_tag LOCUS_03270 22923 22567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03270 23321 22962 gene locus_tag LOCUS_03280 gene rplT 23321 22962 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003222420.1 protein_id gnl|my_center|LOCUS_03280 23530 23333 gene locus_tag LOCUS_03290 gene rpmI 23530 23333 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002556787.1 protein_id gnl|my_center|LOCUS_03290 24158 23613 gene locus_tag LOCUS_03300 gene infC 24158 23613 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002668127.1 protein_id gnl|my_center|LOCUS_03300 25301 24309 gene locus_tag LOCUS_03310 25301 24309 CDS product class II fructose-1,6-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763359.1 protein_id gnl|my_center|LOCUS_03310 26192 25398 gene locus_tag LOCUS_03320 26192 25398 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889700.1 protein_id gnl|my_center|LOCUS_03320 26409 27563 gene locus_tag LOCUS_03330 26409 27563 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095329.1 protein_id gnl|my_center|LOCUS_03330 27575 28648 gene locus_tag LOCUS_03340 27575 28648 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095328.1 protein_id gnl|my_center|LOCUS_03340 28650 29714 gene locus_tag LOCUS_03350 28650 29714 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008192388.1 protein_id gnl|my_center|LOCUS_03350 30735 29689 gene locus_tag LOCUS_03360 30735 29689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03360 31553 30813 gene locus_tag LOCUS_03370 31553 30813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03370 32980 31718 gene locus_tag LOCUS_03380 32980 31718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03380 33513 32992 gene locus_tag LOCUS_03390 33513 32992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03390 34593 33565 gene locus_tag LOCUS_03400 34593 33565 CDS product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037395802.1 protein_id gnl|my_center|LOCUS_03400 35932 34958 gene locus_tag LOCUS_03410 35932 34958 CDS product TAXI family TRAP transporter solute-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114147.1 protein_id gnl|my_center|LOCUS_03410 <36671 35929 gene locus_tag LOCUS_03420 <36671 35929 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_133957058.1:TRAP transporter permease >Feature sequence009 322 1347 gene locus_tag LOCUS_03430 322 1347 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679269.1 protein_id gnl|my_center|LOCUS_03430 1359 2219 gene locus_tag LOCUS_03440 1359 2219 CDS product NAD(+)/NADH kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679270.1 protein_id gnl|my_center|LOCUS_03440 2212 3876 gene locus_tag LOCUS_03450 gene recN 2212 3876 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678799.1 protein_id gnl|my_center|LOCUS_03450 3878 4156 gene locus_tag LOCUS_03460 3878 4156 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369862.1 protein_id gnl|my_center|LOCUS_03460 6470 4143 gene locus_tag LOCUS_03470 6470 4143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03470 6521 7228 gene locus_tag LOCUS_03480 gene deoD 6521 7228 CDS product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000110703.1 protein_id gnl|my_center|LOCUS_03480 7305 8036 gene locus_tag LOCUS_03490 7305 8036 CDS product DUF4912 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002670630.1 protein_id gnl|my_center|LOCUS_03490 8036 9628 gene locus_tag LOCUS_03500 8036 9628 CDS product DUF1957 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393354.1 protein_id gnl|my_center|LOCUS_03500 9841 10293 gene locus_tag LOCUS_03510 gene mraZ 9841 10293 CDS product division/cell wall cluster transcriptional repressor MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678680.1 protein_id gnl|my_center|LOCUS_03510 10296 11177 gene locus_tag LOCUS_03520 gene rsmH 10296 11177 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678681.1 protein_id gnl|my_center|LOCUS_03520 11189 11521 gene locus_tag LOCUS_03530 11189 11521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03530 11587 12903 gene locus_tag LOCUS_03540 gene murF 11587 12903 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678687.1 protein_id gnl|my_center|LOCUS_03540 12896 13825 gene locus_tag LOCUS_03550 gene mraY 12896 13825 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232192.1 protein_id gnl|my_center|LOCUS_03550 13832 14992 gene locus_tag LOCUS_03560 gene ftsW 13832 14992 CDS product putative lipid II flippase FtsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002677685.1 protein_id gnl|my_center|LOCUS_03560 14989 15735 gene locus_tag LOCUS_03570 14989 15735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03570 15758 17005 gene locus_tag LOCUS_03580 gene ftsA 15758 17005 CDS product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943689.1 protein_id gnl|my_center|LOCUS_03580 17031 18248 gene locus_tag LOCUS_03590 gene ftsZ 17031 18248 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002656388.1 protein_id gnl|my_center|LOCUS_03590 18248 19126 gene locus_tag LOCUS_03600 18248 19126 CDS product site-specific tyrosine recombinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_044909847.1 protein_id gnl|my_center|LOCUS_03600 19123 19866 gene locus_tag LOCUS_03610 19123 19866 CDS product TSUP family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681078.1 protein_id gnl|my_center|LOCUS_03610 19899 20555 gene locus_tag LOCUS_03620 19899 20555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03620 20564 21454 gene locus_tag LOCUS_03630 gene xerC 20564 21454 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002079116.1 protein_id gnl|my_center|LOCUS_03630 21447 21983 gene locus_tag LOCUS_03640 gene hslV 21447 21983 CDS product ATP-dependent protease subunit HslV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002668456.1 protein_id gnl|my_center|LOCUS_03640 21987 23345 gene locus_tag LOCUS_03650 gene hslU 21987 23345 CDS product HslU--HslV peptidase ATPase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001293344.1 protein_id gnl|my_center|LOCUS_03650 23356 24216 gene locus_tag LOCUS_03660 23356 24216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03660 25860 24205 gene locus_tag LOCUS_03670 25860 24205 CDS product penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678847.1 protein_id gnl|my_center|LOCUS_03670 25992 26990 gene locus_tag LOCUS_03680 25992 26990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03680 29749 26987 gene locus_tag LOCUS_03690 gene secA 29749 26987 CDS product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679596.1 protein_id gnl|my_center|LOCUS_03690 29917 30999 gene locus_tag LOCUS_03700 29917 30999 CDS product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987044.1 protein_id gnl|my_center|LOCUS_03700 30984 31511 gene locus_tag LOCUS_03710 30984 31511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03710 31504 32652 gene locus_tag LOCUS_03720 31504 32652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03720 32649 33842 gene locus_tag LOCUS_03730 32649 33842 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679701.1 protein_id gnl|my_center|LOCUS_03730 33832 35193 gene locus_tag LOCUS_03740 33832 35193 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002675346.1 protein_id gnl|my_center|LOCUS_03740 35180 35962 gene locus_tag LOCUS_03750 35180 35962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03750 >Feature sequence010 1125 286 gene locus_tag LOCUS_03760 1125 286 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726998.1 protein_id gnl|my_center|LOCUS_03760 2005 1109 gene locus_tag LOCUS_03770 2005 1109 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803743.1 protein_id gnl|my_center|LOCUS_03770 3356 2085 gene locus_tag LOCUS_03780 3356 2085 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726997.1 protein_id gnl|my_center|LOCUS_03780 4373 3408 gene locus_tag LOCUS_03790 4373 3408 CDS product PfkB family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974044.1 protein_id gnl|my_center|LOCUS_03790 5747 4383 gene locus_tag LOCUS_03800 5747 4383 CDS product glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061331.1 protein_id gnl|my_center|LOCUS_03800 6850 5855 gene locus_tag LOCUS_03810 gene ccpA 6850 5855 CDS product catabolite control protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001103297.1 protein_id gnl|my_center|LOCUS_03810 7096 9615 gene locus_tag LOCUS_03820 7096 9615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037393207.1 protein_id gnl|my_center|LOCUS_03820 9752 11023 gene locus_tag LOCUS_03830 9752 11023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03830 11118 11996 gene locus_tag LOCUS_03840 11118 11996 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722709.1 protein_id gnl|my_center|LOCUS_03840 11993 12829 gene locus_tag LOCUS_03850 11993 12829 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083318.1 protein_id gnl|my_center|LOCUS_03850 12833 15940 gene locus_tag LOCUS_03860 12833 15940 CDS product alpha-mannosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989870.1 protein_id gnl|my_center|LOCUS_03860 15957 17039 gene locus_tag LOCUS_03870 15957 17039 CDS product glycoside hydrolase family 88 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288261.1 protein_id gnl|my_center|LOCUS_03870 17294 18286 gene locus_tag LOCUS_03880 17294 18286 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869311.1 protein_id gnl|my_center|LOCUS_03880 18612 18277 gene locus_tag LOCUS_03890 18612 18277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03890 19461 18697 gene locus_tag LOCUS_03900 19461 18697 CDS product aldolase/citrate lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459462.1 protein_id gnl|my_center|LOCUS_03900 19637 19999 gene locus_tag LOCUS_03910 19637 19999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03910 20718 20065 gene locus_tag LOCUS_03920 20718 20065 CDS product DNA-3-methyladenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005168857.1 protein_id gnl|my_center|LOCUS_03920 20802 20981 gene locus_tag LOCUS_03930 20802 20981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03930 22536 21124 gene locus_tag LOCUS_03940 22536 21124 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948690.1 protein_id gnl|my_center|LOCUS_03940 23528 22533 gene locus_tag LOCUS_03950 23528 22533 CDS product electron transfer flavoprotein subunit alpha/FixB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437556.1 protein_id gnl|my_center|LOCUS_03950 24336 23521 gene locus_tag LOCUS_03960 24336 23521 CDS product electron transfer flavoprotein subunit beta/FixA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546330.1 protein_id gnl|my_center|LOCUS_03960 25009 24416 gene locus_tag LOCUS_03970 25009 24416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03970 25876 25016 gene locus_tag LOCUS_03980 25876 25016 CDS product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031770.1 protein_id gnl|my_center|LOCUS_03980 26834 25896 gene locus_tag LOCUS_03990 gene murQ 26834 25896 CDS product N-acetylmuramic acid 6-phosphate etherase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817228.1 protein_id gnl|my_center|LOCUS_03990 26965 28179 gene locus_tag LOCUS_04000 26965 28179 CDS product anhydro-N-acetylmuramic acid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405142.1 protein_id gnl|my_center|LOCUS_04000 28321 29622 gene locus_tag LOCUS_04010 28321 29622 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_094729231.1 protein_id gnl|my_center|LOCUS_04010 29763 30617 gene locus_tag LOCUS_04020 29763 30617 CDS product pectinesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966644.1 protein_id gnl|my_center|LOCUS_04020 32438 30654 gene locus_tag LOCUS_04030 32438 30654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04030 32732 33277 gene locus_tag LOCUS_04040 32732 33277 CDS product DUF4256 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258319.1 protein_id gnl|my_center|LOCUS_04040 33632 33210 gene locus_tag LOCUS_04050 33632 33210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04050 33942 34169 gene locus_tag LOCUS_04060 33942 34169 CDS product ferrous iron transport protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870071.1 protein_id gnl|my_center|LOCUS_04060 >Feature sequence011 3 323 gene locus_tag LOCUS_04070 3 323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04070 323 721 gene locus_tag LOCUS_04080 323 721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966763.1 protein_id gnl|my_center|LOCUS_04080 976 1125 gene locus_tag LOCUS_04090 976 1125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04090 2641 1784 gene locus_tag LOCUS_04100 2641 1784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04100 3607 2645 gene locus_tag LOCUS_04110 3607 2645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04110 3742 4779 gene locus_tag LOCUS_04120 3742 4779 CDS product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763049.1 protein_id gnl|my_center|LOCUS_04120 6042 4759 gene locus_tag LOCUS_04130 6042 4759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04130 6163 7239 gene locus_tag LOCUS_04140 6163 7239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04140 7605 7246 gene locus_tag LOCUS_04150 7605 7246 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146466.1 protein_id gnl|my_center|LOCUS_04150 8396 7608 gene locus_tag LOCUS_04160 gene kdgR 8396 7608 CDS product DNA-binding transcriptional regulator KdgR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096122.1 protein_id gnl|my_center|LOCUS_04160 9804 8401 gene locus_tag LOCUS_04170 gene uxaC 9804 8401 CDS product glucuronate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964011.1 protein_id gnl|my_center|LOCUS_04170 11344 9818 gene locus_tag LOCUS_04180 11344 9818 CDS product altronate dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210408.1 protein_id gnl|my_center|LOCUS_04180 12828 11341 gene locus_tag LOCUS_04190 12828 11341 CDS product tagaturonate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_212691688.1 protein_id gnl|my_center|LOCUS_04190 13820 12825 gene locus_tag LOCUS_04200 13820 12825 CDS product bile acid:sodium symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804021.1 protein_id gnl|my_center|LOCUS_04200 13928 17035 gene locus_tag LOCUS_04210 13928 17035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04210 17114 18037 gene locus_tag LOCUS_04220 gene rmgP 17114 18037 CDS product polygalacturonan/rhamnogalacturonan ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229209.1 protein_id gnl|my_center|LOCUS_04220 18048 18959 gene locus_tag LOCUS_04230 18048 18959 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776882.1 protein_id gnl|my_center|LOCUS_04230 19010 20587 gene locus_tag LOCUS_04240 19010 20587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04240 20659 21762 gene locus_tag LOCUS_04250 20659 21762 CDS product glycoside hydrolase family 88 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286016.1 protein_id gnl|my_center|LOCUS_04250 21989 23071 gene locus_tag LOCUS_04260 21989 23071 CDS product BMP family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669780.1 protein_id gnl|my_center|LOCUS_04260 23156 24676 gene locus_tag LOCUS_04270 23156 24676 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920612.1 protein_id gnl|my_center|LOCUS_04270 24673 25767 gene locus_tag LOCUS_04280 24673 25767 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679664.1 protein_id gnl|my_center|LOCUS_04280 25771 26709 gene locus_tag LOCUS_04290 25771 26709 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_044979586.1 protein_id gnl|my_center|LOCUS_04290 26728 27558 gene locus_tag LOCUS_04300 26728 27558 CDS product purine nucleoside phosphorylase I, inosine and guanosine-specific inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230447.1 protein_id gnl|my_center|LOCUS_04300 27555 28028 gene locus_tag LOCUS_04310 27555 28028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04310 28025 28726 gene locus_tag LOCUS_04320 28025 28726 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001302777.1 protein_id gnl|my_center|LOCUS_04320 28729 29427 gene locus_tag LOCUS_04330 28729 29427 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002670690.1 protein_id gnl|my_center|LOCUS_04330 29417 30325 gene locus_tag LOCUS_04340 29417 30325 CDS product DUF4032 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259715.1 protein_id gnl|my_center|LOCUS_04340 30917 30327 gene locus_tag LOCUS_04350 gene wrbA 30917 30327 CDS product NAD(P)H:quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877850.1 protein_id gnl|my_center|LOCUS_04350 31767 30985 gene locus_tag LOCUS_04360 31767 30985 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065769.1 protein_id gnl|my_center|LOCUS_04360 32549 31794 gene locus_tag LOCUS_04370 32549 31794 CDS product FadR/GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_177221295.1 protein_id gnl|my_center|LOCUS_04370 33443 32721 gene locus_tag LOCUS_04380 33443 32721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04380 34195 33449 gene locus_tag LOCUS_04390 34195 33449 CDS product FadR/GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064244130.1 protein_id gnl|my_center|LOCUS_04390 >Feature sequence012 653 99 gene locus_tag LOCUS_04400 653 99 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04400 1504 2796 gene locus_tag LOCUS_04410 1504 2796 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015782.1 protein_id gnl|my_center|LOCUS_04410 3237 2830 gene locus_tag LOCUS_04420 3237 2830 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000788957.1 protein_id gnl|my_center|LOCUS_04420 3700 4878 gene locus_tag LOCUS_04430 3700 4878 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903257.1 protein_id gnl|my_center|LOCUS_04430 5161 5448 gene locus_tag LOCUS_04440 5161 5448 CDS product autorepressor SdpR family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262697.1 protein_id gnl|my_center|LOCUS_04440 5429 6082 gene locus_tag LOCUS_04450 5429 6082 CDS product SdpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435225.1 protein_id gnl|my_center|LOCUS_04450 7211 6066 gene locus_tag LOCUS_04460 gene mltG 7211 6066 CDS product endolytic transglycosylase MltG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438164.1 protein_id gnl|my_center|LOCUS_04460 8271 7204 gene locus_tag LOCUS_04470 8271 7204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04470 8594 9142 gene locus_tag LOCUS_04480 8594 9142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04480 9146 9796 gene locus_tag LOCUS_04490 9146 9796 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545606.1 protein_id gnl|my_center|LOCUS_04490 10218 9859 gene locus_tag LOCUS_04500 10218 9859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04500 12970 10340 gene locus_tag LOCUS_04510 12970 10340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04510 13573 13007 gene locus_tag LOCUS_04520 13573 13007 CDS product ECF-type riboflavin transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005375133.1 protein_id gnl|my_center|LOCUS_04520 14485 13601 gene locus_tag LOCUS_04530 14485 13601 CDS product S-adenosyl-l-methionine hydroxide adenosyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009931305.1 protein_id gnl|my_center|LOCUS_04530 14666 15115 gene locus_tag LOCUS_04540 14666 15115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04540 15381 15151 gene locus_tag LOCUS_04550 15381 15151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04550 15983 15378 gene locus_tag LOCUS_04560 gene thrH 15983 15378 CDS product bifunctional phosphoserine phosphatase/homoserine phosphotransferase ThrH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002116438.1 protein_id gnl|my_center|LOCUS_04560 16757 16029 gene locus_tag LOCUS_04570 gene cobS 16757 16029 CDS product adenosylcobinamide-GDP ribazoletransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926961.1 protein_id gnl|my_center|LOCUS_04570 17401 16760 gene locus_tag LOCUS_04580 gene cobU 17401 16760 CDS product bifunctional adenosylcobinamide kinase/adenosylcobinamide-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932625.1 protein_id gnl|my_center|LOCUS_04580 18215 17388 gene locus_tag LOCUS_04590 gene cbiR 18215 17388 CDS product cobamide remodeling phosphodiesterase CbiR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932624.1 protein_id gnl|my_center|LOCUS_04590 19261 18215 gene locus_tag LOCUS_04600 gene cobT 19261 18215 CDS product nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001067582.1 protein_id gnl|my_center|LOCUS_04600 19320 20225 gene locus_tag LOCUS_04610 19320 20225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04610 21096 20212 gene locus_tag LOCUS_04620 21096 20212 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942258.1 protein_id gnl|my_center|LOCUS_04620 22148 21093 gene locus_tag LOCUS_04630 22148 21093 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002658381.1 protein_id gnl|my_center|LOCUS_04630 22134 22292 gene locus_tag LOCUS_04640 22134 22292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04640 22365 23105 gene locus_tag LOCUS_04650 22365 23105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04650 23098 23907 gene locus_tag LOCUS_04660 23098 23907 CDS product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888715.1 protein_id gnl|my_center|LOCUS_04660 24020 24649 gene locus_tag LOCUS_04670 24020 24649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04670 25531 24719 gene locus_tag LOCUS_04680 gene nagB 25531 24719 CDS product glucosamine-6-phosphate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761009.1 protein_id gnl|my_center|LOCUS_04680 26182 25589 gene locus_tag LOCUS_04690 26182 25589 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000643829.1 protein_id gnl|my_center|LOCUS_04690 27247 26186 gene locus_tag LOCUS_04700 gene mnmA 27247 26186 CDS product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948825.1 protein_id gnl|my_center|LOCUS_04700 27376 27302 gene locus_tag LOCUS_t00140 27376 27302 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 27642 28541 gene locus_tag LOCUS_04710 27642 28541 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861644.1 protein_id gnl|my_center|LOCUS_04710 29094 28501 gene locus_tag LOCUS_04720 29094 28501 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006310428.1 protein_id gnl|my_center|LOCUS_04720 30368 29091 gene locus_tag LOCUS_04730 30368 29091 CDS product L-serine ammonia-lyase, iron-sulfur-dependent, subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927762.1 protein_id gnl|my_center|LOCUS_04730 31605 30400 gene locus_tag LOCUS_04740 gene manA 31605 30400 CDS product mannose-6-phosphate isomerase, class I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111913.1 protein_id gnl|my_center|LOCUS_04740 <32734 31699 gene locus_tag LOCUS_04750 <32734 31699 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001046719.1:Na+/H+ antiporter NhaC family protein >Feature sequence013 1441 32 gene locus_tag LOCUS_04760 1441 32 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002666765.1 protein_id gnl|my_center|LOCUS_04760 1491 2393 gene locus_tag LOCUS_04770 gene murB 1491 2393 CDS product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056225.1 protein_id gnl|my_center|LOCUS_04770 3414 2353 gene locus_tag LOCUS_04780 3414 2353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04780 3549 4886 gene locus_tag LOCUS_04790 3549 4886 CDS product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943345.1 protein_id gnl|my_center|LOCUS_04790 5679 5062 gene locus_tag LOCUS_04800 5679 5062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04800 5772 6458 gene locus_tag LOCUS_04810 gene yqeC 5772 6458 CDS product selenium cofactor biosynthesis protein YqeC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002359659.1 protein_id gnl|my_center|LOCUS_04810 6475 8286 gene locus_tag LOCUS_04820 6475 8286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04820 8283 9251 gene locus_tag LOCUS_04830 8283 9251 CDS product XdhC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_144034111.1 protein_id gnl|my_center|LOCUS_04830 9332 9865 gene locus_tag LOCUS_04840 9332 9865 CDS product cysteine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023189990.1 protein_id gnl|my_center|LOCUS_04840 9950 11149 gene locus_tag LOCUS_04850 9950 11149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04850 12284 11124 gene locus_tag LOCUS_04860 12284 11124 CDS product DUF438 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939860.1 protein_id gnl|my_center|LOCUS_04860 12308 13189 gene locus_tag LOCUS_04870 12308 13189 CDS product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644751.1 protein_id gnl|my_center|LOCUS_04870 13265 14095 gene locus_tag LOCUS_04880 13265 14095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_04880 13978 14568 gene locus_tag LOCUS_04890 13978 14568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04890 14570 15106 gene locus_tag LOCUS_04900 14570 15106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04900 15103 15783 gene locus_tag LOCUS_04910 15103 15783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04910 15843 16976 gene locus_tag LOCUS_04920 15843 16976 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080165.1 protein_id gnl|my_center|LOCUS_04920 16979 17869 gene locus_tag LOCUS_04930 16979 17869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04930 17943 19334 gene locus_tag LOCUS_04940 17943 19334 CDS product RecQ family ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681501.1 protein_id gnl|my_center|LOCUS_04940 19382 20656 gene locus_tag LOCUS_04950 gene galK 19382 20656 CDS product galactokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028786.1 protein_id gnl|my_center|LOCUS_04950 20777 21664 gene locus_tag LOCUS_04960 20777 21664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04960 22952 21684 gene locus_tag LOCUS_04970 gene thrC 22952 21684 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003020172.1 protein_id gnl|my_center|LOCUS_04970 23378 22962 gene locus_tag LOCUS_04980 23378 22962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04980 25333 23270 gene locus_tag LOCUS_04990 25333 23270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04990 25907 26350 gene locus_tag LOCUS_05000 25907 26350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05000 26936 26268 gene locus_tag LOCUS_05010 26936 26268 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002657503.1 protein_id gnl|my_center|LOCUS_05010 26997 27070 gene locus_tag LOCUS_t00150 26997 27070 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 28327 27155 gene locus_tag LOCUS_05020 28327 27155 CDS product AGE family epimerase/isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202525.1 protein_id gnl|my_center|LOCUS_05020 28920 28510 gene locus_tag LOCUS_05030 28920 28510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05030 29614 28997 gene locus_tag LOCUS_05040 29614 28997 CDS product superoxide dismutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002295401.1 protein_id gnl|my_center|LOCUS_05040 29859 29932 gene locus_tag LOCUS_t00160 29859 29932 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 30167 31297 gene locus_tag LOCUS_05050 30167 31297 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081574.1 protein_id gnl|my_center|LOCUS_05050 >Feature sequence014 367 173 gene locus_tag LOCUS_05060 367 173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05060 1517 456 gene locus_tag LOCUS_05070 1517 456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05070 2764 1514 gene locus_tag LOCUS_05080 2764 1514 CDS product L-rhamnose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118020.1 protein_id gnl|my_center|LOCUS_05080 2862 3728 gene locus_tag LOCUS_05090 2862 3728 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099264237.1 protein_id gnl|my_center|LOCUS_05090 4154 3729 gene locus_tag LOCUS_05100 4154 3729 CDS product RbsD/FucU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000912113.1 protein_id gnl|my_center|LOCUS_05100 4257 6071 gene locus_tag LOCUS_05110 gene fucI 4257 6071 CDS product L-fucose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005779363.1 protein_id gnl|my_center|LOCUS_05110 7139 6138 gene locus_tag LOCUS_05120 gene yiaK 7139 6138 CDS product 3-dehydro-L-gulonate 2-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094954.1 protein_id gnl|my_center|LOCUS_05120 10460 7149 gene locus_tag LOCUS_05130 10460 7149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05130 13051 10457 gene locus_tag LOCUS_05140 13051 10457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05140 13094 13981 gene locus_tag LOCUS_05150 13094 13981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05150 15346 14051 gene locus_tag LOCUS_05160 gene eno 15346 14051 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889730.1 protein_id gnl|my_center|LOCUS_05160 15455 16441 gene locus_tag LOCUS_05170 15455 16441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05170 16456 17202 gene locus_tag LOCUS_05180 16456 17202 CDS product glucosamine-6-phosphate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007335855.1 protein_id gnl|my_center|LOCUS_05180 17300 18376 gene locus_tag LOCUS_05190 gene uxuA 17300 18376 CDS product mannonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082566.1 protein_id gnl|my_center|LOCUS_05190 18378 19094 gene locus_tag LOCUS_05200 18378 19094 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083214.1 protein_id gnl|my_center|LOCUS_05200 19091 20695 gene locus_tag LOCUS_05210 19091 20695 CDS product mannitol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_054937112.1 protein_id gnl|my_center|LOCUS_05210 20710 21654 gene locus_tag LOCUS_05220 20710 21654 CDS product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391779.1 protein_id gnl|my_center|LOCUS_05220 22275 21595 gene locus_tag LOCUS_05230 22275 21595 CDS product LrgB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963931.1 protein_id gnl|my_center|LOCUS_05230 22639 22268 gene locus_tag LOCUS_05240 22639 22268 CDS product CidA/LrgA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784314.1 protein_id gnl|my_center|LOCUS_05240 22734 23783 gene locus_tag LOCUS_05250 22734 23783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05250 24542 23835 gene locus_tag LOCUS_05260 24542 23835 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002670541.1 protein_id gnl|my_center|LOCUS_05260 26780 24684 gene locus_tag LOCUS_05270 gene fusA 26780 24684 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682356.1 protein_id gnl|my_center|LOCUS_05270 27031 27432 gene locus_tag LOCUS_05280 27031 27432 CDS product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979519.1 protein_id gnl|my_center|LOCUS_05280 27435 27716 gene locus_tag LOCUS_05290 27435 27716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05290 >Feature sequence015 842 324 gene locus_tag LOCUS_05300 842 324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05300 910 2343 gene locus_tag LOCUS_05310 gene sbcB 910 2343 CDS product exodeoxyribonuclease I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072723.1 protein_id gnl|my_center|LOCUS_05310 3523 2336 gene locus_tag LOCUS_05320 3523 2336 CDS product glycine C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532322.1 protein_id gnl|my_center|LOCUS_05320 4473 3520 gene locus_tag LOCUS_05330 4473 3520 CDS product L-threonine 3-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000723154.1 protein_id gnl|my_center|LOCUS_05330 4589 5161 gene locus_tag LOCUS_05340 4589 5161 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194572.1 protein_id gnl|my_center|LOCUS_05340 5292 6356 gene locus_tag LOCUS_05350 gene prfA 5292 6356 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680455.1 protein_id gnl|my_center|LOCUS_05350 6361 7212 gene locus_tag LOCUS_05360 gene prmC 6361 7212 CDS product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929958.1 protein_id gnl|my_center|LOCUS_05360 7205 9226 gene locus_tag LOCUS_05370 7205 9226 CDS product bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000508136.1 protein_id gnl|my_center|LOCUS_05370 10864 9230 gene locus_tag LOCUS_05380 10864 9230 CDS product putative manganese-dependent inorganic diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943604.1 protein_id gnl|my_center|LOCUS_05380 10970 11410 gene locus_tag LOCUS_05390 gene rpiB 10970 11410 CDS product ribose 5-phosphate isomerase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966164.1 protein_id gnl|my_center|LOCUS_05390 12564 11401 gene locus_tag LOCUS_05400 12564 11401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05400 13889 12573 gene locus_tag LOCUS_05410 gene hydA 13889 12573 CDS product dihydropyrimidinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393493.1 protein_id gnl|my_center|LOCUS_05410 13779 14012 gene locus_tag LOCUS_05420 13779 14012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05420 15472 14021 gene locus_tag LOCUS_05430 gene gcvPB 15472 14021 CDS product aminomethyl-transferring glycine dehydrogenase subunit GcvPB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861288.1 protein_id gnl|my_center|LOCUS_05430 16824 15469 gene locus_tag LOCUS_05440 gene gcvPA 16824 15469 CDS product aminomethyl-transferring glycine dehydrogenase subunit GcvPA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933289.1 protein_id gnl|my_center|LOCUS_05440 17269 16886 gene locus_tag LOCUS_05450 gene gcvH 17269 16886 CDS product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583866.1 protein_id gnl|my_center|LOCUS_05450 18835 17324 gene locus_tag LOCUS_05460 18835 17324 CDS product glycine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680713.1 protein_id gnl|my_center|LOCUS_05460 19256 20638 gene locus_tag LOCUS_05470 19256 20638 CDS product sodium-dependent transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020940.1 protein_id gnl|my_center|LOCUS_05470 20697 20915 gene locus_tag LOCUS_05480 gene infA 20697 20915 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002668257.1 protein_id gnl|my_center|LOCUS_05480 21843 20956 gene locus_tag LOCUS_05490 21843 20956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05490 22487 21843 gene locus_tag LOCUS_05500 22487 21843 CDS product CBS and ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257688.1 protein_id gnl|my_center|LOCUS_05500 23304 22549 gene locus_tag LOCUS_05510 gene livF 23304 22549 CDS product high-affinity branched-chain amino acid ABC transporter ATP-binding protein LivF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099128.1 protein_id gnl|my_center|LOCUS_05510 24080 23301 gene locus_tag LOCUS_05520 24080 23301 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938016.1 protein_id gnl|my_center|LOCUS_05520 24976 24077 gene locus_tag LOCUS_05530 24976 24077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05530 25895 24978 gene locus_tag LOCUS_05540 25895 24978 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000941427.1 protein_id gnl|my_center|LOCUS_05540 27179 26007 gene locus_tag LOCUS_05550 27179 26007 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583297.1 protein_id gnl|my_center|LOCUS_05550 27415 27846 gene locus_tag LOCUS_05560 gene mscL 27415 27846 CDS product large-conductance mechanosensitive channel protein MscL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070864.1 protein_id gnl|my_center|LOCUS_05560 27891 27967 gene locus_tag LOCUS_t00170 27891 27967 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 28055 28771 gene locus_tag LOCUS_05570 28055 28771 CDS product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582696.1 protein_id gnl|my_center|LOCUS_05570 >Feature sequence016 1497 1084 gene locus_tag LOCUS_05580 1497 1084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05580 1684 1430 gene locus_tag LOCUS_05590 1684 1430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05590 2397 1966 gene locus_tag LOCUS_05600 2397 1966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05600 3177 2608 gene locus_tag LOCUS_05610 3177 2608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05610 3701 3618 gene locus_tag LOCUS_t00180 3701 3618 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 4166 3708 gene locus_tag LOCUS_05620 4166 3708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05620 5453 4227 gene locus_tag LOCUS_05630 gene thrC 5453 4227 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868155.1 protein_id gnl|my_center|LOCUS_05630 6982 5513 gene locus_tag LOCUS_05640 6982 5513 CDS product pyridoxal-phosphate dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393496.1 protein_id gnl|my_center|LOCUS_05640 7295 10471 gene locus_tag LOCUS_05650 gene ygfK 7295 10471 CDS product putative selenate reductase subunit YgfK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705209.1 protein_id gnl|my_center|LOCUS_05650 10482 11804 gene locus_tag LOCUS_05660 gene ssnA 10482 11804 CDS product putative aminohydrolase SsnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706028.1 protein_id gnl|my_center|LOCUS_05660 11837 13057 gene locus_tag LOCUS_05670 11837 13057 CDS product YgeY family selenium metabolism-linked hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705213.1 protein_id gnl|my_center|LOCUS_05670 13382 13182 gene locus_tag LOCUS_05680 13382 13182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05680 13354 14742 gene locus_tag LOCUS_05690 13354 14742 CDS product 8-oxoguanine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966720.1 protein_id gnl|my_center|LOCUS_05690 14739 15572 gene locus_tag LOCUS_05700 gene ygfM 14739 15572 CDS product molybdopterin-dependent oxidoreductase FAD-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000572452.1 protein_id gnl|my_center|LOCUS_05700 15569 18451 gene locus_tag LOCUS_05710 15569 18451 CDS product molybdopterin-dependent oxidoreductase Mo/Fe-S-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206817476.1 protein_id gnl|my_center|LOCUS_05710 18558 19757 gene locus_tag LOCUS_05720 gene ygeW 18558 19757 CDS product knotted carbamoyltransferase YgeW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002379712.1 protein_id gnl|my_center|LOCUS_05720 20173 19814 gene locus_tag LOCUS_05730 20173 19814 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876396.1 protein_id gnl|my_center|LOCUS_05730 21381 20170 gene locus_tag LOCUS_05740 21381 20170 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986386.1 protein_id gnl|my_center|LOCUS_05740 21451 21627 gene locus_tag LOCUS_05750 21451 21627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05750 22662 21661 gene locus_tag LOCUS_05760 22662 21661 CDS product NAD-dependent epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940611.1 protein_id gnl|my_center|LOCUS_05760 24018 22729 gene locus_tag LOCUS_05770 24018 22729 CDS product NCS2 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357375.1 protein_id gnl|my_center|LOCUS_05770 24272 26017 gene locus_tag LOCUS_05780 gene ade 24272 26017 CDS product adenine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937748.1 protein_id gnl|my_center|LOCUS_05780 26762 26007 gene locus_tag LOCUS_05790 26762 26007 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810400.1 protein_id gnl|my_center|LOCUS_05790 27724 26759 gene locus_tag LOCUS_05800 27724 26759 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024407.1 protein_id gnl|my_center|LOCUS_05800 28206 27772 gene locus_tag LOCUS_05810 28206 27772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05810 28844 28134 gene locus_tag LOCUS_05820 28844 28134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05820 >Feature sequence017 <1 771 gene locus_tag LOCUS_05830 <1 771 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003732280.1:ABC transporter ATP-binding protein 768 1832 gene locus_tag LOCUS_05840 768 1832 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393449.1 protein_id gnl|my_center|LOCUS_05840 1829 2800 gene locus_tag LOCUS_05850 1829 2800 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393448.1 protein_id gnl|my_center|LOCUS_05850 2822 3289 gene locus_tag LOCUS_05860 gene ybaK 2822 3289 CDS product Cys-tRNA(Pro) deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244878.1 protein_id gnl|my_center|LOCUS_05860 4164 3286 gene locus_tag LOCUS_05870 4164 3286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05870 5470 4166 gene locus_tag LOCUS_05880 5470 4166 CDS product alcohol acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930145.1 protein_id gnl|my_center|LOCUS_05880 6570 5467 gene locus_tag LOCUS_05890 gene gcvT 6570 5467 CDS product glycine cleavage system aminomethyltransferase GcvT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398598.1 protein_id gnl|my_center|LOCUS_05890 6975 6580 gene locus_tag LOCUS_05900 6975 6580 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868364.1 protein_id gnl|my_center|LOCUS_05900 7673 7029 gene locus_tag LOCUS_05910 7673 7029 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729723.1 protein_id gnl|my_center|LOCUS_05910 8467 7670 gene locus_tag LOCUS_05920 8467 7670 CDS product inositol monophosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958026.1 protein_id gnl|my_center|LOCUS_05920 10737 8464 gene locus_tag LOCUS_05930 10737 8464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05930 11956 10799 gene locus_tag LOCUS_05940 11956 10799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05940 13149 11998 gene locus_tag LOCUS_05950 13149 11998 CDS product putative DNA modification/repair radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584144.1 protein_id gnl|my_center|LOCUS_05950 14088 13186 gene locus_tag LOCUS_05960 14088 13186 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459799.1 protein_id gnl|my_center|LOCUS_05960 14163 14582 gene locus_tag LOCUS_05970 14163 14582 CDS product secondary thiamine-phosphate synthase enzyme YjbQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081009.1 protein_id gnl|my_center|LOCUS_05970 15791 14589 gene locus_tag LOCUS_05980 15791 14589 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358889.1 protein_id gnl|my_center|LOCUS_05980 17178 15886 gene locus_tag LOCUS_05990 17178 15886 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002667047.1 protein_id gnl|my_center|LOCUS_05990 17274 19016 gene locus_tag LOCUS_06000 17274 19016 CDS product Na/Pi cotransporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669793.1 protein_id gnl|my_center|LOCUS_06000 20386 19013 gene locus_tag LOCUS_06010 gene argH 20386 19013 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082327.1 protein_id gnl|my_center|LOCUS_06010 20458 21405 gene locus_tag LOCUS_06020 20458 21405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06020 21726 21406 gene locus_tag LOCUS_06030 gene trxA 21726 21406 CDS product thioredoxin TrxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211990.1 protein_id gnl|my_center|LOCUS_06030 22107 22373 gene locus_tag LOCUS_06040 22107 22373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06040 22533 23582 gene locus_tag LOCUS_06050 22533 23582 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902589.1 protein_id gnl|my_center|LOCUS_06050 23603 24733 gene locus_tag LOCUS_06060 23603 24733 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902588.1 protein_id gnl|my_center|LOCUS_06060 24733 26385 gene locus_tag LOCUS_06070 24733 26385 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005896074.1 protein_id gnl|my_center|LOCUS_06070 >Feature sequence018 417 2984 gene locus_tag LOCUS_06080 gene mutS 417 2984 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920616.1 protein_id gnl|my_center|LOCUS_06080 3051 3500 gene locus_tag LOCUS_06090 3051 3500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06090 3922 3626 gene locus_tag LOCUS_06100 3922 3626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06100 4102 4398 gene locus_tag LOCUS_06110 4102 4398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06110 4459 5940 gene locus_tag LOCUS_06120 gene nusA 4459 5940 CDS product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682413.1 protein_id gnl|my_center|LOCUS_06120 6466 6699 gene locus_tag LOCUS_06130 6466 6699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06130 6696 8603 gene locus_tag LOCUS_06140 6696 8603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06140 8600 8962 gene locus_tag LOCUS_06150 8600 8962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06150 8991 9842 gene locus_tag LOCUS_06160 8991 9842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06160 9829 10668 gene locus_tag LOCUS_06170 9829 10668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06170 10665 10931 gene locus_tag LOCUS_06180 gene rpsO 10665 10931 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002557393.1 protein_id gnl|my_center|LOCUS_06180 11056 13155 gene locus_tag LOCUS_06190 gene pnp 11056 13155 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682350.1 protein_id gnl|my_center|LOCUS_06190 13167 13616 gene locus_tag LOCUS_06200 gene dut 13167 13616 CDS product dUTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767650.1 protein_id gnl|my_center|LOCUS_06200 13640 14863 gene locus_tag LOCUS_06210 13640 14863 CDS product LptF/LptG family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479632.1 protein_id gnl|my_center|LOCUS_06210 14860 15954 gene locus_tag LOCUS_06220 14860 15954 CDS product LptF/LptG family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001276589.1 protein_id gnl|my_center|LOCUS_06220 15951 17072 gene locus_tag LOCUS_06230 gene tgt 15951 17072 CDS product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681512.1 protein_id gnl|my_center|LOCUS_06230 17050 18624 gene locus_tag LOCUS_06240 gene murJ 17050 18624 CDS product murein biosynthesis integral membrane protein MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889824.1 protein_id gnl|my_center|LOCUS_06240 21348 18625 gene locus_tag LOCUS_06250 gene greA 21348 18625 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002673498.1 protein_id gnl|my_center|LOCUS_06250 21777 22412 gene locus_tag LOCUS_06260 gene rpe 21777 22412 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957271.1 protein_id gnl|my_center|LOCUS_06260 22409 22846 gene locus_tag LOCUS_06270 gene dtd 22409 22846 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941193.1 protein_id gnl|my_center|LOCUS_06270 22898 23953 gene locus_tag LOCUS_06280 gene recA 22898 23953 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682153.1 protein_id gnl|my_center|LOCUS_06280 24011 24931 gene locus_tag LOCUS_06290 24011 24931 CDS product segregation/condensation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002670199.1 protein_id gnl|my_center|LOCUS_06290 24931 25518 gene locus_tag LOCUS_06300 gene scpB 24931 25518 CDS product SMC-Scp complex subunit ScpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002672067.1 protein_id gnl|my_center|LOCUS_06300 25515 26267 gene locus_tag LOCUS_06310 25515 26267 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682155.1 protein_id gnl|my_center|LOCUS_06310 26261 26911 gene locus_tag LOCUS_06320 26261 26911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06320 >Feature sequence019 1602 373 gene locus_tag LOCUS_06330 1602 373 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458936.1 protein_id gnl|my_center|LOCUS_06330 3372 1717 gene locus_tag LOCUS_06340 3372 1717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06340 4291 3419 gene locus_tag LOCUS_06350 4291 3419 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886597.1 protein_id gnl|my_center|LOCUS_06350 5267 4302 gene locus_tag LOCUS_06360 5267 4302 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776887.1 protein_id gnl|my_center|LOCUS_06360 5598 6695 gene locus_tag LOCUS_06370 5598 6695 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287288.1 protein_id gnl|my_center|LOCUS_06370 6676 9825 gene locus_tag LOCUS_06380 6676 9825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06380 9803 10420 gene locus_tag LOCUS_06390 9803 10420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06390 13211 10407 gene locus_tag LOCUS_06400 13211 10407 CDS product glycosyl hydrolase 115 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226354.1 protein_id gnl|my_center|LOCUS_06400 13556 13353 gene locus_tag LOCUS_06410 13556 13353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06410 13662 14363 gene locus_tag LOCUS_06420 13662 14363 CDS product L-ribulose-5-phosphate 4-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001170772.1 protein_id gnl|my_center|LOCUS_06420 15437 14376 gene locus_tag LOCUS_06430 15437 14376 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761511.1 protein_id gnl|my_center|LOCUS_06430 16850 15663 gene locus_tag LOCUS_06440 gene gguB 16850 15663 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287993.1 protein_id gnl|my_center|LOCUS_06440 18443 16881 gene locus_tag LOCUS_06450 gene gguA 18443 16881 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533633.1 protein_id gnl|my_center|LOCUS_06450 19573 18476 gene locus_tag LOCUS_06460 gene chvE 19573 18476 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533632.1 protein_id gnl|my_center|LOCUS_06460 20122 21615 gene locus_tag LOCUS_06470 gene araA 20122 21615 CDS product L-arabinose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082981.1 protein_id gnl|my_center|LOCUS_06470 22113 21772 gene locus_tag LOCUS_06480 22113 21772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06480 23372 22179 gene locus_tag LOCUS_06490 gene gguB 23372 22179 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976400.1 protein_id gnl|my_center|LOCUS_06490 24912 23383 gene locus_tag LOCUS_06500 gene gguA 24912 23383 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257794.1 protein_id gnl|my_center|LOCUS_06500 <25891 24990 gene locus_tag LOCUS_06510 <25891 24990 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011727839.1:sugar ABC transporter substrate-binding protein >Feature sequence020 32 796 gene locus_tag LOCUS_06520 32 796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06520 1012 1875 gene locus_tag LOCUS_06530 1012 1875 CDS product phosphatidylglycerol lysyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003399477.1 protein_id gnl|my_center|LOCUS_06530 1872 2651 gene locus_tag LOCUS_06540 1872 2651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06540 3854 2652 gene locus_tag LOCUS_06550 3854 2652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06550 4576 3944 gene locus_tag LOCUS_06560 4576 3944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06560 4661 4987 gene locus_tag LOCUS_06570 4661 4987 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870269.1 protein_id gnl|my_center|LOCUS_06570 4987 5598 gene locus_tag LOCUS_06580 4987 5598 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393404.1 protein_id gnl|my_center|LOCUS_06580 6351 5671 gene locus_tag LOCUS_06590 6351 5671 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083755966.1 protein_id gnl|my_center|LOCUS_06590 6647 6832 gene locus_tag LOCUS_06600 6647 6832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06600 6829 7227 gene locus_tag LOCUS_06610 6829 7227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06610 7270 8274 gene locus_tag LOCUS_06620 7270 8274 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257043.1 protein_id gnl|my_center|LOCUS_06620 8271 9230 gene locus_tag LOCUS_06630 8271 9230 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006315203.1 protein_id gnl|my_center|LOCUS_06630 9227 10087 gene locus_tag LOCUS_06640 9227 10087 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973777.1 protein_id gnl|my_center|LOCUS_06640 10176 11315 gene locus_tag LOCUS_06650 10176 11315 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067002.1 protein_id gnl|my_center|LOCUS_06650 11337 12329 gene locus_tag LOCUS_06660 11337 12329 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972408.1 protein_id gnl|my_center|LOCUS_06660 12329 13849 gene locus_tag LOCUS_06670 12329 13849 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064242816.1 protein_id gnl|my_center|LOCUS_06670 13842 14816 gene locus_tag LOCUS_06680 13842 14816 CDS product ribose ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003573417.1 protein_id gnl|my_center|LOCUS_06680 14833 15837 gene locus_tag LOCUS_06690 14833 15837 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533130.1 protein_id gnl|my_center|LOCUS_06690 16296 15907 gene locus_tag LOCUS_06700 16296 15907 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289210.1 protein_id gnl|my_center|LOCUS_06700 16380 17573 gene locus_tag LOCUS_06710 16380 17573 CDS product YgeY family selenium metabolism-linked hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392231.1 protein_id gnl|my_center|LOCUS_06710 17594 18346 gene locus_tag LOCUS_06720 17594 18346 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459931.1 protein_id gnl|my_center|LOCUS_06720 19612 18425 gene locus_tag LOCUS_06730 19612 18425 CDS product acetylornithine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393770.1 protein_id gnl|my_center|LOCUS_06730 20502 19609 gene locus_tag LOCUS_06740 gene argB 20502 19609 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393771.1 protein_id gnl|my_center|LOCUS_06740 21722 20502 gene locus_tag LOCUS_06750 gene argJ 21722 20502 CDS product bifunctional glutamate N-acetyltransferase/amino-acid acetyltransferase ArgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082329.1 protein_id gnl|my_center|LOCUS_06750 22773 21733 gene locus_tag LOCUS_06760 gene argC 22773 21733 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851634.1 protein_id gnl|my_center|LOCUS_06760 23579 22878 gene locus_tag LOCUS_06770 23579 22878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06770 25641 23635 gene locus_tag LOCUS_06780 25641 23635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06780 >Feature sequence021 203 1411 gene locus_tag LOCUS_06790 203 1411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06790 1414 3162 gene locus_tag LOCUS_06800 gene mutL 1414 3162 CDS product DNA mismatch repair endonuclease MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392628.1 protein_id gnl|my_center|LOCUS_06800 3487 3143 gene locus_tag LOCUS_06810 3487 3143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06810 4631 3498 gene locus_tag LOCUS_06820 4631 3498 CDS product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480805.1 protein_id gnl|my_center|LOCUS_06820 5630 4635 gene locus_tag LOCUS_06830 5630 4635 CDS product dihydroorotate dehydrogenase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257947.1 protein_id gnl|my_center|LOCUS_06830 6256 5789 gene locus_tag LOCUS_06840 6256 5789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06840 7331 6249 gene locus_tag LOCUS_06850 gene serC 7331 6249 CDS product 3-phosphoserine/phosphohydroxythreonine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000442921.1 protein_id gnl|my_center|LOCUS_06850 8215 7331 gene locus_tag LOCUS_06860 8215 7331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06860 8631 8422 gene locus_tag LOCUS_06870 gene rpsU 8631 8422 CDS product 30S ribosomal protein S21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002673965.1 protein_id gnl|my_center|LOCUS_06870 10840 8705 gene locus_tag LOCUS_06880 gene recJ 10840 8705 CDS product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680035.1 protein_id gnl|my_center|LOCUS_06880 11606 10869 gene locus_tag LOCUS_06890 11606 10869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06890 11690 12934 gene locus_tag LOCUS_06900 11690 12934 CDS product DUF4105 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764530.1 protein_id gnl|my_center|LOCUS_06900 13432 12890 gene locus_tag LOCUS_06910 13432 12890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06910 14390 13443 gene locus_tag LOCUS_06920 gene arcC 14390 13443 CDS product carbamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393607.1 protein_id gnl|my_center|LOCUS_06920 17446 14483 gene locus_tag LOCUS_06930 17446 14483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06930 18118 17450 gene locus_tag LOCUS_06940 18118 17450 CDS product YesU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233822.1 protein_id gnl|my_center|LOCUS_06940 21267 18115 gene locus_tag LOCUS_06950 21267 18115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06950 23885 21264 gene locus_tag LOCUS_06960 23885 21264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243379.1 protein_id gnl|my_center|LOCUS_06960 25469 23958 gene locus_tag LOCUS_06970 25469 23958 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244341.1 protein_id gnl|my_center|LOCUS_06970 >Feature sequence022 <1 1111 gene locus_tag LOCUS_06980 <1 1111 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002556930.1:ABC transporter permease 1122 2138 gene locus_tag LOCUS_06990 1122 2138 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258124.1 protein_id gnl|my_center|LOCUS_06990 2131 3210 gene locus_tag LOCUS_07000 2131 3210 CDS product dipeptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258123.1 protein_id gnl|my_center|LOCUS_07000 3750 3196 gene locus_tag LOCUS_07010 3750 3196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07010 3919 5628 gene locus_tag LOCUS_07020 3919 5628 CDS product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002656717.1 protein_id gnl|my_center|LOCUS_07020 5737 6756 gene locus_tag LOCUS_07030 gene ltaE 5737 6756 CDS product low-specificity L-threonine aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082276.1 protein_id gnl|my_center|LOCUS_07030 6753 7538 gene locus_tag LOCUS_07040 6753 7538 CDS product EFR1 family ferrodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107264.1 protein_id gnl|my_center|LOCUS_07040 7535 8785 gene locus_tag LOCUS_07050 7535 8785 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208500.1 protein_id gnl|my_center|LOCUS_07050 9900 8776 gene locus_tag LOCUS_07060 9900 8776 CDS product DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922679.1 protein_id gnl|my_center|LOCUS_07060 9993 10976 gene locus_tag LOCUS_07070 9993 10976 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404019.1 protein_id gnl|my_center|LOCUS_07070 10999 12066 gene locus_tag LOCUS_07080 10999 12066 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_208631126.1 protein_id gnl|my_center|LOCUS_07080 13114 12059 gene locus_tag LOCUS_07090 13114 12059 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584055.1 protein_id gnl|my_center|LOCUS_07090 13710 13498 gene locus_tag LOCUS_07100 13710 13498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07100 15307 13880 gene locus_tag LOCUS_07110 15307 13880 CDS product rhamnulokinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582815.1 protein_id gnl|my_center|LOCUS_07110 16586 15312 gene locus_tag LOCUS_07120 16586 15312 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000853188.1 protein_id gnl|my_center|LOCUS_07120 17757 16597 gene locus_tag LOCUS_07130 17757 16597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07130 19085 17754 gene locus_tag LOCUS_07140 19085 17754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07140 21539 19086 gene locus_tag LOCUS_07150 21539 19086 CDS product dehydrogenase E1 component subunit alpha/beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582808.1 protein_id gnl|my_center|LOCUS_07150 22917 21565 gene locus_tag LOCUS_07160 gene lpdA 22917 21565 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108698.1 protein_id gnl|my_center|LOCUS_07160 24239 22926 gene locus_tag LOCUS_07170 24239 22926 CDS product pyruvate dehydrogenase complex dihydrolipoamide acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537612.1 protein_id gnl|my_center|LOCUS_07170 25006 24251 gene locus_tag LOCUS_07180 25006 24251 CDS product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392145.1 protein_id gnl|my_center|LOCUS_07180 25411 25100 gene locus_tag LOCUS_07190 gene rhaM 25411 25100 CDS product L-rhamnose mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759851.1 protein_id gnl|my_center|LOCUS_07190 >Feature sequence023 816 253 gene locus_tag LOCUS_07200 816 253 CDS product TIGR00296 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876490.1 protein_id gnl|my_center|LOCUS_07200 1654 818 gene locus_tag LOCUS_07210 1654 818 CDS product MEMO1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583860.1 protein_id gnl|my_center|LOCUS_07210 4069 1715 gene locus_tag LOCUS_07220 4069 1715 CDS product glycoside hydrolase family 3 N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096977.1 protein_id gnl|my_center|LOCUS_07220 4918 4073 gene locus_tag LOCUS_07230 4918 4073 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002389896.1 protein_id gnl|my_center|LOCUS_07230 5868 4915 gene locus_tag LOCUS_07240 5868 4915 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775954.1 protein_id gnl|my_center|LOCUS_07240 7294 5948 gene locus_tag LOCUS_07250 7294 5948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07250 8095 7439 gene locus_tag LOCUS_07260 8095 7439 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403448.1 protein_id gnl|my_center|LOCUS_07260 10406 8088 gene locus_tag LOCUS_07270 10406 8088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07270 10696 10624 gene locus_tag LOCUS_t00190 10696 10624 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 10922 11824 gene locus_tag LOCUS_07280 10922 11824 CDS product 2-dehydropantoate 2-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966220.1 protein_id gnl|my_center|LOCUS_07280 11997 13427 gene locus_tag LOCUS_07290 gene trkA 11997 13427 CDS product Trk system potassium transporter TrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002676352.1 protein_id gnl|my_center|LOCUS_07290 13431 14888 gene locus_tag LOCUS_07300 13431 14888 CDS product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012843245.1 protein_id gnl|my_center|LOCUS_07300 14957 16096 gene locus_tag LOCUS_07310 14957 16096 CDS product glycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681108.1 protein_id gnl|my_center|LOCUS_07310 16185 16499 gene locus_tag LOCUS_07320 gene trxA 16185 16499 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001029579.1 protein_id gnl|my_center|LOCUS_07320 16646 17932 gene locus_tag LOCUS_07330 gene trpB 16646 17932 CDS product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482634.1 protein_id gnl|my_center|LOCUS_07330 18616 18005 gene locus_tag LOCUS_07340 18616 18005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07340 19142 18609 gene locus_tag LOCUS_07350 19142 18609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07350 19631 19218 gene locus_tag LOCUS_07360 gene rpsI 19631 19218 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390000.1 protein_id gnl|my_center|LOCUS_07360 20074 19646 gene locus_tag LOCUS_07370 gene rplM 20074 19646 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005336289.1 protein_id gnl|my_center|LOCUS_07370 22841 20604 gene locus_tag LOCUS_07380 22841 20604 CDS product UvrD-helicase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680253.1 protein_id gnl|my_center|LOCUS_07380 24180 22834 gene locus_tag LOCUS_07390 gene rimO 24180 22834 CDS product 30S ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680609.1 protein_id gnl|my_center|LOCUS_07390 >Feature sequence024 823 359 gene locus_tag LOCUS_07400 823 359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680218.1 protein_id gnl|my_center|LOCUS_07400 1276 920 gene locus_tag LOCUS_07410 gene rplS 1276 920 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002670222.1 protein_id gnl|my_center|LOCUS_07410 2015 1254 gene locus_tag LOCUS_07420 gene trmD 2015 1254 CDS product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002670221.1 protein_id gnl|my_center|LOCUS_07420 2521 2012 gene locus_tag LOCUS_07430 2521 2012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07430 2759 2526 gene locus_tag LOCUS_07440 2759 2526 CDS product KH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938139.1 protein_id gnl|my_center|LOCUS_07440 3039 2773 gene locus_tag LOCUS_07450 gene rpsP 3039 2773 CDS product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002670213.1 protein_id gnl|my_center|LOCUS_07450 4399 3065 gene locus_tag LOCUS_07460 gene ffh 4399 3065 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002668253.1 protein_id gnl|my_center|LOCUS_07460 7310 4461 gene locus_tag LOCUS_07470 7310 4461 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679154.1 protein_id gnl|my_center|LOCUS_07470 7379 7960 gene locus_tag LOCUS_07480 gene rnhB 7379 7960 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063751.1 protein_id gnl|my_center|LOCUS_07480 8190 7957 gene locus_tag LOCUS_07490 8190 7957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07490 8310 8381 gene locus_tag LOCUS_t00200 8310 8381 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 8557 9741 gene locus_tag LOCUS_07500 8557 9741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07500 9734 10978 gene locus_tag LOCUS_07510 9734 10978 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002656022.1 protein_id gnl|my_center|LOCUS_07510 11436 11104 gene locus_tag LOCUS_07520 11436 11104 CDS product DUF898 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003564461.1 protein_id gnl|my_center|LOCUS_07520 12348 11563 gene locus_tag LOCUS_07530 12348 11563 CDS product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942579.1 protein_id gnl|my_center|LOCUS_07530 13997 12360 gene locus_tag LOCUS_07540 13997 12360 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000633861.1 protein_id gnl|my_center|LOCUS_07540 14136 14065 gene locus_tag LOCUS_t00210 14136 14065 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 14779 14246 gene locus_tag LOCUS_07550 14779 14246 CDS product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678446.1 protein_id gnl|my_center|LOCUS_07550 15802 14792 gene locus_tag LOCUS_07560 gene tsaD 15802 14792 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680472.1 protein_id gnl|my_center|LOCUS_07560 16065 15799 gene locus_tag LOCUS_07570 16065 15799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07570 16175 16247 gene locus_tag LOCUS_t00220 16175 16247 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 19085 16380 gene locus_tag LOCUS_07580 gene ppdK 19085 16380 CDS product pyruvate, phosphate dikinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082976.1 protein_id gnl|my_center|LOCUS_07580 20248 19442 gene locus_tag LOCUS_07590 20248 19442 CDS product gluconate 5-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762840.1 protein_id gnl|my_center|LOCUS_07590 21094 20252 gene locus_tag LOCUS_07600 gene kduI 21094 20252 CDS product 5-dehydro-4-deoxy-D-glucuronate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010741491.1 protein_id gnl|my_center|LOCUS_07600 22396 21119 gene locus_tag LOCUS_07610 22396 21119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07610 22917 22396 gene locus_tag LOCUS_07620 22917 22396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07620 23994 22984 gene locus_tag LOCUS_07630 23994 22984 CDS product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693870.1 protein_id gnl|my_center|LOCUS_07630 >Feature sequence025 1 381 gene locus_tag LOCUS_07640 1 381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07640 918 1286 gene locus_tag LOCUS_07650 918 1286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07650 1283 3790 gene locus_tag LOCUS_07660 1283 3790 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108297.1 protein_id gnl|my_center|LOCUS_07660 3987 3793 gene locus_tag LOCUS_07670 3987 3793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07670 4137 5105 gene locus_tag LOCUS_07680 4137 5105 CDS product WYL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258178.1 protein_id gnl|my_center|LOCUS_07680 5163 5324 gene locus_tag LOCUS_07690 5163 5324 CDS product rubredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081114.1 protein_id gnl|my_center|LOCUS_07690 5389 5865 gene locus_tag LOCUS_07700 5389 5865 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461262.1 protein_id gnl|my_center|LOCUS_07700 5922 6491 gene locus_tag LOCUS_07710 5922 6491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07710 7799 6498 gene locus_tag LOCUS_07720 7799 6498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07720 7868 8671 gene locus_tag LOCUS_07730 7868 8671 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459709.1 protein_id gnl|my_center|LOCUS_07730 9035 10831 gene locus_tag LOCUS_07740 9035 10831 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403374.1 protein_id gnl|my_center|LOCUS_07740 11988 11284 gene locus_tag LOCUS_07750 11988 11284 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391621.1 protein_id gnl|my_center|LOCUS_07750 12880 11999 gene locus_tag LOCUS_07760 12880 11999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07760 12917 13084 gene locus_tag LOCUS_07770 12917 13084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07770 13485 13201 gene locus_tag LOCUS_07780 13485 13201 CDS product UxaA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582865.1 protein_id gnl|my_center|LOCUS_07780 17250 13714 gene locus_tag LOCUS_07790 gene nifJ 17250 13714 CDS product pyruvate:ferredoxin (flavodoxin) oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391612.1 protein_id gnl|my_center|LOCUS_07790 20393 17895 gene locus_tag LOCUS_07800 20393 17895 CDS product adenosylcobalamin-dependent ribonucleoside-diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339403.1 protein_id gnl|my_center|LOCUS_07800 22146 20809 gene locus_tag LOCUS_07810 gene gdhA 22146 20809 CDS product NADP-specific glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203378.1 protein_id gnl|my_center|LOCUS_07810 >Feature sequence026 1299 115 gene locus_tag LOCUS_07820 1299 115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07820 2141 1416 gene locus_tag LOCUS_07830 2141 1416 CDS product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861199.1 protein_id gnl|my_center|LOCUS_07830 2748 3656 gene locus_tag LOCUS_07840 2748 3656 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963749.1 protein_id gnl|my_center|LOCUS_07840 3656 4495 gene locus_tag LOCUS_07850 3656 4495 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963750.1 protein_id gnl|my_center|LOCUS_07850 4562 5902 gene locus_tag LOCUS_07860 4562 5902 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963751.1 protein_id gnl|my_center|LOCUS_07860 7332 6067 gene locus_tag LOCUS_07870 gene larA 7332 6067 CDS product nickel-dependent lactate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_157860456.1 protein_id gnl|my_center|LOCUS_07870 8600 7329 gene locus_tag LOCUS_07880 8600 7329 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496567.1 protein_id gnl|my_center|LOCUS_07880 9643 8612 gene locus_tag LOCUS_07890 9643 8612 CDS product type II glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021053.1 protein_id gnl|my_center|LOCUS_07890 10451 9681 gene locus_tag LOCUS_07900 10451 9681 CDS product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963554.1 protein_id gnl|my_center|LOCUS_07900 11814 10564 gene locus_tag LOCUS_07910 11814 10564 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582759.1 protein_id gnl|my_center|LOCUS_07910 12006 12812 gene locus_tag LOCUS_07920 12006 12812 CDS product 5-deoxy-glucuronate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000900828.1 protein_id gnl|my_center|LOCUS_07920 13766 12873 gene locus_tag LOCUS_07930 gene iolE 13766 12873 CDS product myo-inosose-2 dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000471986.1 protein_id gnl|my_center|LOCUS_07930 15646 13778 gene locus_tag LOCUS_07940 gene iolD 15646 13778 CDS product 3D-(3,5/4)-trihydroxycyclohexane-1,2-dione acylhydrolase (decyclizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001195356.1 protein_id gnl|my_center|LOCUS_07940 16690 15656 gene locus_tag LOCUS_07950 gene iolG 16690 15656 CDS product inositol 2-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001101686.1 protein_id gnl|my_center|LOCUS_07950 17002 18003 gene locus_tag LOCUS_07960 gene ccpA 17002 18003 CDS product catabolite control protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001103297.1 protein_id gnl|my_center|LOCUS_07960 19271 17910 gene locus_tag LOCUS_07970 19271 17910 CDS product CehA/McbA family metallohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029647.1 protein_id gnl|my_center|LOCUS_07970 20746 19337 gene locus_tag LOCUS_07980 20746 19337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07980 21664 20795 gene locus_tag LOCUS_07990 21664 20795 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776882.1 protein_id gnl|my_center|LOCUS_07990 22553 21669 gene locus_tag LOCUS_08000 gene rmgP 22553 21669 CDS product polygalacturonan/rhamnogalacturonan ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229209.1 protein_id gnl|my_center|LOCUS_08000 23591 22788 gene locus_tag LOCUS_08010 23591 22788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08010 >Feature sequence027 <1 1356 gene locus_tag LOCUS_08020 <1 1356 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010966037.1:hydroxylamine reductase 1484 3517 gene locus_tag LOCUS_08030 1484 3517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08030 4362 3514 gene locus_tag LOCUS_08040 4362 3514 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233833.1 protein_id gnl|my_center|LOCUS_08040 5278 4364 gene locus_tag LOCUS_08050 5278 4364 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233835.1 protein_id gnl|my_center|LOCUS_08050 6628 5348 gene locus_tag LOCUS_08060 6628 5348 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582824.1 protein_id gnl|my_center|LOCUS_08060 7456 6887 gene locus_tag LOCUS_08070 gene efp 7456 6887 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002671939.1 protein_id gnl|my_center|LOCUS_08070 8549 7578 gene locus_tag LOCUS_08080 8549 7578 CDS product tRNA synthetase, class II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680171.1 protein_id gnl|my_center|LOCUS_08080 8617 9945 gene locus_tag LOCUS_08090 gene mnmE 8617 9945 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680027.1 protein_id gnl|my_center|LOCUS_08090 9947 11758 gene locus_tag LOCUS_08100 gene mnmG 9947 11758 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002657592.1 protein_id gnl|my_center|LOCUS_08100 11751 12401 gene locus_tag LOCUS_08110 gene rsmG 11751 12401 CDS product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258170.1 protein_id gnl|my_center|LOCUS_08110 12425 15103 gene locus_tag LOCUS_08120 12425 15103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08120 15100 15933 gene locus_tag LOCUS_08130 15100 15933 CDS product aminotransferase class IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014518967.1 protein_id gnl|my_center|LOCUS_08130 16109 17017 gene locus_tag LOCUS_08140 16109 17017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08140 16986 17468 gene locus_tag LOCUS_08150 16986 17468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08150 17470 19188 gene locus_tag LOCUS_08160 17470 19188 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459675.1 protein_id gnl|my_center|LOCUS_08160 19203 19931 gene locus_tag LOCUS_08170 19203 19931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08170 19939 21363 gene locus_tag LOCUS_08180 19939 21363 CDS product energy-coupling factor ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461242.1 protein_id gnl|my_center|LOCUS_08180 21360 22127 gene locus_tag LOCUS_08190 21360 22127 CDS product energy-coupling factor transporter transmembrane protein EcfT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003733033.1 protein_id gnl|my_center|LOCUS_08190 22141 22662 gene locus_tag LOCUS_08200 22141 22662 CDS product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251052.1 protein_id gnl|my_center|LOCUS_08200 >Feature sequence028 <1 1072 gene locus_tag LOCUS_08210 <1 1072 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003243735.1:guanosine ABC transporter permease NupP 1069 1980 gene locus_tag LOCUS_08220 gene nupQ 1069 1980 CDS product guanosine ABC transporter permease NupQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228827.1 protein_id gnl|my_center|LOCUS_08220 1980 2699 gene locus_tag LOCUS_08230 gene deoD 1980 2699 CDS product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000160304.1 protein_id gnl|my_center|LOCUS_08230 2699 3310 gene locus_tag LOCUS_08240 2699 3310 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003687816.1 protein_id gnl|my_center|LOCUS_08240 4218 3307 gene locus_tag LOCUS_08250 4218 3307 CDS product nucleoside hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925117.1 protein_id gnl|my_center|LOCUS_08250 4327 5115 gene locus_tag LOCUS_08260 4327 5115 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390165.1 protein_id gnl|my_center|LOCUS_08260 6393 5110 gene locus_tag LOCUS_08270 6393 5110 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978245.1 protein_id gnl|my_center|LOCUS_08270 6546 7388 gene locus_tag LOCUS_08280 6546 7388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08280 7385 8956 gene locus_tag LOCUS_08290 7385 8956 CDS product D-aminoacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392815.1 protein_id gnl|my_center|LOCUS_08290 9698 8937 gene locus_tag LOCUS_08300 9698 8937 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815786.1 protein_id gnl|my_center|LOCUS_08300 10344 9709 gene locus_tag LOCUS_08310 10344 9709 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722217.1 protein_id gnl|my_center|LOCUS_08310 11218 10403 gene locus_tag LOCUS_08320 11218 10403 CDS product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948208.1 protein_id gnl|my_center|LOCUS_08320 11399 11776 gene locus_tag LOCUS_08330 11399 11776 CDS product metal-dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964778.1 protein_id gnl|my_center|LOCUS_08330 11916 13226 gene locus_tag LOCUS_08340 11916 13226 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975844.1 protein_id gnl|my_center|LOCUS_08340 13295 14227 gene locus_tag LOCUS_08350 13295 14227 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024311603.1 protein_id gnl|my_center|LOCUS_08350 14237 15085 gene locus_tag LOCUS_08360 14237 15085 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229020.1 protein_id gnl|my_center|LOCUS_08360 15087 15926 gene locus_tag LOCUS_08370 15087 15926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08370 16688 15903 gene locus_tag LOCUS_08380 16688 15903 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000222616.1 protein_id gnl|my_center|LOCUS_08380 18457 16685 gene locus_tag LOCUS_08390 18457 16685 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272760.1 protein_id gnl|my_center|LOCUS_08390 18630 18998 gene locus_tag LOCUS_08400 18630 18998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08400 19062 19520 gene locus_tag LOCUS_08410 19062 19520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08410 19712 19858 gene locus_tag LOCUS_08420 19712 19858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08420 19948 20481 gene locus_tag LOCUS_08430 gene ilvN 19948 20481 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496411.1 protein_id gnl|my_center|LOCUS_08430 20515 21507 gene locus_tag LOCUS_08440 gene ilvC 20515 21507 CDS product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816729.1 protein_id gnl|my_center|LOCUS_08440 >Feature sequence029 2265 1321 gene locus_tag LOCUS_08450 2265 1321 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528958.1 protein_id gnl|my_center|LOCUS_08450 3368 2262 gene locus_tag LOCUS_08460 3368 2262 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975045.1 protein_id gnl|my_center|LOCUS_08460 4878 3352 gene locus_tag LOCUS_08470 4878 3352 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964022.1 protein_id gnl|my_center|LOCUS_08470 5976 4945 gene locus_tag LOCUS_08480 5976 4945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08480 7115 6171 gene locus_tag LOCUS_08490 gene lacC 7115 6171 CDS product tagatose-6-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000604134.1 protein_id gnl|my_center|LOCUS_08490 7594 7112 gene locus_tag LOCUS_08500 7594 7112 CDS product cytidine/deoxycytidylate deaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032889952.1 protein_id gnl|my_center|LOCUS_08500 8522 7581 gene locus_tag LOCUS_08510 8522 7581 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939111.1 protein_id gnl|my_center|LOCUS_08510 9614 8616 gene locus_tag LOCUS_08520 9614 8616 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393756.1 protein_id gnl|my_center|LOCUS_08520 9793 10476 gene locus_tag LOCUS_08530 9793 10476 CDS product cyclase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000862963.1 protein_id gnl|my_center|LOCUS_08530 11272 11012 gene locus_tag LOCUS_08540 11272 11012 CDS product type II toxin-antitoxin system Phd/YefM family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009994775.1 protein_id gnl|my_center|LOCUS_08540 12575 11385 gene locus_tag LOCUS_08550 12575 11385 CDS product sodium ion-translocating decarboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000348847.1 protein_id gnl|my_center|LOCUS_08550 14416 12590 gene locus_tag LOCUS_08560 14416 12590 CDS product biotin attachment protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858311.1 protein_id gnl|my_center|LOCUS_08560 14701 14441 gene locus_tag LOCUS_08570 14701 14441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08570 15010 15864 gene locus_tag LOCUS_08580 15010 15864 CDS product Mrp/NBP35 family ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869781.1 protein_id gnl|my_center|LOCUS_08580 15864 16481 gene locus_tag LOCUS_08590 15864 16481 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680868.1 protein_id gnl|my_center|LOCUS_08590 16498 17214 gene locus_tag LOCUS_08600 16498 17214 CDS product SIMPL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920153.1 protein_id gnl|my_center|LOCUS_08600 17521 18012 gene locus_tag LOCUS_08610 17521 18012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08610 18270 18575 gene locus_tag LOCUS_08620 18270 18575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08620 19564 18548 gene locus_tag LOCUS_08630 19564 18548 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940885.1 protein_id gnl|my_center|LOCUS_08630 19718 19930 gene locus_tag LOCUS_08640 19718 19930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08640 20028 20681 gene locus_tag LOCUS_08650 20028 20681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08650 20659 21510 gene locus_tag LOCUS_08660 20659 21510 CDS product nucleotidyl transferase AbiEii/AbiGii toxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235044995.1 protein_id gnl|my_center|LOCUS_08660 >Feature sequence030 1953 2225 gene locus_tag LOCUS_08670 1953 2225 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939490.1 protein_id gnl|my_center|LOCUS_08670 2756 2268 gene locus_tag LOCUS_08680 2756 2268 CDS product DNA-deoxyinosine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730265.1 protein_id gnl|my_center|LOCUS_08680 2842 3753 gene locus_tag LOCUS_08690 2842 3753 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143348.1 protein_id gnl|my_center|LOCUS_08690 3796 5658 gene locus_tag LOCUS_08700 3796 5658 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000783199.1 protein_id gnl|my_center|LOCUS_08700 5740 6336 gene locus_tag LOCUS_08710 5740 6336 CDS product Abortive infection protein AbiEi inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_072726816.1 protein_id gnl|my_center|LOCUS_08710 7930 6581 gene locus_tag LOCUS_08720 7930 6581 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015909443.1 protein_id gnl|my_center|LOCUS_08720 8102 9400 gene locus_tag LOCUS_08730 8102 9400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08730 9464 10750 gene locus_tag LOCUS_08740 9464 10750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08740 13379 10734 gene locus_tag LOCUS_08750 13379 10734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08750 14442 13417 gene locus_tag LOCUS_08760 14442 13417 CDS product branched-chain amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964788.1 protein_id gnl|my_center|LOCUS_08760 15518 14652 gene locus_tag LOCUS_08770 15518 14652 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803822.1 protein_id gnl|my_center|LOCUS_08770 16444 15518 gene locus_tag LOCUS_08780 16444 15518 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803821.1 protein_id gnl|my_center|LOCUS_08780 18039 16504 gene locus_tag LOCUS_08790 18039 16504 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803820.1 protein_id gnl|my_center|LOCUS_08790 18716 18216 gene locus_tag LOCUS_08800 18716 18216 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014527000.1 protein_id gnl|my_center|LOCUS_08800 20274 18709 gene locus_tag LOCUS_08810 gene nagZ 20274 18709 CDS product beta-N-acetylhexosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963506.1 protein_id gnl|my_center|LOCUS_08810 21244 20258 gene locus_tag LOCUS_08820 21244 20258 CDS product DUF1343 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234976.1 protein_id gnl|my_center|LOCUS_08820 >Feature sequence031 2842 326 gene locus_tag LOCUS_08830 gene leuS 2842 326 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680258.1 protein_id gnl|my_center|LOCUS_08830 4432 2912 gene locus_tag LOCUS_08840 4432 2912 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986679.1 protein_id gnl|my_center|LOCUS_08840 5850 4591 gene locus_tag LOCUS_08850 5850 4591 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002656686.1 protein_id gnl|my_center|LOCUS_08850 6966 5905 gene locus_tag LOCUS_08860 6966 5905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08860 7781 6963 gene locus_tag LOCUS_08870 7781 6963 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948667.1 protein_id gnl|my_center|LOCUS_08870 8806 7772 gene locus_tag LOCUS_08880 gene corA 8806 7772 CDS product magnesium/cobalt transporter CorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021725.1 protein_id gnl|my_center|LOCUS_08880 8965 10167 gene locus_tag LOCUS_08890 8965 10167 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957791.1 protein_id gnl|my_center|LOCUS_08890 10298 12160 gene locus_tag LOCUS_08900 10298 12160 CDS product DNA topoisomerase IV subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002667902.1 protein_id gnl|my_center|LOCUS_08900 12160 14133 gene locus_tag LOCUS_08910 12160 14133 CDS product DNA topoisomerase IV subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679930.1 protein_id gnl|my_center|LOCUS_08910 14133 14810 gene locus_tag LOCUS_08920 14133 14810 CDS product RNA pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766957.1 protein_id gnl|my_center|LOCUS_08920 14898 15665 gene locus_tag LOCUS_08930 14898 15665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08930 15662 16279 gene locus_tag LOCUS_08940 15662 16279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08940 16279 16764 gene locus_tag LOCUS_08950 16279 16764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08950 17699 19015 gene locus_tag LOCUS_08960 17699 19015 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016570.1 protein_id gnl|my_center|LOCUS_08960 20110 19022 gene locus_tag LOCUS_08970 20110 19022 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957826.1 protein_id gnl|my_center|LOCUS_08970 <20694 20182 gene locus_tag LOCUS_08980 <20694 20182 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005790471.1:PEP/pyruvate-binding domain-containing protein >Feature sequence032 156 1259 gene locus_tag LOCUS_08990 156 1259 CDS product DNA adenine methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681927.1 protein_id gnl|my_center|LOCUS_08990 1423 1339 gene locus_tag LOCUS_t00230 1423 1339 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 1528 3558 gene locus_tag LOCUS_09000 1528 3558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09000 4608 3553 gene locus_tag LOCUS_09010 4608 3553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09010 4772 5209 gene locus_tag LOCUS_09020 4772 5209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09020 5261 6808 gene locus_tag LOCUS_09030 gene cls 5261 6808 CDS product cardiolipin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966588.1 protein_id gnl|my_center|LOCUS_09030 6817 7701 gene locus_tag LOCUS_09040 6817 7701 CDS product ribokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385464.1 protein_id gnl|my_center|LOCUS_09040 8010 7777 gene locus_tag LOCUS_09050 8010 7777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09050 9152 8361 gene locus_tag LOCUS_09060 9152 8361 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243004.1 protein_id gnl|my_center|LOCUS_09060 9239 10741 gene locus_tag LOCUS_09070 gene xylB 9239 10741 CDS product xylulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036931.1 protein_id gnl|my_center|LOCUS_09070 10726 12054 gene locus_tag LOCUS_09080 gene xylA 10726 12054 CDS product xylose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039169.1 protein_id gnl|my_center|LOCUS_09080 13008 12055 gene locus_tag LOCUS_09090 13008 12055 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002389891.1 protein_id gnl|my_center|LOCUS_09090 13928 13008 gene locus_tag LOCUS_09100 13928 13008 CDS product VIT1/CCC1 transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584032.1 protein_id gnl|my_center|LOCUS_09100 13980 14282 gene locus_tag LOCUS_09110 13980 14282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09110 14354 16027 gene locus_tag LOCUS_09120 14354 16027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09120 16131 17510 gene locus_tag LOCUS_09130 16131 17510 CDS product undecaprenyl-phosphate glucose phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461019.1 protein_id gnl|my_center|LOCUS_09130 17500 18354 gene locus_tag LOCUS_09140 17500 18354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09140 18364 20388 gene locus_tag LOCUS_09150 18364 20388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09150 >Feature sequence033 1815 976 gene locus_tag LOCUS_09160 1815 976 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030752.1 protein_id gnl|my_center|LOCUS_09160 2738 1812 gene locus_tag LOCUS_09170 2738 1812 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030753.1 protein_id gnl|my_center|LOCUS_09170 4183 2819 gene locus_tag LOCUS_09180 4183 2819 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030754.1 protein_id gnl|my_center|LOCUS_09180 5373 4327 gene locus_tag LOCUS_09190 5373 4327 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083018.1 protein_id gnl|my_center|LOCUS_09190 5715 7793 gene locus_tag LOCUS_09200 5715 7793 CDS product ribonucleoside triphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392959.1 protein_id gnl|my_center|LOCUS_09200 7793 8482 gene locus_tag LOCUS_09210 7793 8482 CDS product anaerobic ribonucleoside-triphosphate reductase activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392958.1 protein_id gnl|my_center|LOCUS_09210 8678 10768 gene locus_tag LOCUS_09220 8678 10768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203361.1 protein_id gnl|my_center|LOCUS_09220 10942 10715 gene locus_tag LOCUS_09230 10942 10715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09230 11211 10942 gene locus_tag LOCUS_09240 11211 10942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09240 11317 12066 gene locus_tag LOCUS_09250 11317 12066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09250 12063 12530 gene locus_tag LOCUS_09260 12063 12530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09260 12600 13556 gene locus_tag LOCUS_09270 12600 13556 CDS product D-2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107655.1 protein_id gnl|my_center|LOCUS_09270 13567 14451 gene locus_tag LOCUS_09280 gene garR 13567 14451 CDS product 2-hydroxy-3-oxopropionate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000178106.1 protein_id gnl|my_center|LOCUS_09280 15140 14472 gene locus_tag LOCUS_09290 15140 14472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09290 15448 15675 gene locus_tag LOCUS_09300 15448 15675 CDS product AbrB/MazE/SpoVT family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002672276.1 protein_id gnl|my_center|LOCUS_09300 15672 16397 gene locus_tag LOCUS_09310 15672 16397 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681925.1 protein_id gnl|my_center|LOCUS_09310 16394 17143 gene locus_tag LOCUS_09320 16394 17143 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010956797.1 protein_id gnl|my_center|LOCUS_09320 17554 17273 gene locus_tag LOCUS_09330 17554 17273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09330 18305 17547 gene locus_tag LOCUS_09340 18305 17547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09340 18945 19397 gene locus_tag LOCUS_09350 18945 19397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09350 >Feature sequence034 1755 955 gene locus_tag LOCUS_09360 1755 955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09360 3064 1775 gene locus_tag LOCUS_09370 3064 1775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09370 4403 3045 gene locus_tag LOCUS_09380 4403 3045 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029494943.1 protein_id gnl|my_center|LOCUS_09380 5041 5754 gene locus_tag LOCUS_09390 5041 5754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09390 5817 6539 gene locus_tag LOCUS_09400 5817 6539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09400 7812 6526 gene locus_tag LOCUS_09410 7812 6526 CDS product ectonucleotide pyrophosphatase/phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861962.1 protein_id gnl|my_center|LOCUS_09410 7955 9046 gene locus_tag LOCUS_09420 7955 9046 CDS product glycoside hydrolase family 88 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288261.1 protein_id gnl|my_center|LOCUS_09420 9057 9983 gene locus_tag LOCUS_09430 9057 9983 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286009.1 protein_id gnl|my_center|LOCUS_09430 10250 10026 gene locus_tag LOCUS_09440 10250 10026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09440 10135 10812 gene locus_tag LOCUS_09450 10135 10812 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012027282.1 protein_id gnl|my_center|LOCUS_09450 10818 13208 gene locus_tag LOCUS_09460 10818 13208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973963.1 protein_id gnl|my_center|LOCUS_09460 13205 15493 gene locus_tag LOCUS_09470 13205 15493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037393207.1 protein_id gnl|my_center|LOCUS_09470 15571 17070 gene locus_tag LOCUS_09480 15571 17070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09480 17096 18010 gene locus_tag LOCUS_09490 17096 18010 CDS product CehA/McbA family metallohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035844551.1 protein_id gnl|my_center|LOCUS_09490 18026 19054 gene locus_tag LOCUS_09500 18026 19054 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080078.1 protein_id gnl|my_center|LOCUS_09500 >Feature sequence035 1643 483 gene locus_tag LOCUS_09510 1643 483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09510 2053 3132 gene locus_tag LOCUS_09520 2053 3132 CDS product Ldh family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867978.1 protein_id gnl|my_center|LOCUS_09520 3251 3928 gene locus_tag LOCUS_09530 3251 3928 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391621.1 protein_id gnl|my_center|LOCUS_09530 4015 5304 gene locus_tag LOCUS_09540 gene larA 4015 5304 CDS product nickel-dependent lactate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948687.1 protein_id gnl|my_center|LOCUS_09540 5309 5620 gene locus_tag LOCUS_09550 5309 5620 CDS product UxaA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812779.1 protein_id gnl|my_center|LOCUS_09550 5617 6786 gene locus_tag LOCUS_09560 5617 6786 CDS product UxaA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460067.1 protein_id gnl|my_center|LOCUS_09560 6818 8197 gene locus_tag LOCUS_09570 6818 8197 CDS product gluconate:H+ symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047747.1 protein_id gnl|my_center|LOCUS_09570 8827 8315 gene locus_tag LOCUS_09580 8827 8315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09580 9561 9725 gene locus_tag LOCUS_09590 9561 9725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09590 9928 10770 gene locus_tag LOCUS_09600 9928 10770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09600 11082 12296 gene locus_tag LOCUS_09610 11082 12296 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693372.1 protein_id gnl|my_center|LOCUS_09610 12376 13428 gene locus_tag LOCUS_09620 12376 13428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09620 15338 13761 gene locus_tag LOCUS_09630 15338 13761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09630 15428 16192 gene locus_tag LOCUS_09640 15428 16192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09640 16209 17459 gene locus_tag LOCUS_09650 16209 17459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09650 17443 18648 gene locus_tag LOCUS_09660 17443 18648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09660 >Feature sequence036 1211 405 gene locus_tag LOCUS_09670 gene proC 1211 405 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906183.1 protein_id gnl|my_center|LOCUS_09670 1714 1208 gene locus_tag LOCUS_09680 gene trmL 1714 1208 CDS product tRNA (uridine(34)/cytosine(34)/5-carboxymethylaminomethyluridine(34)-2'-O)-methyltransferase TrmL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429657.1 protein_id gnl|my_center|LOCUS_09680 1834 2649 gene locus_tag LOCUS_09690 1834 2649 CDS product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009905410.1 protein_id gnl|my_center|LOCUS_09690 2649 3800 gene locus_tag LOCUS_09700 2649 3800 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013582790.1 protein_id gnl|my_center|LOCUS_09700 5045 3879 gene locus_tag LOCUS_09710 gene dinB 5045 3879 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010956849.1 protein_id gnl|my_center|LOCUS_09710 6118 5042 gene locus_tag LOCUS_09720 6118 5042 CDS product D-alanine--D-alanine ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965983.1 protein_id gnl|my_center|LOCUS_09720 7572 6109 gene locus_tag LOCUS_09730 7572 6109 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002657618.1 protein_id gnl|my_center|LOCUS_09730 7897 7586 gene locus_tag LOCUS_09740 7897 7586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09740 7784 8725 gene locus_tag LOCUS_09750 7784 8725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09750 8801 8977 gene locus_tag LOCUS_09760 8801 8977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002672198.1 protein_id gnl|my_center|LOCUS_09760 9326 10768 gene locus_tag LOCUS_09770 gene murC 9326 10768 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002656222.1 protein_id gnl|my_center|LOCUS_09770 10759 11634 gene locus_tag LOCUS_09780 10759 11634 CDS product YicC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682397.1 protein_id gnl|my_center|LOCUS_09780 11642 12163 gene locus_tag LOCUS_09790 11642 12163 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682399.1 protein_id gnl|my_center|LOCUS_09790 12153 12617 gene locus_tag LOCUS_09800 12153 12617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09800 12695 12898 gene locus_tag LOCUS_09810 12695 12898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09810 12822 13814 gene locus_tag LOCUS_09820 gene miaA 12822 13814 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680912.1 protein_id gnl|my_center|LOCUS_09820 15228 13786 gene locus_tag LOCUS_09830 15228 13786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09830 16034 15225 gene locus_tag LOCUS_09840 16034 15225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09840 17442 16021 gene locus_tag LOCUS_09850 17442 16021 CDS product NFACT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679249.1 protein_id gnl|my_center|LOCUS_09850 18778 17423 gene locus_tag LOCUS_09860 gene folC 18778 17423 CDS product bifunctional tetrahydrofolate synthase/dihydrofolate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000582040.1 protein_id gnl|my_center|LOCUS_09860 >Feature sequence037 <1 531 gene locus_tag LOCUS_09870 <1 531 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002680429.1:methionine adenosyltransferase 1272 586 gene locus_tag LOCUS_09880 1272 586 CDS product protein jag inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002667657.1 protein_id gnl|my_center|LOCUS_09880 3115 1316 gene locus_tag LOCUS_09890 gene yidC 3115 1316 CDS product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680325.1 protein_id gnl|my_center|LOCUS_09890 3554 3204 gene locus_tag LOCUS_09900 3554 3204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09900 3702 3535 gene locus_tag LOCUS_09910 gene rpmH 3702 3535 CDS product 50S ribosomal protein L34 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002557032.1 protein_id gnl|my_center|LOCUS_09910 4129 3803 gene locus_tag LOCUS_09920 4129 3803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09920 5201 4110 gene locus_tag LOCUS_09930 gene recF 5201 4110 CDS product DNA replication and repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681135.1 protein_id gnl|my_center|LOCUS_09930 6307 5201 gene locus_tag LOCUS_09940 gene dnaN 6307 5201 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681136.1 protein_id gnl|my_center|LOCUS_09940 7932 6523 gene locus_tag LOCUS_09950 gene dnaA 7932 6523 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680852.1 protein_id gnl|my_center|LOCUS_09950 8131 10164 gene locus_tag LOCUS_09960 gene gyrB 8131 10164 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002666949.1 protein_id gnl|my_center|LOCUS_09960 10181 12697 gene locus_tag LOCUS_09970 gene gyrA 10181 12697 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681235.1 protein_id gnl|my_center|LOCUS_09970 13406 13179 gene locus_tag LOCUS_09980 13406 13179 CDS product NifU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011791779.1 protein_id gnl|my_center|LOCUS_09980 13557 14282 gene locus_tag LOCUS_09990 13557 14282 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681790.1 protein_id gnl|my_center|LOCUS_09990 14266 15204 gene locus_tag LOCUS_10000 14266 15204 CDS product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681789.1 protein_id gnl|my_center|LOCUS_10000 15214 16167 gene locus_tag LOCUS_10010 15214 16167 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680321.1 protein_id gnl|my_center|LOCUS_10010 16182 17534 gene locus_tag LOCUS_10020 gene radA 16182 17534 CDS product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680482.1 protein_id gnl|my_center|LOCUS_10020 17874 18044 gene locus_tag LOCUS_10030 17874 18044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10030 18790 18122 gene locus_tag LOCUS_10040 18790 18122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10040 >Feature sequence038 727 383 gene locus_tag LOCUS_10050 727 383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10050 3405 895 gene locus_tag LOCUS_10060 3405 895 CDS product glycogen/starch/alpha-glucan phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942708.1 protein_id gnl|my_center|LOCUS_10060 3582 3654 gene locus_tag LOCUS_t00240 3582 3654 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 3716 3892 gene locus_tag LOCUS_10070 gene rpmG 3716 3892 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002667594.1 protein_id gnl|my_center|LOCUS_10070 3916 3990 gene locus_tag LOCUS_t00250 3916 3990 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 4027 4206 gene locus_tag LOCUS_10080 gene secE 4027 4206 CDS product preprotein translocase subunit SecE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881261.1 protein_id gnl|my_center|LOCUS_10080 4216 4776 gene locus_tag LOCUS_10090 gene nusG 4216 4776 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002667597.1 protein_id gnl|my_center|LOCUS_10090 4938 5369 gene locus_tag LOCUS_10100 gene rplK 4938 5369 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002667599.1 protein_id gnl|my_center|LOCUS_10100 5371 6060 gene locus_tag LOCUS_10110 gene rplA 5371 6060 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002667601.1 protein_id gnl|my_center|LOCUS_10110 6073 6600 gene locus_tag LOCUS_10120 gene rplJ 6073 6600 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680363.1 protein_id gnl|my_center|LOCUS_10120 6669 7049 gene locus_tag LOCUS_10130 gene rplL 6669 7049 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005650892.1 protein_id gnl|my_center|LOCUS_10130 7220 8800 gene locus_tag LOCUS_10140 7220 8800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10140 8797 10716 gene locus_tag LOCUS_10150 8797 10716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10150 10732 15006 gene locus_tag LOCUS_10160 gene rpoC 10732 15006 CDS product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680359.1 protein_id gnl|my_center|LOCUS_10160 15129 15503 gene locus_tag LOCUS_10170 gene rpsL 15129 15503 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002670535.1 protein_id gnl|my_center|LOCUS_10170 15519 15989 gene locus_tag LOCUS_10180 gene rpsG 15519 15989 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002670537.1 protein_id gnl|my_center|LOCUS_10180 16420 17475 gene locus_tag LOCUS_10190 gene tuf 16420 17475 CDS product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669993.1 protein_id gnl|my_center|LOCUS_10190 17538 17846 gene locus_tag LOCUS_10200 gene rpsJ 17538 17846 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669994.1 protein_id gnl|my_center|LOCUS_10200 >Feature sequence039 497 174 gene locus_tag LOCUS_10210 497 174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10210 981 379 gene locus_tag LOCUS_10220 981 379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10220 1528 974 gene locus_tag LOCUS_10230 gene rsmD 1528 974 CDS product 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669684.1 protein_id gnl|my_center|LOCUS_10230 3657 1570 gene locus_tag LOCUS_10240 gene recG 3657 1570 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680562.1 protein_id gnl|my_center|LOCUS_10240 4300 3659 gene locus_tag LOCUS_10250 4300 3659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10250 7773 4321 gene locus_tag LOCUS_10260 gene dnaE 7773 4321 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957315.1 protein_id gnl|my_center|LOCUS_10260 8680 7796 gene locus_tag LOCUS_10270 8680 7796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10270 9191 8664 gene locus_tag LOCUS_10280 9191 8664 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975277.1 protein_id gnl|my_center|LOCUS_10280 11131 9188 gene locus_tag LOCUS_10290 11131 9188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10290 11231 13312 gene locus_tag LOCUS_10300 gene ligA 11231 13312 CDS product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001124831.1 protein_id gnl|my_center|LOCUS_10300 13369 14667 gene locus_tag LOCUS_10310 13369 14667 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812135.1 protein_id gnl|my_center|LOCUS_10310 14658 15047 gene locus_tag LOCUS_10320 14658 15047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10320 15037 16377 gene locus_tag LOCUS_10330 15037 16377 CDS product ATP-dependent 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002666804.1 protein_id gnl|my_center|LOCUS_10330 16816 17163 gene locus_tag LOCUS_10340 16816 17163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10340 >Feature sequence040 852 121 gene locus_tag LOCUS_10350 gene hisA 852 121 CDS product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino]imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764911.1 protein_id gnl|my_center|LOCUS_10350 1979 852 gene locus_tag LOCUS_10360 gene hisB 1979 852 CDS product bifunctional histidinol-phosphatase/imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766230.1 protein_id gnl|my_center|LOCUS_10360 3039 1972 gene locus_tag LOCUS_10370 gene hisC 3039 1972 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766231.1 protein_id gnl|my_center|LOCUS_10370 4349 3039 gene locus_tag LOCUS_10380 gene hisD 4349 3039 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766232.1 protein_id gnl|my_center|LOCUS_10380 5222 4359 gene locus_tag LOCUS_10390 gene hisG 5222 4359 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760516.1 protein_id gnl|my_center|LOCUS_10390 7218 5521 gene locus_tag LOCUS_10400 gene pheT 7218 5521 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957104.1 protein_id gnl|my_center|LOCUS_10400 8756 7218 gene locus_tag LOCUS_10410 8756 7218 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680967.1 protein_id gnl|my_center|LOCUS_10410 10813 8831 gene locus_tag LOCUS_10420 10813 8831 CDS product alpha-ketoacid dehydrogenase subunit alpha/beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228884.1 protein_id gnl|my_center|LOCUS_10420 11397 10882 gene locus_tag LOCUS_10430 11397 10882 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861543.1 protein_id gnl|my_center|LOCUS_10430 11544 12089 gene locus_tag LOCUS_10440 gene hpt 11544 12089 CDS product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393596.1 protein_id gnl|my_center|LOCUS_10440 12097 12648 gene locus_tag LOCUS_10450 12097 12648 CDS product phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010951420.1 protein_id gnl|my_center|LOCUS_10450 12641 13912 gene locus_tag LOCUS_10460 12641 13912 CDS product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021916.1 protein_id gnl|my_center|LOCUS_10460 14277 15872 gene locus_tag LOCUS_10470 14277 15872 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972693.1 protein_id gnl|my_center|LOCUS_10470 15952 16908 gene locus_tag LOCUS_10480 15952 16908 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860980.1 protein_id gnl|my_center|LOCUS_10480 >Feature sequence041 664 113 gene locus_tag LOCUS_10490 664 113 CDS product chromate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763311.1 protein_id gnl|my_center|LOCUS_10490 1251 661 gene locus_tag LOCUS_10500 1251 661 CDS product chromate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005802804.1 protein_id gnl|my_center|LOCUS_10500 2357 1248 gene locus_tag LOCUS_10510 2357 1248 CDS product SPASM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002390206.1 protein_id gnl|my_center|LOCUS_10510 3816 2404 gene locus_tag LOCUS_10520 3816 2404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10520 4718 3906 gene locus_tag LOCUS_10530 gene zupT 4718 3906 CDS product zinc transporter ZupT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861091.1 protein_id gnl|my_center|LOCUS_10530 4923 5189 gene locus_tag LOCUS_10540 4923 5189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10540 6526 5234 gene locus_tag LOCUS_10550 6526 5234 CDS product UDP-glucose/GDP-mannose dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861675.1 protein_id gnl|my_center|LOCUS_10550 8849 6615 gene locus_tag LOCUS_10560 8849 6615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10560 10354 8894 gene locus_tag LOCUS_10570 10354 8894 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922507.1 protein_id gnl|my_center|LOCUS_10570 12116 10416 gene locus_tag LOCUS_10580 12116 10416 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775818.1 protein_id gnl|my_center|LOCUS_10580 13054 12161 gene locus_tag LOCUS_10590 13054 12161 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012027282.1 protein_id gnl|my_center|LOCUS_10590 13941 13054 gene locus_tag LOCUS_10600 13941 13054 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775816.1 protein_id gnl|my_center|LOCUS_10600 14189 15523 gene locus_tag LOCUS_10610 14189 15523 CDS product alpha-L-fucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681576.1 protein_id gnl|my_center|LOCUS_10610 15527 16270 gene locus_tag LOCUS_10620 15527 16270 CDS product copper homeostasis protein CutC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203367.1 protein_id gnl|my_center|LOCUS_10620 >Feature sequence042 197 1000 gene locus_tag LOCUS_10630 197 1000 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201627435.1 protein_id gnl|my_center|LOCUS_10630 1016 2077 gene locus_tag LOCUS_10640 1016 2077 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011943878.1 protein_id gnl|my_center|LOCUS_10640 2676 2287 gene locus_tag LOCUS_10650 2676 2287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10650 3293 2673 gene locus_tag LOCUS_10660 3293 2673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10660 3802 3293 gene locus_tag LOCUS_10670 3802 3293 CDS product nucleoside deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173510078.1 protein_id gnl|my_center|LOCUS_10670 3958 5208 gene locus_tag LOCUS_10680 3958 5208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10680 5658 5284 gene locus_tag LOCUS_10690 5658 5284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10690 6299 5658 gene locus_tag LOCUS_10700 6299 5658 CDS product cytidylate kinase-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766580.1 protein_id gnl|my_center|LOCUS_10700 6741 6376 gene locus_tag LOCUS_10710 6741 6376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10710 7392 6805 gene locus_tag LOCUS_10720 7392 6805 CDS product cyclase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000862963.1 protein_id gnl|my_center|LOCUS_10720 8156 7389 gene locus_tag LOCUS_10730 8156 7389 CDS product DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435007.1 protein_id gnl|my_center|LOCUS_10730 9069 8143 gene locus_tag LOCUS_10740 gene cysK 9069 8143 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257225.1 protein_id gnl|my_center|LOCUS_10740 9563 9150 gene locus_tag LOCUS_10750 9563 9150 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461668.1 protein_id gnl|my_center|LOCUS_10750 9937 9560 gene locus_tag LOCUS_10760 9937 9560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10760 11708 10191 gene locus_tag LOCUS_10770 11708 10191 CDS product DUF1846 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902867.1 protein_id gnl|my_center|LOCUS_10770 12262 11708 gene locus_tag LOCUS_10780 12262 11708 CDS product DJ-1/PfpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143742.1 protein_id gnl|my_center|LOCUS_10780 13351 12275 gene locus_tag LOCUS_10790 13351 12275 CDS product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942928.1 protein_id gnl|my_center|LOCUS_10790 15199 13394 gene locus_tag LOCUS_10800 15199 13394 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940378.1 protein_id gnl|my_center|LOCUS_10800 15765 15202 gene locus_tag LOCUS_10810 15765 15202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10810 16284 15949 gene locus_tag LOCUS_10820 16284 15949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10820 <17208 16327 gene locus_tag LOCUS_10830 <17208 16327 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010957030.1:long-chain fatty acid--CoA ligase >Feature sequence043 445 122 gene locus_tag LOCUS_10840 445 122 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007056318.1 protein_id gnl|my_center|LOCUS_10840 621 797 gene locus_tag LOCUS_10850 621 797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10850 933 1970 gene locus_tag LOCUS_10860 933 1970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10860 1967 2917 gene locus_tag LOCUS_10870 1967 2917 CDS product zinc-binding alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_077130071.1 protein_id gnl|my_center|LOCUS_10870 2932 3369 gene locus_tag LOCUS_10880 2932 3369 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000776018.1 protein_id gnl|my_center|LOCUS_10880 3439 5346 gene locus_tag LOCUS_10890 3439 5346 CDS product NAD(+) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203175.1 protein_id gnl|my_center|LOCUS_10890 5451 6050 gene locus_tag LOCUS_10900 5451 6050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10900 6097 6711 gene locus_tag LOCUS_10910 6097 6711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10910 6803 7117 gene locus_tag LOCUS_10920 6803 7117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10920 7114 7875 gene locus_tag LOCUS_10930 7114 7875 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403269.1 protein_id gnl|my_center|LOCUS_10930 7879 8781 gene locus_tag LOCUS_10940 7879 8781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10940 8775 10511 gene locus_tag LOCUS_10950 8775 10511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10950 10511 11110 gene locus_tag LOCUS_10960 10511 11110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10960 11135 12313 gene locus_tag LOCUS_10970 11135 12313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10970 13349 12282 gene locus_tag LOCUS_10980 13349 12282 CDS product KamA family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403887.1 protein_id gnl|my_center|LOCUS_10980 13463 14776 gene locus_tag LOCUS_10990 13463 14776 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682053.1 protein_id gnl|my_center|LOCUS_10990 15333 14773 gene locus_tag LOCUS_11000 15333 14773 CDS product manganese efflux pump MntP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851996.1 protein_id gnl|my_center|LOCUS_11000 >Feature sequence044 466 1137 gene locus_tag LOCUS_11010 466 1137 CDS product cytochrome c biogenesis protein CcdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459567.1 protein_id gnl|my_center|LOCUS_11010 1147 1851 gene locus_tag LOCUS_11020 1147 1851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11020 2515 1844 gene locus_tag LOCUS_11030 2515 1844 CDS product hemolysin III family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680231.1 protein_id gnl|my_center|LOCUS_11030 3514 2771 gene locus_tag LOCUS_11040 3514 2771 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878183.1 protein_id gnl|my_center|LOCUS_11040 4379 3507 gene locus_tag LOCUS_11050 4379 3507 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944016.1 protein_id gnl|my_center|LOCUS_11050 4479 4697 gene locus_tag LOCUS_11060 4479 4697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11060 5522 4767 gene locus_tag LOCUS_11070 5522 4767 CDS product basic amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938534.1 protein_id gnl|my_center|LOCUS_11070 6087 5623 gene locus_tag LOCUS_11080 6087 5623 CDS product divergent PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130996.1 protein_id gnl|my_center|LOCUS_11080 6169 7344 gene locus_tag LOCUS_11090 6169 7344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11090 7401 9338 gene locus_tag LOCUS_11100 7401 9338 CDS product aconitate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948184.1 protein_id gnl|my_center|LOCUS_11100 9338 10525 gene locus_tag LOCUS_11110 gene icd 9338 10525 CDS product NADP-dependent isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108123.1 protein_id gnl|my_center|LOCUS_11110 11817 10522 gene locus_tag LOCUS_11120 11817 10522 CDS product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000852462.1 protein_id gnl|my_center|LOCUS_11120 11933 12244 gene locus_tag LOCUS_11130 11933 12244 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002391570.1 protein_id gnl|my_center|LOCUS_11130 13458 12241 gene locus_tag LOCUS_11140 13458 12241 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082326.1 protein_id gnl|my_center|LOCUS_11140 13683 14414 gene locus_tag LOCUS_11150 13683 14414 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963591.1 protein_id gnl|my_center|LOCUS_11150 >Feature sequence045 <1 1231 gene locus_tag LOCUS_11160 <1 1231 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012869156.1:DUF1576 domain-containing protein 1231 1614 gene locus_tag LOCUS_11170 1231 1614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11170 1767 2012 gene locus_tag LOCUS_11180 1767 2012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11180 2016 3329 gene locus_tag LOCUS_11190 2016 3329 CDS product type II toxin-antitoxin system HipA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174384.1 protein_id gnl|my_center|LOCUS_11190 3413 5203 gene locus_tag LOCUS_11200 gene aspS 3413 5203 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679265.1 protein_id gnl|my_center|LOCUS_11200 5240 6124 gene locus_tag LOCUS_11210 5240 6124 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948895.1 protein_id gnl|my_center|LOCUS_11210 6181 6567 gene locus_tag LOCUS_11220 6181 6567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11220 6577 7092 gene locus_tag LOCUS_11230 6577 7092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11230 7804 7076 gene locus_tag LOCUS_11240 7804 7076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11240 8463 7801 gene locus_tag LOCUS_11250 8463 7801 CDS product class II aldolase/adducin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392225.1 protein_id gnl|my_center|LOCUS_11250 9259 8588 gene locus_tag LOCUS_11260 9259 8588 CDS product D-lyxose/D-mannose family sugar isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209520.1 protein_id gnl|my_center|LOCUS_11260 9428 11194 gene locus_tag LOCUS_11270 9428 11194 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966455.1 protein_id gnl|my_center|LOCUS_11270 11707 11195 gene locus_tag LOCUS_11280 11707 11195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11280 11834 12919 gene locus_tag LOCUS_11290 11834 12919 CDS product adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877158.1 protein_id gnl|my_center|LOCUS_11290 13554 12916 gene locus_tag LOCUS_11300 13554 12916 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002666681.1 protein_id gnl|my_center|LOCUS_11300 14058 14672 gene locus_tag LOCUS_11310 14058 14672 CDS product RlmE family RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669797.1 protein_id gnl|my_center|LOCUS_11310 14669 15091 gene locus_tag LOCUS_11320 14669 15091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11320 >Feature sequence046 1080 178 gene locus_tag LOCUS_11330 1080 178 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242715.1 protein_id gnl|my_center|LOCUS_11330 2080 1094 gene locus_tag LOCUS_11340 2080 1094 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244086.1 protein_id gnl|my_center|LOCUS_11340 2493 2266 gene locus_tag LOCUS_11350 2493 2266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11350 2726 2400 gene locus_tag LOCUS_11360 2726 2400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11360 3258 2683 gene locus_tag LOCUS_11370 3258 2683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11370 4504 3305 gene locus_tag LOCUS_11380 4504 3305 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582801.1 protein_id gnl|my_center|LOCUS_11380 6074 4572 gene locus_tag LOCUS_11390 gene gguA 6074 4572 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582800.1 protein_id gnl|my_center|LOCUS_11390 6337 6981 gene locus_tag LOCUS_11400 6337 6981 CDS product queuosine precursor transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020681.1 protein_id gnl|my_center|LOCUS_11400 7067 9535 gene locus_tag LOCUS_11410 gene lon 7067 9535 CDS product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681876.1 protein_id gnl|my_center|LOCUS_11410 9525 10751 gene locus_tag LOCUS_11420 9525 10751 CDS product peptidase U32 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680143.1 protein_id gnl|my_center|LOCUS_11420 10855 11028 gene locus_tag LOCUS_11430 10855 11028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11430 13730 11082 gene locus_tag LOCUS_11440 13730 11082 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678931.1 protein_id gnl|my_center|LOCUS_11440 14359 13826 gene locus_tag LOCUS_11450 14359 13826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11450 <14891 14363 gene locus_tag LOCUS_11460 <14891 14363 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002666766.1:RNA polymerase sigma factor >Feature sequence047 <1 939 gene locus_tag LOCUS_11470 <1 939 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011015138.1:ABC transporter substrate-binding protein 1008 1850 gene locus_tag LOCUS_11480 1008 1850 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004567523.1 protein_id gnl|my_center|LOCUS_11480 1847 2689 gene locus_tag LOCUS_11490 1847 2689 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015137.1 protein_id gnl|my_center|LOCUS_11490 2691 4232 gene locus_tag LOCUS_11500 gene malQ 2691 4232 CDS product 4-alpha-glucanotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_094267720.1 protein_id gnl|my_center|LOCUS_11500 4329 5174 gene locus_tag LOCUS_11510 4329 5174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11510 5171 5932 gene locus_tag LOCUS_11520 5171 5932 CDS product class III extradiol ring-cleavage dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072011.1 protein_id gnl|my_center|LOCUS_11520 6119 5937 gene locus_tag LOCUS_11530 6119 5937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11530 7128 6124 gene locus_tag LOCUS_11540 7128 6124 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009903661.1 protein_id gnl|my_center|LOCUS_11540 7707 7282 gene locus_tag LOCUS_11550 7707 7282 CDS product flavodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002666607.1 protein_id gnl|my_center|LOCUS_11550 8656 7820 gene locus_tag LOCUS_11560 8656 7820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11560 9471 8686 gene locus_tag LOCUS_11570 9471 8686 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399665.1 protein_id gnl|my_center|LOCUS_11570 10053 9541 gene locus_tag LOCUS_11580 10053 9541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11580 10118 11479 gene locus_tag LOCUS_11590 10118 11479 CDS product alpha-glucosidase/alpha-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804146.1 protein_id gnl|my_center|LOCUS_11590 11603 11529 gene locus_tag LOCUS_t00260 11603 11529 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 13360 11693 gene locus_tag LOCUS_11600 13360 11693 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005896074.1 protein_id gnl|my_center|LOCUS_11600 14482 13370 gene locus_tag LOCUS_11610 14482 13370 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902588.1 protein_id gnl|my_center|LOCUS_11610 >Feature sequence048 <1 903 gene locus_tag LOCUS_11620 <1 903 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002356597.1:selenium-dependent xanthine dehydrogenase 1296 910 gene locus_tag LOCUS_11630 1296 910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11630 1751 1380 gene locus_tag LOCUS_11640 1751 1380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11640 2872 1823 gene locus_tag LOCUS_11650 2872 1823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11650 5801 2889 gene locus_tag LOCUS_11660 5801 2889 CDS product glycoside hydrolase family 38 C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027462.1 protein_id gnl|my_center|LOCUS_11660 6979 5798 gene locus_tag LOCUS_11670 gene aar 6979 5798 CDS product bifunctional L-alanine/L-glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004079973.1 protein_id gnl|my_center|LOCUS_11670 7821 6988 gene locus_tag LOCUS_11680 7821 6988 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531924.1 protein_id gnl|my_center|LOCUS_11680 8699 7818 gene locus_tag LOCUS_11690 8699 7818 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004434064.1 protein_id gnl|my_center|LOCUS_11690 10044 8767 gene locus_tag LOCUS_11700 10044 8767 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972818.1 protein_id gnl|my_center|LOCUS_11700 10977 10129 gene locus_tag LOCUS_11710 10977 10129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11710 12051 11101 gene locus_tag LOCUS_11720 12051 11101 CDS product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_207285055.1 protein_id gnl|my_center|LOCUS_11720 13122 12070 gene locus_tag LOCUS_11730 gene dgoD 13122 12070 CDS product galactonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528179.1 protein_id gnl|my_center|LOCUS_11730 13864 13202 gene locus_tag LOCUS_11740 gene eda 13864 13202 CDS product bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583017.1 protein_id gnl|my_center|LOCUS_11740 <14561 13877 gene locus_tag LOCUS_11750 <14561 13877 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005918169.1:ATP-binding cassette domain-containing protein >Feature sequence049 145 3546 gene locus_tag LOCUS_11760 145 3546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11760 3628 4803 gene locus_tag LOCUS_11770 3628 4803 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769287.1 protein_id gnl|my_center|LOCUS_11770 5260 4790 gene locus_tag LOCUS_11780 5260 4790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11780 5364 6248 gene locus_tag LOCUS_11790 5364 6248 CDS product glycoside hydrolase family 43 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108031.1 protein_id gnl|my_center|LOCUS_11790 6239 8281 gene locus_tag LOCUS_11800 6239 8281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11800 8315 8974 gene locus_tag LOCUS_11810 8315 8974 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817367.1 protein_id gnl|my_center|LOCUS_11810 9060 9890 gene locus_tag LOCUS_11820 9060 9890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11820 9887 10678 gene locus_tag LOCUS_11830 9887 10678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11830 10668 11033 gene locus_tag LOCUS_11840 10668 11033 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005804269.1 protein_id gnl|my_center|LOCUS_11840 12116 11121 gene locus_tag LOCUS_11850 12116 11121 CDS product lactonase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000782251.1 protein_id gnl|my_center|LOCUS_11850 13636 12347 gene locus_tag LOCUS_11860 13636 12347 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008363502.1 protein_id gnl|my_center|LOCUS_11860 14256 13813 gene locus_tag LOCUS_11870 14256 13813 CDS product YbaK/EbsC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437963.1 protein_id gnl|my_center|LOCUS_11870 >Feature sequence050 1053 328 gene locus_tag LOCUS_11880 1053 328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11880 1593 1075 gene locus_tag LOCUS_11890 1593 1075 CDS product DUF4416 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544933.1 protein_id gnl|my_center|LOCUS_11890 3505 1595 gene locus_tag LOCUS_11900 3505 1595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11900 4015 4680 gene locus_tag LOCUS_11910 4015 4680 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256674.1 protein_id gnl|my_center|LOCUS_11910 5630 4677 gene locus_tag LOCUS_11920 gene metF 5630 4677 CDS product methylenetetrahydrofolate reductase [NAD(P)H] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005792069.1 protein_id gnl|my_center|LOCUS_11920 9104 5634 gene locus_tag LOCUS_11930 gene metH 9104 5634 CDS product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704023.1 protein_id gnl|my_center|LOCUS_11930 9829 9101 gene locus_tag LOCUS_11940 9829 9101 CDS product UPF0280 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583102.1 protein_id gnl|my_center|LOCUS_11940 10245 9832 gene locus_tag LOCUS_11950 10245 9832 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876487.1 protein_id gnl|my_center|LOCUS_11950 11402 10242 gene locus_tag LOCUS_11960 11402 10242 CDS product homocysteine biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876488.1 protein_id gnl|my_center|LOCUS_11960 11731 11387 gene locus_tag LOCUS_11970 11731 11387 CDS product YqfO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092679.1 protein_id gnl|my_center|LOCUS_11970 11768 12298 gene locus_tag LOCUS_11980 gene pth 11768 12298 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101048.1 protein_id gnl|my_center|LOCUS_11980 >Feature sequence051 <1 1731 gene locus_tag LOCUS_11990 <1 1731 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012869273.1:V-type ATPase 116kDa subunit family protein 1754 2104 gene locus_tag LOCUS_12000 1754 2104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12000 2108 2410 gene locus_tag LOCUS_12010 2108 2410 CDS product V-type ATP synthase subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250552.1 protein_id gnl|my_center|LOCUS_12010 2422 3018 gene locus_tag LOCUS_12020 2422 3018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12020 3015 4793 gene locus_tag LOCUS_12030 3015 4793 CDS product ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250553.1 protein_id gnl|my_center|LOCUS_12030 4783 6204 gene locus_tag LOCUS_12040 4783 6204 CDS product ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048147353.1 protein_id gnl|my_center|LOCUS_12040 6214 6912 gene locus_tag LOCUS_12050 6214 6912 CDS product V-type ATP synthase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870120.1 protein_id gnl|my_center|LOCUS_12050 6896 7378 gene locus_tag LOCUS_12060 6896 7378 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496534.1 protein_id gnl|my_center|LOCUS_12060 7389 7841 gene locus_tag LOCUS_12070 7389 7841 CDS product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328918.1 protein_id gnl|my_center|LOCUS_12070 7962 8945 gene locus_tag LOCUS_12080 7962 8945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679444.1 protein_id gnl|my_center|LOCUS_12080 9121 8936 gene locus_tag LOCUS_12090 9121 8936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12090 10146 9037 gene locus_tag LOCUS_12100 10146 9037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12100 10843 10163 gene locus_tag LOCUS_12110 10843 10163 CDS product lactate utilization protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948953.1 protein_id gnl|my_center|LOCUS_12110 11015 12694 gene locus_tag LOCUS_12120 11015 12694 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948757.1 protein_id gnl|my_center|LOCUS_12120 13297 12695 gene locus_tag LOCUS_12130 13297 12695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12130 >Feature sequence052 179 1426 gene locus_tag LOCUS_12140 179 1426 CDS product cation:dicarboxylase symporter family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002670666.1 protein_id gnl|my_center|LOCUS_12140 1433 2200 gene locus_tag LOCUS_12150 1433 2200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12150 4055 2409 gene locus_tag LOCUS_12160 gene gpmI 4055 2409 CDS product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001973414.1 protein_id gnl|my_center|LOCUS_12160 5845 4073 gene locus_tag LOCUS_12170 5845 4073 CDS product aminopeptidase P family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930907.1 protein_id gnl|my_center|LOCUS_12170 6793 5846 gene locus_tag LOCUS_12180 gene lgt 6793 5846 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013967724.1 protein_id gnl|my_center|LOCUS_12180 6927 8312 gene locus_tag LOCUS_12190 6927 8312 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080969.1 protein_id gnl|my_center|LOCUS_12190 8309 9073 gene locus_tag LOCUS_12200 8309 9073 CDS product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228101.1 protein_id gnl|my_center|LOCUS_12200 9172 8963 gene locus_tag LOCUS_12210 9172 8963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12210 9208 10326 gene locus_tag LOCUS_12220 9208 10326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12220 12066 10783 gene locus_tag LOCUS_12230 gene murA 12066 10783 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002656466.1 protein_id gnl|my_center|LOCUS_12230 12161 13159 gene locus_tag LOCUS_12240 12161 13159 CDS product adenosine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000683574.1 protein_id gnl|my_center|LOCUS_12240 >Feature sequence053 <1 699 gene locus_tag LOCUS_12250 <1 699 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011392145.1:DeoR/GlpR family DNA-binding transcription regulator 711 1853 gene locus_tag LOCUS_12260 711 1853 CDS product Ldh family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867978.1 protein_id gnl|my_center|LOCUS_12260 1872 3161 gene locus_tag LOCUS_12270 1872 3161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12270 3338 3673 gene locus_tag LOCUS_12280 3338 3673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12280 5027 3795 gene locus_tag LOCUS_12290 5027 3795 CDS product glycoside hydrolase family 27 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776921.1 protein_id gnl|my_center|LOCUS_12290 6099 5014 gene locus_tag LOCUS_12300 6099 5014 CDS product glycoside hydrolase family 88 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288261.1 protein_id gnl|my_center|LOCUS_12300 8515 6092 gene locus_tag LOCUS_12310 8515 6092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973963.1 protein_id gnl|my_center|LOCUS_12310 8678 9547 gene locus_tag LOCUS_12320 8678 9547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12320 9544 10845 gene locus_tag LOCUS_12330 9544 10845 CDS product glycoside hydrolase family 28 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037393182.1 protein_id gnl|my_center|LOCUS_12330 11121 13085 gene locus_tag LOCUS_12340 11121 13085 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584050.1 protein_id gnl|my_center|LOCUS_12340 >Feature sequence054 3140 1572 gene locus_tag LOCUS_12350 3140 1572 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680556.1 protein_id gnl|my_center|LOCUS_12350 3614 3144 gene locus_tag LOCUS_12360 3614 3144 CDS product arginine repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762699.1 protein_id gnl|my_center|LOCUS_12360 3763 4311 gene locus_tag LOCUS_12370 3763 4311 CDS product LemA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037392708.1 protein_id gnl|my_center|LOCUS_12370 4311 6170 gene locus_tag LOCUS_12380 4311 6170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12380 6506 6228 gene locus_tag LOCUS_12390 6506 6228 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058088.1 protein_id gnl|my_center|LOCUS_12390 6771 7439 gene locus_tag LOCUS_12400 6771 7439 CDS product SEC59/DGK1/VTE5 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061278.1 protein_id gnl|my_center|LOCUS_12400 7436 8302 gene locus_tag LOCUS_12410 7436 8302 CDS product DUF92 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257179.1 protein_id gnl|my_center|LOCUS_12410 8422 10056 gene locus_tag LOCUS_12420 gene groL 8422 10056 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002670719.1 protein_id gnl|my_center|LOCUS_12420 10329 10171 gene locus_tag LOCUS_12430 10329 10171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12430 10292 10750 gene locus_tag LOCUS_12440 10292 10750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12440 10772 12499 gene locus_tag LOCUS_12450 gene secD 10772 12499 CDS product protein translocase subunit SecD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681894.1 protein_id gnl|my_center|LOCUS_12450 >Feature sequence055 286 756 gene locus_tag LOCUS_12460 286 756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12460 757 1287 gene locus_tag LOCUS_12470 757 1287 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883671.1 protein_id gnl|my_center|LOCUS_12470 1287 2339 gene locus_tag LOCUS_12480 gene aroC 1287 2339 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001297933.1 protein_id gnl|my_center|LOCUS_12480 2336 3997 gene locus_tag LOCUS_12490 2336 3997 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000042798.1 protein_id gnl|my_center|LOCUS_12490 3985 5889 gene locus_tag LOCUS_12500 3985 5889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12500 7372 5891 gene locus_tag LOCUS_12510 gene aroE 7372 5891 CDS product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327789.1 protein_id gnl|my_center|LOCUS_12510 7483 9417 gene locus_tag LOCUS_12520 7483 9417 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678989.1 protein_id gnl|my_center|LOCUS_12520 9410 9973 gene locus_tag LOCUS_12530 9410 9973 CDS product Maf family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392072.1 protein_id gnl|my_center|LOCUS_12530 10119 11000 gene locus_tag LOCUS_12540 gene rpsB 10119 11000 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680262.1 protein_id gnl|my_center|LOCUS_12540 11010 11864 gene locus_tag LOCUS_12550 gene tsf 11010 11864 CDS product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002674264.1 protein_id gnl|my_center|LOCUS_12550 11932 12486 gene locus_tag LOCUS_12560 gene frr 11932 12486 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938169.1 protein_id gnl|my_center|LOCUS_12560 12488 13186 gene locus_tag LOCUS_12570 gene uppS 12488 13186 CDS product polyprenyl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002675801.1 protein_id gnl|my_center|LOCUS_12570 >Feature sequence056 1969 278 gene locus_tag LOCUS_12580 1969 278 CDS product DUF262 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257894.1 protein_id gnl|my_center|LOCUS_12580 2303 2800 gene locus_tag LOCUS_12590 2303 2800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12590 3309 2848 gene locus_tag LOCUS_12600 3309 2848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12600 3556 3362 gene locus_tag LOCUS_12610 3556 3362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12610 5121 3562 gene locus_tag LOCUS_12620 5121 3562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12620 6097 5111 gene locus_tag LOCUS_12630 6097 5111 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682379.1 protein_id gnl|my_center|LOCUS_12630 7909 6113 gene locus_tag LOCUS_12640 7909 6113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12640 8906 7923 gene locus_tag LOCUS_12650 8906 7923 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002671815.1 protein_id gnl|my_center|LOCUS_12650 10826 8988 gene locus_tag LOCUS_12660 10826 8988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12660 11139 12647 gene locus_tag LOCUS_12670 11139 12647 CDS product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003423106.1 protein_id gnl|my_center|LOCUS_12670 >Feature sequence057 <1 1446 gene locus_tag LOCUS_12680 <1 1446 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002682243.1:AMP-binding protein 1449 1745 gene locus_tag LOCUS_12690 gene yhbY 1449 1745 CDS product ribosome assembly RNA-binding protein YhbY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210185.1 protein_id gnl|my_center|LOCUS_12690 3314 1827 gene locus_tag LOCUS_12700 3314 1827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12700 3615 4823 gene locus_tag LOCUS_12710 3615 4823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12710 4816 5724 gene locus_tag LOCUS_12720 4816 5724 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229019.1 protein_id gnl|my_center|LOCUS_12720 5724 6572 gene locus_tag LOCUS_12730 5724 6572 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228625.1 protein_id gnl|my_center|LOCUS_12730 6731 8083 gene locus_tag LOCUS_12740 6731 8083 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975589.1 protein_id gnl|my_center|LOCUS_12740 8295 9281 gene locus_tag LOCUS_12750 8295 9281 CDS product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009566022.1 protein_id gnl|my_center|LOCUS_12750 9281 10777 gene locus_tag LOCUS_12760 9281 10777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12760 10781 12292 gene locus_tag LOCUS_12770 10781 12292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12770 12388 12543 gene locus_tag LOCUS_12780 12388 12543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12780 >Feature sequence058 323 153 gene locus_tag LOCUS_12790 323 153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002657037.1 protein_id gnl|my_center|LOCUS_12790 464 736 gene locus_tag LOCUS_12800 464 736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12800 1348 737 gene locus_tag LOCUS_12810 gene udk 1348 737 CDS product uridine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002655979.1 protein_id gnl|my_center|LOCUS_12810 2386 1352 gene locus_tag LOCUS_12820 2386 1352 CDS product galactose mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120973.1 protein_id gnl|my_center|LOCUS_12820 4259 2442 gene locus_tag LOCUS_12830 gene lepA 4259 2442 CDS product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957093.1 protein_id gnl|my_center|LOCUS_12830 6198 4267 gene locus_tag LOCUS_12840 gene ftsH 6198 4267 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002656600.1 protein_id gnl|my_center|LOCUS_12840 7624 6191 gene locus_tag LOCUS_12850 gene tilS 7624 6191 CDS product tRNA lysidine(34) synthetase TilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678896.1 protein_id gnl|my_center|LOCUS_12850 8138 7611 gene locus_tag LOCUS_12860 gene pth 8138 7611 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226727.1 protein_id gnl|my_center|LOCUS_12860 8762 8142 gene locus_tag LOCUS_12870 8762 8142 CDS product 50S ribosomal protein L25 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678895.1 protein_id gnl|my_center|LOCUS_12870 8991 8918 gene locus_tag LOCUS_t00270 8991 8918 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 9324 9043 gene locus_tag LOCUS_12880 gene spoVG 9324 9043 CDS product septation regulator SpoVG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678893.1 protein_id gnl|my_center|LOCUS_12880 10203 9343 gene locus_tag LOCUS_12890 gene ispE 10203 9343 CDS product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081581.1 protein_id gnl|my_center|LOCUS_12890 11034 10318 gene locus_tag LOCUS_12900 11034 10318 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922324.1 protein_id gnl|my_center|LOCUS_12900 11083 11844 gene locus_tag LOCUS_12910 11083 11844 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000416671.1 protein_id gnl|my_center|LOCUS_12910 >Feature sequence059 406 1074 gene locus_tag LOCUS_12920 406 1074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_12920 1531 1067 gene locus_tag LOCUS_12930 gene nrdR 1531 1067 CDS product transcriptional regulator NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678882.1 protein_id gnl|my_center|LOCUS_12930 1671 2330 gene locus_tag LOCUS_12940 1671 2330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12940 2320 2808 gene locus_tag LOCUS_12950 2320 2808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12950 2801 3523 gene locus_tag LOCUS_12960 2801 3523 CDS product queuosine precursor transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015968.1 protein_id gnl|my_center|LOCUS_12960 4295 3486 gene locus_tag LOCUS_12970 4295 3486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12970 4339 7590 gene locus_tag LOCUS_12980 4339 7590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12980 7599 8330 gene locus_tag LOCUS_12990 gene trmB 7599 8330 CDS product tRNA (guanosine(46)-N7)-methyltransferase TrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010956879.1 protein_id gnl|my_center|LOCUS_12990 10510 8432 gene locus_tag LOCUS_13000 gene fusA 10510 8432 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682245.1 protein_id gnl|my_center|LOCUS_13000 10990 10781 gene locus_tag LOCUS_13010 10990 10781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13010 10871 11647 gene locus_tag LOCUS_13020 10871 11647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13020 >Feature sequence060 52 426 gene locus_tag LOCUS_13030 52 426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13030 413 1525 gene locus_tag LOCUS_13040 413 1525 CDS product Gx transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920600.1 protein_id gnl|my_center|LOCUS_13040 1774 4437 gene locus_tag LOCUS_13050 gene adhE 1774 4437 CDS product bifunctional acetaldehyde-CoA/alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000301680.1 protein_id gnl|my_center|LOCUS_13050 4588 5394 gene locus_tag LOCUS_13060 4588 5394 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000251908.1 protein_id gnl|my_center|LOCUS_13060 5391 6608 gene locus_tag LOCUS_13070 5391 6608 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966040.1 protein_id gnl|my_center|LOCUS_13070 7080 6592 gene locus_tag LOCUS_13080 7080 6592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13080 7550 7080 gene locus_tag LOCUS_13090 7550 7080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13090 7772 8050 gene locus_tag LOCUS_13100 7772 8050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13100 9663 7987 gene locus_tag LOCUS_13110 gene ilvB 9663 7987 CDS product biosynthetic-type acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966446.1 protein_id gnl|my_center|LOCUS_13110 11365 9680 gene locus_tag LOCUS_13120 gene ilvD 11365 9680 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393742.1 protein_id gnl|my_center|LOCUS_13120 12446 11382 gene locus_tag LOCUS_13130 gene leuB 12446 11382 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966448.1 protein_id gnl|my_center|LOCUS_13130 >Feature sequence061 <1 673 gene locus_tag LOCUS_13140 <1 673 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012582624.1:diguanylate cyclase note possible pseudo, frameshifted 670 1209 gene locus_tag LOCUS_13150 670 1209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13150 1443 2369 gene locus_tag LOCUS_13160 1443 2369 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972768.1 protein_id gnl|my_center|LOCUS_13160 2375 3223 gene locus_tag LOCUS_13170 2375 3223 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003532486.1 protein_id gnl|my_center|LOCUS_13170 3252 4532 gene locus_tag LOCUS_13180 3252 4532 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_086852588.1 protein_id gnl|my_center|LOCUS_13180 4596 5939 gene locus_tag LOCUS_13190 gene lplD 4596 5939 CDS product alpha-galacturonidase LplD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244472.1 protein_id gnl|my_center|LOCUS_13190 6052 6987 gene locus_tag LOCUS_13200 6052 6987 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398480.1 protein_id gnl|my_center|LOCUS_13200 6984 8015 gene locus_tag LOCUS_13210 6984 8015 CDS product phosphate/phosphite/phosphonate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905271.1 protein_id gnl|my_center|LOCUS_13210 8094 8846 gene locus_tag LOCUS_13220 gene phnC 8094 8846 CDS product phosphonate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905272.1 protein_id gnl|my_center|LOCUS_13220 8833 9654 gene locus_tag LOCUS_13230 gene phnE 8833 9654 CDS product phosphonate ABC transporter, permease protein PhnE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003131699.1 protein_id gnl|my_center|LOCUS_13230 9663 10472 gene locus_tag LOCUS_13240 gene phnE 9663 10472 CDS product phosphonate ABC transporter, permease protein PhnE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905273.1 protein_id gnl|my_center|LOCUS_13240 10465 11955 gene locus_tag LOCUS_13250 10465 11955 CDS product bifunctional metallophosphatase/5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965265.1 protein_id gnl|my_center|LOCUS_13250 >Feature sequence062 35 619 gene locus_tag LOCUS_13260 35 619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13260 639 1565 gene locus_tag LOCUS_13270 gene nanA 639 1565 CDS product N-acetylneuraminate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703468.1 protein_id gnl|my_center|LOCUS_13270 1987 1664 gene locus_tag LOCUS_13280 1987 1664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13280 4150 2120 gene locus_tag LOCUS_13290 gene fusA 4150 2120 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681223.1 protein_id gnl|my_center|LOCUS_13290 6497 4203 gene locus_tag LOCUS_13300 6497 4203 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002379416.1 protein_id gnl|my_center|LOCUS_13300 7882 6584 gene locus_tag LOCUS_13310 7882 6584 CDS product voltage-gated chloride channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267047.1 protein_id gnl|my_center|LOCUS_13310 8829 7930 gene locus_tag LOCUS_13320 8829 7930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13320 10174 8849 gene locus_tag LOCUS_13330 10174 8849 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814295.1 protein_id gnl|my_center|LOCUS_13330 11285 10224 gene locus_tag LOCUS_13340 11285 10224 CDS product M20/M25/M40 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387189.1 protein_id gnl|my_center|LOCUS_13340 11451 11376 gene locus_tag LOCUS_t00280 11451 11376 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 11557 11485 gene locus_tag LOCUS_t00290 11557 11485 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence063 1463 9 gene locus_tag LOCUS_13350 1463 9 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13350 3584 1662 gene locus_tag LOCUS_13360 3584 1662 CDS product AMP-dependent synthetase/ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926994.1 protein_id gnl|my_center|LOCUS_13360 4407 3688 gene locus_tag LOCUS_13370 gene phnF 4407 3688 CDS product phosphonate metabolism transcriptional regulator PhnF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002194085.1 protein_id gnl|my_center|LOCUS_13370 4839 4979 gene locus_tag LOCUS_13380 4839 4979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13380 5091 5019 gene locus_tag LOCUS_t00300 5091 5019 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 5306 6400 gene locus_tag LOCUS_13390 gene ugpC 5306 6400 CDS product sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004079960.1 protein_id gnl|my_center|LOCUS_13390 6965 6456 gene locus_tag LOCUS_13400 6965 6456 CDS product DUF2179 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000395815.1 protein_id gnl|my_center|LOCUS_13400 8356 7049 gene locus_tag LOCUS_13410 8356 7049 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963601.1 protein_id gnl|my_center|LOCUS_13410 8605 9885 gene locus_tag LOCUS_13420 8605 9885 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000738812.1 protein_id gnl|my_center|LOCUS_13420 9962 11302 gene locus_tag LOCUS_13430 9962 11302 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022042.1 protein_id gnl|my_center|LOCUS_13430 >Feature sequence064 1253 798 gene locus_tag LOCUS_13440 1253 798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13440 1835 2956 gene locus_tag LOCUS_13450 1835 2956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783472.1 protein_id gnl|my_center|LOCUS_13450 4797 3016 gene locus_tag LOCUS_13460 4797 3016 CDS product NADH-dependent [FeFe] hydrogenase, group A6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393219.1 protein_id gnl|my_center|LOCUS_13460 7945 4790 gene locus_tag LOCUS_13470 7945 4790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13470 8433 7942 gene locus_tag LOCUS_13480 gene nuoE 8433 7942 CDS product NADH-quinone oxidoreductase subunit NuoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011343661.1 protein_id gnl|my_center|LOCUS_13480 8626 8883 gene locus_tag LOCUS_13490 8626 8883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_13490 9394 9131 gene locus_tag LOCUS_13500 9394 9131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13500 9299 10357 gene locus_tag LOCUS_13510 9299 10357 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259009.1 protein_id gnl|my_center|LOCUS_13510 10831 10343 gene locus_tag LOCUS_13520 10831 10343 CDS product flavodoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948700.1 protein_id gnl|my_center|LOCUS_13520 >Feature sequence065 439 2796 gene locus_tag LOCUS_13530 439 2796 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680747.1 protein_id gnl|my_center|LOCUS_13530 2793 3551 gene locus_tag LOCUS_13540 2793 3551 CDS product outer membrane lipoprotein-sorting protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002673490.1 protein_id gnl|my_center|LOCUS_13540 3554 4894 gene locus_tag LOCUS_13550 3554 4894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13550 4931 5848 gene locus_tag LOCUS_13560 4931 5848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13560 6227 5829 gene locus_tag LOCUS_13570 6227 5829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13570 7087 6224 gene locus_tag LOCUS_13580 7087 6224 CDS product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927154.1 protein_id gnl|my_center|LOCUS_13580 7844 7080 gene locus_tag LOCUS_13590 7844 7080 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020083.1 protein_id gnl|my_center|LOCUS_13590 8716 7841 gene locus_tag LOCUS_13600 8716 7841 CDS product zinc ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_165439262.1 protein_id gnl|my_center|LOCUS_13600 8981 9493 gene locus_tag LOCUS_13610 8981 9493 CDS product ferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459551.1 protein_id gnl|my_center|LOCUS_13610 9560 10396 gene locus_tag LOCUS_13620 9560 10396 CDS product pirin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460667.1 protein_id gnl|my_center|LOCUS_13620 10680 10423 gene locus_tag LOCUS_13630 10680 10423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13630 >Feature sequence066 <1 927 gene locus_tag LOCUS_13640 <1 927 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011022102.1:class I SAM-dependent DNA methyltransferase 1094 2578 gene locus_tag LOCUS_13650 gene gltX 1094 2578 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002665196.1 protein_id gnl|my_center|LOCUS_13650 2579 3916 gene locus_tag LOCUS_13660 2579 3916 CDS product glycine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002684564.1 protein_id gnl|my_center|LOCUS_13660 3913 5166 gene locus_tag LOCUS_13670 gene tyrS 3913 5166 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682133.1 protein_id gnl|my_center|LOCUS_13670 5215 6168 gene locus_tag LOCUS_13680 5215 6168 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948969.1 protein_id gnl|my_center|LOCUS_13680 6178 6951 gene locus_tag LOCUS_13690 6178 6951 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393480.1 protein_id gnl|my_center|LOCUS_13690 6948 7667 gene locus_tag LOCUS_13700 6948 7667 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897909.1 protein_id gnl|my_center|LOCUS_13700 8037 7657 gene locus_tag LOCUS_13710 8037 7657 CDS product desulfoferrodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004453642.1 protein_id gnl|my_center|LOCUS_13710 9129 8092 gene locus_tag LOCUS_13720 gene mtnA 9129 8092 CDS product S-methyl-5-thioribose-1-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_166394793.1 protein_id gnl|my_center|LOCUS_13720 10421 9144 gene locus_tag LOCUS_13730 10421 9144 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392478.1 protein_id gnl|my_center|LOCUS_13730 <11499 10445 gene locus_tag LOCUS_13740 <11499 10445 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002682243.1:AMP-binding protein >Feature sequence067 31 180 gene locus_tag LOCUS_13750 31 180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13750 221 481 gene locus_tag LOCUS_13760 221 481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13760 474 3164 gene locus_tag LOCUS_13770 474 3164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13770 3217 3546 gene locus_tag LOCUS_13780 3217 3546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13780 3548 3799 gene locus_tag LOCUS_13790 3548 3799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13790 3796 4029 gene locus_tag LOCUS_13800 3796 4029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13800 4039 4416 gene locus_tag LOCUS_13810 4039 4416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13810 4398 4643 gene locus_tag LOCUS_13820 4398 4643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13820 4634 6031 gene locus_tag LOCUS_13830 4634 6031 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012972453.1 protein_id gnl|my_center|LOCUS_13830 6042 6542 gene locus_tag LOCUS_13840 6042 6542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13840 6539 6868 gene locus_tag LOCUS_13850 6539 6868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13850 6858 7223 gene locus_tag LOCUS_13860 6858 7223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13860 7304 7429 gene locus_tag LOCUS_13870 7304 7429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13870 7440 7874 gene locus_tag LOCUS_13880 7440 7874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13880 7879 8547 gene locus_tag LOCUS_13890 7879 8547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13890 8528 8929 gene locus_tag LOCUS_13900 8528 8929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13900 8919 9209 gene locus_tag LOCUS_13910 8919 9209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13910 9206 9463 gene locus_tag LOCUS_13920 9206 9463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13920 9460 9849 gene locus_tag LOCUS_13930 9460 9849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13930 9846 10103 gene locus_tag LOCUS_13940 9846 10103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13940 10145 11215 gene locus_tag LOCUS_13950 10145 11215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13950 >Feature sequence068 2469 874 gene locus_tag LOCUS_13960 2469 874 CDS product oligopeptide transporter, OPT family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010904125.1 protein_id gnl|my_center|LOCUS_13960 2646 3104 gene locus_tag LOCUS_13970 2646 3104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13970 4311 3151 gene locus_tag LOCUS_13980 gene hflX 4311 3151 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002667011.1 protein_id gnl|my_center|LOCUS_13980 4529 5635 gene locus_tag LOCUS_13990 gene ychF 4529 5635 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002666350.1 protein_id gnl|my_center|LOCUS_13990 6344 5637 gene locus_tag LOCUS_14000 6344 5637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14000 6714 7394 gene locus_tag LOCUS_14010 6714 7394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14010 7651 10176 gene locus_tag LOCUS_14020 gene topA 7651 10176 CDS product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057718.1 protein_id gnl|my_center|LOCUS_14020 10193 11125 gene locus_tag LOCUS_14030 10193 11125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14030 >Feature sequence069 2687 1293 gene locus_tag LOCUS_14040 2687 1293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14040 3511 2759 gene locus_tag LOCUS_14050 3511 2759 CDS product tRNA 2-thiocytidine(32) synthetase TtcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869547.1 protein_id gnl|my_center|LOCUS_14050 4716 3508 gene locus_tag LOCUS_14060 4716 3508 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002677985.1 protein_id gnl|my_center|LOCUS_14060 5215 5604 gene locus_tag LOCUS_14070 5215 5604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14070 5836 5594 gene locus_tag LOCUS_14080 5836 5594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14080 5991 6581 gene locus_tag LOCUS_14090 5991 6581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14090 6725 7627 gene locus_tag LOCUS_14100 6725 7627 CDS product 1,4-dihydroxy-2-naphthoate polyprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000070966.1 protein_id gnl|my_center|LOCUS_14100 8925 7690 gene locus_tag LOCUS_14110 8925 7690 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462130.1 protein_id gnl|my_center|LOCUS_14110 8907 9164 gene locus_tag LOCUS_14120 8907 9164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14120 10182 9172 gene locus_tag LOCUS_14130 gene ccpA 10182 9172 CDS product catabolite control protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001103304.1 protein_id gnl|my_center|LOCUS_14130 11293 10172 gene locus_tag LOCUS_14140 11293 10172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14140 >Feature sequence070 2301 382 gene locus_tag LOCUS_14150 gene pflB 2301 382 CDS product formate C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056834.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14150 2582 2313 gene locus_tag LOCUS_14160 2582 2313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14160 2697 3416 gene locus_tag LOCUS_14170 2697 3416 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461647.1 protein_id gnl|my_center|LOCUS_14170 3946 3413 gene locus_tag LOCUS_14180 3946 3413 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003493254.1 protein_id gnl|my_center|LOCUS_14180 4434 3955 gene locus_tag LOCUS_14190 4434 3955 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393698.1 protein_id gnl|my_center|LOCUS_14190 4640 5083 gene locus_tag LOCUS_14200 4640 5083 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531344.1 protein_id gnl|my_center|LOCUS_14200 5190 6293 gene locus_tag LOCUS_14210 5190 6293 CDS product DUF438 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944154.1 protein_id gnl|my_center|LOCUS_14210 6334 7494 gene locus_tag LOCUS_14220 6334 7494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14220 7896 7648 gene locus_tag LOCUS_14230 7896 7648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14230 8882 7905 gene locus_tag LOCUS_14240 8882 7905 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002372605.1 protein_id gnl|my_center|LOCUS_14240 10880 8886 gene locus_tag LOCUS_14250 10880 8886 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003726299.1 protein_id gnl|my_center|LOCUS_14250 >Feature sequence071 86 925 gene locus_tag LOCUS_14260 86 925 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776898.1 protein_id gnl|my_center|LOCUS_14260 930 2870 gene locus_tag LOCUS_14270 930 2870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14270 2894 4624 gene locus_tag LOCUS_14280 2894 4624 CDS product glycoside hydrolase family 2 TIM barrel-domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201936.1 protein_id gnl|my_center|LOCUS_14280 4895 4677 gene locus_tag LOCUS_14290 4895 4677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_14290 5701 6831 gene locus_tag LOCUS_14300 gene ablA 5701 6831 CDS product lysine 2,3-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902971.1 protein_id gnl|my_center|LOCUS_14300 6825 7811 gene locus_tag LOCUS_14310 6825 7811 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838603.1 protein_id gnl|my_center|LOCUS_14310 7799 8746 gene locus_tag LOCUS_14320 7799 8746 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327978.1 protein_id gnl|my_center|LOCUS_14320 8748 9248 gene locus_tag LOCUS_14330 8748 9248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14330 10178 9270 gene locus_tag LOCUS_14340 10178 9270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14340 <10882 10178 gene locus_tag LOCUS_14350 <10882 10178 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000846238.1:ADP-ribosylglycohydrolase family protein >Feature sequence072 1507 185 gene locus_tag LOCUS_14360 1507 185 CDS product glycoside hydrolase family 32 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_055010987.1 protein_id gnl|my_center|LOCUS_14360 2788 1691 gene locus_tag LOCUS_14370 2788 1691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14370 2715 2993 gene locus_tag LOCUS_14380 2715 2993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14380 3542 3081 gene locus_tag LOCUS_14390 3542 3081 CDS product macro domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068139.1 protein_id gnl|my_center|LOCUS_14390 3665 4648 gene locus_tag LOCUS_14400 3665 4648 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393756.1 protein_id gnl|my_center|LOCUS_14400 4759 6108 gene locus_tag LOCUS_14410 4759 6108 CDS product glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061331.1 protein_id gnl|my_center|LOCUS_14410 6108 7037 gene locus_tag LOCUS_14420 6108 7037 CDS product carbohydrate kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061332.1 protein_id gnl|my_center|LOCUS_14420 7030 7926 gene locus_tag LOCUS_14430 7030 7926 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002939305.1 protein_id gnl|my_center|LOCUS_14430 7923 8750 gene locus_tag LOCUS_14440 7923 8750 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804269.1 protein_id gnl|my_center|LOCUS_14440 8761 9438 gene locus_tag LOCUS_14450 8761 9438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14450 9487 10743 gene locus_tag LOCUS_14460 9487 10743 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012774915.1 protein_id gnl|my_center|LOCUS_14460 >Feature sequence073 645 178 gene locus_tag LOCUS_14470 645 178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14470 1580 642 gene locus_tag LOCUS_14480 1580 642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14480 1975 1628 gene locus_tag LOCUS_14490 1975 1628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14490 2121 3053 gene locus_tag LOCUS_14500 2121 3053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14500 4254 3220 gene locus_tag LOCUS_14510 4254 3220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14510 5718 4507 gene locus_tag LOCUS_14520 5718 4507 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017115.1 protein_id gnl|my_center|LOCUS_14520 6363 7298 gene locus_tag LOCUS_14530 6363 7298 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722709.1 protein_id gnl|my_center|LOCUS_14530 7308 8162 gene locus_tag LOCUS_14540 7308 8162 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257156.1 protein_id gnl|my_center|LOCUS_14540 8220 9503 gene locus_tag LOCUS_14550 8220 9503 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257157.1 protein_id gnl|my_center|LOCUS_14550 9665 9516 gene locus_tag LOCUS_14560 9665 9516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14560 9607 10377 gene locus_tag LOCUS_14570 9607 10377 CDS product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047983.1 protein_id gnl|my_center|LOCUS_14570 >Feature sequence074 446 1618 gene locus_tag LOCUS_14580 446 1618 CDS product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211128.1 protein_id gnl|my_center|LOCUS_14580 1615 2799 gene locus_tag LOCUS_14590 1615 2799 CDS product mannitol-1-phosphate 5-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016349320.1 protein_id gnl|my_center|LOCUS_14590 2878 3405 gene locus_tag LOCUS_14600 2878 3405 CDS product asparaginase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391477.1 protein_id gnl|my_center|LOCUS_14600 4438 3500 gene locus_tag LOCUS_14610 4438 3500 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_125082658.1 note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_14610 5162 4440 gene locus_tag LOCUS_14620 5162 4440 CDS product ThuA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086177.1 protein_id gnl|my_center|LOCUS_14620 5459 5671 gene locus_tag LOCUS_14630 5459 5671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_14630 5672 6928 gene locus_tag LOCUS_14640 5672 6928 CDS product putative DNA binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068837.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_14640 7406 6915 gene locus_tag LOCUS_14650 7406 6915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14650 7566 7441 gene locus_tag LOCUS_14660 7566 7441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14660 8713 7577 gene locus_tag LOCUS_14670 8713 7577 CDS product sodium ion-translocating decarboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002991766.1 protein_id gnl|my_center|LOCUS_14670 10023 8854 gene locus_tag LOCUS_14680 10023 8854 CDS product IS4 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108005.1 protein_id gnl|my_center|LOCUS_14680 10501 10259 gene locus_tag LOCUS_14690 10501 10259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14690 >Feature sequence075 1218 670 gene locus_tag LOCUS_14700 1218 670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14700 1459 1211 gene locus_tag LOCUS_14710 1459 1211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14710 1671 1459 gene locus_tag LOCUS_14720 1671 1459 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870276.1 protein_id gnl|my_center|LOCUS_14720 2121 3383 gene locus_tag LOCUS_14730 2121 3383 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546576.1 protein_id gnl|my_center|LOCUS_14730 5331 3493 gene locus_tag LOCUS_14740 5331 3493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14740 6632 5493 gene locus_tag LOCUS_14750 6632 5493 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957791.1 protein_id gnl|my_center|LOCUS_14750 6936 7496 gene locus_tag LOCUS_14760 6936 7496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14760 7487 8170 gene locus_tag LOCUS_14770 7487 8170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14770 8464 8282 gene locus_tag LOCUS_14780 8464 8282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14780 9734 8415 gene locus_tag LOCUS_14790 9734 8415 CDS product putative DNA binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068837.1 protein_id gnl|my_center|LOCUS_14790 9762 9767 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence076 363 184 gene locus_tag LOCUS_14800 363 184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14800 686 375 gene locus_tag LOCUS_14810 686 375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14810 1091 747 gene locus_tag LOCUS_14820 1091 747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14820 1762 1103 gene locus_tag LOCUS_14830 gene pspA 1762 1103 CDS product phage shock protein PspA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000511000.1 protein_id gnl|my_center|LOCUS_14830 1973 2974 gene locus_tag LOCUS_14840 gene pspF 1973 2974 CDS product phage shock protein operon transcriptional activator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096402.1 protein_id gnl|my_center|LOCUS_14840 3192 3004 gene locus_tag LOCUS_14850 3192 3004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14850 3884 3189 gene locus_tag LOCUS_14860 gene pspA 3884 3189 CDS product phage shock protein PspA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_081428804.1 protein_id gnl|my_center|LOCUS_14860 4104 4793 gene locus_tag LOCUS_14870 gene rsmI 4104 4793 CDS product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681097.1 protein_id gnl|my_center|LOCUS_14870 4777 5553 gene locus_tag LOCUS_14880 4777 5553 CDS product TrmH family RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002673320.1 protein_id gnl|my_center|LOCUS_14880 5550 6914 gene locus_tag LOCUS_14890 5550 6914 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051187.1 protein_id gnl|my_center|LOCUS_14890 8909 6897 gene locus_tag LOCUS_14900 8909 6897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14900 8956 9738 gene locus_tag LOCUS_14910 8956 9738 CDS product Nif3-like dinuclear metal center hexameric protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480305.1 protein_id gnl|my_center|LOCUS_14910 9751 10272 gene locus_tag LOCUS_14920 gene lspA 9751 10272 CDS product signal peptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680623.1 protein_id gnl|my_center|LOCUS_14920 >Feature sequence077 173 781 gene locus_tag LOCUS_14930 gene hisIE 173 781 CDS product bifunctional phosphoribosyl-AMP cyclohydrolase/phosphoribosyl-ATP diphosphatase HisIE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762399.1 protein_id gnl|my_center|LOCUS_14930 977 1864 gene locus_tag LOCUS_14940 977 1864 CDS product D-hexose-6-phosphate mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000365085.1 protein_id gnl|my_center|LOCUS_14940 3088 2012 gene locus_tag LOCUS_14950 3088 2012 CDS product tripeptidase T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230352.1 protein_id gnl|my_center|LOCUS_14950 4271 3102 gene locus_tag LOCUS_14960 4271 3102 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870366.1 protein_id gnl|my_center|LOCUS_14960 5508 4258 gene locus_tag LOCUS_14970 5508 4258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14970 6497 5505 gene locus_tag LOCUS_14980 6497 5505 CDS product ADP-ribosylglycohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230702.1 protein_id gnl|my_center|LOCUS_14980 7276 6494 gene locus_tag LOCUS_14990 7276 6494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14990 8611 7343 gene locus_tag LOCUS_15000 8611 7343 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009898649.1 protein_id gnl|my_center|LOCUS_15000 9465 8638 gene locus_tag LOCUS_15010 9465 8638 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949071.1 protein_id gnl|my_center|LOCUS_15010 <10249 9470 gene locus_tag LOCUS_15020 <10249 9470 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_103759610.1:sugar ABC transporter permease >Feature sequence078 600 148 gene locus_tag LOCUS_15030 600 148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15030 813 740 gene locus_tag LOCUS_t00310 813 740 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 891 1691 gene locus_tag LOCUS_15040 891 1691 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250057.1 protein_id gnl|my_center|LOCUS_15040 1676 2383 gene locus_tag LOCUS_15050 1676 2383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15050 2386 2934 gene locus_tag LOCUS_15060 2386 2934 CDS product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881124.1 protein_id gnl|my_center|LOCUS_15060 3335 2928 gene locus_tag LOCUS_15070 3335 2928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15070 4931 3444 gene locus_tag LOCUS_15080 gene gltA 4931 3444 CDS product NADPH-dependent glutamate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681438.1 protein_id gnl|my_center|LOCUS_15080 5784 4936 gene locus_tag LOCUS_15090 5784 4936 CDS product sulfide/dihydroorotate dehydrogenase-like FAD/NAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002676763.1 protein_id gnl|my_center|LOCUS_15090 5931 6275 gene locus_tag LOCUS_15100 5931 6275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15100 6761 6339 gene locus_tag LOCUS_15110 6761 6339 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002670499.1 protein_id gnl|my_center|LOCUS_15110 8203 7046 gene locus_tag LOCUS_15120 8203 7046 CDS product phosphoribosylaminoimidazolecarboxamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788311.1 protein_id gnl|my_center|LOCUS_15120 8865 8185 gene locus_tag LOCUS_15130 8865 8185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15130 9272 8862 gene locus_tag LOCUS_15140 9272 8862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15140 <10115 9308 gene locus_tag LOCUS_15150 <10115 9308 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011393777.1:AmmeMemoRadiSam system radical SAM enzyme >Feature sequence079 39 851 gene locus_tag LOCUS_15160 gene ccsB 39 851 CDS product c-type cytochrome biogenesis protein CcsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393687.1 protein_id gnl|my_center|LOCUS_15160 1132 1713 gene locus_tag LOCUS_15170 1132 1713 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081283.1 protein_id gnl|my_center|LOCUS_15170 2047 1682 gene locus_tag LOCUS_15180 2047 1682 CDS product arsenate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459556.1 protein_id gnl|my_center|LOCUS_15180 2213 3562 gene locus_tag LOCUS_15190 gene tig 2213 3562 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679366.1 protein_id gnl|my_center|LOCUS_15190 3648 4259 gene locus_tag LOCUS_15200 gene clpP 3648 4259 CDS product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679367.1 protein_id gnl|my_center|LOCUS_15200 4259 5488 gene locus_tag LOCUS_15210 gene clpX 4259 5488 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679368.1 protein_id gnl|my_center|LOCUS_15210 5451 6476 gene locus_tag LOCUS_15220 5451 6476 CDS product bifunctional oligoribonuclease/PAP phosphatase NrnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679142.1 protein_id gnl|my_center|LOCUS_15220 6526 7527 gene locus_tag LOCUS_15230 6526 7527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15230 7532 8137 gene locus_tag LOCUS_15240 gene rdgB 7532 8137 CDS product RdgB/HAM1 family non-canonical purine NTP pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957197.1 protein_id gnl|my_center|LOCUS_15240 8137 9915 gene locus_tag LOCUS_15250 gene pepF 8137 9915 CDS product oligoendopeptidase F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_044971600.1 protein_id gnl|my_center|LOCUS_15250 >Feature sequence080 283 1800 gene locus_tag LOCUS_15260 283 1800 CDS product 5'-nucleotidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000913782.1 protein_id gnl|my_center|LOCUS_15260 2142 3677 gene locus_tag LOCUS_15270 2142 3677 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390163.1 protein_id gnl|my_center|LOCUS_15270 3784 4974 gene locus_tag LOCUS_15280 3784 4974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15280 4971 6806 gene locus_tag LOCUS_15290 gene typA 4971 6806 CDS product translational GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939506.1 protein_id gnl|my_center|LOCUS_15290 7543 6791 gene locus_tag LOCUS_15300 7543 6791 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963545.1 protein_id gnl|my_center|LOCUS_15300 8587 7553 gene locus_tag LOCUS_15310 gene asnA 8587 7553 CDS product aspartate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108145.1 protein_id gnl|my_center|LOCUS_15310 8676 9293 gene locus_tag LOCUS_15320 8676 9293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15320 >Feature sequence081 131 724 gene locus_tag LOCUS_15330 131 724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15330 721 924 gene locus_tag LOCUS_15340 721 924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15340 1583 897 gene locus_tag LOCUS_15350 1583 897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15350 2651 1656 gene locus_tag LOCUS_15360 gene hflC 2651 1656 CDS product protease modulator HflC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678885.1 protein_id gnl|my_center|LOCUS_15360 3631 2648 gene locus_tag LOCUS_15370 gene hflK 3631 2648 CDS product FtsH protease activity modulator HflK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678884.1 protein_id gnl|my_center|LOCUS_15370 3733 5943 gene locus_tag LOCUS_15380 gene metG 3733 5943 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682373.1 protein_id gnl|my_center|LOCUS_15380 5955 6950 gene locus_tag LOCUS_15390 5955 6950 CDS product peptidoglycan bridge formation glycyltransferase FemA/FemB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462256.1 protein_id gnl|my_center|LOCUS_15390 8241 6916 gene locus_tag LOCUS_15400 gene murD 8241 6916 CDS product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256652.1 protein_id gnl|my_center|LOCUS_15400 9132 8836 gene locus_tag LOCUS_15410 9132 8836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15410 9519 9352 gene locus_tag LOCUS_15420 9519 9352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15420 >Feature sequence082 1156 74 gene locus_tag LOCUS_15430 1156 74 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902589.1 protein_id gnl|my_center|LOCUS_15430 2172 1246 gene locus_tag LOCUS_15440 gene pfkB 2172 1246 CDS product 1-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861506.1 protein_id gnl|my_center|LOCUS_15440 2963 2169 gene locus_tag LOCUS_15450 2963 2169 CDS product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355560.1 protein_id gnl|my_center|LOCUS_15450 3198 4037 gene locus_tag LOCUS_15460 3198 4037 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_069469570.1 protein_id gnl|my_center|LOCUS_15460 4080 4856 gene locus_tag LOCUS_15470 4080 4856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15470 4858 5409 gene locus_tag LOCUS_15480 4858 5409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15480 5888 5394 gene locus_tag LOCUS_15490 5888 5394 CDS product heme-degrading domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815953.1 protein_id gnl|my_center|LOCUS_15490 6860 5892 gene locus_tag LOCUS_15500 6860 5892 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053899.1 protein_id gnl|my_center|LOCUS_15500 7704 6940 gene locus_tag LOCUS_15510 gene fepC 7704 6940 CDS product iron-enterobactin ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000140641.1 protein_id gnl|my_center|LOCUS_15510 8677 7697 gene locus_tag LOCUS_15520 8677 7697 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948945.1 protein_id gnl|my_center|LOCUS_15520 9540 8674 gene locus_tag LOCUS_15530 9540 8674 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948944.1 protein_id gnl|my_center|LOCUS_15530 >Feature sequence083 1523 255 gene locus_tag LOCUS_15540 1523 255 CDS product DUF4143 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002668780.1 protein_id gnl|my_center|LOCUS_15540 2270 1665 gene locus_tag LOCUS_15550 2270 1665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15550 2796 3188 gene locus_tag LOCUS_15560 2796 3188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15560 4682 3549 gene locus_tag LOCUS_15570 4682 3549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15570 5713 4910 gene locus_tag LOCUS_15580 5713 4910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007056248.1 protein_id gnl|my_center|LOCUS_15580 6520 6897 gene locus_tag LOCUS_15590 6520 6897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15590 7138 7398 gene locus_tag LOCUS_15600 7138 7398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15600 7541 8056 gene locus_tag LOCUS_15610 7541 8056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15610 8703 8005 gene locus_tag LOCUS_15620 8703 8005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15620 >Feature sequence084 799 1572 gene locus_tag LOCUS_15630 799 1572 CDS product DUF72 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391812.1 protein_id gnl|my_center|LOCUS_15630 1565 2740 gene locus_tag LOCUS_15640 gene dinB 1565 2740 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_087861794.1 protein_id gnl|my_center|LOCUS_15640 2730 5678 gene locus_tag LOCUS_15650 2730 5678 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393372.1 protein_id gnl|my_center|LOCUS_15650 5650 6030 gene locus_tag LOCUS_15660 5650 6030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15660 6742 6020 gene locus_tag LOCUS_15670 6742 6020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15670 7052 6810 gene locus_tag LOCUS_15680 7052 6810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15680 7315 6998 gene locus_tag LOCUS_15690 7315 6998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15690 7946 7389 gene locus_tag LOCUS_15700 7946 7389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15700 7998 8576 gene locus_tag LOCUS_15710 7998 8576 CDS product protein-L-isoaspartate(D-aspartate) O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583746.1 protein_id gnl|my_center|LOCUS_15710 8641 8712 gene locus_tag LOCUS_t00320 8641 8712 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence085 312 947 gene locus_tag LOCUS_15720 312 947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15720 1787 924 gene locus_tag LOCUS_15730 1787 924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15730 1883 2308 gene locus_tag LOCUS_15740 1883 2308 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946940.1 protein_id gnl|my_center|LOCUS_15740 2951 2229 gene locus_tag LOCUS_15750 2951 2229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15750 2956 3678 gene locus_tag LOCUS_15760 2956 3678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15760 4131 4898 gene locus_tag LOCUS_15770 4131 4898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15770 4898 5389 gene locus_tag LOCUS_15780 4898 5389 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966865.1 protein_id gnl|my_center|LOCUS_15780 5466 5735 gene locus_tag LOCUS_15790 5466 5735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15790 6743 5739 gene locus_tag LOCUS_15800 6743 5739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15800 7877 6747 gene locus_tag LOCUS_15810 7877 6747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15810 9352 8003 gene locus_tag LOCUS_15820 9352 8003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15820 >Feature sequence086 942 1115 gene locus_tag LOCUS_15830 942 1115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15830 1673 1281 gene locus_tag LOCUS_15840 1673 1281 CDS product PIN domain nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971327.1 protein_id gnl|my_center|LOCUS_15840 1912 1670 gene locus_tag LOCUS_15850 1912 1670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15850 2640 1978 gene locus_tag LOCUS_15860 gene radC 2640 1978 CDS product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682286.1 protein_id gnl|my_center|LOCUS_15860 2623 3069 gene locus_tag LOCUS_15870 2623 3069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15870 4410 3070 gene locus_tag LOCUS_15880 4410 3070 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963751.1 protein_id gnl|my_center|LOCUS_15880 5219 4413 gene locus_tag LOCUS_15890 5219 4413 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963750.1 protein_id gnl|my_center|LOCUS_15890 6097 5216 gene locus_tag LOCUS_15900 6097 5216 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963749.1 protein_id gnl|my_center|LOCUS_15900 6253 8028 gene locus_tag LOCUS_15910 6253 8028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15910 <9430 8016 gene locus_tag LOCUS_15920 <9430 8016 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005454913.1:sodium/glutamate symporter >Feature sequence087 1651 83 gene locus_tag LOCUS_15930 1651 83 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15930 2861 1731 gene locus_tag LOCUS_15940 2861 1731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15940 3955 2879 gene locus_tag LOCUS_15950 3955 2879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15950 5553 4114 gene locus_tag LOCUS_15960 5553 4114 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791097.1 protein_id gnl|my_center|LOCUS_15960 8655 5680 gene locus_tag LOCUS_15970 8655 5680 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203530.1 protein_id gnl|my_center|LOCUS_15970 >Feature sequence088 471 319 gene locus_tag LOCUS_15980 471 319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15980 1469 531 gene locus_tag LOCUS_15990 1469 531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15990 3367 1538 gene locus_tag LOCUS_16000 3367 1538 CDS product phosphoenolpyruvate carboxykinase (GTP) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973998.1 protein_id gnl|my_center|LOCUS_16000 4028 3480 gene locus_tag LOCUS_16010 4028 3480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16010 4128 6431 gene locus_tag LOCUS_16020 4128 6431 CDS product U32 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943959.1 protein_id gnl|my_center|LOCUS_16020 6774 6316 gene locus_tag LOCUS_16030 6774 6316 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000409124.1 protein_id gnl|my_center|LOCUS_16030 7821 6802 gene locus_tag LOCUS_16040 gene asd 7821 6802 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879003.1 protein_id gnl|my_center|LOCUS_16040 8561 7944 gene locus_tag LOCUS_16050 8561 7944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16050 <9219 8558 gene locus_tag LOCUS_16060 <9219 8558 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012048012.1:DUF1538 domain-containing protein >Feature sequence089 1047 1595 gene locus_tag LOCUS_16070 1047 1595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16070 1707 3536 gene locus_tag LOCUS_16080 1707 3536 CDS product phosphoenolpyruvate carboxykinase (GTP) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973998.1 protein_id gnl|my_center|LOCUS_16080 3608 4546 gene locus_tag LOCUS_16090 3608 4546 CDS product WYL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940727.1 protein_id gnl|my_center|LOCUS_16090 4596 4748 gene locus_tag LOCUS_16100 4596 4748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16100 4882 6171 gene locus_tag LOCUS_16110 gene uraA 4882 6171 CDS product uracil permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949042.1 protein_id gnl|my_center|LOCUS_16110 7401 6247 gene locus_tag LOCUS_16120 7401 6247 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986283.1 protein_id gnl|my_center|LOCUS_16120 7683 8591 gene locus_tag LOCUS_16130 7683 8591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16130 <9198 8560 gene locus_tag LOCUS_16140 <9198 8560 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011860663.1:2-dehydropantoate 2-reductase >Feature sequence090 217 1563 gene locus_tag LOCUS_16150 217 1563 CDS product ectonucleotide pyrophosphatase/phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000356408.1 protein_id gnl|my_center|LOCUS_16150 1662 2528 gene locus_tag LOCUS_16160 1662 2528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16160 2622 4616 gene locus_tag LOCUS_16170 gene tkt 2622 4616 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000098601.1 protein_id gnl|my_center|LOCUS_16170 4724 5668 gene locus_tag LOCUS_16180 4724 5668 CDS product 2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963416.1 protein_id gnl|my_center|LOCUS_16180 5673 6596 gene locus_tag LOCUS_16190 5673 6596 CDS product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963688.1 protein_id gnl|my_center|LOCUS_16190 >Feature sequence091 <1 740 gene locus_tag LOCUS_16200 <1 740 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011836907.1:radical SAM family heme chaperone HemW 827 1573 gene locus_tag LOCUS_16210 827 1573 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002668967.1 protein_id gnl|my_center|LOCUS_16210 1579 2073 gene locus_tag LOCUS_16220 gene ruvC 1579 2073 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256932.1 protein_id gnl|my_center|LOCUS_16220 2070 2699 gene locus_tag LOCUS_16230 gene ruvA 2070 2699 CDS product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679554.1 protein_id gnl|my_center|LOCUS_16230 2709 3770 gene locus_tag LOCUS_16240 gene ruvB 2709 3770 CDS product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679608.1 protein_id gnl|my_center|LOCUS_16240 3745 4785 gene locus_tag LOCUS_16250 gene queA 3745 4785 CDS product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957235.1 protein_id gnl|my_center|LOCUS_16250 5386 4775 gene locus_tag LOCUS_16260 gene tmk 5386 4775 CDS product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957272.1 protein_id gnl|my_center|LOCUS_16260 >Feature sequence092 147 1022 gene locus_tag LOCUS_16270 147 1022 CDS product diacylglycerol kinase family lipid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258562.1 protein_id gnl|my_center|LOCUS_16270 1282 2706 gene locus_tag LOCUS_16280 1282 2706 CDS product trehalase family glycosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002671898.1 protein_id gnl|my_center|LOCUS_16280 2708 3472 gene locus_tag LOCUS_16290 2708 3472 CDS product TerB family tellurite resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388716.1 protein_id gnl|my_center|LOCUS_16290 4718 3465 gene locus_tag LOCUS_16300 4718 3465 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963666.1 protein_id gnl|my_center|LOCUS_16300 5359 4769 gene locus_tag LOCUS_16310 gene recR 5359 4769 CDS product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010956990.1 protein_id gnl|my_center|LOCUS_16310 5667 5362 gene locus_tag LOCUS_16320 5667 5362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16320 7298 5682 gene locus_tag LOCUS_16330 gene dnaX 7298 5682 CDS product DNA polymerase III subunit gamma/tau inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957269.1 protein_id gnl|my_center|LOCUS_16330 7419 8282 gene locus_tag LOCUS_16340 7419 8282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16340 8458 8372 gene locus_tag LOCUS_t00330 8458 8372 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 8568 8481 gene locus_tag LOCUS_t00340 8568 8481 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 8671 8598 gene locus_tag LOCUS_t00350 8671 8598 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 8773 8685 gene locus_tag LOCUS_t00360 8773 8685 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 8883 8797 gene locus_tag LOCUS_t00370 8883 8797 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence093 148 1083 gene locus_tag LOCUS_16350 148 1083 CDS product ADP-ribosylglycohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140115.1 protein_id gnl|my_center|LOCUS_16350 1673 1954 gene locus_tag LOCUS_16360 gene rpsF 1673 1954 CDS product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669351.1 protein_id gnl|my_center|LOCUS_16360 1976 2470 gene locus_tag LOCUS_16370 gene ssb 1976 2470 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669349.1 protein_id gnl|my_center|LOCUS_16370 2495 2791 gene locus_tag LOCUS_16380 gene rpsR 2495 2791 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669347.1 protein_id gnl|my_center|LOCUS_16380 2795 3766 gene locus_tag LOCUS_16390 2795 3766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16390 3770 4399 gene locus_tag LOCUS_16400 3770 4399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16400 4405 5790 gene locus_tag LOCUS_16410 gene dnaB 4405 5790 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669313.1 protein_id gnl|my_center|LOCUS_16410 7165 5780 gene locus_tag LOCUS_16420 gene rseP 7165 5780 CDS product RIP metalloprotease RseP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680259.1 protein_id gnl|my_center|LOCUS_16420 8262 7162 gene locus_tag LOCUS_16430 gene dxr 8262 7162 CDS product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680260.1 protein_id gnl|my_center|LOCUS_16430 <8930 8259 gene locus_tag LOCUS_16440 <8930 8259 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002667742.1:phosphatidate cytidylyltransferase >Feature sequence094 <1 644 gene locus_tag LOCUS_16450 <1 644 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002668261.1:UMP kinase 1278 616 gene locus_tag LOCUS_16460 1278 616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16460 1231 1605 gene locus_tag LOCUS_16470 1231 1605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16470 2281 1652 gene locus_tag LOCUS_16480 2281 1652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16480 2593 3780 gene locus_tag LOCUS_16490 2593 3780 CDS product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706729.1 protein_id gnl|my_center|LOCUS_16490 3777 4187 gene locus_tag LOCUS_16500 3777 4187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002556699.1 protein_id gnl|my_center|LOCUS_16500 5185 4337 gene locus_tag LOCUS_16510 5185 4337 CDS product pyridoxamine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964930.1 protein_id gnl|my_center|LOCUS_16510 5252 7096 gene locus_tag LOCUS_16520 5252 7096 CDS product phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682136.1 protein_id gnl|my_center|LOCUS_16520 7515 7093 gene locus_tag LOCUS_16530 7515 7093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16530 8827 7520 gene locus_tag LOCUS_16540 8827 7520 CDS product hexokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680422.1 protein_id gnl|my_center|LOCUS_16540 >Feature sequence095 1241 2176 gene locus_tag LOCUS_16550 1241 2176 CDS product lysine exporter LysO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000491116.1 protein_id gnl|my_center|LOCUS_16550 2601 2173 gene locus_tag LOCUS_16560 2601 2173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16560 2620 3315 gene locus_tag LOCUS_16570 2620 3315 CDS product SprT family zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810266.1 protein_id gnl|my_center|LOCUS_16570 3384 4595 gene locus_tag LOCUS_16580 3384 4595 CDS product FprA family A-type flavoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682387.1 protein_id gnl|my_center|LOCUS_16580 6775 5330 gene locus_tag LOCUS_16590 6775 5330 CDS product aminoacyl-histidine dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767909.1 protein_id gnl|my_center|LOCUS_16590 7979 6795 gene locus_tag LOCUS_16600 gene nagA 7979 6795 CDS product N-acetylglucosamine-6-phosphate deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889694.1 protein_id gnl|my_center|LOCUS_16600 <8571 8026 gene locus_tag LOCUS_16610 <8571 8026 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010964165.1:MATE family efflux transporter >Feature sequence096 1128 157 gene locus_tag LOCUS_16620 1128 157 CDS product zinc-dependent dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392012.1 protein_id gnl|my_center|LOCUS_16620 2121 1129 gene locus_tag LOCUS_16630 2121 1129 CDS product sugar-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067338.1 protein_id gnl|my_center|LOCUS_16630 2858 2124 gene locus_tag LOCUS_16640 gene lsrF 2858 2124 CDS product 3-hydroxy-5-phosphonooxypentane-2,4-dione thiolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000219772.1 protein_id gnl|my_center|LOCUS_16640 3090 3308 gene locus_tag LOCUS_16650 3090 3308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16650 3349 4554 gene locus_tag LOCUS_16660 3349 4554 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017115.1 protein_id gnl|my_center|LOCUS_16660 4705 5298 gene locus_tag LOCUS_16670 4705 5298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16670 6443 5292 gene locus_tag LOCUS_16680 6443 5292 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048446.1 protein_id gnl|my_center|LOCUS_16680 6529 7608 gene locus_tag LOCUS_16690 gene yedE 6529 7608 CDS product YedE family putative selenium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680420.1 protein_id gnl|my_center|LOCUS_16690 7598 7804 gene locus_tag LOCUS_16700 7598 7804 CDS product sulfurtransferase TusA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002667494.1 protein_id gnl|my_center|LOCUS_16700 7801 8040 gene locus_tag LOCUS_16710 7801 8040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16710 >Feature sequence097 187 1545 gene locus_tag LOCUS_16720 187 1545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16720 2131 1532 gene locus_tag LOCUS_16730 2131 1532 CDS product YigZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678865.1 protein_id gnl|my_center|LOCUS_16730 3009 2134 gene locus_tag LOCUS_16740 3009 2134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16740 3140 3808 gene locus_tag LOCUS_16750 gene deoC 3140 3808 CDS product deoxyribose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836882.1 protein_id gnl|my_center|LOCUS_16750 3795 4937 gene locus_tag LOCUS_16760 3795 4937 CDS product thymidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002657215.1 protein_id gnl|my_center|LOCUS_16760 5872 5003 gene locus_tag LOCUS_16770 5872 5003 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002285996.1 protein_id gnl|my_center|LOCUS_16770 5921 7321 gene locus_tag LOCUS_16780 5921 7321 CDS product glycoside hydrolase family 28 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286021.1 protein_id gnl|my_center|LOCUS_16780 >Feature sequence098 190 1524 gene locus_tag LOCUS_16790 190 1524 CDS product ISL3-like element IS1181 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001557163.1 protein_id gnl|my_center|LOCUS_16790 1819 3042 gene locus_tag LOCUS_16800 1819 3042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817204.1 protein_id gnl|my_center|LOCUS_16800 3099 3728 gene locus_tag LOCUS_16810 gene eamB 3099 3728 CDS product cysteine/O-acetylserine transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000188410.1 protein_id gnl|my_center|LOCUS_16810 3826 4545 gene locus_tag LOCUS_16820 3826 4545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16820 5881 4658 gene locus_tag LOCUS_16830 5881 4658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16830 6365 6829 gene locus_tag LOCUS_16840 6365 6829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16840 6982 6896 gene locus_tag LOCUS_t00380 6982 6896 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 7391 7828 gene locus_tag LOCUS_16850 7391 7828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16850 >Feature sequence099 798 1460 gene locus_tag LOCUS_16860 798 1460 CDS product class II aldolase/adducin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460450.1 protein_id gnl|my_center|LOCUS_16860 1678 2505 gene locus_tag LOCUS_16870 1678 2505 CDS product autoinducer 2 ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210043.1 protein_id gnl|my_center|LOCUS_16870 2596 4098 gene locus_tag LOCUS_16880 2596 4098 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210044.1 protein_id gnl|my_center|LOCUS_16880 4110 5141 gene locus_tag LOCUS_16890 4110 5141 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210045.1 protein_id gnl|my_center|LOCUS_16890 5138 6112 gene locus_tag LOCUS_16900 5138 6112 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210046.1 protein_id gnl|my_center|LOCUS_16900 6109 7527 gene locus_tag LOCUS_16910 6109 7527 CDS product rhamnulokinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582815.1 protein_id gnl|my_center|LOCUS_16910 >Feature sequence100 449 1090 gene locus_tag LOCUS_16920 449 1090 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062283627.1 protein_id gnl|my_center|LOCUS_16920 1087 1686 gene locus_tag LOCUS_16930 1087 1686 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393188.1 protein_id gnl|my_center|LOCUS_16930 1704 2591 gene locus_tag LOCUS_16940 1704 2591 CDS product glycine betaine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393187.1 protein_id gnl|my_center|LOCUS_16940 3420 2602 gene locus_tag LOCUS_16950 3420 2602 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682046.1 protein_id gnl|my_center|LOCUS_16950 3687 4760 gene locus_tag LOCUS_16960 3687 4760 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011943878.1 protein_id gnl|my_center|LOCUS_16960 4806 6209 gene locus_tag LOCUS_16970 gene purB 4806 6209 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438353.1 protein_id gnl|my_center|LOCUS_16970 6819 6199 gene locus_tag LOCUS_16980 6819 6199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16980 7751 6816 gene locus_tag LOCUS_16990 7751 6816 CDS product alanine--tRNA ligase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227734.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16990 7951 7685 gene locus_tag LOCUS_17000 7951 7685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17000 >Feature sequence101 124 1167 gene locus_tag LOCUS_17010 124 1167 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008363445.1 protein_id gnl|my_center|LOCUS_17010 1164 3461 gene locus_tag LOCUS_17020 1164 3461 CDS product S8 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011167180.1 protein_id gnl|my_center|LOCUS_17020 4019 3528 gene locus_tag LOCUS_17030 4019 3528 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393456.1 protein_id gnl|my_center|LOCUS_17030 4899 4012 gene locus_tag LOCUS_17040 gene xdhB 4899 4012 CDS product xanthine dehydrogenase FAD-binding subunit XdhB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393457.1 protein_id gnl|my_center|LOCUS_17040 7201 4913 gene locus_tag LOCUS_17050 gene xdhA 7201 4913 CDS product xanthine dehydrogenase molybdenum-binding subunit XdhA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393458.1 protein_id gnl|my_center|LOCUS_17050 >Feature sequence102 2052 1411 gene locus_tag LOCUS_17060 2052 1411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17060 3016 2099 gene locus_tag LOCUS_17070 3016 2099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17070 3388 3032 gene locus_tag LOCUS_17080 3388 3032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17080 3773 3378 gene locus_tag LOCUS_17090 3773 3378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17090 4209 3757 gene locus_tag LOCUS_17100 4209 3757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17100 4661 4206 gene locus_tag LOCUS_17110 4661 4206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17110 6023 4797 gene locus_tag LOCUS_17120 6023 4797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17120 6827 6042 gene locus_tag LOCUS_17130 6827 6042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17130 7861 6839 gene locus_tag LOCUS_17140 7861 6839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17140 >Feature sequence103 584 1573 gene locus_tag LOCUS_17150 584 1573 CDS product N-acetylglucosamine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963507.1 protein_id gnl|my_center|LOCUS_17150 4689 1537 gene locus_tag LOCUS_17160 gene lacZ 4689 1537 CDS product beta-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000177912.1 protein_id gnl|my_center|LOCUS_17160 5529 4717 gene locus_tag LOCUS_17170 5529 4717 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289130.1 protein_id gnl|my_center|LOCUS_17170 6404 5526 gene locus_tag LOCUS_17180 6404 5526 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037400851.1 protein_id gnl|my_center|LOCUS_17180 <7588 6479 gene locus_tag LOCUS_17190 <7588 6479 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012582886.1:sugar ABC transporter substrate-binding protein >Feature sequence104 2356 158 gene locus_tag LOCUS_17200 2356 158 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461874.1 protein_id gnl|my_center|LOCUS_17200 2556 2353 gene locus_tag LOCUS_17210 2556 2353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17210 2647 2718 gene locus_tag LOCUS_t00390 2647 2718 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 2951 2748 gene locus_tag LOCUS_17220 2951 2748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17220 3518 3988 gene locus_tag LOCUS_17230 3518 3988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17230 3919 4386 gene locus_tag LOCUS_17240 3919 4386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17240 4525 5769 gene locus_tag LOCUS_17250 gene dpaL 4525 5769 CDS product diaminopropionate ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869174.1 protein_id gnl|my_center|LOCUS_17250 6702 5770 gene locus_tag LOCUS_17260 6702 5770 CDS product auxin efflux carrier inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582699.1 protein_id gnl|my_center|LOCUS_17260 7338 7063 gene locus_tag LOCUS_17270 7338 7063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17270 >Feature sequence105 2169 376 gene locus_tag LOCUS_17280 2169 376 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679355.1 protein_id gnl|my_center|LOCUS_17280 3148 2225 gene locus_tag LOCUS_17290 3148 2225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17290 4429 3239 gene locus_tag LOCUS_17300 4429 3239 CDS product anaerobic nitric oxide reductase flavorubredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461629.1 protein_id gnl|my_center|LOCUS_17300 4908 4558 gene locus_tag LOCUS_17310 4908 4558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17310 5174 6331 gene locus_tag LOCUS_17320 5174 6331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17320 <7108 6414 gene locus_tag LOCUS_17330 <7108 6414 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011022343.1:helix-turn-helix domain-containing protein >Feature sequence106 2187 409 gene locus_tag LOCUS_17340 2187 409 CDS product ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250553.1 protein_id gnl|my_center|LOCUS_17340 2780 2184 gene locus_tag LOCUS_17350 2780 2184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17350 3092 2790 gene locus_tag LOCUS_17360 3092 2790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17360 3445 3095 gene locus_tag LOCUS_17370 3445 3095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17370 5462 3471 gene locus_tag LOCUS_17380 5462 3471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17380 6556 5459 gene locus_tag LOCUS_17390 6556 5459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17390 6879 6553 gene locus_tag LOCUS_17400 6879 6553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17400 >Feature sequence107 397 1001 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq ggcgatcatcacggtcgcggtacgacggc 2475 2945 gene locus_tag LOCUS_17410 2475 2945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17410 2949 4286 gene locus_tag LOCUS_17420 2949 4286 CDS product phosphomannomutase/phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028721.1 protein_id gnl|my_center|LOCUS_17420 4296 5288 gene locus_tag LOCUS_17430 gene galE 4296 5288 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931718.1 protein_id gnl|my_center|LOCUS_17430 5422 5349 gene locus_tag LOCUS_t00400 5422 5349 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 <7043 5571 gene locus_tag LOCUS_17440 <7043 5571 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_009903241.1:5'-nucleotidase C-terminal domain-containing protein >Feature sequence108 1983 988 gene locus_tag LOCUS_17450 1983 988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17450 2167 3636 gene locus_tag LOCUS_17460 gene istA 2167 3636 CDS product IS21 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015262274.1 protein_id gnl|my_center|LOCUS_17460 3629 4369 gene locus_tag LOCUS_17470 3629 4369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17470 4549 4812 gene locus_tag LOCUS_17480 4549 4812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17480 4793 4996 gene locus_tag LOCUS_17490 4793 4996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17490 5678 5406 gene locus_tag LOCUS_17500 5678 5406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17500 6105 5623 gene locus_tag LOCUS_17510 6105 5623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17510 >Feature sequence109 691 1479 gene locus_tag LOCUS_17520 691 1479 CDS product HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066916.1 protein_id gnl|my_center|LOCUS_17520 2145 1549 gene locus_tag LOCUS_17530 2145 1549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17530 3887 2142 gene locus_tag LOCUS_17540 gene thrS 3887 2142 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002665762.1 protein_id gnl|my_center|LOCUS_17540 4666 4211 gene locus_tag LOCUS_17550 4666 4211 CDS product GAF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000494340.1 protein_id gnl|my_center|LOCUS_17550 5331 4660 gene locus_tag LOCUS_17560 5331 4660 CDS product redox-sensing transcriptional repressor Rex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669725.1 protein_id gnl|my_center|LOCUS_17560 6155 5328 gene locus_tag LOCUS_17570 6155 5328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17570 >Feature sequence110 1374 661 gene locus_tag LOCUS_17580 1374 661 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680283.1 protein_id gnl|my_center|LOCUS_17580 2168 1371 gene locus_tag LOCUS_17590 2168 1371 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937856.1 protein_id gnl|my_center|LOCUS_17590 3304 2168 gene locus_tag LOCUS_17600 3304 2168 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869389.1 protein_id gnl|my_center|LOCUS_17600 4185 3304 gene locus_tag LOCUS_17610 4185 3304 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869388.1 protein_id gnl|my_center|LOCUS_17610 5533 4370 gene locus_tag LOCUS_17620 5533 4370 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869387.1 protein_id gnl|my_center|LOCUS_17620 >Feature sequence111 64 825 gene locus_tag LOCUS_17630 64 825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17630 1332 2471 gene locus_tag LOCUS_17640 1332 2471 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104822.1 protein_id gnl|my_center|LOCUS_17640 2468 2950 gene locus_tag LOCUS_17650 2468 2950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17650 2994 3620 gene locus_tag LOCUS_17660 2994 3620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015942932.1 protein_id gnl|my_center|LOCUS_17660 3666 4847 gene locus_tag LOCUS_17670 gene galK 3666 4847 CDS product galactokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011381253.1 protein_id gnl|my_center|LOCUS_17670 5577 4744 gene locus_tag LOCUS_17680 5577 4744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17680 >Feature sequence112 897 2132 gene locus_tag LOCUS_17690 897 2132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17690 2425 3657 gene locus_tag LOCUS_17700 2425 3657 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987056.1 protein_id gnl|my_center|LOCUS_17700 3754 4158 gene locus_tag LOCUS_17710 3754 4158 CDS product Fur family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880763.1 protein_id gnl|my_center|LOCUS_17710 4170 4712 gene locus_tag LOCUS_17720 4170 4712 CDS product rubrerythrin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418513.1 protein_id gnl|my_center|LOCUS_17720 <5550 4760 gene locus_tag LOCUS_17730 <5550 4760 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164926985.1:amidohydrolase family protein >Feature sequence113 969 160 gene locus_tag LOCUS_17740 969 160 CDS product NAD-dependent protein deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002675715.1 protein_id gnl|my_center|LOCUS_17740 2284 986 gene locus_tag LOCUS_17750 gene miaB 2284 986 CDS product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679246.1 protein_id gnl|my_center|LOCUS_17750 3234 2281 gene locus_tag LOCUS_17760 gene folD 3234 2281 CDS product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005780414.1 protein_id gnl|my_center|LOCUS_17760 3337 3930 gene locus_tag LOCUS_17770 3337 3930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17770 3941 5005 gene locus_tag LOCUS_17780 3941 5005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17780 5142 5480 gene locus_tag LOCUS_17790 5142 5480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17790 >Feature sequence114 684 2039 gene locus_tag LOCUS_17800 684 2039 CDS product phospholipase D family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980938.1 protein_id gnl|my_center|LOCUS_17800 2218 2060 gene locus_tag LOCUS_17810 2218 2060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17810 3573 2482 gene locus_tag LOCUS_17820 3573 2482 CDS product RNA-splicing ligase RtcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682062.1 protein_id gnl|my_center|LOCUS_17820 3966 4427 gene locus_tag LOCUS_17830 3966 4427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17830 >Feature sequence115 511 2109 gene locus_tag LOCUS_17840 511 2109 CDS product FGGY-family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878821.1 protein_id gnl|my_center|LOCUS_17840 2116 2574 gene locus_tag LOCUS_17850 2116 2574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17850 2571 4049 gene locus_tag LOCUS_17860 gene hemL 2571 4049 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209362.1 protein_id gnl|my_center|LOCUS_17860 4054 5205 gene locus_tag LOCUS_17870 4054 5205 CDS product class II aldolase/adducin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682124.1 protein_id gnl|my_center|LOCUS_17870 >Feature sequence116 62 940 gene locus_tag LOCUS_17880 62 940 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099264237.1 protein_id gnl|my_center|LOCUS_17880 2558 933 gene locus_tag LOCUS_17890 2558 933 CDS product SulP family inorganic anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002396652.1 protein_id gnl|my_center|LOCUS_17890 3398 2751 gene locus_tag LOCUS_17900 3398 2751 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815292.1 protein_id gnl|my_center|LOCUS_17900 3282 3506 gene locus_tag LOCUS_17910 3282 3506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17910 5143 3815 gene locus_tag LOCUS_17920 5143 3815 CDS product sn-glycerol-1-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082995.1 protein_id gnl|my_center|LOCUS_17920 >Feature sequence117 1131 1289 gene locus_tag LOCUS_17930 1131 1289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17930 1328 1606 gene locus_tag LOCUS_17940 1328 1606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17940 2575 1727 gene locus_tag LOCUS_17950 2575 1727 CDS product DUF4143 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068541.1 protein_id gnl|my_center|LOCUS_17950 2501 2710 gene locus_tag LOCUS_17960 2501 2710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17960 4148 2985 gene locus_tag LOCUS_17970 4148 2985 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957791.1 protein_id gnl|my_center|LOCUS_17970 4194 4373 gene locus_tag LOCUS_17980 4194 4373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17980 4425 4685 gene locus_tag LOCUS_17990 4425 4685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17990 4701 4883 gene locus_tag LOCUS_18000 4701 4883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18000 >Feature sequence118 320 1309 gene locus_tag LOCUS_18010 gene argF 320 1309 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861433.1 protein_id gnl|my_center|LOCUS_18010 1557 1967 gene locus_tag LOCUS_18020 1557 1967 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002670499.1 protein_id gnl|my_center|LOCUS_18020 2111 2704 gene locus_tag LOCUS_18030 2111 2704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18030 >Feature sequence119 1254 130 gene locus_tag LOCUS_18040 1254 130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18040 1398 1547 gene locus_tag LOCUS_18050 1398 1547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18050 1756 1550 gene locus_tag LOCUS_18060 1756 1550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18060 1688 2080 gene locus_tag LOCUS_18070 1688 2080 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082236.1 protein_id gnl|my_center|LOCUS_18070 2059 3024 gene locus_tag LOCUS_18080 2059 3024 CDS product NAD(P)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876007.1 protein_id gnl|my_center|LOCUS_18080 3222 4271 gene locus_tag LOCUS_18090 3222 4271 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004291480.1 protein_id gnl|my_center|LOCUS_18090 4392 4625 gene locus_tag LOCUS_18100 4392 4625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18100 <5250 4613 gene locus_tag LOCUS_18110 <5250 4613 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011016983.1:ATP/GTP-binding protein >Feature sequence120 346 1050 gene locus_tag LOCUS_18120 346 1050 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063699495.1 protein_id gnl|my_center|LOCUS_18120 1040 2431 gene locus_tag LOCUS_18130 1040 2431 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727913.1 protein_id gnl|my_center|LOCUS_18130 2442 3329 gene locus_tag LOCUS_18140 gene nanA 2442 3329 CDS product N-acetylneuraminate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000224714.1 protein_id gnl|my_center|LOCUS_18140 3343 4146 gene locus_tag LOCUS_18150 3343 4146 CDS product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337278.1 protein_id gnl|my_center|LOCUS_18150 4137 5132 gene locus_tag LOCUS_18160 4137 5132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18160 >Feature sequence121 2077 1343 gene locus_tag LOCUS_18170 2077 1343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18170 2775 2143 gene locus_tag LOCUS_18180 2775 2143 CDS product D-sedoheptulose 7-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966335.1 protein_id gnl|my_center|LOCUS_18180 3691 2768 gene locus_tag LOCUS_18190 3691 2768 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583252.1 protein_id gnl|my_center|LOCUS_18190 4724 3924 gene locus_tag LOCUS_18200 4724 3924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18200 >Feature sequence122 <1 620 gene locus_tag LOCUS_18210 <1 620 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010956682.1:IS30-like element ISTde2 family transposase 1399 668 gene locus_tag LOCUS_18220 1399 668 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013355958.1 protein_id gnl|my_center|LOCUS_18220 2667 1402 gene locus_tag LOCUS_18230 2667 1402 CDS product four-carbon acid sugar kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050298110.1 protein_id gnl|my_center|LOCUS_18230 3546 2734 gene locus_tag LOCUS_18240 3546 2734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18240 4496 3594 gene locus_tag LOCUS_18250 4496 3594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18250 <5145 4584 gene locus_tag LOCUS_18260 <5145 4584 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000349559.1:DUF4037 domain-containing protein >Feature sequence123 886 3057 gene locus_tag LOCUS_18270 886 3057 CDS product DUF4954 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682106.1 protein_id gnl|my_center|LOCUS_18270 3937 3029 gene locus_tag LOCUS_18280 3937 3029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18280 4066 3992 gene locus_tag LOCUS_t00410 4066 3992 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 4183 5076 gene locus_tag LOCUS_18290 4183 5076 CDS product sensor domain-containing diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704423.1 protein_id gnl|my_center|LOCUS_18290 >Feature sequence124 3910 2186 gene locus_tag LOCUS_18300 3910 2186 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015951.1 protein_id gnl|my_center|LOCUS_18300 <4878 4020 gene locus_tag LOCUS_18310 <4878 4020 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002678891.1:DUF2804 domain-containing protein >Feature sequence125 310 1818 gene locus_tag LOCUS_18320 gene istA 310 1818 CDS product IS21 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_100512979.1 protein_id gnl|my_center|LOCUS_18320 1815 2612 gene locus_tag LOCUS_18330 gene istB 1815 2612 CDS product IS21-like element ISBlo1 family helper ATPase IstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012472066.1 protein_id gnl|my_center|LOCUS_18330 4252 2693 gene locus_tag LOCUS_18340 4252 2693 CDS product IS3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_114145401.1 protein_id gnl|my_center|LOCUS_18340 >Feature sequence126 1312 932 gene locus_tag LOCUS_18350 gene rplL 1312 932 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815381.1 protein_id gnl|my_center|LOCUS_18350 1910 1380 gene locus_tag LOCUS_18360 gene rplJ 1910 1380 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974311.1 protein_id gnl|my_center|LOCUS_18360 2612 1923 gene locus_tag LOCUS_18370 gene rplA 2612 1923 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002667601.1 protein_id gnl|my_center|LOCUS_18370 3045 2614 gene locus_tag LOCUS_18380 gene rplK 3045 2614 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002667599.1 protein_id gnl|my_center|LOCUS_18380 3769 3209 gene locus_tag LOCUS_18390 gene nusG 3769 3209 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002667597.1 protein_id gnl|my_center|LOCUS_18390 3958 3779 gene locus_tag LOCUS_18400 gene secE 3958 3779 CDS product preprotein translocase subunit SecE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881261.1 protein_id gnl|my_center|LOCUS_18400 4069 3993 gene locus_tag LOCUS_t00420 4069 3993 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 4268 4092 gene locus_tag LOCUS_18410 gene rpmG 4268 4092 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002667594.1 protein_id gnl|my_center|LOCUS_18410 4403 4330 gene locus_tag LOCUS_t00430 4403 4330 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence127 1051 692 gene locus_tag LOCUS_18420 1051 692 CDS product NifB/NifX family molybdenum-iron cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015943770.1 protein_id gnl|my_center|LOCUS_18420 1410 1048 gene locus_tag LOCUS_18430 1410 1048 CDS product DUF134 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461119.1 protein_id gnl|my_center|LOCUS_18430 1532 1407 gene locus_tag LOCUS_18440 1532 1407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18440 2714 1977 gene locus_tag LOCUS_18450 2714 1977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18450 >Feature sequence128 2033 627 gene locus_tag LOCUS_18460 2033 627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18460 >Feature sequence129 1629 73 gene locus_tag LOCUS_18470 1629 73 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459110.1 protein_id gnl|my_center|LOCUS_18470 1817 2659 gene locus_tag LOCUS_18480 1817 2659 CDS product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296639.1 protein_id gnl|my_center|LOCUS_18480 2673 4118 gene locus_tag LOCUS_18490 gene gnd 2673 4118 CDS product decarboxylating NADP(+)-dependent phosphogluconate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263332.1 protein_id gnl|my_center|LOCUS_18490 >Feature sequence130 564 773 gene locus_tag LOCUS_18500 564 773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18500 867 2099 gene locus_tag LOCUS_18510 867 2099 CDS product CDP-glycerol glycerophosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679056.1 protein_id gnl|my_center|LOCUS_18510 2099 3919 gene locus_tag LOCUS_18520 2099 3919 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203684.1 protein_id gnl|my_center|LOCUS_18520 >Feature sequence131 2203 1250 gene locus_tag LOCUS_18530 2203 1250 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680321.1 protein_id gnl|my_center|LOCUS_18530 3151 2213 gene locus_tag LOCUS_18540 3151 2213 CDS product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681789.1 protein_id gnl|my_center|LOCUS_18540 3902 3135 gene locus_tag LOCUS_18550 3902 3135 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681790.1 protein_id gnl|my_center|LOCUS_18550 4013 4240 gene locus_tag LOCUS_18560 4013 4240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18560 >Feature sequence132 <1 750 gene locus_tag LOCUS_18570 <1 750 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012582802.1:ABC transporter substrate-binding protein 898 1845 gene locus_tag LOCUS_18580 gene arcC 898 1845 CDS product carbamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393607.1 protein_id gnl|my_center|LOCUS_18580 1835 2398 gene locus_tag LOCUS_18590 1835 2398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18590 3598 2354 gene locus_tag LOCUS_18600 3598 2354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18600 >Feature sequence133 1740 472 gene locus_tag LOCUS_18610 gene leuC 1740 472 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966450.1 protein_id gnl|my_center|LOCUS_18610 3348 1756 gene locus_tag LOCUS_18620 gene cimA 3348 1756 CDS product citramalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966451.1 protein_id gnl|my_center|LOCUS_18620 <4028 3341 gene locus_tag LOCUS_18630 <4028 3341 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011393738.1:2-isopropylmalate synthase >Feature sequence134 847 455 gene locus_tag LOCUS_18640 847 455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18640 924 1685 gene locus_tag LOCUS_18650 924 1685 CDS product aspartate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868491.1 protein_id gnl|my_center|LOCUS_18650 2329 1751 gene locus_tag LOCUS_18660 2329 1751 CDS product NADPH-dependent FMN reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530052.1 protein_id gnl|my_center|LOCUS_18660 2898 2527 gene locus_tag LOCUS_18670 2898 2527 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421988.1 protein_id gnl|my_center|LOCUS_18670 3364 2912 gene locus_tag LOCUS_18680 3364 2912 CDS product YhcH/YjgK/YiaL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964154.1 protein_id gnl|my_center|LOCUS_18680 >Feature sequence135 <1 1085 gene locus_tag LOCUS_18690 <1 1085 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008766459.1:cardiolipin synthase 1090 1620 gene locus_tag LOCUS_18700 1090 1620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18700 1633 2145 gene locus_tag LOCUS_18710 1633 2145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18710 2189 2527 gene locus_tag LOCUS_18720 2189 2527 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005467181.1 protein_id gnl|my_center|LOCUS_18720 3818 2628 gene locus_tag LOCUS_18730 3818 2628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18730 >Feature sequence136 122 442 gene locus_tag LOCUS_18740 122 442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18740 620 1906 gene locus_tag LOCUS_18750 620 1906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18750 1884 2543 gene locus_tag LOCUS_18760 1884 2543 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228286.1 protein_id gnl|my_center|LOCUS_18760 3034 2579 gene locus_tag LOCUS_18770 3034 2579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18770 3591 3046 gene locus_tag LOCUS_18780 3591 3046 CDS product glutathione peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005894834.1 protein_id gnl|my_center|LOCUS_18780 >Feature sequence137 1456 2481 gene locus_tag LOCUS_18790 gene mgrA 1456 2481 CDS product L-glyceraldehyde 3-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529545.1 protein_id gnl|my_center|LOCUS_18790 2564 3043 gene locus_tag LOCUS_18800 2564 3043 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918799.1 protein_id gnl|my_center|LOCUS_18800 3710 3036 gene locus_tag LOCUS_18810 gene pflA 3710 3036 CDS product pyruvate formate lyase 1-activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694108.1 protein_id gnl|my_center|LOCUS_18810 >Feature sequence138 277 981 gene locus_tag LOCUS_18820 277 981 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938382.1 protein_id gnl|my_center|LOCUS_18820 997 1701 gene locus_tag LOCUS_18830 997 1701 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938382.1 protein_id gnl|my_center|LOCUS_18830 1698 3179 gene locus_tag LOCUS_18840 1698 3179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18840 >Feature sequence139 149 1105 gene locus_tag LOCUS_18850 149 1105 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258638.1 protein_id gnl|my_center|LOCUS_18850 1113 2021 gene locus_tag LOCUS_18860 1113 2021 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678776.1 protein_id gnl|my_center|LOCUS_18860 2031 3002 gene locus_tag LOCUS_18870 2031 3002 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258124.1 protein_id gnl|my_center|LOCUS_18870 >Feature sequence140 2 700 gene locus_tag LOCUS_18880 2 700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18880 2018 609 gene locus_tag LOCUS_18890 2018 609 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958607.1 protein_id gnl|my_center|LOCUS_18890 2342 2932 gene locus_tag LOCUS_18900 2342 2932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18900 >Feature sequence141 1503 187 gene locus_tag LOCUS_18910 gene secY 1503 187 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002670031.1 protein_id gnl|my_center|LOCUS_18910 1949 1518 gene locus_tag LOCUS_18920 gene rplO 1949 1518 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357513.1 protein_id gnl|my_center|LOCUS_18920 2142 1951 gene locus_tag LOCUS_18930 gene rpmD 2142 1951 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003129921.1 protein_id gnl|my_center|LOCUS_18930 2674 2144 gene locus_tag LOCUS_18940 gene rpsE 2674 2144 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002670027.1 protein_id gnl|my_center|LOCUS_18940 3043 2684 gene locus_tag LOCUS_18950 gene rplR 3043 2684 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002670026.1 protein_id gnl|my_center|LOCUS_18950 3603 3058 gene locus_tag LOCUS_18960 gene rplF 3603 3058 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943471.1 protein_id gnl|my_center|LOCUS_18960 >Feature sequence142 469 1785 gene locus_tag LOCUS_18970 469 1785 CDS product IS110 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016551819.1 protein_id gnl|my_center|LOCUS_18970 1994 3580 gene locus_tag LOCUS_18980 1994 3580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18980 >Feature sequence143 816 346 gene locus_tag LOCUS_18990 gene smpB 816 346 CDS product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002668932.1 protein_id gnl|my_center|LOCUS_18990 2259 817 gene locus_tag LOCUS_19000 2259 817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19000 2323 3330 gene locus_tag LOCUS_19010 gene lepB 2323 3330 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002661914.1 protein_id gnl|my_center|LOCUS_19010 >Feature sequence144 774 2240 gene locus_tag LOCUS_19020 gene istA 774 2240 CDS product IS21 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_100512979.1 protein_id gnl|my_center|LOCUS_19020 2237 3031 gene locus_tag LOCUS_19030 gene istB 2237 3031 CDS product IS21-like element ISBlo1 family helper ATPase IstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012472066.1 protein_id gnl|my_center|LOCUS_19030 3021 3386 gene locus_tag LOCUS_19040 3021 3386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19040 >Feature sequence145 <1 1053 gene locus_tag LOCUS_19050 <1 1053 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011023993.1:glutamate 5-kinase 1043 1933 gene locus_tag LOCUS_19060 1043 1933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19060 1930 2673 gene locus_tag LOCUS_19070 1930 2673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19070 <3564 2670 gene locus_tag LOCUS_19080 <3564 2670 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002681057.1:nicotinate phosphoribosyltransferase >Feature sequence146 322 1074 gene locus_tag LOCUS_19090 gene map 322 1074 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002670900.1 protein_id gnl|my_center|LOCUS_19090 1087 1701 gene locus_tag LOCUS_19100 1087 1701 CDS product phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002657101.1 protein_id gnl|my_center|LOCUS_19100 2018 1842 gene locus_tag LOCUS_19110 2018 1842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19110 2188 3522 gene locus_tag LOCUS_19120 2188 3522 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068386.1 protein_id gnl|my_center|LOCUS_19120 >Feature sequence147 901 170 gene locus_tag LOCUS_19130 901 170 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642262.1 protein_id gnl|my_center|LOCUS_19130 1054 2160 gene locus_tag LOCUS_19140 1054 2160 CDS product anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053675.1 protein_id gnl|my_center|LOCUS_19140 >Feature sequence148 1621 1280 gene locus_tag LOCUS_19150 1621 1280 CDS product NifB/NifX family molybdenum-iron cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813896.1 protein_id gnl|my_center|LOCUS_19150 2448 1618 gene locus_tag LOCUS_19160 2448 1618 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925959.1 protein_id gnl|my_center|LOCUS_19160 2582 2445 gene locus_tag LOCUS_19170 2582 2445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19170 >Feature sequence149 669 1769 gene locus_tag LOCUS_19180 gene nupN 669 1769 CDS product guanosine ABC transporter substrate-binding protein NupN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228831.1 protein_id gnl|my_center|LOCUS_19180 1859 3388 gene locus_tag LOCUS_19190 1859 3388 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000456912.1 protein_id gnl|my_center|LOCUS_19190 >Feature sequence150 2511 424 gene locus_tag LOCUS_19200 2511 424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19200 <3356 2481 gene locus_tag LOCUS_19210 <3356 2481 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002680361.1:DNA-directed RNA polymerase subunit beta note possible pseudo, frameshifted >Feature sequence151 2322 1558 gene locus_tag LOCUS_19220 2322 1558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19220 2976 2410 gene locus_tag LOCUS_19230 2976 2410 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262803.1 protein_id gnl|my_center|LOCUS_19230 3130 3203 gene locus_tag LOCUS_t00440 3130 3203 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence152 371 1432 gene locus_tag LOCUS_19240 371 1432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19240 1635 1838 gene locus_tag LOCUS_19250 1635 1838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19250 1896 2210 gene locus_tag LOCUS_19260 1896 2210 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002655986.1 protein_id gnl|my_center|LOCUS_19260 >Feature sequence153 596 180 gene locus_tag LOCUS_19270 gene rplP 596 180 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810150.1 protein_id gnl|my_center|LOCUS_19270 1310 603 gene locus_tag LOCUS_19280 gene rpsC 1310 603 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002670002.1 protein_id gnl|my_center|LOCUS_19280 1676 1311 gene locus_tag LOCUS_19290 gene rplV 1676 1311 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002670000.1 protein_id gnl|my_center|LOCUS_19290 1948 1673 gene locus_tag LOCUS_19300 gene rpsS 1948 1673 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002557073.1 protein_id gnl|my_center|LOCUS_19300 2782 1958 gene locus_tag LOCUS_19310 gene rplB 2782 1958 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669998.1 protein_id gnl|my_center|LOCUS_19310 3099 2797 gene locus_tag LOCUS_19320 gene rplW 3099 2797 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869926.1 protein_id gnl|my_center|LOCUS_19320 >Feature sequence154 304 786 gene locus_tag LOCUS_19330 304 786 CDS product small multi-drug export protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_202318917.1 protein_id gnl|my_center|LOCUS_19330 793 2802 gene locus_tag LOCUS_19340 793 2802 CDS product UvrD-helicase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682194.1 protein_id gnl|my_center|LOCUS_19340 >Feature sequence155 448 296 gene locus_tag LOCUS_19350 448 296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19350 1608 553 gene locus_tag LOCUS_19360 1608 553 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902589.1 protein_id gnl|my_center|LOCUS_19360 <3200 1672 gene locus_tag LOCUS_19370 <3200 1672 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005896074.1:iron ABC transporter permease >Feature sequence156 374 2770 gene locus_tag LOCUS_19380 374 2770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19380 >Feature sequence157 <1 795 gene locus_tag LOCUS_19390 <1 795 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_116878287.1:HAD family hydrolase 1407 763 gene locus_tag LOCUS_19400 1407 763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19400 1554 2828 gene locus_tag LOCUS_19410 1554 2828 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584098.1 protein_id gnl|my_center|LOCUS_19410 >Feature sequence158 378 1613 gene locus_tag LOCUS_19420 gene pcnB 378 1613 CDS product polynucleotide adenylyltransferase PcnB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669419.1 protein_id gnl|my_center|LOCUS_19420 2485 1610 gene locus_tag LOCUS_19430 2485 1610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679695.1 protein_id gnl|my_center|LOCUS_19430 >Feature sequence159 1035 796 gene locus_tag LOCUS_19440 1035 796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19440 1491 1369 gene locus_tag LOCUS_19450 1491 1369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19450 1664 1494 gene locus_tag LOCUS_19460 1664 1494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19460 1645 1815 gene locus_tag LOCUS_19470 1645 1815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19470 2435 2127 gene locus_tag LOCUS_19480 2435 2127 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388057.1 protein_id gnl|my_center|LOCUS_19480 2767 2432 gene locus_tag LOCUS_19490 2767 2432 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074395.1 protein_id gnl|my_center|LOCUS_19490 >Feature sequence160 <1 732 gene locus_tag LOCUS_19500 <1 732 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011969389.1:iron ABC transporter permease 742 1827 gene locus_tag LOCUS_19510 742 1827 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968139.1 protein_id gnl|my_center|LOCUS_19510 1832 2710 gene locus_tag LOCUS_19520 1832 2710 CDS product PfkB family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083266.1 protein_id gnl|my_center|LOCUS_19520 >Feature sequence161 696 2477 gene locus_tag LOCUS_19530 696 2477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678730.1 protein_id gnl|my_center|LOCUS_19530 >Feature sequence162 >Feature sequence163 1562 537 gene locus_tag LOCUS_19540 gene selD 1562 537 CDS product selenide, water dikinase SelD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012159590.1 protein_id gnl|my_center|LOCUS_19540 >Feature sequence164 186 410 gene locus_tag LOCUS_19550 186 410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19550 403 747 gene locus_tag LOCUS_19560 gene tnpB 403 747 CDS product IS66 family insertion sequence element accessory protein TnpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393820.1 protein_id gnl|my_center|LOCUS_19560 857 1837 gene locus_tag LOCUS_19570 857 1837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19570 1821 2594 gene locus_tag LOCUS_19580 1821 2594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19580 >Feature sequence165 1537 176 gene locus_tag LOCUS_19590 1537 176 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005896573.1 protein_id gnl|my_center|LOCUS_19590 1773 1931 gene locus_tag LOCUS_19600 1773 1931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19600 1928 2674 gene locus_tag LOCUS_19610 1928 2674 CDS product zeta toxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266861.1 protein_id gnl|my_center|LOCUS_19610 >Feature sequence166 1514 849 gene locus_tag LOCUS_19620 1514 849 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016564.1 protein_id gnl|my_center|LOCUS_19620 2524 1511 gene locus_tag LOCUS_19630 2524 1511 CDS product methionine ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016565.1 protein_id gnl|my_center|LOCUS_19630 >Feature sequence167 683 195 gene locus_tag LOCUS_19640 683 195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19640 1655 729 gene locus_tag LOCUS_19650 1655 729 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037249854.1 protein_id gnl|my_center|LOCUS_19650 >Feature sequence168 455 2152 gene locus_tag LOCUS_19660 455 2152 CDS product glutamine--tRNA ligase/YqeY domain fusion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940210.1 protein_id gnl|my_center|LOCUS_19660 >Feature sequence169 233 931 gene locus_tag LOCUS_19670 233 931 CDS product transglutaminase-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813919.1 protein_id gnl|my_center|LOCUS_19670 2001 1186 gene locus_tag LOCUS_19680 2001 1186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19680 >Feature sequence170 <1 963 gene locus_tag LOCUS_19690 <1 963 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011393419.1:tryptophan--tRNA ligase 1166 2317 gene locus_tag LOCUS_19700 1166 2317 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969592.1 protein_id gnl|my_center|LOCUS_19700 >Feature sequence171 >Feature sequence172 2098 833 gene locus_tag LOCUS_19710 2098 833 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584153.1 protein_id gnl|my_center|LOCUS_19710 >Feature sequence173 959 684 gene locus_tag LOCUS_19720 959 684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19720 1181 1056 gene locus_tag LOCUS_19730 1181 1056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19730 2111 1284 gene locus_tag LOCUS_19740 2111 1284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_19740 2393 2205 gene locus_tag LOCUS_19750 2393 2205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19750 >Feature sequence174 1724 831 gene locus_tag LOCUS_19760 1724 831 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902562.1 protein_id gnl|my_center|LOCUS_19760 <2464 1721 gene locus_tag LOCUS_19770 <2464 1721 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011016361.1:ABC transporter permease >Feature sequence175 951 76 gene locus_tag LOCUS_19780 gene rfbA 951 76 CDS product glucose-1-phosphate thymidylyltransferase RfbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965630.1 protein_id gnl|my_center|LOCUS_19780 2062 974 gene locus_tag LOCUS_19790 2062 974 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202936.1 protein_id gnl|my_center|LOCUS_19790 >Feature sequence176 1295 339 gene locus_tag LOCUS_19800 1295 339 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000381071.1 protein_id gnl|my_center|LOCUS_19800 2020 1298 gene locus_tag LOCUS_19810 2020 1298 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812980.1 protein_id gnl|my_center|LOCUS_19810 >Feature sequence177 2178 400 gene locus_tag LOCUS_19820 2178 400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19820 >Feature sequence178 502 1488 gene locus_tag LOCUS_19830 502 1488 CDS product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064839.1 protein_id gnl|my_center|LOCUS_19830 1507 2235 gene locus_tag LOCUS_19840 1507 2235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19840 >Feature sequence179 2230 875 gene locus_tag LOCUS_19850 2230 875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19850 >Feature sequence180 2253 919 gene locus_tag LOCUS_19860 2253 919 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776896.1 protein_id gnl|my_center|LOCUS_19860 >Feature sequence181 1117 134 gene locus_tag LOCUS_19870 1117 134 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004079989.1 protein_id gnl|my_center|LOCUS_19870 1624 2097 gene locus_tag LOCUS_19880 1624 2097 CDS product Abortive infection protein AbiEi inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_072726816.1 protein_id gnl|my_center|LOCUS_19880 >Feature sequence182 1272 280 gene locus_tag LOCUS_19890 gene ccpA 1272 280 CDS product catabolite control protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837218.1 protein_id gnl|my_center|LOCUS_19890 >Feature sequence183 4 2103 gene locus_tag LOCUS_19900 gene gnpA 4 2103 CDS product 1,3-beta-galactosyl-N-acetylhexosamine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389962.1 protein_id gnl|my_center|LOCUS_19900 >Feature sequence184 68 202 gene locus_tag LOCUS_19910 68 202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19910 240 1598 gene locus_tag LOCUS_19920 240 1598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19920 >Feature sequence185 47 439 gene locus_tag LOCUS_19930 47 439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19930 <2243 452 gene locus_tag LOCUS_19940 <2243 452 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012544939.1:PAS domain S-box protein >Feature sequence186 253 1824 gene locus_tag LOCUS_19950 253 1824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19950 >Feature sequence187 1216 20 gene locus_tag LOCUS_19960 1216 20 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582704.1 protein_id gnl|my_center|LOCUS_19960 >Feature sequence188 810 487 gene locus_tag LOCUS_19970 810 487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19970 1578 826 gene locus_tag LOCUS_19980 gene tpiA 1578 826 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678731.1 protein_id gnl|my_center|LOCUS_19980 <2202 1580 gene locus_tag LOCUS_19990 <2202 1580 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002679428.1:phosphoglycerate kinase >Feature sequence189 1038 436 gene locus_tag LOCUS_20000 1038 436 CDS product RlmE family RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669797.1 protein_id gnl|my_center|LOCUS_20000 1612 2187 gene locus_tag LOCUS_20010 1612 2187 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002666681.1 protein_id gnl|my_center|LOCUS_20010 >Feature sequence190 257 1159 gene locus_tag LOCUS_20020 gene nanA 257 1159 CDS product N-acetylneuraminate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703468.1 protein_id gnl|my_center|LOCUS_20020 1721 1209 gene locus_tag LOCUS_20030 1721 1209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20030 1976 1725 gene locus_tag LOCUS_20040 1976 1725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20040 >Feature sequence191 <1 828 gene locus_tag LOCUS_20050 <1 828 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013530373.1:glutamine-hydrolyzing GMP synthase 1380 1748 gene locus_tag LOCUS_20060 1380 1748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20060 >Feature sequence192 452 1261 gene locus_tag LOCUS_20070 452 1261 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098118.1 protein_id gnl|my_center|LOCUS_20070 >Feature sequence193 >Feature sequence194 >Feature sequence195 <1 817 gene locus_tag LOCUS_20080 <1 817 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_064244086.1:ABC transporter substrate-binding protein 890 1768 gene locus_tag LOCUS_20090 890 1768 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064244087.1 protein_id gnl|my_center|LOCUS_20090 >Feature sequence196 119 1474 gene locus_tag LOCUS_20100 119 1474 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460406.1 protein_id gnl|my_center|LOCUS_20100 1579 1507 gene locus_tag LOCUS_t00450 1579 1507 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence197 1613 420 gene locus_tag LOCUS_20110 1613 420 CDS product D-threonate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000783298.1 protein_id gnl|my_center|LOCUS_20110 >Feature sequence198 325 852 gene locus_tag LOCUS_20120 325 852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20120 870 1592 gene locus_tag LOCUS_20130 870 1592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20130 >Feature sequence199 148 1947 gene locus_tag LOCUS_20140 148 1947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20140 >Feature sequence200 676 1002 gene locus_tag LOCUS_20150 676 1002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20150 999 1760 gene locus_tag LOCUS_20160 999 1760 CDS product GPMC system MBL fold metallohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943103.1 protein_id gnl|my_center|LOCUS_20160 >Feature sequence201 283 1380 gene locus_tag LOCUS_20170 283 1380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20170 >Feature sequence202 38 1618 gene locus_tag LOCUS_20180 38 1618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20180 >Feature sequence203 551 147 gene locus_tag LOCUS_20190 551 147 CDS product Fur family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880763.1 protein_id gnl|my_center|LOCUS_20190 1978 749 gene locus_tag LOCUS_20200 1978 749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20200 >Feature sequence204 446 778 gene locus_tag LOCUS_20210 446 778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_20210 1080 1238 gene locus_tag LOCUS_20220 1080 1238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20220 <2001 1197 gene locus_tag LOCUS_20230 <2001 1197 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011254509.1:FMN-dependent dehydrogenase >Feature sequence205 151 1185 gene locus_tag LOCUS_20240 151 1185 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461029.1 protein_id gnl|my_center|LOCUS_20240