>Feature sequence0001 6 1274 gene locus_tag LOCUS_00010 6 1274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00010 1775 3475 gene locus_tag LOCUS_00020 1775 3475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_00020 3542 7435 gene locus_tag LOCUS_00030 3542 7435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_00030 7432 11595 gene locus_tag LOCUS_00040 7432 11595 CDS product amino acid adenylation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_208353729.1 protein_id gnl|my_center|LOCUS_00040 11596 12408 gene locus_tag LOCUS_00050 11596 12408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00050 12405 13220 gene locus_tag LOCUS_00060 12405 13220 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867541.1 protein_id gnl|my_center|LOCUS_00060 13239 20747 gene locus_tag LOCUS_00070 13239 20747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00070 >Feature sequence0002 2746 605 gene locus_tag LOCUS_00080 2746 605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00080 2928 3611 gene locus_tag LOCUS_00090 2928 3611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00090 3994 5316 gene locus_tag LOCUS_00100 3994 5316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00100 5681 5986 gene locus_tag LOCUS_00110 5681 5986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00110 7466 6123 gene locus_tag LOCUS_00120 7466 6123 CDS product dicarboxylate/amino acid:cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089922.1 protein_id gnl|my_center|LOCUS_00120 8205 7576 gene locus_tag LOCUS_00130 8205 7576 CDS product cysteine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970378.1 protein_id gnl|my_center|LOCUS_00130 8844 8428 gene locus_tag LOCUS_00140 8844 8428 CDS product organic hydroperoxide resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084014.1 protein_id gnl|my_center|LOCUS_00140 9465 10550 gene locus_tag LOCUS_00150 gene ahr 9465 10550 CDS product NADPH-dependent aldehyde reductase Ahr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001309160.1 protein_id gnl|my_center|LOCUS_00150 10764 11480 gene locus_tag LOCUS_00160 10764 11480 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970398.1 protein_id gnl|my_center|LOCUS_00160 11651 11944 gene locus_tag LOCUS_00170 11651 11944 CDS product DUF1330 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267656.1 protein_id gnl|my_center|LOCUS_00170 12372 13121 gene locus_tag LOCUS_00180 12372 13121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00180 13864 13127 gene locus_tag LOCUS_00190 13864 13127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00190 14897 14019 gene locus_tag LOCUS_00200 14897 14019 CDS product Kdo hydroxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522262.1 protein_id gnl|my_center|LOCUS_00200 >Feature sequence0003 <1 2208 gene locus_tag LOCUS_00210 <1 2208 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_173072481.1:ATP-binding cassette domain-containing protein 3182 2640 gene locus_tag LOCUS_00220 3182 2640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00220 4953 3373 gene locus_tag LOCUS_00230 4953 3373 CDS product MDR family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942126.1 protein_id gnl|my_center|LOCUS_00230 6228 4960 gene locus_tag LOCUS_00240 6228 4960 CDS product HlyD family secretion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942127.1 protein_id gnl|my_center|LOCUS_00240 6874 6251 gene locus_tag LOCUS_00250 6874 6251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00250 8006 7365 gene locus_tag LOCUS_00260 8006 7365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00260 8165 8755 gene locus_tag LOCUS_00270 gene hisB 8165 8755 CDS product imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243389.1 protein_id gnl|my_center|LOCUS_00270 8764 9387 gene locus_tag LOCUS_00280 gene hisH 8764 9387 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880441.1 protein_id gnl|my_center|LOCUS_00280 9387 10133 gene locus_tag LOCUS_00290 gene hisA 9387 10133 CDS product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino]imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545163.1 protein_id gnl|my_center|LOCUS_00290 12444 10432 gene locus_tag LOCUS_00300 12444 10432 CDS product carboxy terminal-processing peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091593.1 protein_id gnl|my_center|LOCUS_00300 12699 13313 gene locus_tag LOCUS_00310 12699 13313 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460349.1 protein_id gnl|my_center|LOCUS_00310 13807 13382 gene locus_tag LOCUS_00320 gene fabZ 13807 13382 CDS product 3-hydroxyacyl-ACP dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723457.1 protein_id gnl|my_center|LOCUS_00320 14048 15220 gene locus_tag LOCUS_00330 gene sufS 14048 15220 CDS product cysteine desulfurase SufS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228604.1 protein_id gnl|my_center|LOCUS_00330 15397 15822 gene locus_tag LOCUS_00340 15397 15822 CDS product SUF system NifU family Fe-S cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141374.1 protein_id gnl|my_center|LOCUS_00340 15933 16526 gene locus_tag LOCUS_00350 15933 16526 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063921379.1 protein_id gnl|my_center|LOCUS_00350 16523 17437 gene locus_tag LOCUS_00360 16523 17437 CDS product haloalkane dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083907.1 protein_id gnl|my_center|LOCUS_00360 >Feature sequence0004 26 2353 gene locus_tag LOCUS_00370 26 2353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00370 3287 2967 gene locus_tag LOCUS_00380 3287 2967 CDS product type II toxin-antitoxin system PemK/MazF family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002214977.1 protein_id gnl|my_center|LOCUS_00380 3544 3281 gene locus_tag LOCUS_00390 3544 3281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00390 3655 3891 gene locus_tag LOCUS_00400 3655 3891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00400 7618 3902 gene locus_tag LOCUS_00410 7618 3902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00410 8098 8649 gene locus_tag LOCUS_00420 8098 8649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00420 9456 8938 gene locus_tag LOCUS_00430 9456 8938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00430 9622 9473 gene locus_tag LOCUS_00440 9622 9473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00440 10793 9744 gene locus_tag LOCUS_00450 10793 9744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533560.1 protein_id gnl|my_center|LOCUS_00450 12966 10756 gene locus_tag LOCUS_00460 12966 10756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00460 14185 13778 gene locus_tag LOCUS_00470 14185 13778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00470 15528 14548 gene locus_tag LOCUS_00480 15528 14548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00480 15951 15640 gene locus_tag LOCUS_00490 15951 15640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00490 16870 15998 gene locus_tag LOCUS_00500 16870 15998 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880876.1 protein_id gnl|my_center|LOCUS_00500 17410 17231 gene locus_tag LOCUS_00510 17410 17231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00510 17732 17544 gene locus_tag LOCUS_00520 17732 17544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00520 >Feature sequence0005 <1 566 gene locus_tag LOCUS_00530 <1 566 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010879940.1:UDP-glucose/GDP-mannose dehydrogenase family protein 1019 633 gene locus_tag LOCUS_00540 1019 633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00540 1094 1489 gene locus_tag LOCUS_00550 1094 1489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00550 1756 2532 gene locus_tag LOCUS_00560 1756 2532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00560 2802 3164 gene locus_tag LOCUS_00570 2802 3164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00570 3487 4458 gene locus_tag LOCUS_00580 3487 4458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00580 4658 5074 gene locus_tag LOCUS_00590 4658 5074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00590 6530 5097 gene locus_tag LOCUS_00600 6530 5097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00600 7194 6754 gene locus_tag LOCUS_00610 7194 6754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00610 7349 7609 gene locus_tag LOCUS_00620 7349 7609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00620 8544 7663 gene locus_tag LOCUS_00630 8544 7663 CDS product isocitrate lyase/PEP mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_225665727.1 protein_id gnl|my_center|LOCUS_00630 9454 8570 gene locus_tag LOCUS_00640 9454 8570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00640 10135 9869 gene locus_tag LOCUS_00650 10135 9869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00650 10944 10324 gene locus_tag LOCUS_00660 10944 10324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00660 11294 10941 gene locus_tag LOCUS_00670 11294 10941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00670 11501 12109 gene locus_tag LOCUS_00680 11501 12109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00680 12079 12831 gene locus_tag LOCUS_00690 12079 12831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00690 13047 14405 gene locus_tag LOCUS_00700 gene asnS 13047 14405 CDS product asparagine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937318.1 protein_id gnl|my_center|LOCUS_00700 <16490 14707 gene locus_tag LOCUS_00710 <16490 14707 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011267206.1:glutamine--tRNA ligase/YqeY domain fusion protein >Feature sequence0006 556 1674 gene locus_tag LOCUS_00720 556 1674 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257503.1 protein_id gnl|my_center|LOCUS_00720 1823 3196 gene locus_tag LOCUS_00730 1823 3196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00730 3261 4313 gene locus_tag LOCUS_00740 3261 4313 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775774.1 protein_id gnl|my_center|LOCUS_00740 4317 5435 gene locus_tag LOCUS_00750 4317 5435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00750 5432 6343 gene locus_tag LOCUS_00760 5432 6343 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024331.1 protein_id gnl|my_center|LOCUS_00760 6346 7581 gene locus_tag LOCUS_00770 6346 7581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00770 7670 8689 gene locus_tag LOCUS_00780 7670 8689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00780 8719 8793 gene locus_tag LOCUS_t00010 8719 8793 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 8941 10845 gene locus_tag LOCUS_00790 8941 10845 CDS product amidotransferase 1, exosortase A system-associated inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390869.1 protein_id gnl|my_center|LOCUS_00790 10897 11676 gene locus_tag LOCUS_00800 10897 11676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00800 11740 13560 gene locus_tag LOCUS_00810 11740 13560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00810 13815 14699 gene locus_tag LOCUS_00820 13815 14699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00820 >Feature sequence0007 938 378 gene locus_tag LOCUS_00830 938 378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00830 1282 3228 gene locus_tag LOCUS_00840 1282 3228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00840 4294 3506 gene locus_tag LOCUS_00850 4294 3506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00850 5185 4439 gene locus_tag LOCUS_00860 5185 4439 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097129.1 protein_id gnl|my_center|LOCUS_00860 5404 6129 gene locus_tag LOCUS_00870 5404 6129 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088678.1 protein_id gnl|my_center|LOCUS_00870 6297 6989 gene locus_tag LOCUS_00880 6297 6989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00880 7034 8782 gene locus_tag LOCUS_00890 7034 8782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00890 10383 9148 gene locus_tag LOCUS_00900 10383 9148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00900 11352 11606 gene locus_tag LOCUS_00910 11352 11606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00910 11687 11872 gene locus_tag LOCUS_00920 11687 11872 CDS product DUF1843 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188536.1 protein_id gnl|my_center|LOCUS_00920 11889 13307 gene locus_tag LOCUS_00930 11889 13307 CDS product GDL motif peptide-associated radical SAM/SPASM maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004200682.1 protein_id gnl|my_center|LOCUS_00930 14135 13353 gene locus_tag LOCUS_00940 14135 13353 CDS product sulfotransferase family 2 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192709.1 protein_id gnl|my_center|LOCUS_00940 14657 14166 gene locus_tag LOCUS_00950 14657 14166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00950 >Feature sequence0008 47 208 gene locus_tag LOCUS_00960 47 208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00960 1633 650 gene locus_tag LOCUS_00970 1633 650 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228552.1 protein_id gnl|my_center|LOCUS_00970 1735 2664 gene locus_tag LOCUS_00980 1735 2664 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000403856.1 protein_id gnl|my_center|LOCUS_00980 3549 3022 gene locus_tag LOCUS_00990 3549 3022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00990 3930 4559 gene locus_tag LOCUS_01000 3930 4559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01000 5076 7772 gene locus_tag LOCUS_01010 5076 7772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01010 7765 8166 gene locus_tag LOCUS_01020 7765 8166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01020 9049 8225 gene locus_tag LOCUS_01030 9049 8225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01030 9403 9212 gene locus_tag LOCUS_01040 9403 9212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01040 10053 9520 gene locus_tag LOCUS_01050 10053 9520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01050 10439 10098 gene locus_tag LOCUS_01060 10439 10098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01060 10771 11214 gene locus_tag LOCUS_01070 gene aroQ 10771 11214 CDS product type II 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005068810.1 protein_id gnl|my_center|LOCUS_01070 11214 12215 gene locus_tag LOCUS_01080 gene comC 11214 12215 CDS product L-sulfolactate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876829.1 protein_id gnl|my_center|LOCUS_01080 13492 12359 gene locus_tag LOCUS_01090 13492 12359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01090 14295 13672 gene locus_tag LOCUS_01100 14295 13672 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529397.1 protein_id gnl|my_center|LOCUS_01100 14930 14379 gene locus_tag LOCUS_01110 14930 14379 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947825.1 protein_id gnl|my_center|LOCUS_01110 >Feature sequence0009 2895 229 gene locus_tag LOCUS_01120 2895 229 CDS product non-lysosomal glucosylceramidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108530.1 protein_id gnl|my_center|LOCUS_01120 3780 2941 gene locus_tag LOCUS_01130 3780 2941 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722710.1 protein_id gnl|my_center|LOCUS_01130 4641 3784 gene locus_tag LOCUS_01140 4641 3784 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722709.1 protein_id gnl|my_center|LOCUS_01140 5987 4746 gene locus_tag LOCUS_01150 5987 4746 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929854.1 protein_id gnl|my_center|LOCUS_01150 6388 7434 gene locus_tag LOCUS_01160 6388 7434 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226230.1 protein_id gnl|my_center|LOCUS_01160 7506 8525 gene locus_tag LOCUS_01170 7506 8525 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765598.1 protein_id gnl|my_center|LOCUS_01170 8596 8757 gene locus_tag LOCUS_01180 8596 8757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01180 8936 9793 gene locus_tag LOCUS_01190 8936 9793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01190 10650 9934 gene locus_tag LOCUS_01200 10650 9934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01200 11420 10647 gene locus_tag LOCUS_01210 11420 10647 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000911797.1 protein_id gnl|my_center|LOCUS_01210 12100 11510 gene locus_tag LOCUS_01220 12100 11510 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976315.1 protein_id gnl|my_center|LOCUS_01220 12857 13072 gene locus_tag LOCUS_01230 12857 13072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01230 >Feature sequence0010 1591 806 gene locus_tag LOCUS_01240 1591 806 CDS product type II CAAX endopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000066795.1 protein_id gnl|my_center|LOCUS_01240 2414 1710 gene locus_tag LOCUS_01250 gene urtE 2414 1710 CDS product urea ABC transporter ATP-binding subunit UrtE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084269.1 protein_id gnl|my_center|LOCUS_01250 3159 2389 gene locus_tag LOCUS_01260 gene urtD 3159 2389 CDS product urea ABC transporter ATP-binding protein UrtD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531846.1 protein_id gnl|my_center|LOCUS_01260 4418 3249 gene locus_tag LOCUS_01270 gene urtC 4418 3249 CDS product urea ABC transporter permease subunit UrtC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531847.1 protein_id gnl|my_center|LOCUS_01270 6288 4576 gene locus_tag LOCUS_01280 gene urtB 6288 4576 CDS product urea ABC transporter permease subunit UrtB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269026.1 protein_id gnl|my_center|LOCUS_01280 6436 6720 gene locus_tag LOCUS_01290 6436 6720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01290 6635 7948 gene locus_tag LOCUS_01300 gene urtA 6635 7948 CDS product urea ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185937.1 protein_id gnl|my_center|LOCUS_01300 8231 9037 gene locus_tag LOCUS_01310 8231 9037 CDS product urease accessory protein UreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185533.1 protein_id gnl|my_center|LOCUS_01310 9103 9510 gene locus_tag LOCUS_01320 9103 9510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01320 9641 9946 gene locus_tag LOCUS_01330 9641 9946 CDS product urease subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095450.1 protein_id gnl|my_center|LOCUS_01330 10029 11795 gene locus_tag LOCUS_01340 gene ureC 10029 11795 CDS product urease subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186033.1 protein_id gnl|my_center|LOCUS_01340 11795 12307 gene locus_tag LOCUS_01350 gene ureE 11795 12307 CDS product urease accessory protein UreE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205202.1 protein_id gnl|my_center|LOCUS_01350 12438 13124 gene locus_tag LOCUS_01360 12438 13124 CDS product urease accessory protein UreF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004533998.1 protein_id gnl|my_center|LOCUS_01360 13128 13748 gene locus_tag LOCUS_01370 gene ureG 13128 13748 CDS product urease accessory protein UreG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185810.1 protein_id gnl|my_center|LOCUS_01370 >Feature sequence0011 1489 506 gene locus_tag LOCUS_01380 1489 506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01380 2811 2554 gene locus_tag LOCUS_01390 2811 2554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01390 2692 3411 gene locus_tag LOCUS_01400 2692 3411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01400 3639 3944 gene locus_tag LOCUS_01410 3639 3944 CDS product bifunctional 3-phenylpropionate/cinnamic acid dioxygenase ferredoxin subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001080101.1 protein_id gnl|my_center|LOCUS_01410 7384 4466 gene locus_tag LOCUS_01420 7384 4466 CDS product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038744192.1 protein_id gnl|my_center|LOCUS_01420 9294 7825 gene locus_tag LOCUS_01430 9294 7825 CDS product ABC transporter substrate-binding protein/permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869326.1 protein_id gnl|my_center|LOCUS_01430 9887 11083 gene locus_tag LOCUS_01440 9887 11083 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224260.1 protein_id gnl|my_center|LOCUS_01440 11299 12747 gene locus_tag LOCUS_01450 11299 12747 CDS product cellulase family glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920215.1 protein_id gnl|my_center|LOCUS_01450 13002 13697 gene locus_tag LOCUS_01460 13002 13697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01460 >Feature sequence0012 2106 793 gene locus_tag LOCUS_01470 2106 793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01470 2536 3039 gene locus_tag LOCUS_01480 2536 3039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01480 >Feature sequence0013 989 1858 gene locus_tag LOCUS_01490 gene cmr4 989 1858 CDS product type III-B CRISPR module RAMP protein Cmr4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_221897993.1 protein_id gnl|my_center|LOCUS_01490 1855 2220 gene locus_tag LOCUS_01500 1855 2220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01500 2217 3575 gene locus_tag LOCUS_01510 2217 3575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01510 4521 4742 gene locus_tag LOCUS_01520 4521 4742 CDS product DUF433 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142391.1 protein_id gnl|my_center|LOCUS_01520 4739 6634 gene locus_tag LOCUS_01530 4739 6634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01530 6697 7227 gene locus_tag LOCUS_01540 6697 7227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01540 7245 7883 gene locus_tag LOCUS_01550 7245 7883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01550 8120 8329 gene locus_tag LOCUS_01560 8120 8329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01560 8391 8585 gene locus_tag LOCUS_01570 8391 8585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01570 8769 10046 gene locus_tag LOCUS_01580 8769 10046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01580 10202 11464 gene locus_tag LOCUS_01590 10202 11464 CDS product DUF2130 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_211409870.1 protein_id gnl|my_center|LOCUS_01590 11469 12479 gene locus_tag LOCUS_01600 11469 12479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01600 12554 13033 gene locus_tag LOCUS_01610 12554 13033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01610 13250 13744 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtccgaaaggacgaattagccgaaaggcaatggagac >Feature sequence0014 1810 125 gene locus_tag LOCUS_01620 1810 125 CDS product alpha-amylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083724.1 protein_id gnl|my_center|LOCUS_01620 2427 2606 gene locus_tag LOCUS_01630 2427 2606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01630 3040 3924 gene locus_tag LOCUS_01640 3040 3924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_01640 4004 4183 gene locus_tag LOCUS_01650 4004 4183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01650 5390 4329 gene locus_tag LOCUS_01660 5390 4329 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338284.1 protein_id gnl|my_center|LOCUS_01660 6471 5398 gene locus_tag LOCUS_01670 6471 5398 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975133.1 protein_id gnl|my_center|LOCUS_01670 7562 6480 gene locus_tag LOCUS_01680 7562 6480 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338286.1 protein_id gnl|my_center|LOCUS_01680 8662 7565 gene locus_tag LOCUS_01690 8662 7565 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338287.1 protein_id gnl|my_center|LOCUS_01690 9672 8662 gene locus_tag LOCUS_01700 9672 8662 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975138.1 protein_id gnl|my_center|LOCUS_01700 10829 9711 gene locus_tag LOCUS_01710 10829 9711 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533192.1 protein_id gnl|my_center|LOCUS_01710 11065 11985 gene locus_tag LOCUS_01720 11065 11985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01720 12677 11931 gene locus_tag LOCUS_01730 12677 11931 CDS product TIGR04290 family methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533206.1 protein_id gnl|my_center|LOCUS_01730 <13760 12771 gene locus_tag LOCUS_01740 <13760 12771 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015456580.1:Gfo/Idh/MocA family oxidoreductase >Feature sequence0015 222 431 gene locus_tag LOCUS_01750 222 431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01750 1510 1809 gene locus_tag LOCUS_01760 1510 1809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01760 1986 2270 gene locus_tag LOCUS_01770 1986 2270 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000115710.1 protein_id gnl|my_center|LOCUS_01770 2374 2718 gene locus_tag LOCUS_01780 2374 2718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01780 4122 3223 gene locus_tag LOCUS_01790 4122 3223 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000423235.1 protein_id gnl|my_center|LOCUS_01790 5137 4673 gene locus_tag LOCUS_01800 5137 4673 CDS product DUF5662 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_116181623.1 protein_id gnl|my_center|LOCUS_01800 5442 6521 gene locus_tag LOCUS_01810 5442 6521 CDS product fatty acid desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957890.1 protein_id gnl|my_center|LOCUS_01810 7339 7034 gene locus_tag LOCUS_01820 7339 7034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01820 8038 8448 gene locus_tag LOCUS_01830 8038 8448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01830 8445 9893 gene locus_tag LOCUS_01840 8445 9893 CDS product glycoside hydrolase family 130 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119131.1 protein_id gnl|my_center|LOCUS_01840 10065 10277 gene locus_tag LOCUS_01850 10065 10277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01850 10702 11058 gene locus_tag LOCUS_01860 10702 11058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01860 11307 11071 gene locus_tag LOCUS_01870 11307 11071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01870 11560 11823 gene locus_tag LOCUS_01880 11560 11823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01880 12024 11863 gene locus_tag LOCUS_01890 12024 11863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01890 12167 12406 gene locus_tag LOCUS_01900 12167 12406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01900 12830 12384 gene locus_tag LOCUS_01910 12830 12384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01910 <13593 12827 gene locus_tag LOCUS_01920 <13593 12827 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_209484109.1:branched-chain amino acid ABC transporter ATP-binding protein/permease >Feature sequence0016 99 1061 gene locus_tag LOCUS_01930 gene msrP 99 1061 CDS product protein-methionine-sulfoxide reductase catalytic subunit MsrP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050115893.1 protein_id gnl|my_center|LOCUS_01930 1411 2040 gene locus_tag LOCUS_01940 1411 2040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01940 2268 2092 gene locus_tag LOCUS_01950 2268 2092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01950 3283 5271 gene locus_tag LOCUS_01960 3283 5271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01960 5278 6048 gene locus_tag LOCUS_01970 5278 6048 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053094988.1 protein_id gnl|my_center|LOCUS_01970 6823 6368 gene locus_tag LOCUS_01980 6823 6368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01980 7229 7531 gene locus_tag LOCUS_01990 7229 7531 CDS product 4a-hydroxytetrahydrobiopterin dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140928.1 protein_id gnl|my_center|LOCUS_01990 9529 7733 gene locus_tag LOCUS_02000 9529 7733 CDS product ClcB-like voltage-gated chloride channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192418.1 protein_id gnl|my_center|LOCUS_02000 9675 10208 gene locus_tag LOCUS_02010 9675 10208 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969916.1 protein_id gnl|my_center|LOCUS_02010 10389 11369 gene locus_tag LOCUS_02020 10389 11369 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223780.1 protein_id gnl|my_center|LOCUS_02020 >Feature sequence0017 <1 1216 gene locus_tag LOCUS_02030 <1 1216 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_071541097.1:2,3-bisphosphoglycerate-independent phosphoglycerate mutase 1236 1487 gene locus_tag LOCUS_02040 1236 1487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02040 2471 1668 gene locus_tag LOCUS_02050 2471 1668 CDS product DUF2182 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067593.1 protein_id gnl|my_center|LOCUS_02050 3151 2711 gene locus_tag LOCUS_02060 3151 2711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02060 3939 6095 gene locus_tag LOCUS_02070 3939 6095 CDS product amylo-alpha-1,6-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969651.1 protein_id gnl|my_center|LOCUS_02070 7055 7489 gene locus_tag LOCUS_02080 7055 7489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02080 8139 8546 gene locus_tag LOCUS_02090 8139 8546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02090 8598 8670 gene locus_tag LOCUS_t00020 8598 8670 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 8962 8807 gene locus_tag LOCUS_02100 8962 8807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02100 9771 9508 gene locus_tag LOCUS_02110 9771 9508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02110 9946 10242 gene locus_tag LOCUS_02120 9946 10242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02120 10252 10971 gene locus_tag LOCUS_02130 10252 10971 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029628.1 protein_id gnl|my_center|LOCUS_02130 11384 13081 gene locus_tag LOCUS_02140 11384 13081 CDS product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228281.1 protein_id gnl|my_center|LOCUS_02140 >Feature sequence0018 410 1984 gene locus_tag LOCUS_02150 410 1984 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256247.1 protein_id gnl|my_center|LOCUS_02150 2373 2999 gene locus_tag LOCUS_02160 2373 2999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02160 4063 3233 gene locus_tag LOCUS_02170 4063 3233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02170 5345 4389 gene locus_tag LOCUS_02180 5345 4389 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031548.1 protein_id gnl|my_center|LOCUS_02180 5558 6109 gene locus_tag LOCUS_02190 5558 6109 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030666.1 protein_id gnl|my_center|LOCUS_02190 6346 6495 gene locus_tag LOCUS_02200 6346 6495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02200 7586 6642 gene locus_tag LOCUS_02210 7586 6642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02210 8606 8151 gene locus_tag LOCUS_02220 8606 8151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02220 9795 8824 gene locus_tag LOCUS_02230 9795 8824 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896752.1 protein_id gnl|my_center|LOCUS_02230 10818 10192 gene locus_tag LOCUS_02240 10818 10192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02240 10952 11812 gene locus_tag LOCUS_02250 10952 11812 CDS product C1 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104327.1 protein_id gnl|my_center|LOCUS_02250 >Feature sequence0019 319 966 gene locus_tag LOCUS_02260 319 966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02260 1190 1011 gene locus_tag LOCUS_02270 1190 1011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02270 1319 2095 gene locus_tag LOCUS_02280 1319 2095 CDS product TIGR01458 family HAD-type hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000971814.1 protein_id gnl|my_center|LOCUS_02280 2318 2109 gene locus_tag LOCUS_02290 2318 2109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02290 5354 2742 gene locus_tag LOCUS_02300 5354 2742 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941039.1 protein_id gnl|my_center|LOCUS_02300 5969 5355 gene locus_tag LOCUS_02310 5969 5355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02310 6271 6753 gene locus_tag LOCUS_02320 6271 6753 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941206.1 protein_id gnl|my_center|LOCUS_02320 6890 8344 gene locus_tag LOCUS_02330 6890 8344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02330 8486 9475 gene locus_tag LOCUS_02340 8486 9475 CDS product aliphatic sulfonate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030652.1 protein_id gnl|my_center|LOCUS_02340 9472 10383 gene locus_tag LOCUS_02350 9472 10383 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963434.1 protein_id gnl|my_center|LOCUS_02350 10380 11150 gene locus_tag LOCUS_02360 10380 11150 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963435.1 protein_id gnl|my_center|LOCUS_02360 11664 11263 gene locus_tag LOCUS_02370 11664 11263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02370 11940 12470 gene locus_tag LOCUS_02380 11940 12470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02380 >Feature sequence0020 154 792 gene locus_tag LOCUS_02390 gene can 154 792 CDS product carbonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005308055.1 protein_id gnl|my_center|LOCUS_02390 1449 997 gene locus_tag LOCUS_02400 1449 997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02400 1831 1676 gene locus_tag LOCUS_02410 1831 1676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02410 1802 2482 gene locus_tag LOCUS_02420 1802 2482 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067339.1 protein_id gnl|my_center|LOCUS_02420 3182 2805 gene locus_tag LOCUS_02430 3182 2805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02430 5192 3567 gene locus_tag LOCUS_02440 5192 3567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02440 6798 5800 gene locus_tag LOCUS_02450 gene yedA 6798 5800 CDS product drug/metabolite exporter YedA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112921.1 protein_id gnl|my_center|LOCUS_02450 6986 7432 gene locus_tag LOCUS_02460 6986 7432 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974456.1 protein_id gnl|my_center|LOCUS_02460 8586 7579 gene locus_tag LOCUS_02470 8586 7579 CDS product hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970705.1 protein_id gnl|my_center|LOCUS_02470 8767 8570 gene locus_tag LOCUS_02480 8767 8570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02480 9818 9033 gene locus_tag LOCUS_02490 9818 9033 CDS product slipin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869449.1 protein_id gnl|my_center|LOCUS_02490 9991 9821 gene locus_tag LOCUS_02500 9991 9821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02500 11026 10022 gene locus_tag LOCUS_02510 11026 10022 CDS product nodulation protein NfeD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546843.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_02510 11016 11201 gene locus_tag LOCUS_02520 11016 11201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02520 >Feature sequence0021 221 1147 gene locus_tag LOCUS_02530 221 1147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02530 1197 1406 gene locus_tag LOCUS_02540 1197 1406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02540 2521 1727 gene locus_tag LOCUS_02550 2521 1727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02550 3302 3571 gene locus_tag LOCUS_02560 3302 3571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02560 4637 4095 gene locus_tag LOCUS_02570 4637 4095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02570 6741 6959 gene locus_tag LOCUS_02580 6741 6959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02580 7032 8123 gene locus_tag LOCUS_02590 7032 8123 CDS product nucleoside hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969294.1 protein_id gnl|my_center|LOCUS_02590 10850 8268 gene locus_tag LOCUS_02600 10850 8268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02600 12261 11890 gene locus_tag LOCUS_02610 12261 11890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02610 >Feature sequence0022 1796 489 gene locus_tag LOCUS_02620 1796 489 CDS product arsenic transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006315676.1 protein_id gnl|my_center|LOCUS_02620 3049 1817 gene locus_tag LOCUS_02630 3049 1817 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_135177312.1 protein_id gnl|my_center|LOCUS_02630 3503 4153 gene locus_tag LOCUS_02640 3503 4153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02640 4190 4891 gene locus_tag LOCUS_02650 4190 4891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02650 5096 6535 gene locus_tag LOCUS_02660 5096 6535 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176993961.1 protein_id gnl|my_center|LOCUS_02660 6520 7824 gene locus_tag LOCUS_02670 gene gnfM 6520 7824 CDS product nitrogen fixation sigma-54 dependent transcriptional regulator GnfM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941668.1 protein_id gnl|my_center|LOCUS_02670 7848 8828 gene locus_tag LOCUS_02680 7848 8828 CDS product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011176584.1 protein_id gnl|my_center|LOCUS_02680 9032 9919 gene locus_tag LOCUS_02690 9032 9919 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227679.1 protein_id gnl|my_center|LOCUS_02690 9980 10648 gene locus_tag LOCUS_02700 9980 10648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02700 12163 10949 gene locus_tag LOCUS_02710 12163 10949 CDS product 4-hydroxybenzoate 3-monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004556451.1 protein_id gnl|my_center|LOCUS_02710 12577 12182 gene locus_tag LOCUS_02720 gene pcaC 12577 12182 CDS product 4-carboxymuconolactone decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705266.1 protein_id gnl|my_center|LOCUS_02720 >Feature sequence0023 7813 3614 gene locus_tag LOCUS_02730 7813 3614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02730 <12696 7821 gene locus_tag LOCUS_02740 <12696 7821 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011123515.1:type I polyketide synthase >Feature sequence0024 2294 459 gene locus_tag LOCUS_02750 2294 459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02750 2841 3104 gene locus_tag LOCUS_02760 2841 3104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02760 3860 3138 gene locus_tag LOCUS_02770 3860 3138 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090624.1 protein_id gnl|my_center|LOCUS_02770 4514 3900 gene locus_tag LOCUS_02780 4514 3900 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974767.1 protein_id gnl|my_center|LOCUS_02780 4794 5312 gene locus_tag LOCUS_02790 4794 5312 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003109619.1 protein_id gnl|my_center|LOCUS_02790 6354 7232 gene locus_tag LOCUS_02800 6354 7232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02800 7841 8266 gene locus_tag LOCUS_02810 7841 8266 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328411.1 protein_id gnl|my_center|LOCUS_02810 8316 9221 gene locus_tag LOCUS_02820 8316 9221 CDS product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404185.1 protein_id gnl|my_center|LOCUS_02820 9795 10349 gene locus_tag LOCUS_02830 9795 10349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02830 >Feature sequence0025 <1 1203 gene locus_tag LOCUS_02840 <1 1203 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004528841.1:S53 family peptidase 1616 2173 gene locus_tag LOCUS_02850 1616 2173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02850 4489 2192 gene locus_tag LOCUS_02860 4489 2192 CDS product Tex family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939521.1 protein_id gnl|my_center|LOCUS_02860 5629 4760 gene locus_tag LOCUS_02870 5629 4760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02870 6037 6363 gene locus_tag LOCUS_02880 6037 6363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02880 6493 6771 gene locus_tag LOCUS_02890 6493 6771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02890 7181 7996 gene locus_tag LOCUS_02900 7181 7996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02900 9651 8335 gene locus_tag LOCUS_02910 9651 8335 CDS product acetamidase/formamidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002724359.1 protein_id gnl|my_center|LOCUS_02910 10097 9855 gene locus_tag LOCUS_02920 10097 9855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02920 10807 11199 gene locus_tag LOCUS_02930 10807 11199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02930 12314 11520 gene locus_tag LOCUS_02940 12314 11520 CDS product D-threitol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729199.1 protein_id gnl|my_center|LOCUS_02940 >Feature sequence0026 77 150 gene locus_tag LOCUS_t00030 77 150 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 1324 2511 gene locus_tag LOCUS_02950 1324 2511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02950 2522 3673 gene locus_tag LOCUS_02960 2522 3673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02960 3726 3908 gene locus_tag LOCUS_02970 3726 3908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02970 4212 7649 gene locus_tag LOCUS_02980 4212 7649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02980 7659 10019 gene locus_tag LOCUS_02990 7659 10019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02990 10223 10585 gene locus_tag LOCUS_03000 10223 10585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03000 10853 11038 gene locus_tag LOCUS_03010 10853 11038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03010 >Feature sequence0027 <1 766 gene locus_tag LOCUS_03020 <1 766 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011205128.1:DUF1800 domain-containing protein 1086 1868 gene locus_tag LOCUS_03030 1086 1868 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083678.1 protein_id gnl|my_center|LOCUS_03030 2016 2981 gene locus_tag LOCUS_03040 2016 2981 CDS product GlxA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004529113.1 protein_id gnl|my_center|LOCUS_03040 3043 3987 gene locus_tag LOCUS_03050 3043 3987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03050 4526 4287 gene locus_tag LOCUS_03060 4526 4287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03060 5302 4763 gene locus_tag LOCUS_03070 5302 4763 CDS product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730198.1 protein_id gnl|my_center|LOCUS_03070 6722 5277 gene locus_tag LOCUS_03080 6722 5277 CDS product DNA-3-methyladenine glycosylase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391104.1 protein_id gnl|my_center|LOCUS_03080 8045 6897 gene locus_tag LOCUS_03090 8045 6897 CDS product lipocalin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404080.1 protein_id gnl|my_center|LOCUS_03090 10612 8078 gene locus_tag LOCUS_03100 10612 8078 CDS product FtsX-like permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255972.1 protein_id gnl|my_center|LOCUS_03100 <12082 10964 gene locus_tag LOCUS_03110 <12082 10964 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942465.1:[protein-PII] uridylyltransferase >Feature sequence0028 <1 650 gene locus_tag LOCUS_03120 <1 650 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013530726.1:SDR family oxidoreductase 1192 1266 gene locus_tag LOCUS_t00040 1192 1266 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 2031 1483 gene locus_tag LOCUS_03130 2031 1483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03130 2415 2080 gene locus_tag LOCUS_03140 2415 2080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03140 2610 2801 gene locus_tag LOCUS_03150 2610 2801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03150 2802 4781 gene locus_tag LOCUS_03160 2802 4781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03160 4842 5195 gene locus_tag LOCUS_03170 4842 5195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03170 >Feature sequence0029 1327 500 gene locus_tag LOCUS_03180 1327 500 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894672.1 protein_id gnl|my_center|LOCUS_03180 2192 1344 gene locus_tag LOCUS_03190 2192 1344 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976293.1 protein_id gnl|my_center|LOCUS_03190 2364 2116 gene locus_tag LOCUS_03200 2364 2116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03200 3827 2421 gene locus_tag LOCUS_03210 3827 2421 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976294.1 protein_id gnl|my_center|LOCUS_03210 6028 4115 gene locus_tag LOCUS_03220 6028 4115 CDS product glucosamine-6-phosphate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330748.1 protein_id gnl|my_center|LOCUS_03220 6972 6160 gene locus_tag LOCUS_03230 gene thiM 6972 6160 CDS product hydroxyethylthiazole kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939636.1 protein_id gnl|my_center|LOCUS_03230 7535 7140 gene locus_tag LOCUS_03240 7535 7140 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037384441.1 protein_id gnl|my_center|LOCUS_03240 7756 9255 gene locus_tag LOCUS_03250 gene xylB 7756 9255 CDS product xylulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267678.1 protein_id gnl|my_center|LOCUS_03250 9404 9955 gene locus_tag LOCUS_03260 9404 9955 CDS product flavin prenyltransferase UbiX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249464.1 protein_id gnl|my_center|LOCUS_03260 10087 11112 gene locus_tag LOCUS_03270 10087 11112 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943657.1 protein_id gnl|my_center|LOCUS_03270 >Feature sequence0030 10211 9174 gene locus_tag LOCUS_03280 10211 9174 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009927050.1 protein_id gnl|my_center|LOCUS_03280 <11628 10573 gene locus_tag LOCUS_03290 <11628 10573 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_037400906.1:alpha-glucosidase/alpha-galactosidase >Feature sequence0031 <1 525 gene locus_tag LOCUS_03300 <1 525 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011728945.1:EamA family transporter 1419 898 gene locus_tag LOCUS_03310 1419 898 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083839.1 protein_id gnl|my_center|LOCUS_03310 1678 2574 gene locus_tag LOCUS_03320 1678 2574 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066517.1 protein_id gnl|my_center|LOCUS_03320 3200 5431 gene locus_tag LOCUS_03330 3200 5431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03330 5584 6171 gene locus_tag LOCUS_03340 5584 6171 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921477.1 protein_id gnl|my_center|LOCUS_03340 7102 6728 gene locus_tag LOCUS_03350 7102 6728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03350 8699 7308 gene locus_tag LOCUS_03360 8699 7308 CDS product mercuric reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946005.1 protein_id gnl|my_center|LOCUS_03360 9680 8859 gene locus_tag LOCUS_03370 9680 8859 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021030.1 protein_id gnl|my_center|LOCUS_03370 9960 9745 gene locus_tag LOCUS_03380 9960 9745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03380 10196 10014 gene locus_tag LOCUS_03390 10196 10014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03390 >Feature sequence0032 611 351 gene locus_tag LOCUS_03400 611 351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03400 1232 783 gene locus_tag LOCUS_03410 1232 783 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005762782.1 protein_id gnl|my_center|LOCUS_03410 1523 2908 gene locus_tag LOCUS_03420 1523 2908 CDS product TIGR00366 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000580275.1 protein_id gnl|my_center|LOCUS_03420 3470 3183 gene locus_tag LOCUS_03430 3470 3183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03430 3817 3581 gene locus_tag LOCUS_03440 3817 3581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03440 4521 3874 gene locus_tag LOCUS_03450 4521 3874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_082912340.1 protein_id gnl|my_center|LOCUS_03450 5883 4537 gene locus_tag LOCUS_03460 5883 4537 CDS product selenium-binding protein SBP56-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256631.1 protein_id gnl|my_center|LOCUS_03460 7470 6436 gene locus_tag LOCUS_03470 7470 6436 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814870.1 protein_id gnl|my_center|LOCUS_03470 8417 7818 gene locus_tag LOCUS_03480 8417 7818 CDS product isochorismatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970775.1 protein_id gnl|my_center|LOCUS_03480 9716 8904 gene locus_tag LOCUS_03490 9716 8904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03490 10382 9972 gene locus_tag LOCUS_03500 10382 9972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03500 10731 11081 gene locus_tag LOCUS_03510 gene rplS 10731 11081 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392486.1 protein_id gnl|my_center|LOCUS_03510 >Feature sequence0033 513 1421 gene locus_tag LOCUS_03520 513 1421 CDS product polyphosphate kinase 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928954.1 protein_id gnl|my_center|LOCUS_03520 1435 2592 gene locus_tag LOCUS_03530 gene tgt 1435 2592 CDS product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897970.1 protein_id gnl|my_center|LOCUS_03530 2779 3417 gene locus_tag LOCUS_03540 2779 3417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03540 3743 3958 gene locus_tag LOCUS_03550 3743 3958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03550 3975 4436 gene locus_tag LOCUS_03560 gene smpB 3975 4436 CDS product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259157.1 protein_id gnl|my_center|LOCUS_03560 7530 4954 gene locus_tag LOCUS_03570 7530 4954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03570 9945 8008 gene locus_tag LOCUS_03580 9945 8008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03580 11110 10208 gene locus_tag LOCUS_03590 gene xerD 11110 10208 CDS product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000390080.1 protein_id gnl|my_center|LOCUS_03590 11423 11496 gene locus_tag LOCUS_t00050 11423 11496 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence0034 2072 2746 gene locus_tag LOCUS_03600 2072 2746 CDS product PQQ-binding-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037395144.1 protein_id gnl|my_center|LOCUS_03600 3768 2896 gene locus_tag LOCUS_03610 3768 2896 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227999.1 protein_id gnl|my_center|LOCUS_03610 5010 3997 gene locus_tag LOCUS_03620 5010 3997 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582798.1 protein_id gnl|my_center|LOCUS_03620 5335 6912 gene locus_tag LOCUS_03630 5335 6912 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528457.1 protein_id gnl|my_center|LOCUS_03630 6909 8201 gene locus_tag LOCUS_03640 6909 8201 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061256.1 protein_id gnl|my_center|LOCUS_03640 8469 9431 gene locus_tag LOCUS_03650 8469 9431 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976195.1 protein_id gnl|my_center|LOCUS_03650 10774 9638 gene locus_tag LOCUS_03660 10774 9638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03660 >Feature sequence0035 3 344 gene locus_tag LOCUS_03670 3 344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03670 325 1644 gene locus_tag LOCUS_03680 gene rho 325 1644 CDS product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883248.1 protein_id gnl|my_center|LOCUS_03680 1645 2718 gene locus_tag LOCUS_03690 1645 2718 CDS product ribonuclease D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941112.1 protein_id gnl|my_center|LOCUS_03690 2959 4095 gene locus_tag LOCUS_03700 gene aroF 2959 4095 CDS product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546648.1 protein_id gnl|my_center|LOCUS_03700 4092 4898 gene locus_tag LOCUS_03710 4092 4898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03710 4903 5646 gene locus_tag LOCUS_03720 gene nth 4903 5646 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230550.1 protein_id gnl|my_center|LOCUS_03720 6950 5919 gene locus_tag LOCUS_03730 6950 5919 CDS product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064286.1 protein_id gnl|my_center|LOCUS_03730 7405 9333 gene locus_tag LOCUS_03740 7405 9333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03740 <11231 9450 gene locus_tag LOCUS_03750 <11231 9450 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003893142.1:lipase maturation factor family protein >Feature sequence0036 1228 1821 gene locus_tag LOCUS_03760 gene aat 1228 1821 CDS product leucyl/phenylalanyl-tRNA--protein transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141036.1 protein_id gnl|my_center|LOCUS_03760 2007 2456 gene locus_tag LOCUS_03770 2007 2456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03770 2596 3387 gene locus_tag LOCUS_03780 2596 3387 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232156.1 protein_id gnl|my_center|LOCUS_03780 3865 4479 gene locus_tag LOCUS_03790 3865 4479 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067204.1 protein_id gnl|my_center|LOCUS_03790 4783 4562 gene locus_tag LOCUS_03800 4783 4562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03800 5189 4929 gene locus_tag LOCUS_03810 5189 4929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03810 5596 5976 gene locus_tag LOCUS_03820 5596 5976 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064252024.1 protein_id gnl|my_center|LOCUS_03820 5991 6476 gene locus_tag LOCUS_03830 5991 6476 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038076.1 protein_id gnl|my_center|LOCUS_03830 7006 6545 gene locus_tag LOCUS_03840 7006 6545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03840 7310 7017 gene locus_tag LOCUS_03850 7310 7017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03850 7911 7348 gene locus_tag LOCUS_03860 gene pth 7911 7348 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062281463.1 protein_id gnl|my_center|LOCUS_03860 8595 7924 gene locus_tag LOCUS_03870 8595 7924 CDS product 50S ribosomal protein L25/general stress protein Ctc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391626.1 protein_id gnl|my_center|LOCUS_03870 9565 8606 gene locus_tag LOCUS_03880 9565 8606 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814952.1 protein_id gnl|my_center|LOCUS_03880 <11136 9813 gene locus_tag LOCUS_03890 <11136 9813 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011393372.1:DNA polymerase III subunit alpha >Feature sequence0037 103 300 gene locus_tag LOCUS_03900 103 300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03900 461 2047 gene locus_tag LOCUS_03910 gene pckA 461 2047 CDS product phosphoenolpyruvate carboxykinase (ATP) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405091.1 protein_id gnl|my_center|LOCUS_03910 2077 3513 gene locus_tag LOCUS_03920 gene lpdA 2077 3513 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436922.1 protein_id gnl|my_center|LOCUS_03920 4390 3941 gene locus_tag LOCUS_03930 4390 3941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03930 5661 4387 gene locus_tag LOCUS_03940 5661 4387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03940 5834 5658 gene locus_tag LOCUS_03950 5834 5658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03950 6143 5877 gene locus_tag LOCUS_03960 6143 5877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03960 7176 6274 gene locus_tag LOCUS_03970 7176 6274 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122336.1 protein_id gnl|my_center|LOCUS_03970 8925 7639 gene locus_tag LOCUS_03980 8925 7639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03980 9466 10728 gene locus_tag LOCUS_03990 9466 10728 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937371.1 protein_id gnl|my_center|LOCUS_03990 >Feature sequence0038 1006 305 gene locus_tag LOCUS_04000 1006 305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04000 2116 1076 gene locus_tag LOCUS_04010 2116 1076 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403392.1 protein_id gnl|my_center|LOCUS_04010 2917 2129 gene locus_tag LOCUS_04020 2917 2129 CDS product WecB/TagA/CpsF family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920874.1 protein_id gnl|my_center|LOCUS_04020 2877 3050 gene locus_tag LOCUS_04030 2877 3050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04030 3524 5080 gene locus_tag LOCUS_04040 3524 5080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04040 5211 6155 gene locus_tag LOCUS_04050 5211 6155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04050 6214 6948 gene locus_tag LOCUS_04060 6214 6948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04060 8021 7500 gene locus_tag LOCUS_04070 8021 7500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04070 8393 9280 gene locus_tag LOCUS_04080 8393 9280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04080 9358 10584 gene locus_tag LOCUS_04090 9358 10584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04090 >Feature sequence0039 2030 1386 gene locus_tag LOCUS_04100 2030 1386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04100 3334 2054 gene locus_tag LOCUS_04110 3334 2054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04110 4131 3346 gene locus_tag LOCUS_04120 4131 3346 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021200.1 protein_id gnl|my_center|LOCUS_04120 4831 4133 gene locus_tag LOCUS_04130 4831 4133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04130 6813 4927 gene locus_tag LOCUS_04140 6813 4927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04140 7827 6841 gene locus_tag LOCUS_04150 7827 6841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04150 9022 7976 gene locus_tag LOCUS_04160 9022 7976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04160 9871 9068 gene locus_tag LOCUS_04170 9871 9068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04170 <10965 9907 gene locus_tag LOCUS_04180 <10965 9907 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010974172.1:class I SAM-dependent methyltransferase >Feature sequence0040 595 840 gene locus_tag LOCUS_04190 595 840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04190 837 2669 gene locus_tag LOCUS_04200 837 2669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04200 2666 3367 gene locus_tag LOCUS_04210 2666 3367 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403448.1 protein_id gnl|my_center|LOCUS_04210 3517 4509 gene locus_tag LOCUS_04220 3517 4509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04220 4535 5170 gene locus_tag LOCUS_04230 4535 5170 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403448.1 protein_id gnl|my_center|LOCUS_04230 5337 6119 gene locus_tag LOCUS_04240 5337 6119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04240 6150 6659 gene locus_tag LOCUS_04250 6150 6659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04250 7632 8291 gene locus_tag LOCUS_04260 7632 8291 CDS product cytochrome c3 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258004.1 protein_id gnl|my_center|LOCUS_04260 >Feature sequence0041 347 1735 gene locus_tag LOCUS_04270 347 1735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04270 1965 1762 gene locus_tag LOCUS_04280 1965 1762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04280 2034 2690 gene locus_tag LOCUS_04290 2034 2690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04290 3287 4612 gene locus_tag LOCUS_04300 3287 4612 CDS product aromatic acid/H+ symport family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113292.1 protein_id gnl|my_center|LOCUS_04300 4837 5310 gene locus_tag LOCUS_04310 4837 5310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04310 5689 5892 gene locus_tag LOCUS_04320 5689 5892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04320 6805 6281 gene locus_tag LOCUS_04330 6805 6281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04330 8079 6997 gene locus_tag LOCUS_04340 8079 6997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04340 9179 8154 gene locus_tag LOCUS_04350 9179 8154 CDS product aldehyde reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088575.1 protein_id gnl|my_center|LOCUS_04350 9795 9193 gene locus_tag LOCUS_04360 9795 9193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04360 >Feature sequence0042 857 1804 gene locus_tag LOCUS_04370 857 1804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04370 1980 3374 gene locus_tag LOCUS_04380 1980 3374 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942946.1 protein_id gnl|my_center|LOCUS_04380 3951 3592 gene locus_tag LOCUS_04390 3951 3592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04390 4920 4153 gene locus_tag LOCUS_04400 4920 4153 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288522.1 protein_id gnl|my_center|LOCUS_04400 5298 6110 gene locus_tag LOCUS_04410 5298 6110 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007332279.1 protein_id gnl|my_center|LOCUS_04410 6295 6519 gene locus_tag LOCUS_04420 6295 6519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04420 6693 7640 gene locus_tag LOCUS_04430 6693 7640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04430 7975 7727 gene locus_tag LOCUS_04440 7975 7727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04440 8373 8113 gene locus_tag LOCUS_04450 8373 8113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04450 8873 8652 gene locus_tag LOCUS_04460 8873 8652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04460 9594 8896 gene locus_tag LOCUS_04470 9594 8896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04470 9812 10432 gene locus_tag LOCUS_04480 9812 10432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04480 >Feature sequence0043 1811 528 gene locus_tag LOCUS_04490 gene eno 1811 528 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357098.1 protein_id gnl|my_center|LOCUS_04490 3519 2425 gene locus_tag LOCUS_04500 gene cax 3519 2425 CDS product calcium/proton exchanger inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037395855.1 protein_id gnl|my_center|LOCUS_04500 3958 3524 gene locus_tag LOCUS_04510 3958 3524 CDS product potassium channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037395858.1 protein_id gnl|my_center|LOCUS_04510 4162 5124 gene locus_tag LOCUS_04520 4162 5124 CDS product L,D-transpeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098363.1 protein_id gnl|my_center|LOCUS_04520 5257 6360 gene locus_tag LOCUS_04530 5257 6360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04530 7683 7222 gene locus_tag LOCUS_04540 7683 7222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04540 8246 7689 gene locus_tag LOCUS_04550 8246 7689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04550 9160 9381 gene locus_tag LOCUS_04560 9160 9381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04560 9569 10351 gene locus_tag LOCUS_04570 9569 10351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04570 >Feature sequence0044 1626 919 gene locus_tag LOCUS_04580 1626 919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04580 2568 1900 gene locus_tag LOCUS_04590 2568 1900 CDS product MarC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811810.1 protein_id gnl|my_center|LOCUS_04590 3409 2846 gene locus_tag LOCUS_04600 3409 2846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04600 3779 3585 gene locus_tag LOCUS_04610 3779 3585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04610 3780 4331 gene locus_tag LOCUS_04620 3780 4331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04620 4471 4935 gene locus_tag LOCUS_04630 4471 4935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04630 5880 4957 gene locus_tag LOCUS_04640 5880 4957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04640 6729 6181 gene locus_tag LOCUS_04650 6729 6181 CDS product polysaccharide biosynthesis/export family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_185660149.1 protein_id gnl|my_center|LOCUS_04650 8851 6734 gene locus_tag LOCUS_04660 8851 6734 CDS product polysaccharide biosynthesis tyrosine autokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144294.1 protein_id gnl|my_center|LOCUS_04660 9218 9565 gene locus_tag LOCUS_04670 9218 9565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04670 9632 10198 gene locus_tag LOCUS_04680 9632 10198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04680 >Feature sequence0045 291 1121 gene locus_tag LOCUS_04690 gene ccsB 291 1121 CDS product c-type cytochrome biogenesis protein CcsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943894.1 protein_id gnl|my_center|LOCUS_04690 1118 2209 gene locus_tag LOCUS_04700 gene hemA 1118 2209 CDS product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943895.1 protein_id gnl|my_center|LOCUS_04700 2209 3135 gene locus_tag LOCUS_04710 gene hemC 2209 3135 CDS product hydroxymethylbilane synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028842596.1 protein_id gnl|my_center|LOCUS_04710 3119 4624 gene locus_tag LOCUS_04720 gene cobA 3119 4624 CDS product uroporphyrinogen-III C-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460180.1 protein_id gnl|my_center|LOCUS_04720 5160 4966 gene locus_tag LOCUS_04730 5160 4966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04730 5708 5397 gene locus_tag LOCUS_04740 5708 5397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04740 5677 6282 gene locus_tag LOCUS_04750 5677 6282 CDS product LemA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402887.1 protein_id gnl|my_center|LOCUS_04750 6375 7274 gene locus_tag LOCUS_04760 6375 7274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04760 7400 8962 gene locus_tag LOCUS_04770 7400 8962 CDS product lipase maturation factor family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401279.1 protein_id gnl|my_center|LOCUS_04770 9650 9153 gene locus_tag LOCUS_04780 9650 9153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04780 <10629 10079 gene locus_tag LOCUS_04790 <10629 10079 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013530708.1:NAD(P)-dependent alcohol dehydrogenase >Feature sequence0046 933 772 gene locus_tag LOCUS_04800 933 772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04800 1052 1453 gene locus_tag LOCUS_04810 1052 1453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04810 2133 1522 gene locus_tag LOCUS_04820 2133 1522 CDS product DUF1326 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528738.1 protein_id gnl|my_center|LOCUS_04820 2334 2816 gene locus_tag LOCUS_04830 2334 2816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04830 3235 2939 gene locus_tag LOCUS_04840 3235 2939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04840 3326 3254 gene locus_tag LOCUS_t00060 3326 3254 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 4728 3748 gene locus_tag LOCUS_04850 4728 3748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04850 6137 4842 gene locus_tag LOCUS_04860 6137 4842 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268774.1 protein_id gnl|my_center|LOCUS_04860 8118 6121 gene locus_tag LOCUS_04870 8118 6121 CDS product helicase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121692.1 protein_id gnl|my_center|LOCUS_04870 8603 9718 gene locus_tag LOCUS_04880 8603 9718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04880 10415 9687 gene locus_tag LOCUS_04890 gene rnc 10415 9687 CDS product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428341.1 protein_id gnl|my_center|LOCUS_04890 >Feature sequence0047 <1 1509 gene locus_tag LOCUS_04900 <1 1509 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013226244.1:alpha-L-arabinofuranosidase C-terminal domain-containing protein 2818 1577 gene locus_tag LOCUS_04910 2818 1577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04910 2964 3623 gene locus_tag LOCUS_04920 2964 3623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04920 4716 3952 gene locus_tag LOCUS_04930 4716 3952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04930 5115 5480 gene locus_tag LOCUS_04940 5115 5480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04940 5787 6317 gene locus_tag LOCUS_04950 5787 6317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04950 6407 6691 gene locus_tag LOCUS_04960 6407 6691 CDS product YciI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000808563.1 protein_id gnl|my_center|LOCUS_04960 7070 7141 gene locus_tag LOCUS_t00070 7070 7141 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 7846 9273 gene locus_tag LOCUS_04970 7846 9273 CDS product TROVE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062695913.1 protein_id gnl|my_center|LOCUS_04970 10053 9700 gene locus_tag LOCUS_04980 10053 9700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04980 >Feature sequence0048 995 174 gene locus_tag LOCUS_04990 995 174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04990 1440 1165 gene locus_tag LOCUS_05000 1440 1165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05000 1986 1501 gene locus_tag LOCUS_05010 1986 1501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_05010 2810 1983 gene locus_tag LOCUS_05020 2810 1983 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537900.1 protein_id gnl|my_center|LOCUS_05020 3010 2810 gene locus_tag LOCUS_05030 3010 2810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05030 4740 3049 gene locus_tag LOCUS_05040 4740 3049 CDS product CocE/NonD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025269720.1 protein_id gnl|my_center|LOCUS_05040 5636 4737 gene locus_tag LOCUS_05050 5636 4737 CDS product creatininase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531124.1 protein_id gnl|my_center|LOCUS_05050 7094 5724 gene locus_tag LOCUS_05060 7094 5724 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531130.1 protein_id gnl|my_center|LOCUS_05060 7714 7091 gene locus_tag LOCUS_05070 7714 7091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05070 7798 9051 gene locus_tag LOCUS_05080 7798 9051 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727400.1 protein_id gnl|my_center|LOCUS_05080 9224 10207 gene locus_tag LOCUS_05090 9224 10207 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082923.1 protein_id gnl|my_center|LOCUS_05090 >Feature sequence0049 152 742 gene locus_tag LOCUS_05100 152 742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05100 1822 1121 gene locus_tag LOCUS_05110 1822 1121 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403448.1 protein_id gnl|my_center|LOCUS_05110 2518 1997 gene locus_tag LOCUS_05120 2518 1997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05120 3403 2720 gene locus_tag LOCUS_05130 3403 2720 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072770.1 protein_id gnl|my_center|LOCUS_05130 3874 4029 gene locus_tag LOCUS_05140 3874 4029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05140 4616 4128 gene locus_tag LOCUS_05150 4616 4128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05150 4632 4766 gene locus_tag LOCUS_05160 4632 4766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05160 5149 6234 gene locus_tag LOCUS_05170 5149 6234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05170 6271 6573 gene locus_tag LOCUS_05180 6271 6573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05180 6929 7750 gene locus_tag LOCUS_05190 gene chbG 6929 7750 CDS product chitin disaccharide deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815723.1 protein_id gnl|my_center|LOCUS_05190 9011 8298 gene locus_tag LOCUS_05200 9011 8298 CDS product IS6 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028402264.1 protein_id gnl|my_center|LOCUS_05200 9149 9451 gene locus_tag LOCUS_05210 9149 9451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05210 >Feature sequence0050 1441 428 gene locus_tag LOCUS_05220 1441 428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05220 1660 4305 gene locus_tag LOCUS_05230 1660 4305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05230 5664 4591 gene locus_tag LOCUS_05240 5664 4591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05240 6841 5780 gene locus_tag LOCUS_05250 6841 5780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05250 7732 6980 gene locus_tag LOCUS_05260 7732 6980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05260 8852 8109 gene locus_tag LOCUS_05270 8852 8109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05270 9918 8896 gene locus_tag LOCUS_05280 9918 8896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05280 >Feature sequence0051 36 2033 gene locus_tag LOCUS_05290 36 2033 CDS product UvrD-helicase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941556.1 protein_id gnl|my_center|LOCUS_05290 3612 2761 gene locus_tag LOCUS_05300 3612 2761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05300 3750 4580 gene locus_tag LOCUS_05310 3750 4580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05310 4606 7581 gene locus_tag LOCUS_05320 4606 7581 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038503.1 protein_id gnl|my_center|LOCUS_05320 7984 7604 gene locus_tag LOCUS_05330 7984 7604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05330 >Feature sequence0052 103 597 gene locus_tag LOCUS_05340 103 597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05340 1290 691 gene locus_tag LOCUS_05350 1290 691 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_080577794.1 protein_id gnl|my_center|LOCUS_05350 1424 2500 gene locus_tag LOCUS_05360 1424 2500 CDS product saccharopine dehydrogenase NADP-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037401351.1 protein_id gnl|my_center|LOCUS_05360 3404 3955 gene locus_tag LOCUS_05370 3404 3955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05370 4029 4763 gene locus_tag LOCUS_05380 4029 4763 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119458.1 protein_id gnl|my_center|LOCUS_05380 6486 5062 gene locus_tag LOCUS_05390 6486 5062 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902502.1 protein_id gnl|my_center|LOCUS_05390 7656 6745 gene locus_tag LOCUS_05400 7656 6745 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530571.1 protein_id gnl|my_center|LOCUS_05400 7759 8607 gene locus_tag LOCUS_05410 7759 8607 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087073.1 protein_id gnl|my_center|LOCUS_05410 <10082 8846 gene locus_tag LOCUS_05420 <10082 8846 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003113792.1:SLC13 family permease >Feature sequence0053 456 1004 gene locus_tag LOCUS_05430 456 1004 CDS product 2,4'-dihydroxyacetophenone dioxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066672.1 protein_id gnl|my_center|LOCUS_05430 2322 1036 gene locus_tag LOCUS_05440 2322 1036 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122716.1 protein_id gnl|my_center|LOCUS_05440 2624 3034 gene locus_tag LOCUS_05450 2624 3034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05450 3047 3802 gene locus_tag LOCUS_05460 3047 3802 CDS product hydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941404.1 protein_id gnl|my_center|LOCUS_05460 3999 4679 gene locus_tag LOCUS_05470 3999 4679 CDS product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941396.1 protein_id gnl|my_center|LOCUS_05470 4676 6649 gene locus_tag LOCUS_05480 4676 6649 CDS product proton-conducting transporter membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941395.1 protein_id gnl|my_center|LOCUS_05480 6643 7569 gene locus_tag LOCUS_05490 6643 7569 CDS product NADH-quinone oxidoreductase subunit H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941400.1 protein_id gnl|my_center|LOCUS_05490 7566 8204 gene locus_tag LOCUS_05500 7566 8204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05500 8209 9669 gene locus_tag LOCUS_05510 8209 9669 CDS product proton-conducting transporter membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941402.1 protein_id gnl|my_center|LOCUS_05510 >Feature sequence0054 315 160 gene locus_tag LOCUS_05520 315 160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05520 922 647 gene locus_tag LOCUS_05530 922 647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05530 1384 1148 gene locus_tag LOCUS_05540 1384 1148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05540 2409 4169 gene locus_tag LOCUS_05550 2409 4169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05550 4176 4781 gene locus_tag LOCUS_05560 4176 4781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05560 4778 5827 gene locus_tag LOCUS_05570 4778 5827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05570 5815 7116 gene locus_tag LOCUS_05580 5815 7116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05580 8276 7452 gene locus_tag LOCUS_05590 8276 7452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05590 9368 8301 gene locus_tag LOCUS_05600 9368 8301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05600 >Feature sequence0055 3142 3945 gene locus_tag LOCUS_05610 3142 3945 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462327.1 protein_id gnl|my_center|LOCUS_05610 4260 4072 gene locus_tag LOCUS_05620 4260 4072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05620 4324 4839 gene locus_tag LOCUS_05630 4324 4839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05630 5032 6204 gene locus_tag LOCUS_05640 5032 6204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05640 6527 7450 gene locus_tag LOCUS_05650 6527 7450 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257134.1 protein_id gnl|my_center|LOCUS_05650 8508 7522 gene locus_tag LOCUS_05660 8508 7522 CDS product zinc-dependent alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009902587.1 protein_id gnl|my_center|LOCUS_05660 <10038 8996 gene locus_tag LOCUS_05670 <10038 8996 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004523980.1:helix-turn-helix domain-containing protein >Feature sequence0056 270 3371 gene locus_tag LOCUS_05680 gene mdtC 270 3371 CDS product multidrug efflux RND transporter permease subunit MdtC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815800.1 protein_id gnl|my_center|LOCUS_05680 3502 4989 gene locus_tag LOCUS_05690 3502 4989 CDS product efflux transporter outer membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204730.1 note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_05690 5957 5268 gene locus_tag LOCUS_05700 gene phoU 5957 5268 CDS product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388360.1 protein_id gnl|my_center|LOCUS_05700 7305 7114 gene locus_tag LOCUS_05710 7305 7114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05710 8416 7769 gene locus_tag LOCUS_05720 8416 7769 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011166893.1 protein_id gnl|my_center|LOCUS_05720 9695 8508 gene locus_tag LOCUS_05730 9695 8508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05730 >Feature sequence0057 6739 5192 gene locus_tag LOCUS_05740 6739 5192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05740 7932 7132 gene locus_tag LOCUS_05750 7932 7132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05750 8830 7940 gene locus_tag LOCUS_05760 gene fabD 8830 7940 CDS product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231821.1 protein_id gnl|my_center|LOCUS_05760 8913 9164 gene locus_tag LOCUS_05770 8913 9164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05770 9179 9529 gene locus_tag LOCUS_05780 9179 9529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05780 >Feature sequence0058 1382 240 gene locus_tag LOCUS_05790 gene hypE 1382 240 CDS product hydrogenase expression/formation protein HypE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933452.1 protein_id gnl|my_center|LOCUS_05790 2068 1436 gene locus_tag LOCUS_05800 2068 1436 CDS product SIS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256187.1 protein_id gnl|my_center|LOCUS_05800 3213 2065 gene locus_tag LOCUS_05810 gene hypD 3213 2065 CDS product hydrogenase formation protein HypD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258618.1 protein_id gnl|my_center|LOCUS_05810 3485 3231 gene locus_tag LOCUS_05820 3485 3231 CDS product HypC/HybG/HupF family hydrogenase formation chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258619.1 protein_id gnl|my_center|LOCUS_05820 3812 3495 gene locus_tag LOCUS_05830 3812 3495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05830 6154 3809 gene locus_tag LOCUS_05840 gene hypF 6154 3809 CDS product carbamoyltransferase HypF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880400.1 protein_id gnl|my_center|LOCUS_05840 7055 6120 gene locus_tag LOCUS_05850 7055 6120 CDS product NifU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894102.1 protein_id gnl|my_center|LOCUS_05850 7494 7069 gene locus_tag LOCUS_05860 gene hypA 7494 7069 CDS product hydrogenase maturation nickel metallochaperone HypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060898.1 protein_id gnl|my_center|LOCUS_05860 8365 7691 gene locus_tag LOCUS_05870 gene hypB 8365 7691 CDS product hydrogenase nickel incorporation protein HypB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869941.1 protein_id gnl|my_center|LOCUS_05870 9233 8433 gene locus_tag LOCUS_05880 9233 8433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_05880 <9969 9258 gene locus_tag LOCUS_05890 <9969 9258 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013225646.1:nickel-dependent hydrogenase large subunit note possible pseudo, internal stop codon >Feature sequence0059 998 453 gene locus_tag LOCUS_05900 998 453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05900 1890 1207 gene locus_tag LOCUS_05910 1890 1207 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063656.1 protein_id gnl|my_center|LOCUS_05910 2261 2698 gene locus_tag LOCUS_05920 2261 2698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05920 3529 4452 gene locus_tag LOCUS_05930 3529 4452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05930 4542 4835 gene locus_tag LOCUS_05940 4542 4835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05940 4814 5560 gene locus_tag LOCUS_05950 4814 5560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05950 5604 6269 gene locus_tag LOCUS_05960 5604 6269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05960 6262 6447 gene locus_tag LOCUS_05970 6262 6447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05970 7499 8002 gene locus_tag LOCUS_05980 7499 8002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05980 8392 9360 gene locus_tag LOCUS_05990 8392 9360 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_057443118.1 protein_id gnl|my_center|LOCUS_05990 >Feature sequence0060 <1 1439 gene locus_tag LOCUS_06000 <1 1439 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003810859.1:S9 family peptidase 1690 3657 gene locus_tag LOCUS_06010 1690 3657 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012438954.1 protein_id gnl|my_center|LOCUS_06010 4945 3779 gene locus_tag LOCUS_06020 4945 3779 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388935.1 protein_id gnl|my_center|LOCUS_06020 5823 5029 gene locus_tag LOCUS_06030 5823 5029 CDS product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096592.1 protein_id gnl|my_center|LOCUS_06030 7071 6067 gene locus_tag LOCUS_06040 7071 6067 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545714.1 protein_id gnl|my_center|LOCUS_06040 8160 7564 gene locus_tag LOCUS_06050 8160 7564 CDS product DNA-3-methyladenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087248.1 protein_id gnl|my_center|LOCUS_06050 9141 8353 gene locus_tag LOCUS_06060 9141 8353 CDS product Nif3-like dinuclear metal center hexameric protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480305.1 protein_id gnl|my_center|LOCUS_06060 >Feature sequence0061 4872 1765 gene locus_tag LOCUS_06070 4872 1765 CDS product MdtB/MuxB family multidrug efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204974.1 protein_id gnl|my_center|LOCUS_06070 6178 5033 gene locus_tag LOCUS_06080 6178 5033 CDS product MdtA/MuxA family multidrug efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004534674.1 protein_id gnl|my_center|LOCUS_06080 6285 6578 gene locus_tag LOCUS_06090 6285 6578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06090 6770 7513 gene locus_tag LOCUS_06100 6770 7513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06100 9284 7926 gene locus_tag LOCUS_06110 9284 7926 CDS product tryptophanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404453.1 protein_id gnl|my_center|LOCUS_06110 9803 9285 gene locus_tag LOCUS_06120 9803 9285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06120 >Feature sequence0062 1173 610 gene locus_tag LOCUS_06130 gene rfbC 1173 610 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142202.1 protein_id gnl|my_center|LOCUS_06130 2286 1261 gene locus_tag LOCUS_06140 2286 1261 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257100.1 protein_id gnl|my_center|LOCUS_06140 3326 2388 gene locus_tag LOCUS_06150 3326 2388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06150 4898 3363 gene locus_tag LOCUS_06160 4898 3363 CDS product lipopolysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528104.1 protein_id gnl|my_center|LOCUS_06160 5860 4895 gene locus_tag LOCUS_06170 5860 4895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06170 7222 6215 gene locus_tag LOCUS_06180 7222 6215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06180 8623 7349 gene locus_tag LOCUS_06190 8623 7349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06190 9802 8798 gene locus_tag LOCUS_06200 9802 8798 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081431.1 protein_id gnl|my_center|LOCUS_06200 >Feature sequence0063 329 676 gene locus_tag LOCUS_06210 329 676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06210 2982 730 gene locus_tag LOCUS_06220 2982 730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06220 3172 3666 gene locus_tag LOCUS_06230 3172 3666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06230 4155 3730 gene locus_tag LOCUS_06240 4155 3730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06240 4887 4204 gene locus_tag LOCUS_06250 4887 4204 CDS product RES family NAD+ phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390641.1 protein_id gnl|my_center|LOCUS_06250 5330 4884 gene locus_tag LOCUS_06260 5330 4884 CDS product MbcA/ParS/Xre antitoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525097.1 protein_id gnl|my_center|LOCUS_06260 5679 5467 gene locus_tag LOCUS_06270 5679 5467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06270 5896 6747 gene locus_tag LOCUS_06280 5896 6747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06280 7036 7350 gene locus_tag LOCUS_06290 7036 7350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06290 7364 8263 gene locus_tag LOCUS_06300 7364 8263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06300 9360 8578 gene locus_tag LOCUS_06310 9360 8578 CDS product TerC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142748.1 protein_id gnl|my_center|LOCUS_06310 >Feature sequence0064 <1 2686 gene locus_tag LOCUS_06320 <1 2686 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011144060.1:serine/threonine-protein kinase 2851 3066 gene locus_tag LOCUS_06330 2851 3066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06330 3111 3596 gene locus_tag LOCUS_06340 3111 3596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06340 3603 4628 gene locus_tag LOCUS_06350 3603 4628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06350 4948 5391 gene locus_tag LOCUS_06360 4948 5391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06360 5626 7038 gene locus_tag LOCUS_06370 gene fumC 5626 7038 CDS product class II fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083118.1 protein_id gnl|my_center|LOCUS_06370 7648 8943 gene locus_tag LOCUS_06380 7648 8943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06380 >Feature sequence0065 2011 1190 gene locus_tag LOCUS_06390 2011 1190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06390 3103 2018 gene locus_tag LOCUS_06400 gene aroC 3103 2018 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056316.1 protein_id gnl|my_center|LOCUS_06400 3407 4312 gene locus_tag LOCUS_06410 3407 4312 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193396.1 protein_id gnl|my_center|LOCUS_06410 4716 5879 gene locus_tag LOCUS_06420 4716 5879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06420 5967 6701 gene locus_tag LOCUS_06430 5967 6701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06430 7285 6734 gene locus_tag LOCUS_06440 7285 6734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06440 7404 8420 gene locus_tag LOCUS_06450 7404 8420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06450 8710 9339 gene locus_tag LOCUS_06460 8710 9339 CDS product L,D-transpeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928634.1 protein_id gnl|my_center|LOCUS_06460 >Feature sequence0066 155 898 gene locus_tag LOCUS_06470 155 898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06470 2377 965 gene locus_tag LOCUS_06480 2377 965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06480 2647 3852 gene locus_tag LOCUS_06490 2647 3852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06490 3914 4960 gene locus_tag LOCUS_06500 3914 4960 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194045.1 protein_id gnl|my_center|LOCUS_06500 4957 5664 gene locus_tag LOCUS_06510 4957 5664 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194086.1 protein_id gnl|my_center|LOCUS_06510 7442 5724 gene locus_tag LOCUS_06520 7442 5724 CDS product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257227.1 protein_id gnl|my_center|LOCUS_06520 7920 9335 gene locus_tag LOCUS_06530 7920 9335 CDS product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257227.1 protein_id gnl|my_center|LOCUS_06530 >Feature sequence0067 140 850 gene locus_tag LOCUS_06540 140 850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06540 999 1244 gene locus_tag LOCUS_06550 999 1244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06550 1248 1844 gene locus_tag LOCUS_06560 1248 1844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06560 1872 2681 gene locus_tag LOCUS_06570 1872 2681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06570 2969 4759 gene locus_tag LOCUS_06580 2969 4759 CDS product PDZ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259046.1 protein_id gnl|my_center|LOCUS_06580 5426 5226 gene locus_tag LOCUS_06590 5426 5226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06590 5389 6537 gene locus_tag LOCUS_06600 5389 6537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06600 6817 6730 gene locus_tag LOCUS_t00080 6817 6730 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 7821 7606 gene locus_tag LOCUS_06610 7821 7606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06610 8043 7864 gene locus_tag LOCUS_06620 8043 7864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06620 >Feature sequence0068 901 1941 gene locus_tag LOCUS_06630 901 1941 CDS product zinc-dependent alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009902587.1 protein_id gnl|my_center|LOCUS_06630 2326 2907 gene locus_tag LOCUS_06640 2326 2907 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_184304752.1 protein_id gnl|my_center|LOCUS_06640 4356 3133 gene locus_tag LOCUS_06650 4356 3133 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085719.1 protein_id gnl|my_center|LOCUS_06650 7586 4377 gene locus_tag LOCUS_06660 7586 4377 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085718.1 protein_id gnl|my_center|LOCUS_06660 8594 7602 gene locus_tag LOCUS_06670 8594 7602 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085719.1 protein_id gnl|my_center|LOCUS_06670 8551 8754 gene locus_tag LOCUS_06680 8551 8754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06680 >Feature sequence0069 1486 1022 gene locus_tag LOCUS_06690 1486 1022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06690 4408 1577 gene locus_tag LOCUS_06700 4408 1577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06700 7436 4686 gene locus_tag LOCUS_06710 gene glnE 7436 4686 CDS product bifunctional [glutamate--ammonia ligase]-adenylyl-L-tyrosine phosphorylase/[glutamate--ammonia-ligase] adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943989.1 protein_id gnl|my_center|LOCUS_06710 8200 7442 gene locus_tag LOCUS_06720 8200 7442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06720 9344 8478 gene locus_tag LOCUS_06730 9344 8478 CDS product diacylglycerol kinase family lipid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258345.1 protein_id gnl|my_center|LOCUS_06730 >Feature sequence0070 2315 3259 gene locus_tag LOCUS_06740 2315 3259 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113857.1 protein_id gnl|my_center|LOCUS_06740 3256 3987 gene locus_tag LOCUS_06750 3256 3987 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113858.1 protein_id gnl|my_center|LOCUS_06750 3993 5909 gene locus_tag LOCUS_06760 3993 5909 CDS product GldG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092447.1 protein_id gnl|my_center|LOCUS_06760 5906 7348 gene locus_tag LOCUS_06770 5906 7348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06770 7715 8974 gene locus_tag LOCUS_06780 7715 8974 CDS product anti-phage deoxyguanosine triphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888443.1 protein_id gnl|my_center|LOCUS_06780 >Feature sequence0071 739 1623 gene locus_tag LOCUS_06790 739 1623 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088409.1 protein_id gnl|my_center|LOCUS_06790 1977 3110 gene locus_tag LOCUS_06800 1977 3110 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256669.1 protein_id gnl|my_center|LOCUS_06800 3111 4094 gene locus_tag LOCUS_06810 3111 4094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06810 4144 5019 gene locus_tag LOCUS_06820 4144 5019 CDS product XdhC/CoxI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940877.1 protein_id gnl|my_center|LOCUS_06820 5019 5627 gene locus_tag LOCUS_06830 5019 5627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06830 6999 5776 gene locus_tag LOCUS_06840 gene uxaC 6999 5776 CDS product glucuronate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765680.1 protein_id gnl|my_center|LOCUS_06840 7282 8553 gene locus_tag LOCUS_06850 7282 8553 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098861.1 protein_id gnl|my_center|LOCUS_06850 >Feature sequence0072 58 666 gene locus_tag LOCUS_06860 58 666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06860 1500 859 gene locus_tag LOCUS_06870 1500 859 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141682.1 protein_id gnl|my_center|LOCUS_06870 3040 1751 gene locus_tag LOCUS_06880 3040 1751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06880 4092 3334 gene locus_tag LOCUS_06890 4092 3334 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141682.1 protein_id gnl|my_center|LOCUS_06890 4577 4359 gene locus_tag LOCUS_06900 4577 4359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06900 6120 4552 gene locus_tag LOCUS_06910 6120 4552 CDS product mechanosensitive ion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973731.1 protein_id gnl|my_center|LOCUS_06910 6920 6297 gene locus_tag LOCUS_06920 6920 6297 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339004.1 protein_id gnl|my_center|LOCUS_06920 8018 7089 gene locus_tag LOCUS_06930 8018 7089 CDS product ring-cleaving dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086031.1 protein_id gnl|my_center|LOCUS_06930 <9471 8015 gene locus_tag LOCUS_06940 <9471 8015 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_169351683.1:sigma 54-interacting transcriptional regulator >Feature sequence0073 1549 1349 gene locus_tag LOCUS_06950 1549 1349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06950 2769 1813 gene locus_tag LOCUS_06960 2769 1813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06960 3307 3804 gene locus_tag LOCUS_06970 3307 3804 CDS product ferritin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001022822.1 protein_id gnl|my_center|LOCUS_06970 3849 4127 gene locus_tag LOCUS_06980 3849 4127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06980 4567 4331 gene locus_tag LOCUS_06990 4567 4331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06990 5932 5036 gene locus_tag LOCUS_07000 5932 5036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07000 6935 6138 gene locus_tag LOCUS_07010 6935 6138 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096673.1 protein_id gnl|my_center|LOCUS_07010 7743 7468 gene locus_tag LOCUS_07020 7743 7468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07020 7842 8783 gene locus_tag LOCUS_07030 7842 8783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07030 >Feature sequence0074 320 51 gene locus_tag LOCUS_07040 320 51 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07040 535 1305 gene locus_tag LOCUS_07050 535 1305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07050 1879 2625 gene locus_tag LOCUS_07060 1879 2625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07060 2615 3829 gene locus_tag LOCUS_07070 2615 3829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07070 3826 5724 gene locus_tag LOCUS_07080 3826 5724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07080 6939 6079 gene locus_tag LOCUS_07090 gene qorB 6939 6079 CDS product NAD(P)H:quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000560592.1 protein_id gnl|my_center|LOCUS_07090 7144 7521 gene locus_tag LOCUS_07100 7144 7521 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000816344.1 protein_id gnl|my_center|LOCUS_07100 7878 8057 gene locus_tag LOCUS_07110 7878 8057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07110 8241 7999 gene locus_tag LOCUS_07120 8241 7999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07120 8720 8361 gene locus_tag LOCUS_07130 8720 8361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07130 >Feature sequence0075 1424 843 gene locus_tag LOCUS_07140 1424 843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_07140 1857 1654 gene locus_tag LOCUS_07150 1857 1654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07150 3392 2328 gene locus_tag LOCUS_07160 3392 2328 CDS product lysylphosphatidylglycerol synthase transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932827.1 protein_id gnl|my_center|LOCUS_07160 3691 4428 gene locus_tag LOCUS_07170 3691 4428 CDS product LssY C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970478.1 protein_id gnl|my_center|LOCUS_07170 4762 4983 gene locus_tag LOCUS_07180 4762 4983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07180 5934 5005 gene locus_tag LOCUS_07190 5934 5005 CDS product acetamidase/formamidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895776.1 protein_id gnl|my_center|LOCUS_07190 7780 6215 gene locus_tag LOCUS_07200 7780 6215 CDS product Hsp70 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015077.1 protein_id gnl|my_center|LOCUS_07200 8323 8712 gene locus_tag LOCUS_07210 8323 8712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07210 >Feature sequence0076 847 1026 gene locus_tag LOCUS_07220 847 1026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07220 1180 980 gene locus_tag LOCUS_07230 1180 980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07230 2753 2217 gene locus_tag LOCUS_07240 2753 2217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07240 3265 2750 gene locus_tag LOCUS_07250 3265 2750 CDS product ASCH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259197.1 protein_id gnl|my_center|LOCUS_07250 4364 3255 gene locus_tag LOCUS_07260 4364 3255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07260 5163 4519 gene locus_tag LOCUS_07270 5163 4519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07270 7551 6103 gene locus_tag LOCUS_07280 7551 6103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07280 8018 7548 gene locus_tag LOCUS_07290 8018 7548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929475.1 protein_id gnl|my_center|LOCUS_07290 >Feature sequence0077 494 991 gene locus_tag LOCUS_07300 494 991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07300 1175 1390 gene locus_tag LOCUS_07310 1175 1390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07310 1414 1623 gene locus_tag LOCUS_07320 1414 1623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07320 2754 2338 gene locus_tag LOCUS_07330 2754 2338 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083055.1 protein_id gnl|my_center|LOCUS_07330 3374 3003 gene locus_tag LOCUS_07340 3374 3003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07340 3494 4480 gene locus_tag LOCUS_07350 3494 4480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07350 4599 4817 gene locus_tag LOCUS_07360 4599 4817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07360 5883 5110 gene locus_tag LOCUS_07370 5883 5110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07370 6247 7809 gene locus_tag LOCUS_07380 gene cimA 6247 7809 CDS product citramalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583555.1 protein_id gnl|my_center|LOCUS_07380 7879 8661 gene locus_tag LOCUS_07390 7879 8661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07390 >Feature sequence0078 249 1418 gene locus_tag LOCUS_07400 gene dnaJ 249 1418 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194374.1 protein_id gnl|my_center|LOCUS_07400 1593 2354 gene locus_tag LOCUS_07410 1593 2354 CDS product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048001.1 protein_id gnl|my_center|LOCUS_07410 2351 3601 gene locus_tag LOCUS_07420 2351 3601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07420 3573 4424 gene locus_tag LOCUS_07430 gene murI 3573 4424 CDS product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545640.1 protein_id gnl|my_center|LOCUS_07430 4580 4789 gene locus_tag LOCUS_07440 4580 4789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07440 5950 4673 gene locus_tag LOCUS_07450 gene larA 5950 4673 CDS product nickel-dependent lactate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002484568.1 protein_id gnl|my_center|LOCUS_07450 6513 6055 gene locus_tag LOCUS_07460 6513 6055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07460 7310 6801 gene locus_tag LOCUS_07470 7310 6801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07470 8494 7637 gene locus_tag LOCUS_07480 8494 7637 CDS product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259324.1 protein_id gnl|my_center|LOCUS_07480 >Feature sequence0079 1657 2667 gene locus_tag LOCUS_07490 1657 2667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07490 3135 3875 gene locus_tag LOCUS_07500 3135 3875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07500 3916 4767 gene locus_tag LOCUS_07510 3916 4767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07510 4668 5501 gene locus_tag LOCUS_07520 4668 5501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07520 7244 5511 gene locus_tag LOCUS_07530 7244 5511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07530 8744 7902 gene locus_tag LOCUS_07540 8744 7902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07540 >Feature sequence0080 1586 2032 gene locus_tag LOCUS_07550 1586 2032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07550 2358 2092 gene locus_tag LOCUS_07560 2358 2092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07560 3433 2645 gene locus_tag LOCUS_07570 3433 2645 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230679.1 protein_id gnl|my_center|LOCUS_07570 4582 3707 gene locus_tag LOCUS_07580 4582 3707 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230680.1 protein_id gnl|my_center|LOCUS_07580 5733 4579 gene locus_tag LOCUS_07590 5733 4579 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230681.1 protein_id gnl|my_center|LOCUS_07590 7141 6104 gene locus_tag LOCUS_07600 7141 6104 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_200876235.1 protein_id gnl|my_center|LOCUS_07600 7167 7367 gene locus_tag LOCUS_07610 7167 7367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07610 8460 7939 gene locus_tag LOCUS_07620 8460 7939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07620 >Feature sequence0081 275 502 gene locus_tag LOCUS_07630 275 502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07630 435 779 gene locus_tag LOCUS_07640 435 779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07640 2360 792 gene locus_tag LOCUS_07650 2360 792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07650 2891 2604 gene locus_tag LOCUS_07660 2891 2604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07660 3421 2888 gene locus_tag LOCUS_07670 3421 2888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07670 3538 3750 gene locus_tag LOCUS_07680 3538 3750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07680 3860 5089 gene locus_tag LOCUS_07690 3860 5089 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258472.1 protein_id gnl|my_center|LOCUS_07690 5089 5907 gene locus_tag LOCUS_07700 5089 5907 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257603.1 protein_id gnl|my_center|LOCUS_07700 6698 7201 gene locus_tag LOCUS_07710 6698 7201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07710 7455 7883 gene locus_tag LOCUS_07720 7455 7883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07720 8792 8412 gene locus_tag LOCUS_07730 8792 8412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07730 >Feature sequence0082 2871 1072 gene locus_tag LOCUS_07740 2871 1072 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244082.1 protein_id gnl|my_center|LOCUS_07740 3783 4571 gene locus_tag LOCUS_07750 3783 4571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07750 4568 5203 gene locus_tag LOCUS_07760 4568 5203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07760 5234 5650 gene locus_tag LOCUS_07770 5234 5650 CDS product GNAT family acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004543851.1 protein_id gnl|my_center|LOCUS_07770 6118 5828 gene locus_tag LOCUS_07780 6118 5828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07780 6909 7088 gene locus_tag LOCUS_07790 6909 7088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07790 7472 7672 gene locus_tag LOCUS_07800 7472 7672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07800 8394 7834 gene locus_tag LOCUS_07810 8394 7834 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035528.1 protein_id gnl|my_center|LOCUS_07810 >Feature sequence0083 4045 2795 gene locus_tag LOCUS_07820 gene eno 4045 2795 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173981.1 protein_id gnl|my_center|LOCUS_07820 5061 4042 gene locus_tag LOCUS_07830 5061 4042 CDS product aminoglycoside phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459460.1 protein_id gnl|my_center|LOCUS_07830 5986 5342 gene locus_tag LOCUS_07840 gene dhaL 5986 5342 CDS product dihydroxyacetone kinase subunit DhaL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969459.1 protein_id gnl|my_center|LOCUS_07840 6989 5979 gene locus_tag LOCUS_07850 6989 5979 CDS product dihydroxyacetone kinase subunit DhaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002228229.1 protein_id gnl|my_center|LOCUS_07850 7380 8522 gene locus_tag LOCUS_07860 gene ugpC 7380 8522 CDS product sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267680.1 protein_id gnl|my_center|LOCUS_07860 >Feature sequence0084 2143 1031 gene locus_tag LOCUS_07870 gene hemW 2143 1031 CDS product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460876.1 protein_id gnl|my_center|LOCUS_07870 2449 3456 gene locus_tag LOCUS_07880 2449 3456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07880 3697 4647 gene locus_tag LOCUS_07890 3697 4647 CDS product phytoene/squalene synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004554743.1 protein_id gnl|my_center|LOCUS_07890 5826 4750 gene locus_tag LOCUS_07900 5826 4750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07900 7593 6334 gene locus_tag LOCUS_07910 gene purD 7593 6334 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545691.1 protein_id gnl|my_center|LOCUS_07910 8355 7597 gene locus_tag LOCUS_07920 8355 7597 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583839.1 protein_id gnl|my_center|LOCUS_07920 >Feature sequence0085 482 661 gene locus_tag LOCUS_07930 482 661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07930 1909 716 gene locus_tag LOCUS_07940 1909 716 CDS product DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324978.1 protein_id gnl|my_center|LOCUS_07940 2258 2500 gene locus_tag LOCUS_07950 2258 2500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07950 2675 3562 gene locus_tag LOCUS_07960 2675 3562 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258710.1 protein_id gnl|my_center|LOCUS_07960 3758 3549 gene locus_tag LOCUS_07970 3758 3549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07970 3780 3974 gene locus_tag LOCUS_07980 3780 3974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07980 3971 4408 gene locus_tag LOCUS_07990 3971 4408 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003410811.1 protein_id gnl|my_center|LOCUS_07990 4619 4383 gene locus_tag LOCUS_08000 4619 4383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08000 4650 4844 gene locus_tag LOCUS_08010 4650 4844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08010 4982 5887 gene locus_tag LOCUS_08020 4982 5887 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000423235.1 protein_id gnl|my_center|LOCUS_08020 6767 6144 gene locus_tag LOCUS_08030 6767 6144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08030 7341 6823 gene locus_tag LOCUS_08040 7341 6823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08040 <9082 7341 gene locus_tag LOCUS_08050 <9082 7341 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015776827.1:cbb3-type cytochrome c oxidase subunit I >Feature sequence0086 272 733 gene locus_tag LOCUS_08060 272 733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08060 756 1034 gene locus_tag LOCUS_08070 756 1034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08070 1021 1425 gene locus_tag LOCUS_08080 1021 1425 CDS product nitrile hydratase accessory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028174057.1 protein_id gnl|my_center|LOCUS_08080 1594 2307 gene locus_tag LOCUS_08090 1594 2307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08090 2614 2354 gene locus_tag LOCUS_08100 2614 2354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08100 2735 3604 gene locus_tag LOCUS_08110 2735 3604 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082270.1 protein_id gnl|my_center|LOCUS_08110 4272 4943 gene locus_tag LOCUS_08120 4272 4943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08120 5372 7051 gene locus_tag LOCUS_08130 5372 7051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08130 7283 8143 gene locus_tag LOCUS_08140 7283 8143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08140 8789 8349 gene locus_tag LOCUS_08150 8789 8349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08150 >Feature sequence0087 175 642 gene locus_tag LOCUS_08160 175 642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08160 639 1370 gene locus_tag LOCUS_08170 639 1370 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460478.1 protein_id gnl|my_center|LOCUS_08170 2373 1624 gene locus_tag LOCUS_08180 2373 1624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08180 3397 2543 gene locus_tag LOCUS_08190 gene cysW 3397 2543 CDS product sulfate ABC transporter permease subunit CysW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142072.1 protein_id gnl|my_center|LOCUS_08190 4256 3402 gene locus_tag LOCUS_08200 gene cysT 4256 3402 CDS product sulfate ABC transporter permease subunit CysT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928930.1 protein_id gnl|my_center|LOCUS_08200 5278 4253 gene locus_tag LOCUS_08210 5278 4253 CDS product sulfate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_072773820.1 protein_id gnl|my_center|LOCUS_08210 6076 5789 gene locus_tag LOCUS_08220 6076 5789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08220 8700 6913 gene locus_tag LOCUS_08230 8700 6913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08230 >Feature sequence0088 1031 126 gene locus_tag LOCUS_08240 1031 126 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530675.1 protein_id gnl|my_center|LOCUS_08240 2035 1028 gene locus_tag LOCUS_08250 2035 1028 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942605.1 protein_id gnl|my_center|LOCUS_08250 3024 2110 gene locus_tag LOCUS_08260 3024 2110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08260 4286 3012 gene locus_tag LOCUS_08270 4286 3012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08270 5710 4364 gene locus_tag LOCUS_08280 5710 4364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08280 6544 5726 gene locus_tag LOCUS_08290 6544 5726 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942150.1 protein_id gnl|my_center|LOCUS_08290 7141 6566 gene locus_tag LOCUS_08300 gene nusG 7141 6566 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008630512.1 protein_id gnl|my_center|LOCUS_08300 8738 7467 gene locus_tag LOCUS_08310 8738 7467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08310 >Feature sequence0089 1001 576 gene locus_tag LOCUS_08320 1001 576 CDS product organic hydroperoxide resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005063604.1 protein_id gnl|my_center|LOCUS_08320 1696 1088 gene locus_tag LOCUS_08330 1696 1088 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388643.1 protein_id gnl|my_center|LOCUS_08330 2181 3428 gene locus_tag LOCUS_08340 2181 3428 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403427.1 protein_id gnl|my_center|LOCUS_08340 3976 3904 gene locus_tag LOCUS_t00090 3976 3904 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 4164 5357 gene locus_tag LOCUS_08350 4164 5357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08350 5354 7552 gene locus_tag LOCUS_08360 gene glgB 5354 7552 CDS product 1,4-alpha-glucan branching protein GlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390326.1 protein_id gnl|my_center|LOCUS_08360 <8871 7815 gene locus_tag LOCUS_08370 <8871 7815 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000099131.1:exodeoxyribonuclease VII large subunit >Feature sequence0090 542 733 gene locus_tag LOCUS_08380 542 733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08380 767 1057 gene locus_tag LOCUS_08390 767 1057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08390 1106 2692 gene locus_tag LOCUS_08400 1106 2692 CDS product methyltransferase regulatory domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967728.1 protein_id gnl|my_center|LOCUS_08400 5554 3173 gene locus_tag LOCUS_08410 5554 3173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08410 7822 5858 gene locus_tag LOCUS_08420 7822 5858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08420 8081 8605 gene locus_tag LOCUS_08430 gene tssB 8081 8605 CDS product type VI secretion system contractile sheath small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083666.1 protein_id gnl|my_center|LOCUS_08430 >Feature sequence0091 435 1142 gene locus_tag LOCUS_08440 435 1142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08440 1786 1316 gene locus_tag LOCUS_08450 1786 1316 CDS product heme-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727730.1 protein_id gnl|my_center|LOCUS_08450 3621 1879 gene locus_tag LOCUS_08460 3621 1879 CDS product thiamine pyrophosphate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970775.1 protein_id gnl|my_center|LOCUS_08460 4347 3676 gene locus_tag LOCUS_08470 4347 3676 CDS product SCO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256468.1 protein_id gnl|my_center|LOCUS_08470 5180 4350 gene locus_tag LOCUS_08480 5180 4350 CDS product c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526491.1 protein_id gnl|my_center|LOCUS_08480 6825 5185 gene locus_tag LOCUS_08490 6825 5185 CDS product b(o/a)3-type cytochrome-c oxidase subunit 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004536008.1 protein_id gnl|my_center|LOCUS_08490 7394 6837 gene locus_tag LOCUS_08500 7394 6837 CDS product cytochrome c oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010102577.1 protein_id gnl|my_center|LOCUS_08500 7710 7489 gene locus_tag LOCUS_08510 7710 7489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08510 8430 7750 gene locus_tag LOCUS_08520 8430 7750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08520 >Feature sequence0092 1571 1218 gene locus_tag LOCUS_08530 1571 1218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08530 1714 1944 gene locus_tag LOCUS_08540 1714 1944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08540 1941 2375 gene locus_tag LOCUS_08550 1941 2375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08550 3867 2386 gene locus_tag LOCUS_08560 3867 2386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08560 5517 4084 gene locus_tag LOCUS_08570 5517 4084 CDS product NADH-quinone oxidoreductase subunit N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932458.1 protein_id gnl|my_center|LOCUS_08570 7000 5522 gene locus_tag LOCUS_08580 7000 5522 CDS product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392501.1 protein_id gnl|my_center|LOCUS_08580 <8760 6997 gene locus_tag LOCUS_08590 <8760 6997 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011392500.1:NADH-quinone oxidoreductase subunit L >Feature sequence0093 497 60 gene locus_tag LOCUS_08600 497 60 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08600 1450 2037 gene locus_tag LOCUS_08610 1450 2037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08610 2349 2200 gene locus_tag LOCUS_08620 2349 2200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08620 3745 3461 gene locus_tag LOCUS_08630 3745 3461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08630 4389 3742 gene locus_tag LOCUS_08640 4389 3742 CDS product cytochrome c oxidase subunit 3 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000100797.1 protein_id gnl|my_center|LOCUS_08640 6023 4386 gene locus_tag LOCUS_08650 gene ctaD 6023 4386 CDS product cytochrome c oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258008.1 protein_id gnl|my_center|LOCUS_08650 7009 6044 gene locus_tag LOCUS_08660 gene coxB 7009 6044 CDS product cytochrome c oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258007.1 protein_id gnl|my_center|LOCUS_08660 7824 7012 gene locus_tag LOCUS_08670 7824 7012 CDS product SCO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258006.1 protein_id gnl|my_center|LOCUS_08670 8285 7821 gene locus_tag LOCUS_08680 8285 7821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08680 >Feature sequence0094 <1 596 gene locus_tag LOCUS_08690 <1 596 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011022528.1:HEAT repeat domain-containing protein note possible pseudo, frameshifted 724 1905 gene locus_tag LOCUS_08700 724 1905 CDS product HEAT repeat domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022528.1 protein_id gnl|my_center|LOCUS_08700 2353 2090 gene locus_tag LOCUS_08710 2353 2090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08710 4512 3127 gene locus_tag LOCUS_08720 4512 3127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08720 6875 5037 gene locus_tag LOCUS_08730 6875 5037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08730 >Feature sequence0095 971 618 gene locus_tag LOCUS_08740 971 618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08740 1408 1007 gene locus_tag LOCUS_08750 1408 1007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08750 2534 1647 gene locus_tag LOCUS_08760 2534 1647 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173998.1 protein_id gnl|my_center|LOCUS_08760 3424 2531 gene locus_tag LOCUS_08770 3424 2531 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173997.1 protein_id gnl|my_center|LOCUS_08770 4738 3449 gene locus_tag LOCUS_08780 4738 3449 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173996.1 protein_id gnl|my_center|LOCUS_08780 4969 6288 gene locus_tag LOCUS_08790 gene algB 4969 6288 CDS product sigma-54-dependent response regulator transcription factor AlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102840.1 protein_id gnl|my_center|LOCUS_08790 6465 6298 gene locus_tag LOCUS_08800 6465 6298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08800 6536 8335 gene locus_tag LOCUS_08810 6536 8335 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963797.1 protein_id gnl|my_center|LOCUS_08810 >Feature sequence0096 664 410 gene locus_tag LOCUS_08820 664 410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08820 956 1366 gene locus_tag LOCUS_08830 956 1366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08830 5498 1926 gene locus_tag LOCUS_08840 5498 1926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08840 5770 6933 gene locus_tag LOCUS_08850 5770 6933 CDS product Xaa-Pro peptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967702.1 protein_id gnl|my_center|LOCUS_08850 8088 7144 gene locus_tag LOCUS_08860 8088 7144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08860 >Feature sequence0097 1621 593 gene locus_tag LOCUS_08870 1621 593 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035375.1 protein_id gnl|my_center|LOCUS_08870 1686 1910 gene locus_tag LOCUS_08880 1686 1910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08880 2547 2089 gene locus_tag LOCUS_08890 gene rpiB 2547 2089 CDS product ribose 5-phosphate isomerase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004187340.1 protein_id gnl|my_center|LOCUS_08890 3621 2614 gene locus_tag LOCUS_08900 3621 2614 CDS product dihydroxyacetone kinase subunit DhaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389115.1 protein_id gnl|my_center|LOCUS_08900 3629 4807 gene locus_tag LOCUS_08910 3629 4807 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963682.1 protein_id gnl|my_center|LOCUS_08910 4820 5470 gene locus_tag LOCUS_08920 4820 5470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08920 5658 5969 gene locus_tag LOCUS_08930 5658 5969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08930 6038 7249 gene locus_tag LOCUS_08940 6038 7249 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037392042.1 protein_id gnl|my_center|LOCUS_08940 <8545 7593 gene locus_tag LOCUS_08950 <8545 7593 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011203293.1:signal peptide peptidase SppA >Feature sequence0098 1342 3648 gene locus_tag LOCUS_08960 1342 3648 CDS product DNA translocase FtsK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943733.1 protein_id gnl|my_center|LOCUS_08960 3681 4658 gene locus_tag LOCUS_08970 3681 4658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08970 4667 6094 gene locus_tag LOCUS_08980 gene rimO 4667 6094 CDS product 30S ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943823.1 protein_id gnl|my_center|LOCUS_08980 6091 7269 gene locus_tag LOCUS_08990 6091 7269 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583708.1 protein_id gnl|my_center|LOCUS_08990 7273 8343 gene locus_tag LOCUS_09000 gene hflX 7273 8343 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000460377.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_09000 >Feature sequence0099 <1 1050 gene locus_tag LOCUS_09010 <1 1050 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_126140198.1:pectinesterase family protein 1480 1133 gene locus_tag LOCUS_09020 1480 1133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_09020 2200 1505 gene locus_tag LOCUS_09030 2200 1505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_09030 3475 2378 gene locus_tag LOCUS_09040 gene alr 3475 2378 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071542276.1 protein_id gnl|my_center|LOCUS_09040 4327 3881 gene locus_tag LOCUS_09050 4327 3881 CDS product DoxX family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941174.1 protein_id gnl|my_center|LOCUS_09050 4746 4324 gene locus_tag LOCUS_09060 4746 4324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09060 5318 4743 gene locus_tag LOCUS_09070 5318 4743 CDS product DUF1573 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943348.1 protein_id gnl|my_center|LOCUS_09070 5441 6064 gene locus_tag LOCUS_09080 5441 6064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09080 6112 6609 gene locus_tag LOCUS_09090 6112 6609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09090 7341 6664 gene locus_tag LOCUS_09100 7341 6664 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905122.1 protein_id gnl|my_center|LOCUS_09100 7526 7338 gene locus_tag LOCUS_09110 7526 7338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09110 >Feature sequence0100 1778 840 gene locus_tag LOCUS_09120 1778 840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09120 2689 1889 gene locus_tag LOCUS_09130 2689 1889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09130 3220 3603 gene locus_tag LOCUS_09140 3220 3603 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143848.1 protein_id gnl|my_center|LOCUS_09140 3985 4200 gene locus_tag LOCUS_09150 3985 4200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09150 4557 6269 gene locus_tag LOCUS_09160 4557 6269 CDS product SulP family inorganic anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065280.1 protein_id gnl|my_center|LOCUS_09160 6293 6733 gene locus_tag LOCUS_09170 6293 6733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09170 6793 7380 gene locus_tag LOCUS_09180 6793 7380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09180 7501 7740 gene locus_tag LOCUS_09190 7501 7740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09190 >Feature sequence0101 <1 1478 gene locus_tag LOCUS_09200 <1 1478 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011392708.1:FAD-dependent oxidoreductase 1480 1950 gene locus_tag LOCUS_09210 1480 1950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09210 2127 3230 gene locus_tag LOCUS_09220 2127 3230 CDS product cytochrome bc complex cytochrome b subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942293.1 protein_id gnl|my_center|LOCUS_09220 3232 4620 gene locus_tag LOCUS_09230 3232 4620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09230 4717 5412 gene locus_tag LOCUS_09240 4717 5412 CDS product phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064926.1 protein_id gnl|my_center|LOCUS_09240 5833 5666 gene locus_tag LOCUS_09250 5833 5666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09250 7322 6024 gene locus_tag LOCUS_09260 7322 6024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09260 <8412 7339 gene locus_tag LOCUS_09270 <8412 7339 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005114807.1:divalent metal cation transporter >Feature sequence0102 1145 2197 gene locus_tag LOCUS_09280 1145 2197 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228694.1 protein_id gnl|my_center|LOCUS_09280 2777 4369 gene locus_tag LOCUS_09290 2777 4369 CDS product FAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444518.1 protein_id gnl|my_center|LOCUS_09290 6108 4588 gene locus_tag LOCUS_09300 6108 4588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09300 6197 7594 gene locus_tag LOCUS_09310 6197 7594 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088030.1 protein_id gnl|my_center|LOCUS_09310 >Feature sequence0103 901 2724 gene locus_tag LOCUS_09320 901 2724 CDS product putative porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112715.1 protein_id gnl|my_center|LOCUS_09320 2727 3434 gene locus_tag LOCUS_09330 2727 3434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09330 3689 4510 gene locus_tag LOCUS_09340 3689 4510 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527206.1 protein_id gnl|my_center|LOCUS_09340 5507 6535 gene locus_tag LOCUS_09350 5507 6535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09350 >Feature sequence0104 1 855 gene locus_tag LOCUS_09360 1 855 CDS product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530665.1 protein_id gnl|my_center|LOCUS_09360 873 1955 gene locus_tag LOCUS_09370 873 1955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729753.1 protein_id gnl|my_center|LOCUS_09370 2092 2559 gene locus_tag LOCUS_09380 2092 2559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09380 3062 2880 gene locus_tag LOCUS_09390 3062 2880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09390 3625 4293 gene locus_tag LOCUS_09400 3625 4293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09400 4370 5101 gene locus_tag LOCUS_09410 4370 5101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09410 8284 5120 gene locus_tag LOCUS_09420 8284 5120 CDS product ligand-binding sensor domain-containing diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038432.1 protein_id gnl|my_center|LOCUS_09420 >Feature sequence0105 2130 631 gene locus_tag LOCUS_09430 2130 631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09430 3326 2127 gene locus_tag LOCUS_09440 3326 2127 CDS product DUF4105 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405075.1 protein_id gnl|my_center|LOCUS_09440 5662 3716 gene locus_tag LOCUS_09450 5662 3716 CDS product phospho-sugar mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786230.1 protein_id gnl|my_center|LOCUS_09450 5927 6811 gene locus_tag LOCUS_09460 5927 6811 CDS product class I SAM-dependent rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888469.1 protein_id gnl|my_center|LOCUS_09460 7073 7261 gene locus_tag LOCUS_09470 7073 7261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09470 7849 7358 gene locus_tag LOCUS_09480 7849 7358 CDS product dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941234.1 protein_id gnl|my_center|LOCUS_09480 >Feature sequence0106 447 2711 gene locus_tag LOCUS_09490 447 2711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09490 3951 2842 gene locus_tag LOCUS_09500 3951 2842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09500 4511 4341 gene locus_tag LOCUS_09510 4511 4341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09510 4517 5269 gene locus_tag LOCUS_09520 4517 5269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09520 5262 5456 gene locus_tag LOCUS_09530 5262 5456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09530 5764 6678 gene locus_tag LOCUS_09540 5764 6678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09540 7782 6895 gene locus_tag LOCUS_09550 7782 6895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09550 >Feature sequence0107 2137 776 gene locus_tag LOCUS_09560 2137 776 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272601.1 protein_id gnl|my_center|LOCUS_09560 3932 2622 gene locus_tag LOCUS_09570 3932 2622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09570 7825 4295 gene locus_tag LOCUS_09580 7825 4295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09580 >Feature sequence0108 1003 629 gene locus_tag LOCUS_09590 gene uraH 1003 629 CDS product hydroxyisourate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013850504.1 protein_id gnl|my_center|LOCUS_09590 1518 1000 gene locus_tag LOCUS_09600 gene uraD 1518 1000 CDS product 2-oxo-4-hydroxy-4-carboxy-5-ureidoimidazoline decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640536.1 protein_id gnl|my_center|LOCUS_09600 1925 2767 gene locus_tag LOCUS_09610 gene pucL 1925 2767 CDS product urate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223818.1 protein_id gnl|my_center|LOCUS_09610 2873 3697 gene locus_tag LOCUS_09620 2873 3697 CDS product XdhC/CoxI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003386049.1 protein_id gnl|my_center|LOCUS_09620 7641 3724 gene locus_tag LOCUS_09630 7641 3724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09630 >Feature sequence0109 269 1435 gene locus_tag LOCUS_09640 269 1435 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966352.1 protein_id gnl|my_center|LOCUS_09640 2593 1478 gene locus_tag LOCUS_09650 2593 1478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09650 3731 2586 gene locus_tag LOCUS_09660 3731 2586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09660 4644 5150 gene locus_tag LOCUS_09670 4644 5150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09670 5404 6807 gene locus_tag LOCUS_09680 5404 6807 CDS product undecaprenyl-phosphate glucose phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788605.1 protein_id gnl|my_center|LOCUS_09680 >Feature sequence0110 <1 4219 gene locus_tag LOCUS_09690 <1 4219 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000686845.1:AAA family ATPase 4405 5010 gene locus_tag LOCUS_09700 4405 5010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09700 5149 6978 gene locus_tag LOCUS_09710 gene poxB 5149 6978 CDS product ubiquinone-dependent pyruvate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090021.1 protein_id gnl|my_center|LOCUS_09710 7099 8052 gene locus_tag LOCUS_09720 7099 8052 CDS product 2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963416.1 protein_id gnl|my_center|LOCUS_09720 >Feature sequence0111 1937 549 gene locus_tag LOCUS_09730 1937 549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09730 2092 1955 gene locus_tag LOCUS_09740 2092 1955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09740 2145 2396 gene locus_tag LOCUS_09750 2145 2396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09750 3135 3392 gene locus_tag LOCUS_09760 3135 3392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09760 >Feature sequence0112 3967 2678 gene locus_tag LOCUS_09770 3967 2678 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028172666.1 protein_id gnl|my_center|LOCUS_09770 7083 4171 gene locus_tag LOCUS_09780 7083 4171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09780 7788 7714 gene locus_tag LOCUS_t00100 7788 7714 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence0113 1297 758 gene locus_tag LOCUS_09790 1297 758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09790 1695 1420 gene locus_tag LOCUS_09800 1695 1420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09800 2242 1832 gene locus_tag LOCUS_09810 2242 1832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09810 2328 3749 gene locus_tag LOCUS_09820 gene cls 2328 3749 CDS product cardiolipin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029629072.1 protein_id gnl|my_center|LOCUS_09820 3969 4376 gene locus_tag LOCUS_09830 3969 4376 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265510.1 protein_id gnl|my_center|LOCUS_09830 5444 4623 gene locus_tag LOCUS_09840 5444 4623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09840 6136 5441 gene locus_tag LOCUS_09850 6136 5441 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938539.1 protein_id gnl|my_center|LOCUS_09850 6630 6154 gene locus_tag LOCUS_09860 gene mlaD 6630 6154 CDS product outer membrane lipid asymmetry maintenance protein MlaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938540.1 protein_id gnl|my_center|LOCUS_09860 7736 7026 gene locus_tag LOCUS_09870 7736 7026 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546205.1 protein_id gnl|my_center|LOCUS_09870 <8257 7733 gene locus_tag LOCUS_09880 <8257 7733 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010938542.1:ABC transporter permease >Feature sequence0114 2154 1234 gene locus_tag LOCUS_09890 2154 1234 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143217.1 protein_id gnl|my_center|LOCUS_09890 3532 2231 gene locus_tag LOCUS_09900 3532 2231 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966003.1 protein_id gnl|my_center|LOCUS_09900 4089 3562 gene locus_tag LOCUS_09910 4089 3562 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729104.1 protein_id gnl|my_center|LOCUS_09910 4888 5352 gene locus_tag LOCUS_09920 4888 5352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09920 5715 5470 gene locus_tag LOCUS_09930 5715 5470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09930 6293 8185 gene locus_tag LOCUS_09940 6293 8185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09940 >Feature sequence0115 891 427 gene locus_tag LOCUS_09950 891 427 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034855332.1 protein_id gnl|my_center|LOCUS_09950 1199 2320 gene locus_tag LOCUS_09960 1199 2320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09960 2378 3499 gene locus_tag LOCUS_09970 2378 3499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09970 3499 4953 gene locus_tag LOCUS_09980 3499 4953 CDS product MBOAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119569.1 protein_id gnl|my_center|LOCUS_09980 5092 5730 gene locus_tag LOCUS_09990 gene clpP 5092 5730 CDS product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193408.1 protein_id gnl|my_center|LOCUS_09990 6430 5693 gene locus_tag LOCUS_10000 6430 5693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10000 8077 6530 gene locus_tag LOCUS_10010 8077 6530 CDS product glucosyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000561375.1 protein_id gnl|my_center|LOCUS_10010 >Feature sequence0116 <1 2181 gene locus_tag LOCUS_10020 <1 2181 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000767848.1:TonB-dependent receptor 2441 3133 gene locus_tag LOCUS_10030 2441 3133 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257731.1 protein_id gnl|my_center|LOCUS_10030 3182 3742 gene locus_tag LOCUS_10040 3182 3742 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257731.1 protein_id gnl|my_center|LOCUS_10040 3739 4326 gene locus_tag LOCUS_10050 3739 4326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10050 5008 4379 gene locus_tag LOCUS_10060 gene bioD 5008 4379 CDS product dethiobiotin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942228.1 protein_id gnl|my_center|LOCUS_10060 6494 5148 gene locus_tag LOCUS_10070 gene glmM 6494 5148 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938578.1 protein_id gnl|my_center|LOCUS_10070 6886 6722 gene locus_tag LOCUS_10080 6886 6722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10080 7687 6890 gene locus_tag LOCUS_10090 gene cdaA 7687 6890 CDS product diadenylate cyclase CdaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545037.1 protein_id gnl|my_center|LOCUS_10090 <8204 7681 gene locus_tag LOCUS_10100 <8204 7681 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011948526.1:dihydropteroate synthase >Feature sequence0117 4157 2862 gene locus_tag LOCUS_10110 4157 2862 CDS product MdtA/MuxA family multidrug efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004534674.1 protein_id gnl|my_center|LOCUS_10110 6183 4795 gene locus_tag LOCUS_10120 6183 4795 CDS product heterodisulfide reductase-related iron-sulfur binding cluster inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143065.1 protein_id gnl|my_center|LOCUS_10120 7625 6183 gene locus_tag LOCUS_10130 7625 6183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10130 >Feature sequence0118 894 481 gene locus_tag LOCUS_10140 894 481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10140 1005 1229 gene locus_tag LOCUS_10150 1005 1229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10150 2091 1210 gene locus_tag LOCUS_10160 2091 1210 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089011.1 protein_id gnl|my_center|LOCUS_10160 2749 2474 gene locus_tag LOCUS_10170 2749 2474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10170 3683 3105 gene locus_tag LOCUS_10180 3683 3105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10180 4162 5022 gene locus_tag LOCUS_10190 4162 5022 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530928.1 protein_id gnl|my_center|LOCUS_10190 5882 5619 gene locus_tag LOCUS_10200 5882 5619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10200 6314 5928 gene locus_tag LOCUS_10210 6314 5928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10210 6819 6562 gene locus_tag LOCUS_10220 6819 6562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10220 >Feature sequence0119 1601 1251 gene locus_tag LOCUS_10230 1601 1251 CDS product lipid-A-disaccharide synthase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087215.1 protein_id gnl|my_center|LOCUS_10230 3960 1852 gene locus_tag LOCUS_10240 3960 1852 CDS product S53 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004528841.1 protein_id gnl|my_center|LOCUS_10240 4637 4296 gene locus_tag LOCUS_10250 4637 4296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10250 6929 4935 gene locus_tag LOCUS_10260 6929 4935 CDS product S53 family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230264.1 protein_id gnl|my_center|LOCUS_10260 >Feature sequence0120 974 1876 gene locus_tag LOCUS_10270 974 1876 CDS product cyclase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729452.1 protein_id gnl|my_center|LOCUS_10270 4210 2084 gene locus_tag LOCUS_10280 gene glgX 4210 2084 CDS product glycogen debranching protein GlgX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113651.1 protein_id gnl|my_center|LOCUS_10280 5739 4231 gene locus_tag LOCUS_10290 5739 4231 CDS product deoxyribodipyrimidine photo-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259342.1 protein_id gnl|my_center|LOCUS_10290 6290 5964 gene locus_tag LOCUS_10300 6290 5964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10300 7527 6430 gene locus_tag LOCUS_10310 7527 6430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10310 <8030 7524 gene locus_tag LOCUS_10320 <8030 7524 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_236615986.1:aldehyde dehydrogenase family protein >Feature sequence0121 <1 741 gene locus_tag LOCUS_10330 <1 741 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010880264.1:Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB 4319 978 gene locus_tag LOCUS_10340 4319 978 CDS product M1 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928589.1 protein_id gnl|my_center|LOCUS_10340 5504 4407 gene locus_tag LOCUS_10350 5504 4407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10350 6047 5709 gene locus_tag LOCUS_10360 6047 5709 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384997.1 protein_id gnl|my_center|LOCUS_10360 7528 6071 gene locus_tag LOCUS_10370 7528 6071 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198019.1 protein_id gnl|my_center|LOCUS_10370 >Feature sequence0122 <1 1038 gene locus_tag LOCUS_10380 <1 1038 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011204730.1:efflux transporter outer membrane subunit 1483 1121 gene locus_tag LOCUS_10390 1483 1121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10390 1702 1860 gene locus_tag LOCUS_10400 1702 1860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10400 2993 2496 gene locus_tag LOCUS_10410 2993 2496 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037398772.1 protein_id gnl|my_center|LOCUS_10410 6555 3349 gene locus_tag LOCUS_10420 6555 3349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140825.1 protein_id gnl|my_center|LOCUS_10420 7749 6757 gene locus_tag LOCUS_10430 7749 6757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10430 >Feature sequence0123 810 1166 gene locus_tag LOCUS_10440 810 1166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10440 1259 2527 gene locus_tag LOCUS_10450 1259 2527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10450 4126 4479 gene locus_tag LOCUS_10460 4126 4479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10460 4460 4978 gene locus_tag LOCUS_10470 4460 4978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10470 7298 6834 gene locus_tag LOCUS_10480 7298 6834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10480 >Feature sequence0124 227 1141 gene locus_tag LOCUS_10490 227 1141 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014551636.1 protein_id gnl|my_center|LOCUS_10490 1468 1043 gene locus_tag LOCUS_10500 1468 1043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10500 2367 1465 gene locus_tag LOCUS_10510 2367 1465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10510 3353 2613 gene locus_tag LOCUS_10520 3353 2613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10520 3999 3319 gene locus_tag LOCUS_10530 3999 3319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10530 4140 6539 gene locus_tag LOCUS_10540 4140 6539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10540 6734 7552 gene locus_tag LOCUS_10550 6734 7552 CDS product deoxyribonuclease IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256944.1 protein_id gnl|my_center|LOCUS_10550 >Feature sequence0125 573 2576 gene locus_tag LOCUS_10560 gene asnB 573 2576 CDS product asparagine synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976178.1 protein_id gnl|my_center|LOCUS_10560 2580 3911 gene locus_tag LOCUS_10570 2580 3911 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039986.1 protein_id gnl|my_center|LOCUS_10570 3925 5310 gene locus_tag LOCUS_10580 3925 5310 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206912.1 protein_id gnl|my_center|LOCUS_10580 5454 6737 gene locus_tag LOCUS_10590 5454 6737 CDS product amidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703346.1 protein_id gnl|my_center|LOCUS_10590 6968 7732 gene locus_tag LOCUS_10600 6968 7732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10600 >Feature sequence0126 723 409 gene locus_tag LOCUS_10610 723 409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10610 1194 2603 gene locus_tag LOCUS_10620 1194 2603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10620 2844 2668 gene locus_tag LOCUS_10630 2844 2668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10630 5107 3605 gene locus_tag LOCUS_10640 5107 3605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10640 6246 5821 gene locus_tag LOCUS_10650 6246 5821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10650 6482 6234 gene locus_tag LOCUS_10660 6482 6234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10660 7203 6796 gene locus_tag LOCUS_10670 7203 6796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10670 7371 7616 gene locus_tag LOCUS_10680 7371 7616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10680 7613 7822 gene locus_tag LOCUS_10690 7613 7822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10690 >Feature sequence0127 <1 1455 gene locus_tag LOCUS_10700 <1 1455 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012583112.1:ATP-dependent helicase 1899 2942 gene locus_tag LOCUS_10710 1899 2942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10710 2939 3202 gene locus_tag LOCUS_10720 2939 3202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10720 3594 3854 gene locus_tag LOCUS_10730 gene rpsO 3594 3854 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942237.1 protein_id gnl|my_center|LOCUS_10730 4222 6366 gene locus_tag LOCUS_10740 gene pnp 4222 6366 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545734.1 protein_id gnl|my_center|LOCUS_10740 >Feature sequence0128 1961 1437 gene locus_tag LOCUS_10750 1961 1437 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770403.1 protein_id gnl|my_center|LOCUS_10750 4592 2301 gene locus_tag LOCUS_10760 4592 2301 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197530050.1 protein_id gnl|my_center|LOCUS_10760 >Feature sequence0129 819 2033 gene locus_tag LOCUS_10770 819 2033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10770 2030 2875 gene locus_tag LOCUS_10780 2030 2875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10780 3022 3222 gene locus_tag LOCUS_10790 3022 3222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10790 3475 3723 gene locus_tag LOCUS_10800 3475 3723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10800 3781 4302 gene locus_tag LOCUS_10810 3781 4302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10810 4455 4865 gene locus_tag LOCUS_10820 4455 4865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_10820 7300 6215 gene locus_tag LOCUS_10830 7300 6215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10830 >Feature sequence0130 261 623 gene locus_tag LOCUS_10840 261 623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10840 2784 949 gene locus_tag LOCUS_10850 2784 949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10850 4362 3007 gene locus_tag LOCUS_10860 gene algB 4362 3007 CDS product sigma-54-dependent response regulator transcription factor AlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102840.1 protein_id gnl|my_center|LOCUS_10860 5677 4913 gene locus_tag LOCUS_10870 5677 4913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10870 >Feature sequence0131 1857 1063 gene locus_tag LOCUS_10880 1857 1063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10880 3342 2020 gene locus_tag LOCUS_10890 3342 2020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10890 4998 3568 gene locus_tag LOCUS_10900 4998 3568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10900 6321 5065 gene locus_tag LOCUS_10910 6321 5065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10910 >Feature sequence0132 2254 335 gene locus_tag LOCUS_10920 gene speA 2254 335 CDS product biosynthetic arginine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144058.1 protein_id gnl|my_center|LOCUS_10920 2791 2318 gene locus_tag LOCUS_10930 2791 2318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10930 3472 2951 gene locus_tag LOCUS_10940 3472 2951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10940 3747 3466 gene locus_tag LOCUS_10950 3747 3466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10950 4324 3740 gene locus_tag LOCUS_10960 4324 3740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10960 5357 4671 gene locus_tag LOCUS_10970 gene pgl 5357 4671 CDS product 6-phosphogluconolactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939587.1 protein_id gnl|my_center|LOCUS_10970 5833 5354 gene locus_tag LOCUS_10980 gene sixA 5833 5354 CDS product phosphohistidine phosphatase SixA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979596.1 protein_id gnl|my_center|LOCUS_10980 6935 5970 gene locus_tag LOCUS_10990 6935 5970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10990 7554 6919 gene locus_tag LOCUS_11000 gene tmk 7554 6919 CDS product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886759.1 protein_id gnl|my_center|LOCUS_11000 >Feature sequence0133 305 1255 gene locus_tag LOCUS_11010 305 1255 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037249854.1 protein_id gnl|my_center|LOCUS_11010 1565 1164 gene locus_tag LOCUS_11020 1565 1164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11020 3132 1606 gene locus_tag LOCUS_11030 3132 1606 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973485.1 protein_id gnl|my_center|LOCUS_11030 3216 4100 gene locus_tag LOCUS_11040 3216 4100 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965283.1 protein_id gnl|my_center|LOCUS_11040 4237 6177 gene locus_tag LOCUS_11050 4237 6177 CDS product RecQ family ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456651.1 protein_id gnl|my_center|LOCUS_11050 6693 7346 gene locus_tag LOCUS_11060 6693 7346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11060 >Feature sequence0134 858 1277 gene locus_tag LOCUS_11070 858 1277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11070 1673 1900 gene locus_tag LOCUS_11080 1673 1900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11080 2170 2367 gene locus_tag LOCUS_11090 2170 2367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11090 2484 2951 gene locus_tag LOCUS_11100 2484 2951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11100 3722 2967 gene locus_tag LOCUS_11110 3722 2967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11110 4907 3936 gene locus_tag LOCUS_11120 4907 3936 CDS product D-ribose ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975228.1 protein_id gnl|my_center|LOCUS_11120 6052 4985 gene locus_tag LOCUS_11130 6052 4985 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533059.1 protein_id gnl|my_center|LOCUS_11130 <7681 6070 gene locus_tag LOCUS_11140 <7681 6070 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013533058.1:sugar ABC transporter ATP-binding protein >Feature sequence0135 <1 1174 gene locus_tag LOCUS_11150 <1 1174 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004187990.1:S53 family peptidase 1248 2228 gene locus_tag LOCUS_11160 1248 2228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11160 3609 2359 gene locus_tag LOCUS_11170 3609 2359 CDS product TIGR03118 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928497.1 protein_id gnl|my_center|LOCUS_11170 4383 3631 gene locus_tag LOCUS_11180 4383 3631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11180 5071 6306 gene locus_tag LOCUS_11190 5071 6306 CDS product TCR/Tet family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615760.1 protein_id gnl|my_center|LOCUS_11190 7381 6878 gene locus_tag LOCUS_11200 7381 6878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11200 >Feature sequence0136 2190 370 gene locus_tag LOCUS_11210 2190 370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11210 2639 3037 gene locus_tag LOCUS_11220 2639 3037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11220 3959 3252 gene locus_tag LOCUS_11230 3959 3252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11230 4042 4725 gene locus_tag LOCUS_11240 4042 4725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11240 4761 5534 gene locus_tag LOCUS_11250 4761 5534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11250 5536 6462 gene locus_tag LOCUS_11260 5536 6462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11260 7227 7580 gene locus_tag LOCUS_11270 7227 7580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11270 >Feature sequence0137 <1 2740 gene locus_tag LOCUS_11280 <1 2740 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_082901088.1:autotransporter domain-containing protein 3161 3988 gene locus_tag LOCUS_11290 3161 3988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11290 7113 4066 gene locus_tag LOCUS_11300 7113 4066 CDS product FAD-binding and (Fe-S)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228347.1 protein_id gnl|my_center|LOCUS_11300 >Feature sequence0138 224 1966 gene locus_tag LOCUS_11310 224 1966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11310 1941 2915 gene locus_tag LOCUS_11320 1941 2915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11320 3181 5586 gene locus_tag LOCUS_11330 3181 5586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11330 5768 6856 gene locus_tag LOCUS_11340 5768 6856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11340 6900 7187 gene locus_tag LOCUS_11350 6900 7187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11350 >Feature sequence0139 919 647 gene locus_tag LOCUS_11360 919 647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11360 1199 927 gene locus_tag LOCUS_11370 1199 927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11370 2001 1447 gene locus_tag LOCUS_11380 2001 1447 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000764472.1 protein_id gnl|my_center|LOCUS_11380 3068 2013 gene locus_tag LOCUS_11390 3068 2013 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964071.1 protein_id gnl|my_center|LOCUS_11390 3265 3537 gene locus_tag LOCUS_11400 3265 3537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11400 4237 3614 gene locus_tag LOCUS_11410 4237 3614 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944761.1 protein_id gnl|my_center|LOCUS_11410 5488 4478 gene locus_tag LOCUS_11420 gene dusB 5488 4478 CDS product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434962.1 protein_id gnl|my_center|LOCUS_11420 5893 5513 gene locus_tag LOCUS_11430 5893 5513 CDS product STAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000406877.1 protein_id gnl|my_center|LOCUS_11430 6900 6223 gene locus_tag LOCUS_11440 6900 6223 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545169.1 protein_id gnl|my_center|LOCUS_11440 7394 6897 gene locus_tag LOCUS_11450 gene infC 7394 6897 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391235.1 protein_id gnl|my_center|LOCUS_11450 >Feature sequence0140 140 3454 gene locus_tag LOCUS_11460 140 3454 CDS product TAT-variant-translocated molybdopterin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258002.1 protein_id gnl|my_center|LOCUS_11460 3454 4905 gene locus_tag LOCUS_11470 gene nrfD 3454 4905 CDS product polysulfide reductase NrfD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404833.1 protein_id gnl|my_center|LOCUS_11470 4902 5462 gene locus_tag LOCUS_11480 4902 5462 CDS product DUF3341 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404832.1 protein_id gnl|my_center|LOCUS_11480 5455 6147 gene locus_tag LOCUS_11490 5455 6147 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205421545.1 protein_id gnl|my_center|LOCUS_11490 6144 7379 gene locus_tag LOCUS_11500 6144 7379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013062436.1 protein_id gnl|my_center|LOCUS_11500 >Feature sequence0141 <1 538 gene locus_tag LOCUS_11510 <1 538 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011267744.1:error-prone DNA polymerase 3380 1917 gene locus_tag LOCUS_11520 gene gabD 3380 1917 CDS product NADP-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009971372.1 protein_id gnl|my_center|LOCUS_11520 3896 4957 gene locus_tag LOCUS_11530 gene apbC 3896 4957 CDS product iron-sulfur cluster carrier protein ApbC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257064.1 protein_id gnl|my_center|LOCUS_11530 5040 5252 gene locus_tag LOCUS_11540 5040 5252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11540 5322 5861 gene locus_tag LOCUS_11550 gene pyrR 5322 5861 CDS product bifunctional pyr operon transcriptional regulator/uracil phosphoribosyltransferase PyrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257759.1 protein_id gnl|my_center|LOCUS_11550 5858 6823 gene locus_tag LOCUS_11560 5858 6823 CDS product aspartate carbamoyltransferase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_196768321.1 protein_id gnl|my_center|LOCUS_11560 >Feature sequence0142 784 215 gene locus_tag LOCUS_11570 784 215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11570 1305 781 gene locus_tag LOCUS_11580 1305 781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11580 2476 1676 gene locus_tag LOCUS_11590 2476 1676 CDS product anti-sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085797.1 protein_id gnl|my_center|LOCUS_11590 3024 2473 gene locus_tag LOCUS_11600 3024 2473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11600 3187 4146 gene locus_tag LOCUS_11610 3187 4146 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085800.1 protein_id gnl|my_center|LOCUS_11610 4350 4787 gene locus_tag LOCUS_11620 4350 4787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11620 4784 5176 gene locus_tag LOCUS_11630 4784 5176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11630 6313 5381 gene locus_tag LOCUS_11640 6313 5381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11640 6975 6493 gene locus_tag LOCUS_11650 6975 6493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11650 >Feature sequence0143 619 2163 gene locus_tag LOCUS_11660 619 2163 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037398620.1 protein_id gnl|my_center|LOCUS_11660 2191 3345 gene locus_tag LOCUS_11670 2191 3345 CDS product glycoside hydrolase family 88 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703474.1 protein_id gnl|my_center|LOCUS_11670 3342 4613 gene locus_tag LOCUS_11680 3342 4613 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584153.1 protein_id gnl|my_center|LOCUS_11680 5028 5960 gene locus_tag LOCUS_11690 5028 5960 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584152.1 protein_id gnl|my_center|LOCUS_11690 5963 6817 gene locus_tag LOCUS_11700 5963 6817 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172776.1 protein_id gnl|my_center|LOCUS_11700 >Feature sequence0144 913 1842 gene locus_tag LOCUS_11710 913 1842 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729990.1 protein_id gnl|my_center|LOCUS_11710 1944 2903 gene locus_tag LOCUS_11720 1944 2903 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976172.1 protein_id gnl|my_center|LOCUS_11720 2941 3756 gene locus_tag LOCUS_11730 2941 3756 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530829.1 protein_id gnl|my_center|LOCUS_11730 3753 4724 gene locus_tag LOCUS_11740 3753 4724 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707197.1 protein_id gnl|my_center|LOCUS_11740 6235 5126 gene locus_tag LOCUS_11750 6235 5126 CDS product S-adenosylmethionine:tRNA ribosyltransferase-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223438.1 protein_id gnl|my_center|LOCUS_11750 7039 6239 gene locus_tag LOCUS_11760 7039 6239 CDS product YciK family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210625.1 protein_id gnl|my_center|LOCUS_11760 >Feature sequence0145 509 138 gene locus_tag LOCUS_11770 509 138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11770 893 543 gene locus_tag LOCUS_11780 893 543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11780 2611 890 gene locus_tag LOCUS_11790 gene kaiC 2611 890 CDS product circadian clock protein KaiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331300.1 protein_id gnl|my_center|LOCUS_11790 3462 2896 gene locus_tag LOCUS_11800 3462 2896 CDS product type 1 glutamine amidotransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037891.1 protein_id gnl|my_center|LOCUS_11800 3923 4846 gene locus_tag LOCUS_11810 3923 4846 CDS product diacylglycerol kinase family lipid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888863.1 protein_id gnl|my_center|LOCUS_11810 5164 5322 gene locus_tag LOCUS_11820 5164 5322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11820 5341 5532 gene locus_tag LOCUS_11830 5341 5532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11830 5579 5731 gene locus_tag LOCUS_11840 5579 5731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11840 6034 6438 gene locus_tag LOCUS_11850 6034 6438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11850 7376 6459 gene locus_tag LOCUS_11860 7376 6459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11860 >Feature sequence0146 773 354 gene locus_tag LOCUS_11870 773 354 CDS product YciI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_145104183.1 protein_id gnl|my_center|LOCUS_11870 1155 751 gene locus_tag LOCUS_11880 1155 751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11880 2431 1715 gene locus_tag LOCUS_11890 2431 1715 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038724.1 protein_id gnl|my_center|LOCUS_11890 3758 2811 gene locus_tag LOCUS_11900 3758 2811 CDS product GlxA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920797.1 protein_id gnl|my_center|LOCUS_11900 3851 4558 gene locus_tag LOCUS_11910 3851 4558 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003110820.1 protein_id gnl|my_center|LOCUS_11910 4571 5560 gene locus_tag LOCUS_11920 4571 5560 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275492.1 protein_id gnl|my_center|LOCUS_11920 6011 5586 gene locus_tag LOCUS_11930 6011 5586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11930 6567 6388 gene locus_tag LOCUS_11940 6567 6388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11940 6652 6921 gene locus_tag LOCUS_11950 6652 6921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11950 7014 7331 gene locus_tag LOCUS_11960 7014 7331 CDS product DUF2277 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089416.1 protein_id gnl|my_center|LOCUS_11960 >Feature sequence0147 1580 153 gene locus_tag LOCUS_11970 1580 153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11970 1755 3017 gene locus_tag LOCUS_11980 1755 3017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11980 3036 7370 gene locus_tag LOCUS_11990 3036 7370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11990 >Feature sequence0148 <1 2211 gene locus_tag LOCUS_12000 <1 2211 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_006037763.1:RHS repeat-associated core domain-containing protein 2208 2603 gene locus_tag LOCUS_12010 2208 2603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12010 2865 4205 gene locus_tag LOCUS_12020 2865 4205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12020 5974 4202 gene locus_tag LOCUS_12030 5974 4202 CDS product ABC transporter ATP-binding protein/permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090269.1 protein_id gnl|my_center|LOCUS_12030 >Feature sequence0149 565 1071 gene locus_tag LOCUS_12040 565 1071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12040 2539 3690 gene locus_tag LOCUS_12050 2539 3690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12050 5066 4290 gene locus_tag LOCUS_12060 5066 4290 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902034.1 protein_id gnl|my_center|LOCUS_12060 5498 5953 gene locus_tag LOCUS_12070 5498 5953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12070 7145 6186 gene locus_tag LOCUS_12080 7145 6186 CDS product S-adenosylmethionine:tRNA ribosyltransferase-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223438.1 protein_id gnl|my_center|LOCUS_12080 >Feature sequence0150 621 2093 gene locus_tag LOCUS_12090 621 2093 CDS product FGGY-family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209440.1 protein_id gnl|my_center|LOCUS_12090 2319 3260 gene locus_tag LOCUS_12100 2319 3260 CDS product sugar-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046798190.1 protein_id gnl|my_center|LOCUS_12100 3599 4429 gene locus_tag LOCUS_12110 3599 4429 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080608.1 protein_id gnl|my_center|LOCUS_12110 4429 5367 gene locus_tag LOCUS_12120 4429 5367 CDS product transketolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080609.1 protein_id gnl|my_center|LOCUS_12120 5669 6793 gene locus_tag LOCUS_12130 5669 6793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12130 >Feature sequence0151 <1 620 gene locus_tag LOCUS_12140 <1 620 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011086257.1:SulP family inorganic anion transporter 1899 850 gene locus_tag LOCUS_12150 1899 850 CDS product iron-containing alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011176676.1 protein_id gnl|my_center|LOCUS_12150 3768 2050 gene locus_tag LOCUS_12160 3768 2050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12160 3948 4973 gene locus_tag LOCUS_12170 3948 4973 CDS product DUF4105 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035992.1 protein_id gnl|my_center|LOCUS_12170 5353 4991 gene locus_tag LOCUS_12180 5353 4991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12180 6458 5748 gene locus_tag LOCUS_12190 6458 5748 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838137.1 protein_id gnl|my_center|LOCUS_12190 <7464 6455 gene locus_tag LOCUS_12200 <7464 6455 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_118838136.1:histidine kinase >Feature sequence0152 <1 1204 gene locus_tag LOCUS_12210 <1 1204 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005786303.1:sigma-54 dependent transcriptional regulator 1492 4395 gene locus_tag LOCUS_12220 gene uvrA 1492 4395 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391799.1 protein_id gnl|my_center|LOCUS_12220 4380 7142 gene locus_tag LOCUS_12230 4380 7142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12230 >Feature sequence0153 3209 2406 gene locus_tag LOCUS_12240 3209 2406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12240 3636 3235 gene locus_tag LOCUS_12250 3636 3235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12250 4760 3633 gene locus_tag LOCUS_12260 4760 3633 CDS product DUF2169 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943804.1 protein_id gnl|my_center|LOCUS_12260 5851 4760 gene locus_tag LOCUS_12270 5851 4760 CDS product DUF2169 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943804.1 protein_id gnl|my_center|LOCUS_12270 <7439 5877 gene locus_tag LOCUS_12280 <7439 5877 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003114515.1:type VI secretion system tip protein VgrG >Feature sequence0154 600 145 gene locus_tag LOCUS_12290 600 145 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707487.1 protein_id gnl|my_center|LOCUS_12290 690 2180 gene locus_tag LOCUS_12300 690 2180 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808112.1 protein_id gnl|my_center|LOCUS_12300 2804 2253 gene locus_tag LOCUS_12310 2804 2253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12310 4075 2816 gene locus_tag LOCUS_12320 4075 2816 CDS product Glu/Leu/Phe/Val dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257936.1 protein_id gnl|my_center|LOCUS_12320 4656 5201 gene locus_tag LOCUS_12330 4656 5201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12330 5188 5436 gene locus_tag LOCUS_12340 5188 5436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12340 5981 5637 gene locus_tag LOCUS_12350 5981 5637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12350 7027 6269 gene locus_tag LOCUS_12360 7027 6269 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926867.1 protein_id gnl|my_center|LOCUS_12360 >Feature sequence0155 <1 910 gene locus_tag LOCUS_12370 <1 910 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164928965.1:CHAT domain-containing protein 927 1988 gene locus_tag LOCUS_12380 927 1988 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529023.1 protein_id gnl|my_center|LOCUS_12380 2326 2973 gene locus_tag LOCUS_12390 2326 2973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12390 2960 4489 gene locus_tag LOCUS_12400 2960 4489 CDS product DNA polymerase Y family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727778.1 protein_id gnl|my_center|LOCUS_12400 >Feature sequence0156 62 1660 gene locus_tag LOCUS_12410 62 1660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12410 1691 3100 gene locus_tag LOCUS_12420 1691 3100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12420 3146 4426 gene locus_tag LOCUS_12430 3146 4426 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005303290.1 protein_id gnl|my_center|LOCUS_12430 5655 4612 gene locus_tag LOCUS_12440 gene rhaS 5655 4612 CDS product rhamnose ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327310.1 protein_id gnl|my_center|LOCUS_12440 6976 6026 gene locus_tag LOCUS_12450 6976 6026 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812325.1 protein_id gnl|my_center|LOCUS_12450 >Feature sequence0157 783 604 gene locus_tag LOCUS_12460 783 604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12460 1044 2597 gene locus_tag LOCUS_12470 1044 2597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12470 3694 2687 gene locus_tag LOCUS_12480 3694 2687 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114722.1 protein_id gnl|my_center|LOCUS_12480 4730 3993 gene locus_tag LOCUS_12490 4730 3993 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339004.1 protein_id gnl|my_center|LOCUS_12490 5301 4720 gene locus_tag LOCUS_12500 5301 4720 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001789900.1 protein_id gnl|my_center|LOCUS_12500 6582 7250 gene locus_tag LOCUS_12510 6582 7250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12510 >Feature sequence0158 604 1335 gene locus_tag LOCUS_12520 604 1335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12520 1369 5112 gene locus_tag LOCUS_12530 1369 5112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12530 5109 6047 gene locus_tag LOCUS_12540 5109 6047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12540 6183 7064 gene locus_tag LOCUS_12550 6183 7064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12550 >Feature sequence0159 545 264 gene locus_tag LOCUS_12560 545 264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12560 953 2194 gene locus_tag LOCUS_12570 953 2194 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028172666.1 protein_id gnl|my_center|LOCUS_12570 2213 5434 gene locus_tag LOCUS_12580 2213 5434 CDS product multidrug efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922389.1 protein_id gnl|my_center|LOCUS_12580 >Feature sequence0160 <1 1570 gene locus_tag LOCUS_12590 <1 1570 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011143152.1:S8 family serine peptidase 1583 3676 gene locus_tag LOCUS_12600 1583 3676 CDS product S53 family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230264.1 protein_id gnl|my_center|LOCUS_12600 4210 4845 gene locus_tag LOCUS_12610 4210 4845 CDS product ECF-type sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007336412.1 protein_id gnl|my_center|LOCUS_12610 >Feature sequence0161 1785 322 gene locus_tag LOCUS_12620 1785 322 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114945.1 protein_id gnl|my_center|LOCUS_12620 2081 3937 gene locus_tag LOCUS_12630 2081 3937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12630 3886 4260 gene locus_tag LOCUS_12640 3886 4260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12640 4267 5664 gene locus_tag LOCUS_12650 4267 5664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12650 >Feature sequence0162 3218 1788 gene locus_tag LOCUS_12660 3218 1788 CDS product mercuric reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946005.1 protein_id gnl|my_center|LOCUS_12660 3799 3374 gene locus_tag LOCUS_12670 3799 3374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12670 4209 4547 gene locus_tag LOCUS_12680 4209 4547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12680 4862 5794 gene locus_tag LOCUS_12690 4862 5794 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_151128636.1 protein_id gnl|my_center|LOCUS_12690 7121 5889 gene locus_tag LOCUS_12700 gene chrA 7121 5889 CDS product chromate efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000184001.1 protein_id gnl|my_center|LOCUS_12700 >Feature sequence0163 416 1615 gene locus_tag LOCUS_12710 gene rhaI 416 1615 CDS product L-rhamnose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080416.1 protein_id gnl|my_center|LOCUS_12710 2180 2779 gene locus_tag LOCUS_12720 2180 2779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12720 3899 2877 gene locus_tag LOCUS_12730 3899 2877 CDS product PfkB family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209518.1 protein_id gnl|my_center|LOCUS_12730 4711 4289 gene locus_tag LOCUS_12740 4711 4289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12740 4900 4972 gene locus_tag LOCUS_t00110 4900 4972 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 5203 5718 gene locus_tag LOCUS_12750 5203 5718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12750 6090 6974 gene locus_tag LOCUS_12760 6090 6974 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812339.1 protein_id gnl|my_center|LOCUS_12760 >Feature sequence0164 1789 1595 gene locus_tag LOCUS_12770 1789 1595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12770 <7234 2556 gene locus_tag LOCUS_12780 <7234 2556 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000686845.1:AAA family ATPase >Feature sequence0165 127 1164 gene locus_tag LOCUS_12790 127 1164 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007610940.1 protein_id gnl|my_center|LOCUS_12790 2632 1526 gene locus_tag LOCUS_12800 gene mtnA 2632 1526 CDS product S-methyl-5-thioribose-1-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003529406.1 protein_id gnl|my_center|LOCUS_12800 3908 2622 gene locus_tag LOCUS_12810 gene mtnK 3908 2622 CDS product S-methyl-5-thioribose kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087665.1 protein_id gnl|my_center|LOCUS_12810 5688 4342 gene locus_tag LOCUS_12820 5688 4342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12820 >Feature sequence0166 236 12 gene locus_tag LOCUS_12830 236 12 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12830 1747 275 gene locus_tag LOCUS_12840 1747 275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12840 2005 2220 gene locus_tag LOCUS_12850 2005 2220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12850 3248 2268 gene locus_tag LOCUS_12860 3248 2268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12860 3895 3476 gene locus_tag LOCUS_12870 3895 3476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12870 4092 3859 gene locus_tag LOCUS_12880 4092 3859 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000764038.1 protein_id gnl|my_center|LOCUS_12880 4616 5422 gene locus_tag LOCUS_12890 4616 5422 CDS product heme-dependent peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242896.1 protein_id gnl|my_center|LOCUS_12890 5815 6636 gene locus_tag LOCUS_12900 5815 6636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12900 >Feature sequence0167 810 148 gene locus_tag LOCUS_12910 810 148 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761370.1 protein_id gnl|my_center|LOCUS_12910 3473 1032 gene locus_tag LOCUS_12920 3473 1032 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141201.1 protein_id gnl|my_center|LOCUS_12920 6023 3591 gene locus_tag LOCUS_12930 6023 3591 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141201.1 protein_id gnl|my_center|LOCUS_12930 <7166 6608 gene locus_tag LOCUS_12940 <7166 6608 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011141201.1:ABC transporter permease >Feature sequence0168 1259 306 gene locus_tag LOCUS_12950 1259 306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12950 2620 1256 gene locus_tag LOCUS_12960 2620 1256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12960 <7128 2631 gene locus_tag LOCUS_12970 <7128 2631 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004194140.1:type I polyketide synthase >Feature sequence0169 229 1482 gene locus_tag LOCUS_12980 gene hutI 229 1482 CDS product imidazolonepropionase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244327.1 protein_id gnl|my_center|LOCUS_12980 1635 2186 gene locus_tag LOCUS_12990 1635 2186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12990 2105 3052 gene locus_tag LOCUS_13000 2105 3052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13000 3195 4400 gene locus_tag LOCUS_13010 gene argE 3195 4400 CDS product acetylornithine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703480.1 protein_id gnl|my_center|LOCUS_13010 4863 4504 gene locus_tag LOCUS_13020 4863 4504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13020 5202 6104 gene locus_tag LOCUS_13030 5202 6104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13030 6231 6605 gene locus_tag LOCUS_13040 gene xcpT 6231 6605 CDS product GspG family T2SS major pseudopilin variant XcpT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119751.1 protein_id gnl|my_center|LOCUS_13040 >Feature sequence0170 409 699 gene locus_tag LOCUS_13050 409 699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13050 1076 696 gene locus_tag LOCUS_13060 1076 696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13060 1308 2195 gene locus_tag LOCUS_13070 1308 2195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13070 2912 2322 gene locus_tag LOCUS_13080 2912 2322 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257731.1 protein_id gnl|my_center|LOCUS_13080 4608 3406 gene locus_tag LOCUS_13090 4608 3406 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142255.1 protein_id gnl|my_center|LOCUS_13090 5172 4780 gene locus_tag LOCUS_13100 5172 4780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13100 5534 5950 gene locus_tag LOCUS_13110 5534 5950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13110 >Feature sequence0171 <1 2145 gene locus_tag LOCUS_13120 <1 2145 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011392112.1:DNA internalization-related competence protein ComEC/Rec2 2738 2103 gene locus_tag LOCUS_13130 2738 2103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13130 4069 3134 gene locus_tag LOCUS_13140 4069 3134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13140 5786 4389 gene locus_tag LOCUS_13150 5786 4389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13150 5904 5725 gene locus_tag LOCUS_13160 5904 5725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13160 6296 5997 gene locus_tag LOCUS_13170 6296 5997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13170 <7101 6397 gene locus_tag LOCUS_13180 <7101 6397 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011389479.1:alpha-1,4-glucan--maltose-1-phosphate maltosyltransferase >Feature sequence0172 3 1310 gene locus_tag LOCUS_13190 3 1310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13190 1727 2881 gene locus_tag LOCUS_13200 1727 2881 CDS product porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922914.1 protein_id gnl|my_center|LOCUS_13200 4445 2964 gene locus_tag LOCUS_13210 4445 2964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13210 4750 5604 gene locus_tag LOCUS_13220 4750 5604 CDS product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783633.1 protein_id gnl|my_center|LOCUS_13220 5755 6951 gene locus_tag LOCUS_13230 5755 6951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13230 >Feature sequence0173 2501 1050 gene locus_tag LOCUS_13240 2501 1050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13240 2990 2814 gene locus_tag LOCUS_13250 2990 2814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13250 3346 2987 gene locus_tag LOCUS_13260 3346 2987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13260 4179 5396 gene locus_tag LOCUS_13270 4179 5396 CDS product DUF2235 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003088736.1 protein_id gnl|my_center|LOCUS_13270 5457 5750 gene locus_tag LOCUS_13280 5457 5750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13280 >Feature sequence0174 236 802 gene locus_tag LOCUS_13290 236 802 CDS product HDIG domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228920.1 protein_id gnl|my_center|LOCUS_13290 1211 2311 gene locus_tag LOCUS_13300 1211 2311 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006314820.1 protein_id gnl|my_center|LOCUS_13300 2531 3322 gene locus_tag LOCUS_13310 2531 3322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13310 4325 3576 gene locus_tag LOCUS_13320 4325 3576 CDS product anti-sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085797.1 protein_id gnl|my_center|LOCUS_13320 4836 4312 gene locus_tag LOCUS_13330 4836 4312 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527184.1 protein_id gnl|my_center|LOCUS_13330 6229 5063 gene locus_tag LOCUS_13340 6229 5063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13340 >Feature sequence0175 <1 1446 gene locus_tag LOCUS_13350 <1 1446 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011143425.1:FAD-binding and (Fe-S)-binding domain-containing protein 1681 2343 gene locus_tag LOCUS_13360 1681 2343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13360 3353 2340 gene locus_tag LOCUS_13370 3353 2340 CDS product CPBP family intramembrane metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204297.1 protein_id gnl|my_center|LOCUS_13370 3588 3794 gene locus_tag LOCUS_13380 3588 3794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13380 4098 3886 gene locus_tag LOCUS_13390 4098 3886 CDS product type II toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813809.1 protein_id gnl|my_center|LOCUS_13390 4371 4844 gene locus_tag LOCUS_13400 4371 4844 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229426.1 protein_id gnl|my_center|LOCUS_13400 5069 5674 gene locus_tag LOCUS_13410 5069 5674 CDS product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971922.1 protein_id gnl|my_center|LOCUS_13410 6726 5815 gene locus_tag LOCUS_13420 6726 5815 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967090.1 protein_id gnl|my_center|LOCUS_13420 >Feature sequence0176 1214 2875 gene locus_tag LOCUS_13430 1214 2875 CDS product monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026958.1 protein_id gnl|my_center|LOCUS_13430 3616 3257 gene locus_tag LOCUS_13440 3616 3257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13440 4515 3613 gene locus_tag LOCUS_13450 4515 3613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13450 5365 4520 gene locus_tag LOCUS_13460 5365 4520 CDS product DUF692 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444160.1 protein_id gnl|my_center|LOCUS_13460 5908 5642 gene locus_tag LOCUS_13470 5908 5642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13470 6191 6976 gene locus_tag LOCUS_13480 6191 6976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13480 >Feature sequence0177 <1 682 gene locus_tag LOCUS_13490 <1 682 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000446384.1:multidrug efflux transporter periplasmic adaptor subunit MdtN 741 944 gene locus_tag LOCUS_13500 741 944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13500 969 3065 gene locus_tag LOCUS_13510 969 3065 CDS product FUSC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210377.1 protein_id gnl|my_center|LOCUS_13510 3392 3721 gene locus_tag LOCUS_13520 3392 3721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13520 4478 3849 gene locus_tag LOCUS_13530 4478 3849 CDS product YdeI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234230.1 protein_id gnl|my_center|LOCUS_13530 5138 6952 gene locus_tag LOCUS_13540 5138 6952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13540 >Feature sequence0178 <1 1136 gene locus_tag LOCUS_13550 <1 1136 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000516666.1:catalase family protein 1147 2445 gene locus_tag LOCUS_13560 1147 2445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13560 2442 3941 gene locus_tag LOCUS_13570 2442 3941 CDS product peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729271.1 protein_id gnl|my_center|LOCUS_13570 4383 5042 gene locus_tag LOCUS_13580 4383 5042 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142702.1 protein_id gnl|my_center|LOCUS_13580 5039 5734 gene locus_tag LOCUS_13590 5039 5734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13590 >Feature sequence0179 929 666 gene locus_tag LOCUS_13600 929 666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13600 1447 1250 gene locus_tag LOCUS_13610 1447 1250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13610 3686 3294 gene locus_tag LOCUS_13620 3686 3294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13620 4488 5894 gene locus_tag LOCUS_13630 4488 5894 CDS product aldehyde dehydrogenase (NADP(+)) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038347.1 protein_id gnl|my_center|LOCUS_13630 6897 6124 gene locus_tag LOCUS_13640 6897 6124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13640 >Feature sequence0180 <1 1639 gene locus_tag LOCUS_13650 <1 1639 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164922389.1:multidrug efflux RND transporter permease subunit 1961 2278 gene locus_tag LOCUS_13660 1961 2278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13660 2550 2263 gene locus_tag LOCUS_13670 2550 2263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13670 2834 2658 gene locus_tag LOCUS_13680 2834 2658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13680 2891 3211 gene locus_tag LOCUS_13690 2891 3211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13690 3287 4411 gene locus_tag LOCUS_13700 3287 4411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_13700 4516 5100 gene locus_tag LOCUS_13710 4516 5100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_13710 5338 6414 gene locus_tag LOCUS_13720 5338 6414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13720 >Feature sequence0181 294 82 gene locus_tag LOCUS_13730 294 82 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13730 941 438 gene locus_tag LOCUS_13740 941 438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13740 2097 1072 gene locus_tag LOCUS_13750 2097 1072 CDS product NAD(P)-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000870126.1 protein_id gnl|my_center|LOCUS_13750 2533 3450 gene locus_tag LOCUS_13760 2533 3450 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143349.1 protein_id gnl|my_center|LOCUS_13760 5197 3845 gene locus_tag LOCUS_13770 5197 3845 CDS product allantoinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887796.1 protein_id gnl|my_center|LOCUS_13770 5499 5843 gene locus_tag LOCUS_13780 5499 5843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13780 5938 6906 gene locus_tag LOCUS_13790 gene kdgK1 5938 6906 CDS product bifunctional 2-dehydro-3-deoxygluconokinase/2-dehydro-3-deoxygalactonokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902071.1 protein_id gnl|my_center|LOCUS_13790 >Feature sequence0182 1632 2876 gene locus_tag LOCUS_13800 1632 2876 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021211.1 protein_id gnl|my_center|LOCUS_13800 3821 3057 gene locus_tag LOCUS_13810 3821 3057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13810 4259 5149 gene locus_tag LOCUS_13820 4259 5149 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193487479.1 protein_id gnl|my_center|LOCUS_13820 5719 5153 gene locus_tag LOCUS_13830 5719 5153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13830 6429 5716 gene locus_tag LOCUS_13840 gene phoU 6429 5716 CDS product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938768.1 protein_id gnl|my_center|LOCUS_13840 >Feature sequence0183 2621 576 gene locus_tag LOCUS_13850 2621 576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13850 4196 2631 gene locus_tag LOCUS_13860 4196 2631 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582804.1 protein_id gnl|my_center|LOCUS_13860 5302 4544 gene locus_tag LOCUS_13870 5302 4544 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970020.1 protein_id gnl|my_center|LOCUS_13870 >Feature sequence0184 24 2015 gene locus_tag LOCUS_13880 24 2015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13880 2387 2049 gene locus_tag LOCUS_13890 2387 2049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13890 3508 3669 gene locus_tag LOCUS_13900 3508 3669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13900 3930 4124 gene locus_tag LOCUS_13910 3930 4124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13910 4357 4211 gene locus_tag LOCUS_13920 4357 4211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13920 4393 4845 gene locus_tag LOCUS_13930 4393 4845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13930 4916 5074 gene locus_tag LOCUS_13940 4916 5074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13940 5146 5373 gene locus_tag LOCUS_13950 5146 5373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13950 5349 5642 gene locus_tag LOCUS_13960 5349 5642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13960 6816 6007 gene locus_tag LOCUS_13970 6816 6007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13970 >Feature sequence0185 338 523 gene locus_tag LOCUS_13980 338 523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13980 1845 628 gene locus_tag LOCUS_13990 1845 628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13990 2176 1850 gene locus_tag LOCUS_14000 2176 1850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14000 4126 3878 gene locus_tag LOCUS_14010 4126 3878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14010 5223 4096 gene locus_tag LOCUS_14020 5223 4096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14020 6280 6095 gene locus_tag LOCUS_14030 6280 6095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14030 >Feature sequence0186 1367 711 gene locus_tag LOCUS_14040 1367 711 CDS product thioesterase II family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964340.1 protein_id gnl|my_center|LOCUS_14040 <6872 1573 gene locus_tag LOCUS_14050 <6872 1573 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011123515.1:type I polyketide synthase >Feature sequence0187 1148 342 gene locus_tag LOCUS_14060 gene mip 1148 342 CDS product macrophage infectivity potentiator Mip inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011213317.1 protein_id gnl|my_center|LOCUS_14060 3087 1222 gene locus_tag LOCUS_14070 gene mrdA 3087 1222 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583753.1 protein_id gnl|my_center|LOCUS_14070 4959 3217 gene locus_tag LOCUS_14080 4959 3217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14080 5280 6029 gene locus_tag LOCUS_14090 5280 6029 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103021216.1 protein_id gnl|my_center|LOCUS_14090 6036 6452 gene locus_tag LOCUS_14100 6036 6452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14100 >Feature sequence0188 5656 4118 gene locus_tag LOCUS_14110 5656 4118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14110 6825 5653 gene locus_tag LOCUS_14120 6825 5653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14120 >Feature sequence0189 447 67 gene locus_tag LOCUS_14130 447 67 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14130 537 1457 gene locus_tag LOCUS_14140 537 1457 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005087496.1 protein_id gnl|my_center|LOCUS_14140 2773 1733 gene locus_tag LOCUS_14150 2773 1733 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530576.1 protein_id gnl|my_center|LOCUS_14150 4508 2982 gene locus_tag LOCUS_14160 4508 2982 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530575.1 protein_id gnl|my_center|LOCUS_14160 4948 4547 gene locus_tag LOCUS_14170 4948 4547 CDS product four helix bundle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870231.1 protein_id gnl|my_center|LOCUS_14170 6010 5051 gene locus_tag LOCUS_14180 6010 5051 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530574.1 protein_id gnl|my_center|LOCUS_14180 >Feature sequence0190 43 669 gene locus_tag LOCUS_14190 43 669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14190 1598 666 gene locus_tag LOCUS_14200 1598 666 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228665.1 protein_id gnl|my_center|LOCUS_14200 2664 1663 gene locus_tag LOCUS_14210 2664 1663 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207004.1 protein_id gnl|my_center|LOCUS_14210 2914 4353 gene locus_tag LOCUS_14220 2914 4353 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940696.1 protein_id gnl|my_center|LOCUS_14220 4274 4594 gene locus_tag LOCUS_14230 4274 4594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14230 4788 5549 gene locus_tag LOCUS_14240 4788 5549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14240 6148 6708 gene locus_tag LOCUS_14250 6148 6708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14250 >Feature sequence0191 2250 1276 gene locus_tag LOCUS_14260 2250 1276 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226240.1 protein_id gnl|my_center|LOCUS_14260 2703 3089 gene locus_tag LOCUS_14270 2703 3089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14270 4380 3277 gene locus_tag LOCUS_14280 4380 3277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14280 4711 5520 gene locus_tag LOCUS_14290 gene prpB 4711 5520 CDS product methylisocitrate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010945814.1 protein_id gnl|my_center|LOCUS_14290 5528 6658 gene locus_tag LOCUS_14300 gene prpC 5528 6658 CDS product 2-methylcitrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001271319.1 protein_id gnl|my_center|LOCUS_14300 >Feature sequence0192 2275 815 gene locus_tag LOCUS_14310 gene purF 2275 815 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942281.1 protein_id gnl|my_center|LOCUS_14310 4527 2272 gene locus_tag LOCUS_14320 gene purL 4527 2272 CDS product phosphoribosylformylglycinamidine synthase subunit PurL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_196768344.1 protein_id gnl|my_center|LOCUS_14320 5225 4524 gene locus_tag LOCUS_14330 gene purQ 5225 4524 CDS product phosphoribosylformylglycinamidine synthase subunit PurQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393545.1 protein_id gnl|my_center|LOCUS_14330 5484 5233 gene locus_tag LOCUS_14340 gene purS 5484 5233 CDS product phosphoribosylformylglycinamidine synthase subunit PurS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388468.1 protein_id gnl|my_center|LOCUS_14340 5695 6540 gene locus_tag LOCUS_14350 5695 6540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14350 >Feature sequence0193 361 1836 gene locus_tag LOCUS_14360 361 1836 CDS product rhamnulokinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582815.1 protein_id gnl|my_center|LOCUS_14360 1833 4010 gene locus_tag LOCUS_14370 1833 4010 CDS product bifunctional rhamnulose-1-phosphate aldolase/short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258146.1 protein_id gnl|my_center|LOCUS_14370 4007 4726 gene locus_tag LOCUS_14380 4007 4726 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_150234528.1 protein_id gnl|my_center|LOCUS_14380 4861 6258 gene locus_tag LOCUS_14390 gene lutB 4861 6258 CDS product lactate utilization iron-sulfur protein LutB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228307.1 protein_id gnl|my_center|LOCUS_14390 >Feature sequence0194 896 2500 gene locus_tag LOCUS_14400 gene aceB 896 2500 CDS product malate synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258821.1 protein_id gnl|my_center|LOCUS_14400 2720 3598 gene locus_tag LOCUS_14410 2720 3598 CDS product glycine cleavage T C-terminal barrel domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258471.1 protein_id gnl|my_center|LOCUS_14410 3595 4206 gene locus_tag LOCUS_14420 3595 4206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14420 5929 4514 gene locus_tag LOCUS_14430 5929 4514 CDS product L-fucose/L-arabinose isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167413.1 protein_id gnl|my_center|LOCUS_14430 >Feature sequence0195 959 420 gene locus_tag LOCUS_14440 959 420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14440 1114 1482 gene locus_tag LOCUS_14450 1114 1482 CDS product GxxExxY protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056479.1 protein_id gnl|my_center|LOCUS_14450 3035 1599 gene locus_tag LOCUS_14460 3035 1599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14460 3204 3818 gene locus_tag LOCUS_14470 gene upp 3204 3818 CDS product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294095.1 protein_id gnl|my_center|LOCUS_14470 4606 3989 gene locus_tag LOCUS_14480 4606 3989 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140820.1 protein_id gnl|my_center|LOCUS_14480 4864 5670 gene locus_tag LOCUS_14490 gene pcaD 4864 5670 CDS product 3-oxoadipate enol-lactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268150.1 protein_id gnl|my_center|LOCUS_14490 5710 6579 gene locus_tag LOCUS_14500 5710 6579 CDS product SprT family zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932386.1 protein_id gnl|my_center|LOCUS_14500 >Feature sequence0196 295 570 gene locus_tag LOCUS_14510 295 570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14510 752 612 gene locus_tag LOCUS_14520 752 612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14520 819 1760 gene locus_tag LOCUS_14530 819 1760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14530 2144 2878 gene locus_tag LOCUS_14540 gene scbB 2144 2878 CDS product A-factor type gamma-butyrolactone 6-reductase ScbB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030779.1 protein_id gnl|my_center|LOCUS_14540 3707 3183 gene locus_tag LOCUS_14550 3707 3183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14550 4180 3845 gene locus_tag LOCUS_14560 4180 3845 CDS product YciI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009562580.1 protein_id gnl|my_center|LOCUS_14560 5736 4195 gene locus_tag LOCUS_14570 5736 4195 CDS product DJ-1/PfpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143798.1 protein_id gnl|my_center|LOCUS_14570 <6751 5963 gene locus_tag LOCUS_14580 <6751 5963 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011031151.1:GlxA family transcriptional regulator >Feature sequence0197 1968 460 gene locus_tag LOCUS_14590 1968 460 CDS product EmrA/EmrK family multidrug efflux transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121732.1 protein_id gnl|my_center|LOCUS_14590 <6735 2182 gene locus_tag LOCUS_14600 <6735 2182 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000686845.1:AAA family ATPase >Feature sequence0198 <1 548 gene locus_tag LOCUS_14610 <1 548 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_060814984.1:glycoside hydrolase family 31 protein 2111 834 gene locus_tag LOCUS_14620 2111 834 CDS product IS110 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030568499.1 protein_id gnl|my_center|LOCUS_14620 4184 2754 gene locus_tag LOCUS_14630 4184 2754 CDS product glycoside hydrolase family 15 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970768.1 protein_id gnl|my_center|LOCUS_14630 4641 5558 gene locus_tag LOCUS_14640 4641 5558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14640 >Feature sequence0199 1811 522 gene locus_tag LOCUS_14650 1811 522 CDS product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545264.1 protein_id gnl|my_center|LOCUS_14650 2184 2936 gene locus_tag LOCUS_14660 2184 2936 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176994060.1 protein_id gnl|my_center|LOCUS_14660 3312 2923 gene locus_tag LOCUS_14670 3312 2923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14670 3528 4136 gene locus_tag LOCUS_14680 3528 4136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14680 5338 4175 gene locus_tag LOCUS_14690 5338 4175 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838638.1 protein_id gnl|my_center|LOCUS_14690 <6717 5473 gene locus_tag LOCUS_14700 <6717 5473 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_198673836.1:right-handed parallel beta-helix repeat-containing protein >Feature sequence0200 3099 1093 gene locus_tag LOCUS_14710 gene prsK 3099 1093 CDS product PEP-CTERM system histidine kinase PrsK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942586.1 protein_id gnl|my_center|LOCUS_14710 3501 3944 gene locus_tag LOCUS_14720 3501 3944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14720 5455 4421 gene locus_tag LOCUS_14730 5455 4421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14730 5942 6145 gene locus_tag LOCUS_14740 5942 6145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14740 >Feature sequence0201 2055 1561 gene locus_tag LOCUS_14750 2055 1561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14750 2375 2103 gene locus_tag LOCUS_14760 2375 2103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14760 4064 2703 gene locus_tag LOCUS_14770 4064 2703 CDS product phospholipase C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900400.1 protein_id gnl|my_center|LOCUS_14770 4297 6480 gene locus_tag LOCUS_14780 4297 6480 CDS product FUSC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036738.1 protein_id gnl|my_center|LOCUS_14780 >Feature sequence0202 6422 5673 gene locus_tag LOCUS_14790 6422 5673 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_184768134.1 protein_id gnl|my_center|LOCUS_14790 6691 6419 gene locus_tag LOCUS_14800 6691 6419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14800 >Feature sequence0203 1567 1283 gene locus_tag LOCUS_14810 1567 1283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14810 2104 1604 gene locus_tag LOCUS_14820 2104 1604 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967578.1 protein_id gnl|my_center|LOCUS_14820 4000 2414 gene locus_tag LOCUS_14830 gene pckA 4000 2414 CDS product phosphoenolpyruvate carboxykinase (ATP) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405091.1 protein_id gnl|my_center|LOCUS_14830 5409 4030 gene locus_tag LOCUS_14840 gene lpdA 5409 4030 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700832.1 protein_id gnl|my_center|LOCUS_14840 5966 5406 gene locus_tag LOCUS_14850 5966 5406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14850 6432 5956 gene locus_tag LOCUS_14860 6432 5956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14860 >Feature sequence0204 369 980 gene locus_tag LOCUS_14870 369 980 CDS product HAD-IA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117887.1 protein_id gnl|my_center|LOCUS_14870 2035 1313 gene locus_tag LOCUS_14880 2035 1313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14880 2482 2991 gene locus_tag LOCUS_14890 2482 2991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14890 5514 3286 gene locus_tag LOCUS_14900 gene mrdA 5514 3286 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545126.1 protein_id gnl|my_center|LOCUS_14900 >Feature sequence0205 245 583 gene locus_tag LOCUS_14910 245 583 CDS product histidine triad nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056841.1 protein_id gnl|my_center|LOCUS_14910 1401 718 gene locus_tag LOCUS_14920 1401 718 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946654.1 protein_id gnl|my_center|LOCUS_14920 2485 1538 gene locus_tag LOCUS_14930 2485 1538 CDS product DUF2167 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035601.1 protein_id gnl|my_center|LOCUS_14930 2890 3306 gene locus_tag LOCUS_14940 gene crcB 2890 3306 CDS product fluoride efflux transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387989.1 protein_id gnl|my_center|LOCUS_14940 3321 3695 gene locus_tag LOCUS_14950 gene crcB 3321 3695 CDS product fluoride efflux transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387989.1 protein_id gnl|my_center|LOCUS_14950 3700 4044 gene locus_tag LOCUS_14960 3700 4044 CDS product DUF190 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085423.1 protein_id gnl|my_center|LOCUS_14960 4382 4035 gene locus_tag LOCUS_14970 4382 4035 CDS product DUF190 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085423.1 protein_id gnl|my_center|LOCUS_14970 4781 5014 gene locus_tag LOCUS_14980 4781 5014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14980 5171 6250 gene locus_tag LOCUS_14990 5171 6250 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546088.1 protein_id gnl|my_center|LOCUS_14990 6648 6331 gene locus_tag LOCUS_15000 6648 6331 CDS product DUF190 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085423.1 protein_id gnl|my_center|LOCUS_15000 >Feature sequence0206 1140 64 gene locus_tag LOCUS_15010 1140 64 CDS product ATP-grasp domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582961.1 protein_id gnl|my_center|LOCUS_15010 2602 1346 gene locus_tag LOCUS_15020 2602 1346 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957841.1 protein_id gnl|my_center|LOCUS_15020 5138 2817 gene locus_tag LOCUS_15030 5138 2817 CDS product polysaccharide biosynthesis tyrosine autokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389244.1 protein_id gnl|my_center|LOCUS_15030 <6651 5152 gene locus_tag LOCUS_15040 <6651 5152 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012256833.1:nucleoside-diphosphate sugar epimerase/dehydratase >Feature sequence0207 2125 2415 gene locus_tag LOCUS_15050 2125 2415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15050 3820 2933 gene locus_tag LOCUS_15060 gene rbsK 3820 2933 CDS product ribokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391595.1 protein_id gnl|my_center|LOCUS_15060 4019 4420 gene locus_tag LOCUS_15070 4019 4420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15070 5220 5387 gene locus_tag LOCUS_15080 5220 5387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15080 6626 5460 gene locus_tag LOCUS_15090 6626 5460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15090 >Feature sequence0208 683 171 gene locus_tag LOCUS_15100 683 171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15100 1203 1571 gene locus_tag LOCUS_15110 1203 1571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15110 2673 1774 gene locus_tag LOCUS_15120 2673 1774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15120 4622 3024 gene locus_tag LOCUS_15130 gene nadB 4622 3024 CDS product L-aspartate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942471.1 protein_id gnl|my_center|LOCUS_15130 5383 4619 gene locus_tag LOCUS_15140 gene panC 5383 4619 CDS product pantoate--beta-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080408.1 protein_id gnl|my_center|LOCUS_15140 <6625 5767 gene locus_tag LOCUS_15150 <6625 5767 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010933743.1:maltose alpha-D-glucosyltransferase >Feature sequence0209 <1 653 gene locus_tag LOCUS_15160 <1 653 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005772424.1:sugar porter family MFS transporter 956 2323 gene locus_tag LOCUS_15170 956 2323 CDS product cytochrome ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545853.1 protein_id gnl|my_center|LOCUS_15170 2320 3369 gene locus_tag LOCUS_15180 gene cydB 2320 3369 CDS product cytochrome d ubiquinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122521.1 protein_id gnl|my_center|LOCUS_15180 3591 4079 gene locus_tag LOCUS_15190 3591 4079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15190 4081 5664 gene locus_tag LOCUS_15200 4081 5664 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002214220.1 protein_id gnl|my_center|LOCUS_15200 5674 5946 gene locus_tag LOCUS_15210 5674 5946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15210 >Feature sequence0210 143 346 gene locus_tag LOCUS_15220 143 346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15220 606 1955 gene locus_tag LOCUS_15230 606 1955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15230 3088 3678 gene locus_tag LOCUS_15240 3088 3678 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257731.1 protein_id gnl|my_center|LOCUS_15240 3880 4044 gene locus_tag LOCUS_15250 3880 4044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15250 6084 4255 gene locus_tag LOCUS_15260 6084 4255 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967072.1 protein_id gnl|my_center|LOCUS_15260 >Feature sequence0211 488 75 gene locus_tag LOCUS_15270 488 75 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15270 645 1304 gene locus_tag LOCUS_15280 645 1304 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393500.1 protein_id gnl|my_center|LOCUS_15280 1482 2645 gene locus_tag LOCUS_15290 1482 2645 CDS product homogentisate 1,2-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480624.1 protein_id gnl|my_center|LOCUS_15290 3085 4182 gene locus_tag LOCUS_15300 gene hppD 3085 4182 CDS product 4-hydroxyphenylpyruvate dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256700.1 protein_id gnl|my_center|LOCUS_15300 6002 4551 gene locus_tag LOCUS_15310 6002 4551 CDS product adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275161.1 protein_id gnl|my_center|LOCUS_15310 >Feature sequence0212 1426 827 gene locus_tag LOCUS_15320 1426 827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15320 1685 1996 gene locus_tag LOCUS_15330 1685 1996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15330 2169 3848 gene locus_tag LOCUS_15340 2169 3848 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086748.1 protein_id gnl|my_center|LOCUS_15340 5255 4233 gene locus_tag LOCUS_15350 5255 4233 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223676.1 protein_id gnl|my_center|LOCUS_15350 5560 5748 gene locus_tag LOCUS_15360 5560 5748 CDS product CDGSH iron-sulfur domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024015098.1 protein_id gnl|my_center|LOCUS_15360 >Feature sequence0213 376 113 gene locus_tag LOCUS_15370 376 113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15370 1037 1834 gene locus_tag LOCUS_15380 1037 1834 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528365.1 protein_id gnl|my_center|LOCUS_15380 3494 2052 gene locus_tag LOCUS_15390 3494 2052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15390 2771 2864 gene locus_tag LOCUS_t00120 2771 2864 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 3716 4462 gene locus_tag LOCUS_15400 3716 4462 CDS product sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121635.1 protein_id gnl|my_center|LOCUS_15400 >Feature sequence0214 875 1861 gene locus_tag LOCUS_15410 875 1861 CDS product prohibitin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_104756978.1 protein_id gnl|my_center|LOCUS_15410 2693 1953 gene locus_tag LOCUS_15420 gene gmk 2693 1953 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693898.1 protein_id gnl|my_center|LOCUS_15420 3316 3690 gene locus_tag LOCUS_15430 3316 3690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15430 3736 5139 gene locus_tag LOCUS_15440 3736 5139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15440 5392 6291 gene locus_tag LOCUS_15450 5392 6291 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089805.1 protein_id gnl|my_center|LOCUS_15450 >Feature sequence0215 <1 1193 gene locus_tag LOCUS_15460 <1 1193 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003813290.1:phenylacetate-CoA oxygenase/reductase subunit PaaK 1207 2871 gene locus_tag LOCUS_15470 gene paaN 1207 2871 CDS product phenylacetic acid degradation protein PaaN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186941.1 protein_id gnl|my_center|LOCUS_15470 3373 3059 gene locus_tag LOCUS_15480 3373 3059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15480 3398 3748 gene locus_tag LOCUS_15490 3398 3748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15490 3745 4530 gene locus_tag LOCUS_15500 3745 4530 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162687994.1 protein_id gnl|my_center|LOCUS_15500 4658 5443 gene locus_tag LOCUS_15510 gene paaG 4658 5443 CDS product 2-(1,2-epoxy-1,2-dihydrophenyl)acetyl-CoA isomerase PaaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931073.1 protein_id gnl|my_center|LOCUS_15510 >Feature sequence0216 1023 1724 gene locus_tag LOCUS_15520 gene paoA 1023 1724 CDS product aldehyde dehydrogenase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000070685.1 protein_id gnl|my_center|LOCUS_15520 1737 2741 gene locus_tag LOCUS_15530 1737 2741 CDS product xanthine dehydrogenase family protein subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267645.1 protein_id gnl|my_center|LOCUS_15530 2822 5008 gene locus_tag LOCUS_15540 2822 5008 CDS product xanthine dehydrogenase family protein molybdopterin-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007245994.1 protein_id gnl|my_center|LOCUS_15540 5142 5321 gene locus_tag LOCUS_15550 5142 5321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15550 5914 5402 gene locus_tag LOCUS_15560 5914 5402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15560 6187 5972 gene locus_tag LOCUS_15570 6187 5972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15570 >Feature sequence0217 1004 324 gene locus_tag LOCUS_15580 1004 324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15580 1612 1899 gene locus_tag LOCUS_15590 1612 1899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15590 3019 2396 gene locus_tag LOCUS_15600 3019 2396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15600 4468 3878 gene locus_tag LOCUS_15610 4468 3878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15610 5509 5285 gene locus_tag LOCUS_15620 5509 5285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15620 5916 6440 gene locus_tag LOCUS_15630 5916 6440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15630 >Feature sequence0218 2767 1424 gene locus_tag LOCUS_15640 2767 1424 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011174245.1 protein_id gnl|my_center|LOCUS_15640 4215 2764 gene locus_tag LOCUS_15650 gene lysS 4215 2764 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001833056.1 protein_id gnl|my_center|LOCUS_15650 4787 4506 gene locus_tag LOCUS_15660 4787 4506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15660 <6572 5016 gene locus_tag LOCUS_15670 <6572 5016 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007327661.1:biosynthetic-type acetolactate synthase large subunit >Feature sequence0219 3378 2263 gene locus_tag LOCUS_15680 gene ugpC 3378 2263 CDS product sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384669.1 protein_id gnl|my_center|LOCUS_15680 6001 3365 gene locus_tag LOCUS_15690 6001 3365 CDS product non-lysosomal glucosylceramidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108530.1 protein_id gnl|my_center|LOCUS_15690 6563 6249 gene locus_tag LOCUS_15700 6563 6249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15700 >Feature sequence0220 3642 424 gene locus_tag LOCUS_15710 3642 424 CDS product multidrug efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532875.1 protein_id gnl|my_center|LOCUS_15710 4858 3656 gene locus_tag LOCUS_15720 4858 3656 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706757.1 protein_id gnl|my_center|LOCUS_15720 5979 5518 gene locus_tag LOCUS_15730 5979 5518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15730 >Feature sequence0221 1604 780 gene locus_tag LOCUS_15740 1604 780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15740 1915 1601 gene locus_tag LOCUS_15750 1915 1601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15750 2942 2490 gene locus_tag LOCUS_15760 2942 2490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15760 3051 3260 gene locus_tag LOCUS_15770 3051 3260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15770 5914 3623 gene locus_tag LOCUS_15780 5914 3623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15780 >Feature sequence0222 137 9 gene locus_tag LOCUS_15790 137 9 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15790 279 1796 gene locus_tag LOCUS_15800 gene dxs 279 1796 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460263.1 protein_id gnl|my_center|LOCUS_15800 2119 3123 gene locus_tag LOCUS_15810 2119 3123 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327241.1 protein_id gnl|my_center|LOCUS_15810 4064 3378 gene locus_tag LOCUS_15820 gene larB 4064 3378 CDS product nickel pincer cofactor biosynthesis protein LarB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011100884.1 protein_id gnl|my_center|LOCUS_15820 4804 4301 gene locus_tag LOCUS_15830 4804 4301 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050754241.1 protein_id gnl|my_center|LOCUS_15830 4815 4991 gene locus_tag LOCUS_15840 4815 4991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15840 5220 5843 gene locus_tag LOCUS_15850 gene plsY 5220 5843 CDS product glycerol-3-phosphate 1-O-acyltransferase PlsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880403.1 protein_id gnl|my_center|LOCUS_15850 >Feature sequence0223 617 835 gene locus_tag LOCUS_15860 617 835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15860 2112 1015 gene locus_tag LOCUS_15870 gene ald 2112 1015 CDS product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926910.1 protein_id gnl|my_center|LOCUS_15870 2912 2352 gene locus_tag LOCUS_15880 2912 2352 CDS product YqgE/AlgH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030865482.1 protein_id gnl|my_center|LOCUS_15880 3024 3815 gene locus_tag LOCUS_15890 3024 3815 CDS product thiazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000912209.1 protein_id gnl|my_center|LOCUS_15890 4146 4946 gene locus_tag LOCUS_15900 4146 4946 CDS product dipeptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084175.1 protein_id gnl|my_center|LOCUS_15900 4962 6140 gene locus_tag LOCUS_15910 gene rodA 4962 6140 CDS product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016844.1 protein_id gnl|my_center|LOCUS_15910 >Feature sequence0224 <1 2087 gene locus_tag LOCUS_15920 <1 2087 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_149605307.1:tetratricopeptide repeat protein note possible pseudo, frameshifted 2084 2683 gene locus_tag LOCUS_15930 2084 2683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15930 3187 2792 gene locus_tag LOCUS_15940 3187 2792 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063783.1 protein_id gnl|my_center|LOCUS_15940 3512 3258 gene locus_tag LOCUS_15950 3512 3258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15950 3594 4241 gene locus_tag LOCUS_15960 3594 4241 CDS product CGNR zinc finger domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969083.1 protein_id gnl|my_center|LOCUS_15960 4288 4578 gene locus_tag LOCUS_15970 4288 4578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15970 4968 4489 gene locus_tag LOCUS_15980 4968 4489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15980 <6518 4941 gene locus_tag LOCUS_15990 <6518 4941 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011140819.1:DUF262 domain-containing protein >Feature sequence0225 <1 596 gene locus_tag LOCUS_16000 <1 596 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010880791.1:ketol-acid reductoisomerase 1061 873 gene locus_tag LOCUS_16010 1061 873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16010 3154 1346 gene locus_tag LOCUS_16020 gene pepF 3154 1346 CDS product oligoendopeptidase F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122658.1 protein_id gnl|my_center|LOCUS_16020 4482 3589 gene locus_tag LOCUS_16030 gene xerC 4482 3589 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324269.1 protein_id gnl|my_center|LOCUS_16030 6321 4510 gene locus_tag LOCUS_16040 gene atzF 6321 4510 CDS product allophanate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140963.1 protein_id gnl|my_center|LOCUS_16040 >Feature sequence0226 677 159 gene locus_tag LOCUS_16050 677 159 CDS product ferritin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006313899.1 protein_id gnl|my_center|LOCUS_16050 1062 862 gene locus_tag LOCUS_16060 1062 862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16060 1207 1443 gene locus_tag LOCUS_16070 1207 1443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16070 2558 1452 gene locus_tag LOCUS_16080 2558 1452 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064253038.1 protein_id gnl|my_center|LOCUS_16080 3022 5178 gene locus_tag LOCUS_16090 3022 5178 CDS product amylo-alpha-1,6-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969651.1 protein_id gnl|my_center|LOCUS_16090 5717 5346 gene locus_tag LOCUS_16100 5717 5346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16100 >Feature sequence0227 <1 821 gene locus_tag LOCUS_16110 <1 821 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003115055.1:type VI secretion system baseplate subunit TssF 1022 1807 gene locus_tag LOCUS_16120 1022 1807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16120 1858 4623 gene locus_tag LOCUS_16130 gene tssH 1858 4623 CDS product type VI secretion system ATPase TssH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115056.1 protein_id gnl|my_center|LOCUS_16130 >Feature sequence0228 811 2766 gene locus_tag LOCUS_16140 gene glgX 811 2766 CDS product glycogen debranching protein GlgX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021995.1 protein_id gnl|my_center|LOCUS_16140 2852 3502 gene locus_tag LOCUS_16150 2852 3502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16150 4209 3700 gene locus_tag LOCUS_16160 4209 3700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16160 <6457 4375 gene locus_tag LOCUS_16170 <6457 4375 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013532875.1:multidrug efflux RND transporter permease subunit >Feature sequence0229 3714 400 gene locus_tag LOCUS_16180 3714 400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16180 5303 3927 gene locus_tag LOCUS_16190 5303 3927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16190 <6425 5322 gene locus_tag LOCUS_16200 <6425 5322 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942127.1:HlyD family secretion protein >Feature sequence0230 2099 783 gene locus_tag LOCUS_16210 2099 783 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066912.1 protein_id gnl|my_center|LOCUS_16210 3322 2204 gene locus_tag LOCUS_16220 3322 2204 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869311.1 protein_id gnl|my_center|LOCUS_16220 4563 3502 gene locus_tag LOCUS_16230 4563 3502 CDS product erythritol/L-threitol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209403.1 protein_id gnl|my_center|LOCUS_16230 6188 5028 gene locus_tag LOCUS_16240 gene ugpC 6188 5028 CDS product sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004079960.1 protein_id gnl|my_center|LOCUS_16240 >Feature sequence0231 2427 715 gene locus_tag LOCUS_16250 gene pilB 2427 715 CDS product type IV-A pilus assembly ATPase PilB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546881.1 protein_id gnl|my_center|LOCUS_16250 3022 2417 gene locus_tag LOCUS_16260 3022 2417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16260 3796 3104 gene locus_tag LOCUS_16270 3796 3104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16270 4348 3803 gene locus_tag LOCUS_16280 4348 3803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16280 6147 4345 gene locus_tag LOCUS_16290 6147 4345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16290 >Feature sequence0232 1203 1991 gene locus_tag LOCUS_16300 gene fabL 1203 1991 CDS product enoyl-[acyl-carrier-protein] reductase FabL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003223262.1 protein_id gnl|my_center|LOCUS_16300 1963 2304 gene locus_tag LOCUS_16310 1963 2304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16310 2306 3772 gene locus_tag LOCUS_16320 gene lcfB 2306 3772 CDS product long-chain-fatty-acid--CoA ligase LcfB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244686.1 protein_id gnl|my_center|LOCUS_16320 3769 4914 gene locus_tag LOCUS_16330 3769 4914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16330 4911 6203 gene locus_tag LOCUS_16340 4911 6203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16340 >Feature sequence0233 <1 861 gene locus_tag LOCUS_16350 <1 861 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942898.1:tetraacyldisaccharide 4'-kinase 905 1969 gene locus_tag LOCUS_16360 905 1969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16360 3821 2496 gene locus_tag LOCUS_16370 3821 2496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16370 4414 3818 gene locus_tag LOCUS_16380 gene ruvA 4414 3818 CDS product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004406125.1 protein_id gnl|my_center|LOCUS_16380 4413 5150 gene locus_tag LOCUS_16390 4413 5150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16390 >Feature sequence0234 1288 491 gene locus_tag LOCUS_16400 1288 491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16400 1435 1686 gene locus_tag LOCUS_16410 1435 1686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16410 1690 2157 gene locus_tag LOCUS_16420 1690 2157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16420 2331 3104 gene locus_tag LOCUS_16430 2331 3104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16430 3631 3119 gene locus_tag LOCUS_16440 3631 3119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16440 3956 3624 gene locus_tag LOCUS_16450 3956 3624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16450 3993 4214 gene locus_tag LOCUS_16460 3993 4214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16460 5834 4131 gene locus_tag LOCUS_16470 5834 4131 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921422.1 protein_id gnl|my_center|LOCUS_16470 >Feature sequence0235 1147 1380 gene locus_tag LOCUS_16480 1147 1380 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000764038.1 protein_id gnl|my_center|LOCUS_16480 1754 3310 gene locus_tag LOCUS_16490 1754 3310 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014329122.1 protein_id gnl|my_center|LOCUS_16490 3468 4325 gene locus_tag LOCUS_16500 3468 4325 CDS product histone deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902051.1 protein_id gnl|my_center|LOCUS_16500 5963 5076 gene locus_tag LOCUS_16510 5963 5076 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000433117.1 protein_id gnl|my_center|LOCUS_16510 >Feature sequence0236 <1 791 gene locus_tag LOCUS_16520 <1 791 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012258980.1:cobalamin-binding protein 2526 1213 gene locus_tag LOCUS_16530 2526 1213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16530 3127 4224 gene locus_tag LOCUS_16540 3127 4224 CDS product DUF3800 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000517778.1 protein_id gnl|my_center|LOCUS_16540 4410 4592 gene locus_tag LOCUS_16550 4410 4592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16550 5380 4568 gene locus_tag LOCUS_16560 5380 4568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16560 5841 6335 gene locus_tag LOCUS_16570 5841 6335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16570 >Feature sequence0237 1315 257 gene locus_tag LOCUS_16580 1315 257 CDS product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205421550.1 protein_id gnl|my_center|LOCUS_16580 2273 1677 gene locus_tag LOCUS_16590 2273 1677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16590 3055 2597 gene locus_tag LOCUS_16600 3055 2597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16600 3221 3991 gene locus_tag LOCUS_16610 3221 3991 CDS product DUF2071 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903274.1 protein_id gnl|my_center|LOCUS_16610 4357 5241 gene locus_tag LOCUS_16620 4357 5241 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120390.1 protein_id gnl|my_center|LOCUS_16620 >Feature sequence0238 <1 1680 gene locus_tag LOCUS_16630 <1 1680 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000757932.1:maltoporin LamB 2814 3890 gene locus_tag LOCUS_16640 2814 3890 CDS product lipid A deacylase LpxR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389754.1 protein_id gnl|my_center|LOCUS_16640 4392 5192 gene locus_tag LOCUS_16650 4392 5192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16650 >Feature sequence0239 1180 1749 gene locus_tag LOCUS_16660 gene rfaH 1180 1749 CDS product transcription/translation regulatory transformer protein RfaH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005760598.1 protein_id gnl|my_center|LOCUS_16660 2320 2970 gene locus_tag LOCUS_16670 2320 2970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16670 2967 3344 gene locus_tag LOCUS_16680 2967 3344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16680 3420 5690 gene locus_tag LOCUS_16690 3420 5690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16690 >Feature sequence0240 399 178 gene locus_tag LOCUS_16700 399 178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16700 832 416 gene locus_tag LOCUS_16710 832 416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16710 1085 1013 gene locus_tag LOCUS_t00130 1085 1013 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 1366 1181 gene locus_tag LOCUS_16720 1366 1181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16720 3385 1799 gene locus_tag LOCUS_16730 3385 1799 CDS product S53 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004528841.1 protein_id gnl|my_center|LOCUS_16730 4281 3739 gene locus_tag LOCUS_16740 4281 3739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16740 4532 6235 gene locus_tag LOCUS_16750 4532 6235 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257153.1 protein_id gnl|my_center|LOCUS_16750 >Feature sequence0241 2681 1029 gene locus_tag LOCUS_16760 gene oppA 2681 1029 CDS product oligopeptide ABC transporter substrate-binding protein OppA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002218177.1 protein_id gnl|my_center|LOCUS_16760 4936 2816 gene locus_tag LOCUS_16770 4936 2816 CDS product M3 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770371.1 protein_id gnl|my_center|LOCUS_16770 5957 5196 gene locus_tag LOCUS_16780 5957 5196 CDS product UvrB/UvrC motif-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329167.1 protein_id gnl|my_center|LOCUS_16780 >Feature sequence0242 338 1645 gene locus_tag LOCUS_16790 gene aceA 338 1645 CDS product isocitrate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259719.1 protein_id gnl|my_center|LOCUS_16790 1716 3248 gene locus_tag LOCUS_16800 1716 3248 CDS product acetyl-CoA hydrolase/transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389680.1 protein_id gnl|my_center|LOCUS_16800 4645 3356 gene locus_tag LOCUS_16810 4645 3356 CDS product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000852462.1 protein_id gnl|my_center|LOCUS_16810 4875 5285 gene locus_tag LOCUS_16820 4875 5285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16820 5866 6276 gene locus_tag LOCUS_16830 5866 6276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16830 >Feature sequence0243 <1 589 gene locus_tag LOCUS_16840 <1 589 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011975826.1:adenylate/guanylate cyclase domain-containing protein 1610 660 gene locus_tag LOCUS_16850 1610 660 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006311043.1 protein_id gnl|my_center|LOCUS_16850 2165 5209 gene locus_tag LOCUS_16860 2165 5209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16860 5247 5693 gene locus_tag LOCUS_16870 5247 5693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16870 >Feature sequence0244 1013 570 gene locus_tag LOCUS_16880 1013 570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16880 1911 1021 gene locus_tag LOCUS_16890 1911 1021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16890 2160 1915 gene locus_tag LOCUS_16900 2160 1915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16900 2691 3041 gene locus_tag LOCUS_16910 2691 3041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16910 4275 3004 gene locus_tag LOCUS_16920 4275 3004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16920 5141 4317 gene locus_tag LOCUS_16930 5141 4317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16930 <6275 5548 gene locus_tag LOCUS_16940 <6275 5548 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004199037.1:sugar-binding transcriptional regulator >Feature sequence0245 347 1162 gene locus_tag LOCUS_16950 347 1162 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722709.1 protein_id gnl|my_center|LOCUS_16950 1372 2268 gene locus_tag LOCUS_16960 1372 2268 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083318.1 protein_id gnl|my_center|LOCUS_16960 2414 3085 gene locus_tag LOCUS_16970 2414 3085 CDS product heavy metal response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943577.1 protein_id gnl|my_center|LOCUS_16970 3404 4768 gene locus_tag LOCUS_16980 3404 4768 CDS product heavy metal sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943578.1 protein_id gnl|my_center|LOCUS_16980 5136 5684 gene locus_tag LOCUS_16990 5136 5684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16990 >Feature sequence0246 512 1528 gene locus_tag LOCUS_17000 512 1528 CDS product methylcobamide--CoM methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986252.1 protein_id gnl|my_center|LOCUS_17000 1544 2845 gene locus_tag LOCUS_17010 1544 2845 CDS product uroporphyrinogen decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005801343.1 protein_id gnl|my_center|LOCUS_17010 2820 3482 gene locus_tag LOCUS_17020 2820 3482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17020 3485 4855 gene locus_tag LOCUS_17030 3485 4855 CDS product methanol--corrinoid methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392723.1 protein_id gnl|my_center|LOCUS_17030 5050 5787 gene locus_tag LOCUS_17040 5050 5787 CDS product DUF1638 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816516.1 protein_id gnl|my_center|LOCUS_17040 >Feature sequence0247 <1 1164 gene locus_tag LOCUS_17050 <1 1164 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001226465.1:hexuronate transporter ExuT 1217 3622 gene locus_tag LOCUS_17060 1217 3622 CDS product glycoside hydrolase family 31 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704830.1 protein_id gnl|my_center|LOCUS_17060 4590 4120 gene locus_tag LOCUS_17070 4590 4120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17070 4691 6184 gene locus_tag LOCUS_17080 4691 6184 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004555084.1 protein_id gnl|my_center|LOCUS_17080 >Feature sequence0248 765 5342 gene locus_tag LOCUS_17090 gene gltB 765 5342 CDS product glutamate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259099.1 protein_id gnl|my_center|LOCUS_17090 5498 5890 gene locus_tag LOCUS_17100 5498 5890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17100 >Feature sequence0249 2469 1084 gene locus_tag LOCUS_17110 2469 1084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17110 4086 3703 gene locus_tag LOCUS_17120 4086 3703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_17120 4575 4096 gene locus_tag LOCUS_17130 4575 4096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_17130 5020 4631 gene locus_tag LOCUS_17140 5020 4631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17140 >Feature sequence0250 2475 1141 gene locus_tag LOCUS_17150 2475 1141 CDS product glycine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002684564.1 protein_id gnl|my_center|LOCUS_17150 2520 3434 gene locus_tag LOCUS_17160 2520 3434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17160 3635 4564 gene locus_tag LOCUS_17170 3635 4564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17170 5983 4757 gene locus_tag LOCUS_17180 5983 4757 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230598.1 protein_id gnl|my_center|LOCUS_17180 >Feature sequence0251 2829 439 gene locus_tag LOCUS_17190 2829 439 CDS product glycoside hydrolase family 3 N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096977.1 protein_id gnl|my_center|LOCUS_17190 3344 4984 gene locus_tag LOCUS_17200 3344 4984 CDS product DUF4139 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224279.1 protein_id gnl|my_center|LOCUS_17200 5150 5902 gene locus_tag LOCUS_17210 5150 5902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17210 >Feature sequence0252 340 978 gene locus_tag LOCUS_17220 340 978 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041170108.1 protein_id gnl|my_center|LOCUS_17220 1277 1927 gene locus_tag LOCUS_17230 1277 1927 CDS product bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970026.1 protein_id gnl|my_center|LOCUS_17230 1924 2865 gene locus_tag LOCUS_17240 1924 2865 CDS product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970027.1 protein_id gnl|my_center|LOCUS_17240 2862 3845 gene locus_tag LOCUS_17250 2862 3845 CDS product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970028.1 protein_id gnl|my_center|LOCUS_17250 3832 4740 gene locus_tag LOCUS_17260 3832 4740 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970029.1 protein_id gnl|my_center|LOCUS_17260 4809 5693 gene locus_tag LOCUS_17270 4809 5693 CDS product SIS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970030.1 protein_id gnl|my_center|LOCUS_17270 >Feature sequence0253 1221 253 gene locus_tag LOCUS_17280 1221 253 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947102.1 protein_id gnl|my_center|LOCUS_17280 1991 1218 gene locus_tag LOCUS_17290 gene lpxI 1991 1218 CDS product UDP-2,3-diacylglucosamine diphosphatase LpxI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011791912.1 protein_id gnl|my_center|LOCUS_17290 3041 2301 gene locus_tag LOCUS_17300 gene ispE 3041 2301 CDS product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458917.1 protein_id gnl|my_center|LOCUS_17300 3142 3846 gene locus_tag LOCUS_17310 gene pyrF 3142 3846 CDS product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_156274057.1 protein_id gnl|my_center|LOCUS_17310 4762 4187 gene locus_tag LOCUS_17320 4762 4187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17320 >Feature sequence0254 973 2970 gene locus_tag LOCUS_17330 973 2970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17330 5163 4306 gene locus_tag LOCUS_17340 5163 4306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17340 5635 5405 gene locus_tag LOCUS_17350 5635 5405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17350 5760 6074 gene locus_tag LOCUS_17360 5760 6074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17360 >Feature sequence0255 2109 103 gene locus_tag LOCUS_17370 2109 103 CDS product S53 family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230264.1 protein_id gnl|my_center|LOCUS_17370 4355 2289 gene locus_tag LOCUS_17380 4355 2289 CDS product S53 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004528841.1 protein_id gnl|my_center|LOCUS_17380 4804 5550 gene locus_tag LOCUS_17390 4804 5550 CDS product sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121635.1 protein_id gnl|my_center|LOCUS_17390 >Feature sequence0256 1107 166 gene locus_tag LOCUS_17400 1107 166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17400 2110 1727 gene locus_tag LOCUS_17410 2110 1727 CDS product ester cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227323.1 protein_id gnl|my_center|LOCUS_17410 2558 2262 gene locus_tag LOCUS_17420 2558 2262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17420 2724 2536 gene locus_tag LOCUS_17430 2724 2536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17430 2828 3010 gene locus_tag LOCUS_17440 2828 3010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17440 3257 4066 gene locus_tag LOCUS_17450 3257 4066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17450 4541 4897 gene locus_tag LOCUS_17460 4541 4897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17460 5483 5100 gene locus_tag LOCUS_17470 5483 5100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17470 >Feature sequence0257 <1 1821 gene locus_tag LOCUS_17480 <1 1821 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_173072481.1:ATP-binding cassette domain-containing protein 1831 3273 gene locus_tag LOCUS_17490 1831 3273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17490 3297 3836 gene locus_tag LOCUS_17500 3297 3836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17500 3987 5102 gene locus_tag LOCUS_17510 3987 5102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17510 5236 6120 gene locus_tag LOCUS_17520 5236 6120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17520 >Feature sequence0258 9 641 gene locus_tag LOCUS_17530 9 641 CDS product NADPH-dependent F420 reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103987.1 protein_id gnl|my_center|LOCUS_17530 2094 769 gene locus_tag LOCUS_17540 gene melA 2094 769 CDS product alpha-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000986619.1 protein_id gnl|my_center|LOCUS_17540 3084 2260 gene locus_tag LOCUS_17550 3084 2260 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974399.1 protein_id gnl|my_center|LOCUS_17550 4031 3081 gene locus_tag LOCUS_17560 4031 3081 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000237985.1 protein_id gnl|my_center|LOCUS_17560 5749 4457 gene locus_tag LOCUS_17570 5749 4457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17570 >Feature sequence0259 1865 1131 gene locus_tag LOCUS_17580 1865 1131 CDS product sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121635.1 protein_id gnl|my_center|LOCUS_17580 2088 2381 gene locus_tag LOCUS_17590 2088 2381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17590 3504 2470 gene locus_tag LOCUS_17600 3504 2470 CDS product alanine--glyoxylate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088780.1 protein_id gnl|my_center|LOCUS_17600 5066 3891 gene locus_tag LOCUS_17610 5066 3891 CDS product RtcB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887075.1 protein_id gnl|my_center|LOCUS_17610 6167 5172 gene locus_tag LOCUS_17620 6167 5172 CDS product ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004534169.1 protein_id gnl|my_center|LOCUS_17620 >Feature sequence0260 3 455 gene locus_tag LOCUS_17630 3 455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17630 493 1014 gene locus_tag LOCUS_17640 493 1014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17640 1025 2503 gene locus_tag LOCUS_17650 1025 2503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17650 2595 2972 gene locus_tag LOCUS_17660 2595 2972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17660 4194 3502 gene locus_tag LOCUS_17670 4194 3502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17670 5303 4191 gene locus_tag LOCUS_17680 5303 4191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17680 5821 5489 gene locus_tag LOCUS_17690 gene cutA 5821 5489 CDS product divalent-cation tolerance protein CutA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879470.1 protein_id gnl|my_center|LOCUS_17690 >Feature sequence0261 544 1176 gene locus_tag LOCUS_17700 544 1176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17700 6094 1412 gene locus_tag LOCUS_17710 6094 1412 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037460.1 protein_id gnl|my_center|LOCUS_17710 >Feature sequence0262 2029 77 gene locus_tag LOCUS_17720 2029 77 CDS product CocE/NonD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037381.1 protein_id gnl|my_center|LOCUS_17720 2395 2760 gene locus_tag LOCUS_17730 2395 2760 CDS product DUF4260 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088113.1 protein_id gnl|my_center|LOCUS_17730 4270 3179 gene locus_tag LOCUS_17740 4270 3179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088279.1 protein_id gnl|my_center|LOCUS_17740 5274 4642 gene locus_tag LOCUS_17750 5274 4642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17750 5941 5444 gene locus_tag LOCUS_17760 5941 5444 CDS product heme-degrading domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199466.1 protein_id gnl|my_center|LOCUS_17760 >Feature sequence0263 513 118 gene locus_tag LOCUS_17770 513 118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17770 2259 838 gene locus_tag LOCUS_17780 2259 838 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965184.1 protein_id gnl|my_center|LOCUS_17780 2578 3993 gene locus_tag LOCUS_17790 2578 3993 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793798.1 protein_id gnl|my_center|LOCUS_17790 4388 5650 gene locus_tag LOCUS_17800 4388 5650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17800 >Feature sequence0264 2127 508 gene locus_tag LOCUS_17810 2127 508 CDS product carboxylesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726970.1 protein_id gnl|my_center|LOCUS_17810 2947 2555 gene locus_tag LOCUS_17820 2947 2555 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444835.1 protein_id gnl|my_center|LOCUS_17820 3081 3863 gene locus_tag LOCUS_17830 3081 3863 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192042.1 protein_id gnl|my_center|LOCUS_17830 5189 4305 gene locus_tag LOCUS_17840 gene bla 5189 4305 CDS product class A beta-lactamase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974796.1 protein_id gnl|my_center|LOCUS_17840 >Feature sequence0265 124 669 gene locus_tag LOCUS_17850 124 669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17850 666 1385 gene locus_tag LOCUS_17860 666 1385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17860 1627 2274 gene locus_tag LOCUS_17870 1627 2274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17870 4715 2997 gene locus_tag LOCUS_17880 4715 2997 CDS product thiamine pyrophosphate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037399307.1 protein_id gnl|my_center|LOCUS_17880 5012 6046 gene locus_tag LOCUS_17890 5012 6046 CDS product DUF4105 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035992.1 protein_id gnl|my_center|LOCUS_17890 >Feature sequence0266 1283 915 gene locus_tag LOCUS_17900 1283 915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17900 1446 1931 gene locus_tag LOCUS_17910 1446 1931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17910 2014 2649 gene locus_tag LOCUS_17920 2014 2649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17920 3056 3295 gene locus_tag LOCUS_17930 3056 3295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17930 3386 4201 gene locus_tag LOCUS_17940 3386 4201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17940 4804 4382 gene locus_tag LOCUS_17950 4804 4382 CDS product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940111.1 protein_id gnl|my_center|LOCUS_17950 4739 5122 gene locus_tag LOCUS_17960 4739 5122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17960 5544 5933 gene locus_tag LOCUS_17970 5544 5933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17970 >Feature sequence0267 <1 1508 gene locus_tag LOCUS_17980 <1 1508 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013533657.1:3-hydroxyacyl-CoA dehydrogenase NAD-binding domain-containing protein 1688 2881 gene locus_tag LOCUS_17990 1688 2881 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899055.1 protein_id gnl|my_center|LOCUS_17990 3857 3015 gene locus_tag LOCUS_18000 3857 3015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18000 4635 4246 gene locus_tag LOCUS_18010 gene apaG 4635 4246 CDS product Co2+/Mg2+ efflux protein ApaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000383338.1 protein_id gnl|my_center|LOCUS_18010 4670 5470 gene locus_tag LOCUS_18020 gene thiD 4670 5470 CDS product bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228119.1 protein_id gnl|my_center|LOCUS_18020 >Feature sequence0268 2442 1450 gene locus_tag LOCUS_18030 2442 1450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18030 3298 2810 gene locus_tag LOCUS_18040 3298 2810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18040 3885 3307 gene locus_tag LOCUS_18050 3885 3307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18050 4085 5458 gene locus_tag LOCUS_18060 4085 5458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_18060 >Feature sequence0269 1877 345 gene locus_tag LOCUS_18070 1877 345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18070 2083 1874 gene locus_tag LOCUS_18080 2083 1874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18080 3124 2183 gene locus_tag LOCUS_18090 3124 2183 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122336.1 protein_id gnl|my_center|LOCUS_18090 3868 4452 gene locus_tag LOCUS_18100 3868 4452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18100 5782 4544 gene locus_tag LOCUS_18110 5782 4544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18110 >Feature sequence0270 900 403 gene locus_tag LOCUS_18120 900 403 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259306.1 protein_id gnl|my_center|LOCUS_18120 1801 926 gene locus_tag LOCUS_18130 gene cutB 1801 926 CDS product glyceraldehyde dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978541.1 protein_id gnl|my_center|LOCUS_18130 2527 1988 gene locus_tag LOCUS_18140 2527 1988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18140 3441 2527 gene locus_tag LOCUS_18150 3441 2527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18150 5634 3556 gene locus_tag LOCUS_18160 5634 3556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18160 >Feature sequence0271 1105 551 gene locus_tag LOCUS_18170 1105 551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18170 1154 1306 gene locus_tag LOCUS_18180 1154 1306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18180 1576 3711 gene locus_tag LOCUS_18190 1576 3711 CDS product prolyl oligopeptidase family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140683.1 protein_id gnl|my_center|LOCUS_18190 3786 4580 gene locus_tag LOCUS_18200 3786 4580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18200 4750 4986 gene locus_tag LOCUS_18210 4750 4986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18210 5210 4983 gene locus_tag LOCUS_18220 5210 4983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18220 >Feature sequence0272 261 1532 gene locus_tag LOCUS_18230 261 1532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18230 4339 1829 gene locus_tag LOCUS_18240 4339 1829 CDS product CHAT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545943.1 protein_id gnl|my_center|LOCUS_18240 4441 4593 gene locus_tag LOCUS_18250 4441 4593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18250 5543 4962 gene locus_tag LOCUS_18260 5543 4962 CDS product DNA-3-methyladenine glycosylase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235045020.1 protein_id gnl|my_center|LOCUS_18260 >Feature sequence0273 2418 1057 gene locus_tag LOCUS_18270 2418 1057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18270 3102 2704 gene locus_tag LOCUS_18280 3102 2704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18280 3007 3681 gene locus_tag LOCUS_18290 3007 3681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18290 5119 3890 gene locus_tag LOCUS_18300 5119 3890 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933019.1 protein_id gnl|my_center|LOCUS_18300 <6026 5328 gene locus_tag LOCUS_18310 <6026 5328 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010933018.1:ABC transporter permease >Feature sequence0274 1888 2991 gene locus_tag LOCUS_18320 1888 2991 CDS product LOG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023171875.1 protein_id gnl|my_center|LOCUS_18320 3678 3406 gene locus_tag LOCUS_18330 3678 3406 CDS product phosphopantetheine-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940916.1 protein_id gnl|my_center|LOCUS_18330 3780 4517 gene locus_tag LOCUS_18340 3780 4517 CDS product TlyA family rRNA (cytidine-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942068.1 protein_id gnl|my_center|LOCUS_18340 4505 5374 gene locus_tag LOCUS_18350 4505 5374 CDS product NAD(+)/NADH kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931779.1 protein_id gnl|my_center|LOCUS_18350 5371 5829 gene locus_tag LOCUS_18360 5371 5829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18360 >Feature sequence0275 449 928 gene locus_tag LOCUS_18370 449 928 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025774673.1 protein_id gnl|my_center|LOCUS_18370 925 2109 gene locus_tag LOCUS_18380 925 2109 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392702.1 protein_id gnl|my_center|LOCUS_18380 2371 3081 gene locus_tag LOCUS_18390 2371 3081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18390 3094 4722 gene locus_tag LOCUS_18400 3094 4722 CDS product NAD+ synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938901.1 protein_id gnl|my_center|LOCUS_18400 4727 5602 gene locus_tag LOCUS_18410 4727 5602 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942409.1 protein_id gnl|my_center|LOCUS_18410 5796 5599 gene locus_tag LOCUS_18420 5796 5599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18420 >Feature sequence0276 2183 1290 gene locus_tag LOCUS_18430 2183 1290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18430 2895 2332 gene locus_tag LOCUS_18440 2895 2332 CDS product XTP/dITP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942438.1 protein_id gnl|my_center|LOCUS_18440 3002 5593 gene locus_tag LOCUS_18450 gene leuS 3002 5593 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001199945.1 protein_id gnl|my_center|LOCUS_18450 >Feature sequence0277 494 42 gene locus_tag LOCUS_18460 494 42 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207573.1 protein_id gnl|my_center|LOCUS_18460 618 875 gene locus_tag LOCUS_18470 618 875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18470 1335 847 gene locus_tag LOCUS_18480 1335 847 CDS product DUF1772 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141194.1 protein_id gnl|my_center|LOCUS_18480 1491 2399 gene locus_tag LOCUS_18490 1491 2399 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143349.1 protein_id gnl|my_center|LOCUS_18490 3146 2898 gene locus_tag LOCUS_18500 3146 2898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18500 3826 3446 gene locus_tag LOCUS_18510 3826 3446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18510 4671 3856 gene locus_tag LOCUS_18520 4671 3856 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004523473.1 protein_id gnl|my_center|LOCUS_18520 5495 4668 gene locus_tag LOCUS_18530 5495 4668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18530 >Feature sequence0278 1481 645 gene locus_tag LOCUS_18540 gene nadC 1481 645 CDS product carboxylating nicotinate-nucleotide diphosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256782.1 protein_id gnl|my_center|LOCUS_18540 1649 2005 gene locus_tag LOCUS_18550 1649 2005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18550 2185 2463 gene locus_tag LOCUS_18560 2185 2463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18560 2493 2834 gene locus_tag LOCUS_18570 2493 2834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18570 2827 5676 gene locus_tag LOCUS_18580 2827 5676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18580 >Feature sequence0279 <1 829 gene locus_tag LOCUS_18590 <1 829 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004544143.1:FAD-dependent monooxygenase 1632 949 gene locus_tag LOCUS_18600 1632 949 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403448.1 protein_id gnl|my_center|LOCUS_18600 3086 1737 gene locus_tag LOCUS_18610 3086 1737 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887438.1 protein_id gnl|my_center|LOCUS_18610 3256 4455 gene locus_tag LOCUS_18620 3256 4455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18620 <5968 5089 gene locus_tag LOCUS_18630 <5968 5089 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011140636.1:response regulator >Feature sequence0280 1876 905 gene locus_tag LOCUS_18640 1876 905 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929295.1 protein_id gnl|my_center|LOCUS_18640 2657 2025 gene locus_tag LOCUS_18650 2657 2025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18650 4914 2647 gene locus_tag LOCUS_18660 4914 2647 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813559.1 protein_id gnl|my_center|LOCUS_18660 >Feature sequence0281 <1 1177 gene locus_tag LOCUS_18670 <1 1177 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015705377.1:carbohydrate porin 1763 1485 gene locus_tag LOCUS_18680 1763 1485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18680 2022 3281 gene locus_tag LOCUS_18690 2022 3281 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173996.1 protein_id gnl|my_center|LOCUS_18690 3331 3594 gene locus_tag LOCUS_18700 3331 3594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18700 3607 4587 gene locus_tag LOCUS_18710 gene queA 3607 4587 CDS product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081288.1 protein_id gnl|my_center|LOCUS_18710 4787 5551 gene locus_tag LOCUS_18720 4787 5551 CDS product TSUP family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176994212.1 protein_id gnl|my_center|LOCUS_18720 >Feature sequence0282 2011 1454 gene locus_tag LOCUS_18730 2011 1454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18730 4119 3001 gene locus_tag LOCUS_18740 4119 3001 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257896.1 protein_id gnl|my_center|LOCUS_18740 >Feature sequence0283 1344 775 gene locus_tag LOCUS_18750 1344 775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18750 1754 1350 gene locus_tag LOCUS_18760 1754 1350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18760 3612 1867 gene locus_tag LOCUS_18770 3612 1867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18770 4189 3605 gene locus_tag LOCUS_18780 4189 3605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18780 4772 4329 gene locus_tag LOCUS_18790 4772 4329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18790 5442 4798 gene locus_tag LOCUS_18800 5442 4798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18800 >Feature sequence0284 233 320 gene locus_tag LOCUS_t00140 233 320 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 1933 2511 gene locus_tag LOCUS_18810 1933 2511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18810 2504 3136 gene locus_tag LOCUS_18820 2504 3136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18820 4069 3509 gene locus_tag LOCUS_18830 4069 3509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18830 4419 4066 gene locus_tag LOCUS_18840 4419 4066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18840 5574 4579 gene locus_tag LOCUS_18850 5574 4579 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259668.1 protein_id gnl|my_center|LOCUS_18850 >Feature sequence0285 323 105 gene locus_tag LOCUS_18860 323 105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18860 480 301 gene locus_tag LOCUS_18870 480 301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18870 657 815 gene locus_tag LOCUS_18880 657 815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_18880 1867 1217 gene locus_tag LOCUS_18890 1867 1217 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005109943.1 protein_id gnl|my_center|LOCUS_18890 2552 2004 gene locus_tag LOCUS_18900 2552 2004 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003706302.1 protein_id gnl|my_center|LOCUS_18900 2827 3240 gene locus_tag LOCUS_18910 2827 3240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18910 4203 3307 gene locus_tag LOCUS_18920 4203 3307 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143349.1 protein_id gnl|my_center|LOCUS_18920 <5916 4341 gene locus_tag LOCUS_18930 <5916 4341 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013527968.1:NAD(P)/FAD-dependent oxidoreductase >Feature sequence0286 1801 2283 gene locus_tag LOCUS_18940 1801 2283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18940 2334 2669 gene locus_tag LOCUS_18950 2334 2669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18950 2735 3031 gene locus_tag LOCUS_18960 2735 3031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18960 3541 3954 gene locus_tag LOCUS_18970 3541 3954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18970 4866 5054 gene locus_tag LOCUS_18980 4866 5054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18980 >Feature sequence0287 980 459 gene locus_tag LOCUS_18990 980 459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18990 1171 2253 gene locus_tag LOCUS_19000 gene purK 1171 2253 CDS product 5-(carboxyamino)imidazole ribonucleotide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009966735.1 protein_id gnl|my_center|LOCUS_19000 2237 2686 gene locus_tag LOCUS_19010 2237 2686 CDS product DUF192 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003820399.1 protein_id gnl|my_center|LOCUS_19010 2770 4599 gene locus_tag LOCUS_19020 gene polX 2770 4599 CDS product DNA polymerase/3'-5' exonuclease PolX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957611.1 protein_id gnl|my_center|LOCUS_19020 4873 5679 gene locus_tag LOCUS_19030 4873 5679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19030 >Feature sequence0288 898 602 gene locus_tag LOCUS_19040 898 602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19040 1068 1562 gene locus_tag LOCUS_19050 1068 1562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19050 1922 3013 gene locus_tag LOCUS_19060 1922 3013 CDS product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770245.1 protein_id gnl|my_center|LOCUS_19060 3369 5789 gene locus_tag LOCUS_19070 3369 5789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19070 >Feature sequence0289 <1 932 gene locus_tag LOCUS_19080 <1 932 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011088606.1:MFS transporter 1527 2009 gene locus_tag LOCUS_19090 1527 2009 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444185.1 protein_id gnl|my_center|LOCUS_19090 3088 2063 gene locus_tag LOCUS_19100 3088 2063 CDS product hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969875.1 protein_id gnl|my_center|LOCUS_19100 4491 3097 gene locus_tag LOCUS_19110 4491 3097 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974049.1 protein_id gnl|my_center|LOCUS_19110 4798 5250 gene locus_tag LOCUS_19120 gene phnB 4798 5250 CDS product Dot/Icm type IV secretion system effector PhnB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957793.1 protein_id gnl|my_center|LOCUS_19120 >Feature sequence0290 2871 1063 gene locus_tag LOCUS_19130 2871 1063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19130 4739 2868 gene locus_tag LOCUS_19140 4739 2868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19140 4892 5611 gene locus_tag LOCUS_19150 4892 5611 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256313.1 protein_id gnl|my_center|LOCUS_19150 >Feature sequence0291 1663 404 gene locus_tag LOCUS_19160 1663 404 CDS product acetoin dehydrogenase dihydrolipoyllysine-residue acetyltransferase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067244.1 protein_id gnl|my_center|LOCUS_19160 2788 1814 gene locus_tag LOCUS_19170 2788 1814 CDS product alpha-ketoacid dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_234705060.1 protein_id gnl|my_center|LOCUS_19170 3933 2893 gene locus_tag LOCUS_19180 3933 2893 CDS product thiamine pyrophosphate-dependent dehydrogenase E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067246.1 protein_id gnl|my_center|LOCUS_19180 5649 4105 gene locus_tag LOCUS_19190 5649 4105 CDS product FGGY-family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067242.1 protein_id gnl|my_center|LOCUS_19190 >Feature sequence0292 1402 2013 gene locus_tag LOCUS_19200 1402 2013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19200 2160 2993 gene locus_tag LOCUS_19210 2160 2993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19210 3350 3835 gene locus_tag LOCUS_19220 3350 3835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19220 3865 5082 gene locus_tag LOCUS_19230 3865 5082 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479682.1 protein_id gnl|my_center|LOCUS_19230 >Feature sequence0293 1822 1418 gene locus_tag LOCUS_19240 1822 1418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19240 2578 2057 gene locus_tag LOCUS_19250 2578 2057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19250 4272 2851 gene locus_tag LOCUS_19260 4272 2851 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_144080476.1 protein_id gnl|my_center|LOCUS_19260 4472 5374 gene locus_tag LOCUS_19270 4472 5374 CDS product 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920127.1 protein_id gnl|my_center|LOCUS_19270 >Feature sequence0294 567 1025 gene locus_tag LOCUS_19280 567 1025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19280 1044 3107 gene locus_tag LOCUS_19290 gene tkt 1044 3107 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_092005623.1 protein_id gnl|my_center|LOCUS_19290 3420 4244 gene locus_tag LOCUS_19300 3420 4244 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729831.1 protein_id gnl|my_center|LOCUS_19300 4474 5811 gene locus_tag LOCUS_19310 4474 5811 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969686.1 protein_id gnl|my_center|LOCUS_19310 >Feature sequence0295 309 605 gene locus_tag LOCUS_19320 309 605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19320 804 619 gene locus_tag LOCUS_19330 804 619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19330 2292 1825 gene locus_tag LOCUS_19340 2292 1825 CDS product RES family NAD+ phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402968.1 protein_id gnl|my_center|LOCUS_19340 2693 2289 gene locus_tag LOCUS_19350 2693 2289 CDS product DUF2384 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_095512524.1 protein_id gnl|my_center|LOCUS_19350 3263 2928 gene locus_tag LOCUS_19360 3263 2928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19360 4298 3819 gene locus_tag LOCUS_19370 4298 3819 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083839.1 protein_id gnl|my_center|LOCUS_19370 >Feature sequence0296 556 59 gene locus_tag LOCUS_19380 556 59 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19380 1419 673 gene locus_tag LOCUS_19390 1419 673 CDS product succinate dehydrogenase/fumarate reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005078515.1 protein_id gnl|my_center|LOCUS_19390 1627 1448 gene locus_tag LOCUS_19400 1627 1448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19400 3596 1773 gene locus_tag LOCUS_19410 3596 1773 CDS product fumarate reductase/succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224226.1 protein_id gnl|my_center|LOCUS_19410 3849 3610 gene locus_tag LOCUS_19420 3849 3610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19420 4574 3810 gene locus_tag LOCUS_19430 4574 3810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030062.1 protein_id gnl|my_center|LOCUS_19430 >Feature sequence0297 <1 809 gene locus_tag LOCUS_19440 <1 809 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_118838340.1:histidine ammonia-lyase 1178 2209 gene locus_tag LOCUS_19450 1178 2209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19450 2261 3835 gene locus_tag LOCUS_19460 2261 3835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19460 >Feature sequence0298 3387 2638 gene locus_tag LOCUS_19470 3387 2638 CDS product sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121635.1 protein_id gnl|my_center|LOCUS_19470 4025 3441 gene locus_tag LOCUS_19480 4025 3441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19480 4138 4521 gene locus_tag LOCUS_19490 4138 4521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19490 5327 4743 gene locus_tag LOCUS_19500 5327 4743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19500 >Feature sequence0299 1123 692 gene locus_tag LOCUS_19510 1123 692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19510 1770 2540 gene locus_tag LOCUS_19520 1770 2540 CDS product L-iditol 2-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064240170.1 protein_id gnl|my_center|LOCUS_19520 3856 2885 gene locus_tag LOCUS_19530 3856 2885 CDS product ribose ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006315915.1 protein_id gnl|my_center|LOCUS_19530 5363 3843 gene locus_tag LOCUS_19540 gene gguA 5363 3843 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582800.1 protein_id gnl|my_center|LOCUS_19540 5424 5612 gene locus_tag LOCUS_19550 5424 5612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19550 >Feature sequence0300 556 978 gene locus_tag LOCUS_19560 gene rplM 556 978 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_112902658.1 protein_id gnl|my_center|LOCUS_19560 985 1374 gene locus_tag LOCUS_19570 gene rpsI 985 1374 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939789.1 protein_id gnl|my_center|LOCUS_19570 2131 2748 gene locus_tag LOCUS_19580 2131 2748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19580 2766 3509 gene locus_tag LOCUS_19590 2766 3509 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061211.1 protein_id gnl|my_center|LOCUS_19590 3510 3746 gene locus_tag LOCUS_19600 3510 3746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19600 4344 3856 gene locus_tag LOCUS_19610 4344 3856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19610 4664 4320 gene locus_tag LOCUS_19620 4664 4320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19620 <5834 4739 gene locus_tag LOCUS_19630 <5834 4739 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010883393.1:RNA polymerase sigma factor >Feature sequence0301 808 963 gene locus_tag LOCUS_19640 808 963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19640 5361 1117 gene locus_tag LOCUS_19650 5361 1117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19650 >Feature sequence0302 1980 1501 gene locus_tag LOCUS_19660 1980 1501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_19660 2841 2059 gene locus_tag LOCUS_19670 2841 2059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_19670 4365 3136 gene locus_tag LOCUS_19680 gene allC 4365 3136 CDS product allantoate deiminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002383320.1 protein_id gnl|my_center|LOCUS_19680 >Feature sequence0303 1415 312 gene locus_tag LOCUS_19690 1415 312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19690 3725 1626 gene locus_tag LOCUS_19700 3725 1626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19700 3877 4290 gene locus_tag LOCUS_19710 3877 4290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19710 >Feature sequence0304 1282 1070 gene locus_tag LOCUS_19720 1282 1070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19720 1521 2660 gene locus_tag LOCUS_19730 1521 2660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19730 3682 2657 gene locus_tag LOCUS_19740 3682 2657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19740 4509 3757 gene locus_tag LOCUS_19750 4509 3757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19750 5363 4542 gene locus_tag LOCUS_19760 5363 4542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19760 >Feature sequence0305 183 1211 gene locus_tag LOCUS_19770 183 1211 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204136.1 protein_id gnl|my_center|LOCUS_19770 1606 2316 gene locus_tag LOCUS_19780 gene radC 1606 2316 CDS product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392073.1 protein_id gnl|my_center|LOCUS_19780 3447 2557 gene locus_tag LOCUS_19790 3447 2557 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_151128636.1 protein_id gnl|my_center|LOCUS_19790 3683 5083 gene locus_tag LOCUS_19800 3683 5083 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388869.1 protein_id gnl|my_center|LOCUS_19800 5177 5374 gene locus_tag LOCUS_19810 5177 5374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19810 >Feature sequence0306 1194 1406 gene locus_tag LOCUS_19820 1194 1406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19820 3778 3596 gene locus_tag LOCUS_19830 3778 3596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19830 4415 4627 gene locus_tag LOCUS_19840 4415 4627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19840 4891 4667 gene locus_tag LOCUS_19850 4891 4667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19850 5081 4860 gene locus_tag LOCUS_19860 5081 4860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19860 5401 5081 gene locus_tag LOCUS_19870 5401 5081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19870 >Feature sequence0307 615 427 gene locus_tag LOCUS_19880 615 427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19880 886 707 gene locus_tag LOCUS_19890 886 707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19890 1970 2563 gene locus_tag LOCUS_19900 1970 2563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19900 3055 3462 gene locus_tag LOCUS_19910 3055 3462 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097692.1 protein_id gnl|my_center|LOCUS_19910 3465 3824 gene locus_tag LOCUS_19920 3465 3824 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002213446.1 protein_id gnl|my_center|LOCUS_19920 4592 4996 gene locus_tag LOCUS_19930 4592 4996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19930 >Feature sequence0308 1069 689 gene locus_tag LOCUS_19940 1069 689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19940 1796 1350 gene locus_tag LOCUS_19950 1796 1350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19950 2122 1793 gene locus_tag LOCUS_19960 2122 1793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19960 2347 2751 gene locus_tag LOCUS_19970 2347 2751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19970 3182 3412 gene locus_tag LOCUS_19980 3182 3412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19980 3537 3758 gene locus_tag LOCUS_19990 3537 3758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19990 3945 4187 gene locus_tag LOCUS_20000 3945 4187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20000 4496 4879 gene locus_tag LOCUS_20010 4496 4879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20010 >Feature sequence0309 1046 285 gene locus_tag LOCUS_20020 1046 285 CDS product TIM barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123560.1 protein_id gnl|my_center|LOCUS_20020 1728 1219 gene locus_tag LOCUS_20030 1728 1219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20030 1948 2991 gene locus_tag LOCUS_20040 1948 2991 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921231.1 protein_id gnl|my_center|LOCUS_20040 3433 3816 gene locus_tag LOCUS_20050 3433 3816 CDS product BlaI/MecI/CopY family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929155.1 protein_id gnl|my_center|LOCUS_20050 3813 5729 gene locus_tag LOCUS_20060 3813 5729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20060 >Feature sequence0310 5012 3444 gene locus_tag LOCUS_20070 gene rng 5012 3444 CDS product ribonuclease G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943853.1 protein_id gnl|my_center|LOCUS_20070 5766 5074 gene locus_tag LOCUS_20080 5766 5074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20080 >Feature sequence0311 1104 865 gene locus_tag LOCUS_20090 1104 865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20090 1289 1495 gene locus_tag LOCUS_20100 1289 1495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20100 1574 2296 gene locus_tag LOCUS_20110 1574 2296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20110 2409 3326 gene locus_tag LOCUS_20120 2409 3326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20120 3359 4132 gene locus_tag LOCUS_20130 3359 4132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20130 5749 4418 gene locus_tag LOCUS_20140 5749 4418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20140 >Feature sequence0312 1362 295 gene locus_tag LOCUS_20150 1362 295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20150 2735 1665 gene locus_tag LOCUS_20160 2735 1665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20160 3331 2837 gene locus_tag LOCUS_20170 3331 2837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20170 5587 3635 gene locus_tag LOCUS_20180 5587 3635 CDS product fructose-1,6-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964880.1 protein_id gnl|my_center|LOCUS_20180 >Feature sequence0313 191 1099 gene locus_tag LOCUS_20190 191 1099 CDS product TraB/GumN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583996.1 protein_id gnl|my_center|LOCUS_20190 2921 1455 gene locus_tag LOCUS_20200 gene pyk 2921 1455 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393367.1 protein_id gnl|my_center|LOCUS_20200 3242 3508 gene locus_tag LOCUS_20210 3242 3508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20210 3765 5036 gene locus_tag LOCUS_20220 gene hisS 3765 5036 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000431277.1 protein_id gnl|my_center|LOCUS_20220 >Feature sequence0314 315 2789 gene locus_tag LOCUS_20230 315 2789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20230 4272 3085 gene locus_tag LOCUS_20240 4272 3085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20240 4600 4812 gene locus_tag LOCUS_20250 4600 4812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20250 >Feature sequence0315 1647 955 gene locus_tag LOCUS_20260 1647 955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20260 2057 2467 gene locus_tag LOCUS_20270 2057 2467 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968136.1 protein_id gnl|my_center|LOCUS_20270 2796 3869 gene locus_tag LOCUS_20280 2796 3869 CDS product alanine--glyoxylate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943872.1 protein_id gnl|my_center|LOCUS_20280 4075 4572 gene locus_tag LOCUS_20290 4075 4572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20290 4873 5469 gene locus_tag LOCUS_20300 4873 5469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20300 >Feature sequence0316 1478 159 gene locus_tag LOCUS_20310 1478 159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20310 2094 4529 gene locus_tag LOCUS_20320 2094 4529 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141201.1 protein_id gnl|my_center|LOCUS_20320 4718 5701 gene locus_tag LOCUS_20330 4718 5701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20330 >Feature sequence0317 423 1397 gene locus_tag LOCUS_20340 423 1397 CDS product pyruvate dehydrogenase complex E1 component subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000279894.1 protein_id gnl|my_center|LOCUS_20340 1410 2693 gene locus_tag LOCUS_20350 1410 2693 CDS product pyruvate dehydrogenase complex dihydrolipoamide acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337521.1 protein_id gnl|my_center|LOCUS_20350 2852 4228 gene locus_tag LOCUS_20360 gene lpdA 2852 4228 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962865.1 protein_id gnl|my_center|LOCUS_20360 5647 5036 gene locus_tag LOCUS_20370 5647 5036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20370 >Feature sequence0318 <1 909 gene locus_tag LOCUS_20380 <1 909 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_037391987.1:LysR family transcriptional regulator 1800 1039 gene locus_tag LOCUS_20390 gene gpmA 1800 1039 CDS product 2,3-diphosphoglycerate-dependent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932091.1 protein_id gnl|my_center|LOCUS_20390 3589 2003 gene locus_tag LOCUS_20400 gene pckA 3589 2003 CDS product phosphoenolpyruvate carboxykinase (ATP) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405091.1 protein_id gnl|my_center|LOCUS_20400 4843 3635 gene locus_tag LOCUS_20410 4843 3635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20410 <5703 4858 gene locus_tag LOCUS_20420 <5703 4858 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002668968.1:type I glyceraldehyde-3-phosphate dehydrogenase >Feature sequence0319 970 299 gene locus_tag LOCUS_20430 970 299 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141420.1 protein_id gnl|my_center|LOCUS_20430 1131 1973 gene locus_tag LOCUS_20440 1131 1973 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974553.1 protein_id gnl|my_center|LOCUS_20440 1988 2887 gene locus_tag LOCUS_20450 1988 2887 CDS product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976044.1 protein_id gnl|my_center|LOCUS_20450 2880 3803 gene locus_tag LOCUS_20460 2880 3803 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974554.1 protein_id gnl|my_center|LOCUS_20460 4310 3819 gene locus_tag LOCUS_20470 4310 3819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20470 4507 5106 gene locus_tag LOCUS_20480 4507 5106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20480 >Feature sequence0320 2193 508 gene locus_tag LOCUS_20490 2193 508 CDS product peptidase S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257170.1 protein_id gnl|my_center|LOCUS_20490 2387 2833 gene locus_tag LOCUS_20500 2387 2833 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269427.1 protein_id gnl|my_center|LOCUS_20500 3442 4911 gene locus_tag LOCUS_20510 3442 4911 CDS product FAD/NAD(P)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527331.1 protein_id gnl|my_center|LOCUS_20510 >Feature sequence0321 1197 586 gene locus_tag LOCUS_20520 1197 586 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208130.1 protein_id gnl|my_center|LOCUS_20520 1305 2054 gene locus_tag LOCUS_20530 1305 2054 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028373.1 protein_id gnl|my_center|LOCUS_20530 2540 3334 gene locus_tag LOCUS_20540 2540 3334 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090624.1 protein_id gnl|my_center|LOCUS_20540 4264 3587 gene locus_tag LOCUS_20550 4264 3587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20550 4604 4347 gene locus_tag LOCUS_20560 4604 4347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20560 4712 5353 gene locus_tag LOCUS_20570 4712 5353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20570 >Feature sequence0322 1554 535 gene locus_tag LOCUS_20580 1554 535 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_077753831.1 protein_id gnl|my_center|LOCUS_20580 3115 1544 gene locus_tag LOCUS_20590 3115 1544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20590 4100 3222 gene locus_tag LOCUS_20600 4100 3222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20600 5402 4110 gene locus_tag LOCUS_20610 5402 4110 CDS product DUF4910 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707841.1 protein_id gnl|my_center|LOCUS_20610 >Feature sequence0323 980 189 gene locus_tag LOCUS_20620 980 189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20620 1330 2292 gene locus_tag LOCUS_20630 1330 2292 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582950.1 protein_id gnl|my_center|LOCUS_20630 2568 4082 gene locus_tag LOCUS_20640 2568 4082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20640 5569 4109 gene locus_tag LOCUS_20650 5569 4109 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705992.1 protein_id gnl|my_center|LOCUS_20650 >Feature sequence0324 2186 1023 gene locus_tag LOCUS_20660 2186 1023 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968364.1 protein_id gnl|my_center|LOCUS_20660 2282 3340 gene locus_tag LOCUS_20670 2282 3340 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968361.1 protein_id gnl|my_center|LOCUS_20670 3411 4178 gene locus_tag LOCUS_20680 3411 4178 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223575.1 protein_id gnl|my_center|LOCUS_20680 >Feature sequence0325 3420 991 gene locus_tag LOCUS_20690 3420 991 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141201.1 protein_id gnl|my_center|LOCUS_20690 <5658 3602 gene locus_tag LOCUS_20700 <5658 3602 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164928775.1:ABC transporter permease >Feature sequence0326 1592 2857 gene locus_tag LOCUS_20710 1592 2857 CDS product Glu/Leu/Phe/Val dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257936.1 protein_id gnl|my_center|LOCUS_20710 >Feature sequence0327 1907 2470 gene locus_tag LOCUS_20720 1907 2470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20720 2467 4605 gene locus_tag LOCUS_20730 2467 4605 CDS product pyruvate formate lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797468.1 protein_id gnl|my_center|LOCUS_20730 <5649 4593 gene locus_tag LOCUS_20740 <5649 4593 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_162992366.1:sugar ABC transporter ATP-binding protein >Feature sequence0328 870 613 gene locus_tag LOCUS_20750 870 613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20750 1817 921 gene locus_tag LOCUS_20760 1817 921 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707196.1 protein_id gnl|my_center|LOCUS_20760 1931 2545 gene locus_tag LOCUS_20770 1931 2545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20770 3097 4938 gene locus_tag LOCUS_20780 3097 4938 CDS product thiamine pyrophosphate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533218.1 protein_id gnl|my_center|LOCUS_20780 >Feature sequence0329 3403 2636 gene locus_tag LOCUS_20790 3403 2636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20790 3617 4105 gene locus_tag LOCUS_20800 3617 4105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20800 5157 4201 gene locus_tag LOCUS_20810 5157 4201 CDS product GlxA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064252799.1 protein_id gnl|my_center|LOCUS_20810 >Feature sequence0330 2 1699 gene locus_tag LOCUS_20820 2 1699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20820 2191 5208 gene locus_tag LOCUS_20830 2191 5208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20830 5252 5449 gene locus_tag LOCUS_20840 5252 5449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20840 >Feature sequence0331 <5627 2 gene locus_tag LOCUS_20850 <5627 2 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013095415.1:ATP-binding sensor histidine kinase >Feature sequence0332 217 705 gene locus_tag LOCUS_20860 217 705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20860 864 1541 gene locus_tag LOCUS_20870 864 1541 CDS product O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223717.1 protein_id gnl|my_center|LOCUS_20870 1785 2468 gene locus_tag LOCUS_20880 1785 2468 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000868943.1 protein_id gnl|my_center|LOCUS_20880 3143 2676 gene locus_tag LOCUS_20890 3143 2676 CDS product YdeI/OmpD-associated family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039237.1 protein_id gnl|my_center|LOCUS_20890 3630 3190 gene locus_tag LOCUS_20900 3630 3190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20900 3971 3627 gene locus_tag LOCUS_20910 3971 3627 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226515.1 protein_id gnl|my_center|LOCUS_20910 >Feature sequence0333 102 434 gene locus_tag LOCUS_20920 102 434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20920 779 2701 gene locus_tag LOCUS_20930 779 2701 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123734.1 protein_id gnl|my_center|LOCUS_20930 3595 3110 gene locus_tag LOCUS_20940 3595 3110 CDS product DUF1772 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030667.1 protein_id gnl|my_center|LOCUS_20940 3668 4246 gene locus_tag LOCUS_20950 3668 4246 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973632.1 protein_id gnl|my_center|LOCUS_20950 4350 4529 gene locus_tag LOCUS_20960 4350 4529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20960 >Feature sequence0334 117 389 gene locus_tag LOCUS_20970 117 389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20970 1046 618 gene locus_tag LOCUS_20980 1046 618 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530912.1 protein_id gnl|my_center|LOCUS_20980 2472 1810 gene locus_tag LOCUS_20990 2472 1810 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005077236.1 protein_id gnl|my_center|LOCUS_20990 2924 3718 gene locus_tag LOCUS_21000 2924 3718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21000 4156 3836 gene locus_tag LOCUS_21010 4156 3836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21010 4407 4153 gene locus_tag LOCUS_21020 4407 4153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21020 4698 5057 gene locus_tag LOCUS_21030 4698 5057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21030 >Feature sequence0335 <1 528 gene locus_tag LOCUS_21040 <1 528 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015775783.1:UTP--glucose-1-phosphate uridylyltransferase 560 766 gene locus_tag LOCUS_21050 560 766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21050 1486 668 gene locus_tag LOCUS_21060 1486 668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21060 1810 1556 gene locus_tag LOCUS_21070 1810 1556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21070 2664 1810 gene locus_tag LOCUS_21080 2664 1810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21080 3757 2870 gene locus_tag LOCUS_21090 3757 2870 CDS product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940783.1 protein_id gnl|my_center|LOCUS_21090 3869 5131 gene locus_tag LOCUS_21100 3869 5131 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000097166.1 protein_id gnl|my_center|LOCUS_21100 >Feature sequence0336 699 202 gene locus_tag LOCUS_21110 699 202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21110 915 703 gene locus_tag LOCUS_21120 915 703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21120 1132 881 gene locus_tag LOCUS_21130 1132 881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21130 1233 1448 gene locus_tag LOCUS_21140 1233 1448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21140 1491 1643 gene locus_tag LOCUS_21150 1491 1643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21150 1654 2217 gene locus_tag LOCUS_21160 1654 2217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21160 3391 2678 gene locus_tag LOCUS_21170 gene radC 3391 2678 CDS product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545736.1 protein_id gnl|my_center|LOCUS_21170 3732 5336 gene locus_tag LOCUS_21180 3732 5336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21180 >Feature sequence0337 <1 747 gene locus_tag LOCUS_21190 <1 747 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012546821.1:replication-associated recombination protein A 1849 1049 gene locus_tag LOCUS_21200 gene tatC 1849 1049 CDS product twin-arginine translocase subunit TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887452.1 protein_id gnl|my_center|LOCUS_21200 2627 2046 gene locus_tag LOCUS_21210 2627 2046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21210 3987 2620 gene locus_tag LOCUS_21220 gene argH 3987 2620 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546455.1 protein_id gnl|my_center|LOCUS_21220 5022 4075 gene locus_tag LOCUS_21230 gene rbsK 5022 4075 CDS product ribokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391595.1 protein_id gnl|my_center|LOCUS_21230 >Feature sequence0338 389 1141 gene locus_tag LOCUS_21240 389 1141 CDS product MIP/aquaporin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081684.1 protein_id gnl|my_center|LOCUS_21240 1172 2653 gene locus_tag LOCUS_21250 gene glpK 1172 2653 CDS product glycerol kinase GlpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888563.1 protein_id gnl|my_center|LOCUS_21250 2842 4407 gene locus_tag LOCUS_21260 2842 4407 CDS product glycerol-3-phosphate dehydrogenase/oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887662.1 protein_id gnl|my_center|LOCUS_21260 >Feature sequence0339 <1 864 gene locus_tag LOCUS_21270 <1 864 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011338530.1:TIGR03862 family flavoprotein 871 1377 gene locus_tag LOCUS_21280 gene bcp 871 1377 CDS product thioredoxin-dependent thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785789.1 protein_id gnl|my_center|LOCUS_21280 1777 2994 gene locus_tag LOCUS_21290 1777 2994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21290 3067 4497 gene locus_tag LOCUS_21300 3067 4497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21300 4487 5290 gene locus_tag LOCUS_21310 4487 5290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21310 >Feature sequence0340 211 1743 gene locus_tag LOCUS_21320 211 1743 CDS product FGGY-family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066694.1 protein_id gnl|my_center|LOCUS_21320 2336 3181 gene locus_tag LOCUS_21330 2336 3181 CDS product formate/nitrite transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730486.1 protein_id gnl|my_center|LOCUS_21330 3311 5083 gene locus_tag LOCUS_21340 3311 5083 CDS product NirA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967420.1 protein_id gnl|my_center|LOCUS_21340 >Feature sequence0341 2452 3084 gene locus_tag LOCUS_21350 2452 3084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21350 3523 3149 gene locus_tag LOCUS_21360 3523 3149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21360 <5569 3940 gene locus_tag LOCUS_21370 <5569 3940 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011085026.1:AAA family ATPase >Feature sequence0342 686 219 gene locus_tag LOCUS_21380 686 219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21380 1758 1156 gene locus_tag LOCUS_21390 1758 1156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21390 2798 1761 gene locus_tag LOCUS_21400 2798 1761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21400 2928 3137 gene locus_tag LOCUS_21410 2928 3137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21410 4903 3425 gene locus_tag LOCUS_21420 4903 3425 CDS product putative Na+/H+ antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929970.1 protein_id gnl|my_center|LOCUS_21420 5358 5104 gene locus_tag LOCUS_21430 5358 5104 CDS product phosphocarrier protein HPr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000146946.1 protein_id gnl|my_center|LOCUS_21430 >Feature sequence0343 1295 2155 gene locus_tag LOCUS_21440 1295 2155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21440 2452 3009 gene locus_tag LOCUS_21450 2452 3009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21450 4661 3606 gene locus_tag LOCUS_21460 4661 3606 CDS product chemotaxis protein CheB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525053.1 protein_id gnl|my_center|LOCUS_21460 >Feature sequence0344 174 10 gene locus_tag LOCUS_21470 174 10 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21470 973 221 gene locus_tag LOCUS_21480 973 221 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141273.1 protein_id gnl|my_center|LOCUS_21480 3733 1301 gene locus_tag LOCUS_21490 3733 1301 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141201.1 protein_id gnl|my_center|LOCUS_21490 5291 3963 gene locus_tag LOCUS_21500 5291 3963 CDS product HlyD family efflux transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928727.1 protein_id gnl|my_center|LOCUS_21500 >Feature sequence0345 361 3396 gene locus_tag LOCUS_21510 361 3396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21510 4012 4275 gene locus_tag LOCUS_21520 4012 4275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21520 4489 4713 gene locus_tag LOCUS_21530 4489 4713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21530 4910 5341 gene locus_tag LOCUS_21540 4910 5341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21540 >Feature sequence0346 751 62 gene locus_tag LOCUS_21550 751 62 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21550 1160 825 gene locus_tag LOCUS_21560 1160 825 CDS product zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325406.1 protein_id gnl|my_center|LOCUS_21560 1500 2081 gene locus_tag LOCUS_21570 1500 2081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21570 2730 2404 gene locus_tag LOCUS_21580 2730 2404 CDS product GlsB/YeaQ/YmgE family stress response membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005058449.1 protein_id gnl|my_center|LOCUS_21580 2983 3615 gene locus_tag LOCUS_21590 gene dhaL 2983 3615 CDS product dihydroxyacetone kinase subunit DhaL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257203.1 protein_id gnl|my_center|LOCUS_21590 4640 3750 gene locus_tag LOCUS_21600 4640 3750 CDS product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058215.1 protein_id gnl|my_center|LOCUS_21600 5377 4640 gene locus_tag LOCUS_21610 5377 4640 CDS product metal ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678718.1 protein_id gnl|my_center|LOCUS_21610 >Feature sequence0347 255 794 gene locus_tag LOCUS_21620 gene pyrR 255 794 CDS product bifunctional pyr operon transcriptional regulator/uracil phosphoribosyltransferase PyrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257759.1 protein_id gnl|my_center|LOCUS_21620 791 1756 gene locus_tag LOCUS_21630 791 1756 CDS product aspartate carbamoyltransferase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_196768321.1 protein_id gnl|my_center|LOCUS_21630 1753 3024 gene locus_tag LOCUS_21640 1753 3024 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392399.1 protein_id gnl|my_center|LOCUS_21640 3324 4373 gene locus_tag LOCUS_21650 3324 4373 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970101.1 protein_id gnl|my_center|LOCUS_21650 4513 4695 gene locus_tag LOCUS_21660 4513 4695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21660 4831 5169 gene locus_tag LOCUS_21670 4831 5169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21670 >Feature sequence0348 <1 1108 gene locus_tag LOCUS_21680 <1 1108 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164929427.1:PAS domain S-box protein 1222 2004 gene locus_tag LOCUS_21690 1222 2004 CDS product TIM barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969896.1 protein_id gnl|my_center|LOCUS_21690 4044 2077 gene locus_tag LOCUS_21700 4044 2077 CDS product S53 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223434.1 protein_id gnl|my_center|LOCUS_21700 4463 5218 gene locus_tag LOCUS_21710 4463 5218 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_122195341.1 protein_id gnl|my_center|LOCUS_21710 >Feature sequence0349 2518 965 gene locus_tag LOCUS_21720 2518 965 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268053.1 protein_id gnl|my_center|LOCUS_21720 3852 2773 gene locus_tag LOCUS_21730 3852 2773 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004202597.1 protein_id gnl|my_center|LOCUS_21730 4861 4436 gene locus_tag LOCUS_21740 4861 4436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21740 >Feature sequence0350 969 1817 gene locus_tag LOCUS_21750 969 1817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21750 2932 2048 gene locus_tag LOCUS_21760 2932 2048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21760 3295 3062 gene locus_tag LOCUS_21770 3295 3062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21770 3873 3229 gene locus_tag LOCUS_21780 3873 3229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21780 4972 3860 gene locus_tag LOCUS_21790 4972 3860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21790 5201 4959 gene locus_tag LOCUS_21800 5201 4959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21800 5282 5461 gene locus_tag LOCUS_21810 5282 5461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21810 >Feature sequence0351 2418 256 gene locus_tag LOCUS_21820 gene ppk1 2418 256 CDS product polyphosphate kinase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099209.1 protein_id gnl|my_center|LOCUS_21820 3608 2703 gene locus_tag LOCUS_21830 3608 2703 CDS product NmrA family NAD(P)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728191.1 protein_id gnl|my_center|LOCUS_21830 3993 4619 gene locus_tag LOCUS_21840 3993 4619 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086729.1 protein_id gnl|my_center|LOCUS_21840 5128 4745 gene locus_tag LOCUS_21850 5128 4745 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230674.1 protein_id gnl|my_center|LOCUS_21850 >Feature sequence0352 <1 1762 gene locus_tag LOCUS_21860 <1 1762 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_094122848.1:RDD family protein 2375 4333 gene locus_tag LOCUS_21870 2375 4333 CDS product oligopeptidase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140133.1 protein_id gnl|my_center|LOCUS_21870 >Feature sequence0353 1500 916 gene locus_tag LOCUS_21880 1500 916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21880 2119 3324 gene locus_tag LOCUS_21890 2119 3324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21890 3432 3256 gene locus_tag LOCUS_21900 3432 3256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21900 4326 3820 gene locus_tag LOCUS_21910 4326 3820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21910 4293 4886 gene locus_tag LOCUS_21920 4293 4886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21920 4958 5158 gene locus_tag LOCUS_21930 4958 5158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21930 >Feature sequence0354 1088 666 gene locus_tag LOCUS_21940 1088 666 CDS product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405004.1 protein_id gnl|my_center|LOCUS_21940 2354 1335 gene locus_tag LOCUS_21950 2354 1335 CDS product quinone-dependent dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259753.1 protein_id gnl|my_center|LOCUS_21950 4071 2719 gene locus_tag LOCUS_21960 gene mnmE 4071 2719 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944074.1 protein_id gnl|my_center|LOCUS_21960 4483 4241 gene locus_tag LOCUS_21970 4483 4241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21970 <5457 4805 gene locus_tag LOCUS_21980 <5457 4805 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011392052.1:histidinol-phosphate transaminase >Feature sequence0355 <1 1268 gene locus_tag LOCUS_21990 <1 1268 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011393548.1:adenylosuccinate lyase 1362 2555 gene locus_tag LOCUS_22000 1362 2555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22000 2765 4093 gene locus_tag LOCUS_22010 gene ffh 2765 4093 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000863460.1 protein_id gnl|my_center|LOCUS_22010 4129 4389 gene locus_tag LOCUS_22020 gene rpsP 4129 4389 CDS product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004451027.1 protein_id gnl|my_center|LOCUS_22020 4468 4701 gene locus_tag LOCUS_22030 4468 4701 CDS product KH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883358.1 protein_id gnl|my_center|LOCUS_22030 >Feature sequence0356 1 1491 gene locus_tag LOCUS_22040 1 1491 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205421524.1 protein_id gnl|my_center|LOCUS_22040 2131 1640 gene locus_tag LOCUS_22050 2131 1640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22050 2072 2362 gene locus_tag LOCUS_22060 2072 2362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22060 5404 3245 gene locus_tag LOCUS_22070 5404 3245 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162006391.1 protein_id gnl|my_center|LOCUS_22070 >Feature sequence0357 394 1482 gene locus_tag LOCUS_22080 394 1482 CDS product winged helix DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763966.1 protein_id gnl|my_center|LOCUS_22080 1487 1672 gene locus_tag LOCUS_22090 1487 1672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22090 2583 1591 gene locus_tag LOCUS_22100 2583 1591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22100 4573 2483 gene locus_tag LOCUS_22110 4573 2483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22110 4730 4945 gene locus_tag LOCUS_22120 4730 4945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22120 >Feature sequence0358 881 1489 gene locus_tag LOCUS_22130 881 1489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22130 1698 3050 gene locus_tag LOCUS_22140 1698 3050 CDS product nucleobase:cation symporter-2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790376.1 protein_id gnl|my_center|LOCUS_22140 3854 3312 gene locus_tag LOCUS_22150 3854 3312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22150 <5439 4040 gene locus_tag LOCUS_22160 <5439 4040 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001271667.1:dihydrolipoyl dehydrogenase >Feature sequence0359 1274 1038 gene locus_tag LOCUS_22170 1274 1038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22170 3049 1997 gene locus_tag LOCUS_22180 3049 1997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22180 4226 3234 gene locus_tag LOCUS_22190 4226 3234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22190 4245 4562 gene locus_tag LOCUS_22200 4245 4562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22200 >Feature sequence0360 931 1686 gene locus_tag LOCUS_22210 931 1686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22210 1775 3499 gene locus_tag LOCUS_22220 1775 3499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22220 >Feature sequence0361 2760 1747 gene locus_tag LOCUS_22230 gene pheS 2760 1747 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080838.1 protein_id gnl|my_center|LOCUS_22230 3149 2895 gene locus_tag LOCUS_22240 3149 2895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22240 4109 3852 gene locus_tag LOCUS_22250 4109 3852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22250 <5431 4575 gene locus_tag LOCUS_22260 <5431 4575 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011141025.1:magnesium/cobalt transporter CorA >Feature sequence0362 425 171 gene locus_tag LOCUS_22270 425 171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22270 2561 1611 gene locus_tag LOCUS_22280 2561 1611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22280 3660 3091 gene locus_tag LOCUS_22290 3660 3091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22290 5029 3980 gene locus_tag LOCUS_22300 5029 3980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22300 5165 5320 gene locus_tag LOCUS_22310 5165 5320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22310 >Feature sequence0363 <1 1706 gene locus_tag LOCUS_22320 <1 1706 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941791.1:chromosome segregation protein SMC 2112 4565 gene locus_tag LOCUS_22330 2112 4565 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928791.1 protein_id gnl|my_center|LOCUS_22330 >Feature sequence0364 1287 1069 gene locus_tag LOCUS_22340 1287 1069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22340 2618 1488 gene locus_tag LOCUS_22350 2618 1488 CDS product IscS subfamily cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524724.1 protein_id gnl|my_center|LOCUS_22350 3703 3170 gene locus_tag LOCUS_22360 3703 3170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22360 4352 3687 gene locus_tag LOCUS_22370 4352 3687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22370 <5417 4354 gene locus_tag LOCUS_22380 <5417 4354 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002210022.1:RHS repeat-associated core domain-containing protein >Feature sequence0365 3486 286 gene locus_tag LOCUS_22390 3486 286 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140878.1 protein_id gnl|my_center|LOCUS_22390 3649 4578 gene locus_tag LOCUS_22400 3649 4578 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970995.1 protein_id gnl|my_center|LOCUS_22400 >Feature sequence0366 432 1067 gene locus_tag LOCUS_22410 432 1067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22410 1555 2511 gene locus_tag LOCUS_22420 1555 2511 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162992220.1 protein_id gnl|my_center|LOCUS_22420 3347 2718 gene locus_tag LOCUS_22430 3347 2718 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939818.1 protein_id gnl|my_center|LOCUS_22430 3832 3410 gene locus_tag LOCUS_22440 3832 3410 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000203348.1 protein_id gnl|my_center|LOCUS_22440 3947 4810 gene locus_tag LOCUS_22450 3947 4810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22450 >Feature sequence0367 459 1352 gene locus_tag LOCUS_22460 459 1352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22460 1939 3081 gene locus_tag LOCUS_22470 1939 3081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22470 3078 5108 gene locus_tag LOCUS_22480 3078 5108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22480 >Feature sequence0368 <1 1246 gene locus_tag LOCUS_22490 <1 1246 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164921836.1:proline--tRNA ligase 2006 1455 gene locus_tag LOCUS_22500 2006 1455 CDS product GyrI-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226534.1 protein_id gnl|my_center|LOCUS_22500 2677 2180 gene locus_tag LOCUS_22510 2677 2180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22510 3655 2852 gene locus_tag LOCUS_22520 3655 2852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22520 <5404 3919 gene locus_tag LOCUS_22530 <5404 3919 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011090330.1:thiamine pyrophosphate-binding protein >Feature sequence0369 2145 634 gene locus_tag LOCUS_22540 2145 634 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104585.1 protein_id gnl|my_center|LOCUS_22540 3422 2418 gene locus_tag LOCUS_22550 3422 2418 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969895.1 protein_id gnl|my_center|LOCUS_22550 4154 4858 gene locus_tag LOCUS_22560 4154 4858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22560 >Feature sequence0370 1093 416 gene locus_tag LOCUS_22570 1093 416 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141682.1 protein_id gnl|my_center|LOCUS_22570 1416 1105 gene locus_tag LOCUS_22580 1416 1105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22580 1709 2047 gene locus_tag LOCUS_22590 1709 2047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22590 2503 2003 gene locus_tag LOCUS_22600 2503 2003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049832451.1 protein_id gnl|my_center|LOCUS_22600 3780 3968 gene locus_tag LOCUS_22610 3780 3968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22610 4461 4805 gene locus_tag LOCUS_22620 4461 4805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22620 >Feature sequence0371 <1 1071 gene locus_tag LOCUS_22630 <1 1071 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_167367787.1:carbohydrate porin 2045 1251 gene locus_tag LOCUS_22640 2045 1251 CDS product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398587.1 protein_id gnl|my_center|LOCUS_22640 3027 2224 gene locus_tag LOCUS_22650 3027 2224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22650 3755 3084 gene locus_tag LOCUS_22660 3755 3084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22660 4593 3829 gene locus_tag LOCUS_22670 4593 3829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970849.1 protein_id gnl|my_center|LOCUS_22670 5172 4786 gene locus_tag LOCUS_22680 5172 4786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22680 >Feature sequence0372 1855 2313 gene locus_tag LOCUS_22690 1855 2313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22690 2635 3228 gene locus_tag LOCUS_22700 2635 3228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22700 5224 3413 gene locus_tag LOCUS_22710 5224 3413 CDS product carbamoyltransferase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225490.1 protein_id gnl|my_center|LOCUS_22710 >Feature sequence0373 567 43 gene locus_tag LOCUS_22720 567 43 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22720 1170 697 gene locus_tag LOCUS_22730 1170 697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22730 2733 1252 gene locus_tag LOCUS_22740 2733 1252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22740 3420 2806 gene locus_tag LOCUS_22750 3420 2806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22750 3621 4535 gene locus_tag LOCUS_22760 gene fabG 3621 4535 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881113.1 protein_id gnl|my_center|LOCUS_22760 >Feature sequence0374 332 730 gene locus_tag LOCUS_22770 332 730 CDS product anti-sigma regulatory factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883997.1 protein_id gnl|my_center|LOCUS_22770 738 1739 gene locus_tag LOCUS_22780 738 1739 CDS product anti-sigma regulatory factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883998.1 protein_id gnl|my_center|LOCUS_22780 1736 3970 gene locus_tag LOCUS_22790 1736 3970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22790 4044 4868 gene locus_tag LOCUS_22800 4044 4868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22800 >Feature sequence0375 <1 1069 gene locus_tag LOCUS_22810 <1 1069 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011389571.1:sodium-translocating pyrophosphatase 1197 2558 gene locus_tag LOCUS_22820 gene lpdA 1197 2558 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393264.1 protein_id gnl|my_center|LOCUS_22820 <5376 3018 gene locus_tag LOCUS_22830 <5376 3018 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010933346.1:pyruvate, phosphate dikinase >Feature sequence0376 242 946 gene locus_tag LOCUS_22840 242 946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22840 1001 1990 gene locus_tag LOCUS_22850 gene bioB 1001 1990 CDS product biotin synthase BioB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015185990.1 protein_id gnl|my_center|LOCUS_22850 2314 4887 gene locus_tag LOCUS_22860 2314 4887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22860 4901 5083 gene locus_tag LOCUS_22870 4901 5083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22870 >Feature sequence0377 945 238 gene locus_tag LOCUS_22880 945 238 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932143.1 protein_id gnl|my_center|LOCUS_22880 2172 961 gene locus_tag LOCUS_22890 2172 961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22890 2938 2153 gene locus_tag LOCUS_22900 2938 2153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22900 4279 3143 gene locus_tag LOCUS_22910 4279 3143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22910 <5368 4284 gene locus_tag LOCUS_22920 <5368 4284 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010883002.1:translation elongation factor 4 >Feature sequence0378 409 1740 gene locus_tag LOCUS_22930 409 1740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22930 3369 2098 gene locus_tag LOCUS_22940 3369 2098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144283.1 protein_id gnl|my_center|LOCUS_22940 >Feature sequence0379 <1 843 gene locus_tag LOCUS_22950 <1 843 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257973.1:ABC transporter ATP-binding protein 765 2030 gene locus_tag LOCUS_22960 765 2030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22960 2182 3648 gene locus_tag LOCUS_22970 2182 3648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22970 4428 4964 gene locus_tag LOCUS_22980 4428 4964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22980 >Feature sequence0380 902 1972 gene locus_tag LOCUS_22990 902 1972 CDS product Xaa-Pro peptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902891.1 protein_id gnl|my_center|LOCUS_22990 2653 2090 gene locus_tag LOCUS_23000 2653 2090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23000 4043 2661 gene locus_tag LOCUS_23010 gene miaB 4043 2661 CDS product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392626.1 protein_id gnl|my_center|LOCUS_23010 >Feature sequence0381 2512 1334 gene locus_tag LOCUS_23020 gene metK 2512 1334 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942525.1 protein_id gnl|my_center|LOCUS_23020 2609 3541 gene locus_tag LOCUS_23030 2609 3541 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014507354.1 protein_id gnl|my_center|LOCUS_23030 3654 4565 gene locus_tag LOCUS_23040 3654 4565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23040 4688 5119 gene locus_tag LOCUS_23050 4688 5119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23050 >Feature sequence0382 39 410 gene locus_tag LOCUS_23060 39 410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23060 1591 614 gene locus_tag LOCUS_23070 1591 614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23070 1809 3470 gene locus_tag LOCUS_23080 1809 3470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23080 3611 4762 gene locus_tag LOCUS_23090 3611 4762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23090 4816 5133 gene locus_tag LOCUS_23100 4816 5133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23100 >Feature sequence0383 528 1547 gene locus_tag LOCUS_23110 528 1547 CDS product trypsin-like peptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928937.1 protein_id gnl|my_center|LOCUS_23110 1815 2264 gene locus_tag LOCUS_23120 gene rpiB 1815 2264 CDS product ribose 5-phosphate isomerase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880713.1 protein_id gnl|my_center|LOCUS_23120 2267 2734 gene locus_tag LOCUS_23130 2267 2734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23130 2910 4037 gene locus_tag LOCUS_23140 2910 4037 CDS product EstA family serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268699.1 protein_id gnl|my_center|LOCUS_23140 4021 4449 gene locus_tag LOCUS_23150 4021 4449 CDS product secondary thiamine-phosphate synthase enzyme YjbQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037396765.1 protein_id gnl|my_center|LOCUS_23150 4446 5294 gene locus_tag LOCUS_23160 4446 5294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23160 >Feature sequence0384 831 3086 gene locus_tag LOCUS_23170 831 3086 CDS product alpha-amylase family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141594.1 protein_id gnl|my_center|LOCUS_23170 4784 3081 gene locus_tag LOCUS_23180 4784 3081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23180 >Feature sequence0385 1027 5 gene locus_tag LOCUS_23190 1027 5 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23190 1488 1994 gene locus_tag LOCUS_23200 1488 1994 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043111304.1 protein_id gnl|my_center|LOCUS_23200 <5332 2323 gene locus_tag LOCUS_23210 <5332 2323 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011706758.1:multidrug efflux RND transporter permease subunit >Feature sequence0386 921 412 gene locus_tag LOCUS_23220 921 412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23220 1449 1000 gene locus_tag LOCUS_23230 gene fabZ 1449 1000 CDS product 3-hydroxyacyl-ACP dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005420541.1 protein_id gnl|my_center|LOCUS_23230 2396 1497 gene locus_tag LOCUS_23240 2396 1497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23240 3758 2415 gene locus_tag LOCUS_23250 3758 2415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23250 4900 3755 gene locus_tag LOCUS_23260 4900 3755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23260 5178 4897 gene locus_tag LOCUS_23270 5178 4897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_23270 >Feature sequence0387 1818 121 gene locus_tag LOCUS_23280 1818 121 CDS product ATPase, T2SS/T4P/T4SS family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615922.1 protein_id gnl|my_center|LOCUS_23280 2912 2019 gene locus_tag LOCUS_23290 2912 2019 CDS product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393067.1 protein_id gnl|my_center|LOCUS_23290 4332 3013 gene locus_tag LOCUS_23300 gene gltX 4332 3013 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545418.1 protein_id gnl|my_center|LOCUS_23300 >Feature sequence0388 143 523 gene locus_tag LOCUS_23310 143 523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23310 4768 1241 gene locus_tag LOCUS_23320 4768 1241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23320 >Feature sequence0389 1388 2785 gene locus_tag LOCUS_23330 gene lpdA 1388 2785 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892330.1 protein_id gnl|my_center|LOCUS_23330 3029 3625 gene locus_tag LOCUS_23340 3029 3625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23340 3729 4457 gene locus_tag LOCUS_23350 3729 4457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23350 5302 4478 gene locus_tag LOCUS_23360 5302 4478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23360 >Feature sequence0390 60 257 gene locus_tag LOCUS_23370 60 257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23370 1274 957 gene locus_tag LOCUS_23380 1274 957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23380 2085 1366 gene locus_tag LOCUS_23390 2085 1366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_116468607.1 protein_id gnl|my_center|LOCUS_23390 2570 2082 gene locus_tag LOCUS_23400 2570 2082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23400 3438 2893 gene locus_tag LOCUS_23410 3438 2893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23410 4469 3435 gene locus_tag LOCUS_23420 4469 3435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23420 >Feature sequence0391 1000 38 gene locus_tag LOCUS_23430 1000 38 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23430 2072 1404 gene locus_tag LOCUS_23440 2072 1404 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120055.1 protein_id gnl|my_center|LOCUS_23440 2171 2932 gene locus_tag LOCUS_23450 2171 2932 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002213038.1 protein_id gnl|my_center|LOCUS_23450 2977 3735 gene locus_tag LOCUS_23460 2977 3735 CDS product 3-oxoacyl-ACP reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974443.1 protein_id gnl|my_center|LOCUS_23460 4126 4635 gene locus_tag LOCUS_23470 4126 4635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23470 >Feature sequence0392 1926 2153 gene locus_tag LOCUS_23480 1926 2153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23480 2162 2347 gene locus_tag LOCUS_23490 2162 2347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23490 2659 2997 gene locus_tag LOCUS_23500 2659 2997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23500 2945 3193 gene locus_tag LOCUS_23510 2945 3193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23510 <5304 3163 gene locus_tag LOCUS_23520 <5304 3163 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_048065409.1:glycosyltransferase family 2 protein >Feature sequence0393 873 580 gene locus_tag LOCUS_23530 873 580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23530 1618 962 gene locus_tag LOCUS_23540 1618 962 CDS product malonate decarboxylase holo-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206495.1 protein_id gnl|my_center|LOCUS_23540 2688 1867 gene locus_tag LOCUS_23550 gene mdcE 2688 1867 CDS product biotin-independent malonate decarboxylase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112668.1 protein_id gnl|my_center|LOCUS_23550 3596 2685 gene locus_tag LOCUS_23560 3596 2685 CDS product biotin-independent malonate decarboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266408.1 protein_id gnl|my_center|LOCUS_23560 3886 3593 gene locus_tag LOCUS_23570 3886 3593 CDS product malonate decarboxylase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287548.1 protein_id gnl|my_center|LOCUS_23570 <5301 4146 gene locus_tag LOCUS_23580 <5301 4146 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004190298.1:triphosphoribosyl-dephospho-CoA synthase >Feature sequence0394 686 1648 gene locus_tag LOCUS_23590 686 1648 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015909376.1 protein_id gnl|my_center|LOCUS_23590 1864 2469 gene locus_tag LOCUS_23600 1864 2469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23600 4109 4795 gene locus_tag LOCUS_23610 4109 4795 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001103807.1 protein_id gnl|my_center|LOCUS_23610 >Feature sequence0395 4463 2373 gene locus_tag LOCUS_23620 4463 2373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_23620 >Feature sequence0396 1001 78 gene locus_tag LOCUS_23630 1001 78 CDS product IclR family transcriptional regulator C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223757.1 protein_id gnl|my_center|LOCUS_23630 1099 2013 gene locus_tag LOCUS_23640 1099 2013 CDS product intradiol ring-cleavage dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533090.1 protein_id gnl|my_center|LOCUS_23640 2051 2908 gene locus_tag LOCUS_23650 2051 2908 CDS product CoA transferase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768681.1 protein_id gnl|my_center|LOCUS_23650 2913 3686 gene locus_tag LOCUS_23660 2913 3686 CDS product CoA-transferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406327.1 protein_id gnl|my_center|LOCUS_23660 >Feature sequence0397 1864 1223 gene locus_tag LOCUS_23670 1864 1223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23670 2001 2675 gene locus_tag LOCUS_23680 2001 2675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23680 3946 2996 gene locus_tag LOCUS_23690 3946 2996 CDS product 3-hydroxyacyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705190.1 protein_id gnl|my_center|LOCUS_23690 4226 4555 gene locus_tag LOCUS_23700 4226 4555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_23700 <5289 4772 gene locus_tag LOCUS_23710 <5289 4772 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013230380.1:RNA polymerase sigma factor SigJ >Feature sequence0398 1641 583 gene locus_tag LOCUS_23720 1641 583 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530994.1 protein_id gnl|my_center|LOCUS_23720 2435 1638 gene locus_tag LOCUS_23730 2435 1638 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530993.1 protein_id gnl|my_center|LOCUS_23730 4303 2954 gene locus_tag LOCUS_23740 4303 2954 CDS product MSMEG_0569 family flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003891990.1 protein_id gnl|my_center|LOCUS_23740 4862 4587 gene locus_tag LOCUS_23750 4862 4587 CDS product MSMEG_0570 family nitrogen starvation response protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003891991.1 protein_id gnl|my_center|LOCUS_23750 >Feature sequence0399 1331 1164 gene locus_tag LOCUS_23760 1331 1164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23760 2628 1336 gene locus_tag LOCUS_23770 2628 1336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23770 3763 4194 gene locus_tag LOCUS_23780 3763 4194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23780 4668 4465 gene locus_tag LOCUS_23790 4668 4465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23790 <5288 4754 gene locus_tag LOCUS_23800 <5288 4754 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011084163.1:acyl-CoA thioesterase >Feature sequence0400 1478 549 gene locus_tag LOCUS_23810 1478 549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23810 2487 1483 gene locus_tag LOCUS_23820 2487 1483 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550164.1 protein_id gnl|my_center|LOCUS_23820 2590 3240 gene locus_tag LOCUS_23830 2590 3240 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531693.1 protein_id gnl|my_center|LOCUS_23830 3466 5271 gene locus_tag LOCUS_23840 3466 5271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23840 >Feature sequence0401 2500 1568 gene locus_tag LOCUS_23850 2500 1568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23850 3366 2506 gene locus_tag LOCUS_23860 3366 2506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23860 4520 4137 gene locus_tag LOCUS_23870 4520 4137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23870 >Feature sequence0402 <1 534 gene locus_tag LOCUS_23880 <1 534 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011405187.1:ATP-binding cassette domain-containing protein 531 1997 gene locus_tag LOCUS_23890 531 1997 CDS product glycine betaine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035422.1 protein_id gnl|my_center|LOCUS_23890 2006 3826 gene locus_tag LOCUS_23900 2006 3826 CDS product MOSC and FAD-binding oxidoreductase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966240.1 protein_id gnl|my_center|LOCUS_23900 >Feature sequence0403 <1 1015 gene locus_tag LOCUS_23910 <1 1015 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013530836.1:DHA2 family efflux MFS transporter permease subunit 1188 1769 gene locus_tag LOCUS_23920 1188 1769 CDS product nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243940.1 protein_id gnl|my_center|LOCUS_23920 1845 2288 gene locus_tag LOCUS_23930 1845 2288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23930 2503 2949 gene locus_tag LOCUS_23940 2503 2949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23940 3421 3035 gene locus_tag LOCUS_23950 3421 3035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_23950 4759 3428 gene locus_tag LOCUS_23960 4759 3428 CDS product IlvD/Edd family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532968.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_23960 >Feature sequence0404 83 1804 gene locus_tag LOCUS_23970 83 1804 CDS product dynamin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256851.1 protein_id gnl|my_center|LOCUS_23970 2180 3004 gene locus_tag LOCUS_23980 2180 3004 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480221.1 protein_id gnl|my_center|LOCUS_23980 3001 4158 gene locus_tag LOCUS_23990 3001 4158 CDS product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142249.1 protein_id gnl|my_center|LOCUS_23990 >Feature sequence0405 2728 2985 gene locus_tag LOCUS_24000 2728 2985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24000 3189 3371 gene locus_tag LOCUS_24010 3189 3371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24010 3424 3870 gene locus_tag LOCUS_24020 3424 3870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24020 >Feature sequence0406 <1 1001 gene locus_tag LOCUS_24030 <1 1001 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010939508.1:alpha/beta fold hydrolase 988 1377 gene locus_tag LOCUS_24040 988 1377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24040 3095 1734 gene locus_tag LOCUS_24050 3095 1734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24050 3878 3381 gene locus_tag LOCUS_24060 3878 3381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24060 5076 4465 gene locus_tag LOCUS_24070 5076 4465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24070 5026 5217 gene locus_tag LOCUS_24080 5026 5217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24080 >Feature sequence0407 644 75 gene locus_tag LOCUS_24090 644 75 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082042.1 protein_id gnl|my_center|LOCUS_24090 810 1241 gene locus_tag LOCUS_24100 810 1241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24100 1747 3879 gene locus_tag LOCUS_24110 1747 3879 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197530052.1 protein_id gnl|my_center|LOCUS_24110 3980 4558 gene locus_tag LOCUS_24120 3980 4558 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143952.1 protein_id gnl|my_center|LOCUS_24120 >Feature sequence0408 287 370 gene locus_tag LOCUS_t00150 287 370 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 846 1121 gene locus_tag LOCUS_24130 846 1121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24130 1471 1238 gene locus_tag LOCUS_24140 1471 1238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24140 2002 1580 gene locus_tag LOCUS_24150 2002 1580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24150 2216 2485 gene locus_tag LOCUS_24160 2216 2485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24160 3108 2704 gene locus_tag LOCUS_24170 3108 2704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24170 4196 3582 gene locus_tag LOCUS_24180 4196 3582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24180 4702 4517 gene locus_tag LOCUS_24190 4702 4517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24190 >Feature sequence0409 803 381 gene locus_tag LOCUS_24200 803 381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24200 941 1288 gene locus_tag LOCUS_24210 941 1288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_24210 1292 1669 gene locus_tag LOCUS_24220 1292 1669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_24220 2235 1753 gene locus_tag LOCUS_24230 2235 1753 CDS product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971326.1 protein_id gnl|my_center|LOCUS_24230 3008 2601 gene locus_tag LOCUS_24240 3008 2601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24240 3127 3825 gene locus_tag LOCUS_24250 3127 3825 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021737.1 protein_id gnl|my_center|LOCUS_24250 4309 4136 gene locus_tag LOCUS_24260 4309 4136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24260 4340 5155 gene locus_tag LOCUS_24270 4340 5155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24270 >Feature sequence0410 938 393 gene locus_tag LOCUS_24280 938 393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24280 1242 1018 gene locus_tag LOCUS_24290 1242 1018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24290 3542 2031 gene locus_tag LOCUS_24300 3542 2031 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942684.1 protein_id gnl|my_center|LOCUS_24300 3892 4935 gene locus_tag LOCUS_24310 3892 4935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24310 >Feature sequence0411 251 484 gene locus_tag LOCUS_24320 251 484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24320 500 772 gene locus_tag LOCUS_24330 500 772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24330 721 936 gene locus_tag LOCUS_24340 721 936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24340 2162 3544 gene locus_tag LOCUS_24350 2162 3544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24350 3979 4431 gene locus_tag LOCUS_24360 3979 4431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24360 >Feature sequence0412 899 1558 gene locus_tag LOCUS_24370 899 1558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24370 1561 2013 gene locus_tag LOCUS_24380 1561 2013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24380 2245 2445 gene locus_tag LOCUS_24390 2245 2445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24390 3841 3029 gene locus_tag LOCUS_24400 3841 3029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24400 >Feature sequence0413 >Feature sequence0414 <1 727 gene locus_tag LOCUS_24410 <1 727 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012502785.1:tetratricopeptide repeat protein 1171 1455 gene locus_tag LOCUS_24420 1171 1455 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008139488.1 protein_id gnl|my_center|LOCUS_24420 2275 1880 gene locus_tag LOCUS_24430 gene tsaA 2275 1880 CDS product tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229491.1 protein_id gnl|my_center|LOCUS_24430 2917 2483 gene locus_tag LOCUS_24440 2917 2483 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005081306.1 protein_id gnl|my_center|LOCUS_24440 3264 2914 gene locus_tag LOCUS_24450 3264 2914 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_068923899.1 protein_id gnl|my_center|LOCUS_24450 4416 3436 gene locus_tag LOCUS_24460 4416 3436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24460 4339 4743 gene locus_tag LOCUS_24470 4339 4743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24470 >Feature sequence0415 >Feature sequence0416 2538 1582 gene locus_tag LOCUS_24480 2538 1582 CDS product FAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769647.1 protein_id gnl|my_center|LOCUS_24480 3401 2652 gene locus_tag LOCUS_24490 3401 2652 CDS product electron transfer flavoprotein subunit beta/FixA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930110.1 protein_id gnl|my_center|LOCUS_24490 3640 4812 gene locus_tag LOCUS_24500 3640 4812 CDS product isovaleryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975571.1 protein_id gnl|my_center|LOCUS_24500 >Feature sequence0417 1858 164 gene locus_tag LOCUS_24510 1858 164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24510 1995 2324 gene locus_tag LOCUS_24520 1995 2324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24520 3505 2321 gene locus_tag LOCUS_24530 3505 2321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24530 3622 3870 gene locus_tag LOCUS_24540 3622 3870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24540 3860 3994 gene locus_tag LOCUS_24550 3860 3994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24550 4166 4375 gene locus_tag LOCUS_24560 4166 4375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24560 >Feature sequence0418 898 395 gene locus_tag LOCUS_24570 898 395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24570 1198 1920 gene locus_tag LOCUS_24580 1198 1920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24580 1917 2255 gene locus_tag LOCUS_24590 1917 2255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24590 2919 2623 gene locus_tag LOCUS_24600 2919 2623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24600 3179 2916 gene locus_tag LOCUS_24610 3179 2916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24610 3660 4487 gene locus_tag LOCUS_24620 3660 4487 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388089.1 protein_id gnl|my_center|LOCUS_24620 4450 4674 gene locus_tag LOCUS_24630 4450 4674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24630 >Feature sequence0419 1431 622 gene locus_tag LOCUS_24640 1431 622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24640 1871 2674 gene locus_tag LOCUS_24650 1871 2674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24650 2674 3273 gene locus_tag LOCUS_24660 2674 3273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_24660 4019 4762 gene locus_tag LOCUS_24670 gene mak 4019 4762 CDS product fructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095821.1 protein_id gnl|my_center|LOCUS_24670 >Feature sequence0420 <1 1046 gene locus_tag LOCUS_24680 <1 1046 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015705673.1:glucoamylase family protein 1379 2056 gene locus_tag LOCUS_24690 1379 2056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24690 2468 2983 gene locus_tag LOCUS_24700 2468 2983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24700 3654 3115 gene locus_tag LOCUS_24710 3654 3115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24710 4451 3885 gene locus_tag LOCUS_24720 4451 3885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24720 >Feature sequence0421 <1 1016 gene locus_tag LOCUS_24730 <1 1016 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012259719.1:isocitrate lyase 1955 1251 gene locus_tag LOCUS_24740 1955 1251 CDS product LrgB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084166.1 protein_id gnl|my_center|LOCUS_24740 2421 1948 gene locus_tag LOCUS_24750 2421 1948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24750 3750 2947 gene locus_tag LOCUS_24760 3750 2947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24760 4900 3755 gene locus_tag LOCUS_24770 4900 3755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24770 >Feature sequence0422 <1 1494 gene locus_tag LOCUS_24780 <1 1494 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011057902.1:DUF4912 domain-containing protein 2646 1954 gene locus_tag LOCUS_24790 2646 1954 CDS product cysteine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_209606634.1 protein_id gnl|my_center|LOCUS_24790 4246 2663 gene locus_tag LOCUS_24800 4246 2663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085511.1 protein_id gnl|my_center|LOCUS_24800 4984 4277 gene locus_tag LOCUS_24810 4984 4277 CDS product cysteine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000194414.1 protein_id gnl|my_center|LOCUS_24810 >Feature sequence0423 3098 3871 gene locus_tag LOCUS_24820 3098 3871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24820 >Feature sequence0424 1518 58 gene locus_tag LOCUS_24830 1518 58 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976065.1 protein_id gnl|my_center|LOCUS_24830 2653 1970 gene locus_tag LOCUS_24840 2653 1970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24840 >Feature sequence0425 1044 1964 gene locus_tag LOCUS_24850 gene oppB 1044 1964 CDS product oligopeptide ABC transporter permease OppB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388349.1 protein_id gnl|my_center|LOCUS_24850 2008 2856 gene locus_tag LOCUS_24860 2008 2856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24860 >Feature sequence0426 <1 684 gene locus_tag LOCUS_24870 <1 684 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_048065404.1:F0F1 ATP synthase subunit beta 681 1193 gene locus_tag LOCUS_24880 681 1193 CDS product F0F1 ATP synthase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926973.1 protein_id gnl|my_center|LOCUS_24880 1186 1548 gene locus_tag LOCUS_24890 1186 1548 CDS product AtpZ/AtpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022410.1 protein_id gnl|my_center|LOCUS_24890 1520 1945 gene locus_tag LOCUS_24900 1520 1945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24900 1936 2688 gene locus_tag LOCUS_24910 1936 2688 CDS product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022408.1 protein_id gnl|my_center|LOCUS_24910 2793 3074 gene locus_tag LOCUS_24920 2793 3074 CDS product F0F1 ATP synthase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328511.1 protein_id gnl|my_center|LOCUS_24920 3078 3866 gene locus_tag LOCUS_24930 3078 3866 CDS product ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022406.1 protein_id gnl|my_center|LOCUS_24930 >Feature sequence0427 <1 2025 gene locus_tag LOCUS_24940 <1 2025 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012583501.1:ATP-dependent DNA helicase RecG 2038 3516 gene locus_tag LOCUS_24950 2038 3516 CDS product DegQ family serine endoprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545143.1 protein_id gnl|my_center|LOCUS_24950 >Feature sequence0428 2557 1538 gene locus_tag LOCUS_24960 2557 1538 CDS product zinc-dependent alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230322.1 protein_id gnl|my_center|LOCUS_24960 2845 4911 gene locus_tag LOCUS_24970 2845 4911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24970 >Feature sequence0429 1499 1825 gene locus_tag LOCUS_24980 1499 1825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24980 1967 2404 gene locus_tag LOCUS_24990 1967 2404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24990 2806 3504 gene locus_tag LOCUS_25000 2806 3504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25000 3723 4568 gene locus_tag LOCUS_25010 3723 4568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25010 >Feature sequence0430 282 974 gene locus_tag LOCUS_25020 282 974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25020 943 1656 gene locus_tag LOCUS_25030 943 1656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25030 2116 2610 gene locus_tag LOCUS_25040 2116 2610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25040 4547 3171 gene locus_tag LOCUS_25050 4547 3171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25050 >Feature sequence0431 432 25 gene locus_tag LOCUS_25060 432 25 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_25060 922 512 gene locus_tag LOCUS_25070 922 512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_25070 1146 970 gene locus_tag LOCUS_25080 1146 970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25080 2352 2615 gene locus_tag LOCUS_25090 2352 2615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25090 2615 3001 gene locus_tag LOCUS_25100 2615 3001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25100 3869 3141 gene locus_tag LOCUS_25110 3869 3141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25110 >Feature sequence0432 2192 573 gene locus_tag LOCUS_25120 2192 573 CDS product FAD-dependent monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004544143.1 protein_id gnl|my_center|LOCUS_25120 2433 3107 gene locus_tag LOCUS_25130 2433 3107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25130 3523 3104 gene locus_tag LOCUS_25140 3523 3104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25140 3675 3941 gene locus_tag LOCUS_25150 3675 3941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25150 3916 4272 gene locus_tag LOCUS_25160 3916 4272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25160 4761 4552 gene locus_tag LOCUS_25170 4761 4552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25170 >Feature sequence0433 >Feature sequence0434 107 2326 gene locus_tag LOCUS_25180 107 2326 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259305.1 protein_id gnl|my_center|LOCUS_25180 2469 3314 gene locus_tag LOCUS_25190 2469 3314 CDS product xanthine dehydrogenase family protein subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259304.1 protein_id gnl|my_center|LOCUS_25190 3671 4123 gene locus_tag LOCUS_25200 3671 4123 CDS product carbon monoxide dehydrogenase subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327054.1 protein_id gnl|my_center|LOCUS_25200 <5055 4531 gene locus_tag LOCUS_25210 <5055 4531 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_091308313.1:Si-specific NAD(P)(+) transhydrogenase >Feature sequence0435 2708 276 gene locus_tag LOCUS_25220 2708 276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25220 3595 3197 gene locus_tag LOCUS_25230 3595 3197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25230 3972 4757 gene locus_tag LOCUS_25240 3972 4757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25240 >Feature sequence0436 1130 615 gene locus_tag LOCUS_25250 1130 615 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970394.1 protein_id gnl|my_center|LOCUS_25250 2609 1917 gene locus_tag LOCUS_25260 gene rpe 2609 1917 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000589966.1 protein_id gnl|my_center|LOCUS_25260 >Feature sequence0437 1523 1092 gene locus_tag LOCUS_25270 1523 1092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25270 1752 3200 gene locus_tag LOCUS_25280 gene glgA 1752 3200 CDS product glycogen synthase GlgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943869.1 protein_id gnl|my_center|LOCUS_25280 3828 3523 gene locus_tag LOCUS_25290 3828 3523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25290 3951 4820 gene locus_tag LOCUS_25300 3951 4820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25300 >Feature sequence0438 <1 1239 gene locus_tag LOCUS_25310 <1 1239 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012582800.1:sugar ABC transporter ATP-binding protein 1236 2234 gene locus_tag LOCUS_25320 gene rbsC 1236 2234 CDS product ribose ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005463702.1 protein_id gnl|my_center|LOCUS_25320 3128 2334 gene locus_tag LOCUS_25330 3128 2334 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088129.1 protein_id gnl|my_center|LOCUS_25330 3841 3410 gene locus_tag LOCUS_25340 3841 3410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25340 4815 5000 gene locus_tag LOCUS_25350 4815 5000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25350 >Feature sequence0439 658 2571 gene locus_tag LOCUS_25360 658 2571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25360 2955 3566 gene locus_tag LOCUS_25370 2955 3566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25370 4613 3576 gene locus_tag LOCUS_25380 4613 3576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25380 >Feature sequence0440 597 1373 gene locus_tag LOCUS_25390 597 1373 CDS product enoyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582796.1 protein_id gnl|my_center|LOCUS_25390 1648 3024 gene locus_tag LOCUS_25400 1648 3024 CDS product FAD-linked oxidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943908.1 protein_id gnl|my_center|LOCUS_25400 3109 3957 gene locus_tag LOCUS_25410 3109 3957 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975348.1 protein_id gnl|my_center|LOCUS_25410 >Feature sequence0441 1434 1024 gene locus_tag LOCUS_25420 1434 1024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525504.1 protein_id gnl|my_center|LOCUS_25420 2401 1652 gene locus_tag LOCUS_25430 2401 1652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25430 2367 2591 gene locus_tag LOCUS_25440 2367 2591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25440 4298 2955 gene locus_tag LOCUS_25450 4298 2955 CDS product deoxyguanosinetriphosphate triphosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895838.1 protein_id gnl|my_center|LOCUS_25450 4503 4291 gene locus_tag LOCUS_25460 4503 4291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25460 >Feature sequence0442 <1 2391 gene locus_tag LOCUS_25470 <1 2391 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011141201.1:ABC transporter permease 3294 4424 gene locus_tag LOCUS_25480 3294 4424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25480 >Feature sequence0443 1797 727 gene locus_tag LOCUS_25490 1797 727 CDS product hydrogenase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225647.1 protein_id gnl|my_center|LOCUS_25490 2425 1871 gene locus_tag LOCUS_25500 2425 1871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25500 3434 2895 gene locus_tag LOCUS_25510 3434 2895 CDS product hydrogenase maturation protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225641.1 protein_id gnl|my_center|LOCUS_25510 4783 3431 gene locus_tag LOCUS_25520 4783 3431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728540.1 protein_id gnl|my_center|LOCUS_25520 >Feature sequence0444 2236 836 gene locus_tag LOCUS_25530 2236 836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25530 3729 2233 gene locus_tag LOCUS_25540 3729 2233 CDS product polysaccharide biosynthesis C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933859.1 protein_id gnl|my_center|LOCUS_25540 <5009 3717 gene locus_tag LOCUS_25550 <5009 3717 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164926801.1:TolC family protein >Feature sequence0445 2360 1350 gene locus_tag LOCUS_25560 2360 1350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25560 3184 2633 gene locus_tag LOCUS_25570 3184 2633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25570 3741 3181 gene locus_tag LOCUS_25580 gene frr 3741 3181 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259405.1 protein_id gnl|my_center|LOCUS_25580 4548 3805 gene locus_tag LOCUS_25590 gene pyrH 4548 3805 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005904124.1 protein_id gnl|my_center|LOCUS_25590 >Feature sequence0446 205 3393 gene locus_tag LOCUS_25600 205 3393 CDS product multidrug efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532875.1 protein_id gnl|my_center|LOCUS_25600 3579 3932 gene locus_tag LOCUS_25610 3579 3932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25610 <5008 3918 gene locus_tag LOCUS_25620 <5008 3918 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004399166.1:long-chain-fatty-acid--CoA ligase LcfA >Feature sequence0447 370 1476 gene locus_tag LOCUS_25630 370 1476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25630 2350 1409 gene locus_tag LOCUS_25640 2350 1409 CDS product methanogenesis marker 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024078.1 protein_id gnl|my_center|LOCUS_25640 3264 2698 gene locus_tag LOCUS_25650 3264 2698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25650 3752 3973 gene locus_tag LOCUS_25660 3752 3973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25660 4438 4187 gene locus_tag LOCUS_25670 4438 4187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25670 >Feature sequence0448 3538 1592 gene locus_tag LOCUS_25680 3538 1592 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123734.1 protein_id gnl|my_center|LOCUS_25680 3688 4593 gene locus_tag LOCUS_25690 3688 4593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25690 >Feature sequence0449 1543 1124 gene locus_tag LOCUS_25700 1543 1124 CDS product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975895.1 protein_id gnl|my_center|LOCUS_25700 3306 1759 gene locus_tag LOCUS_25710 gene gguA 3306 1759 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162992366.1 protein_id gnl|my_center|LOCUS_25710 3597 4319 gene locus_tag LOCUS_25720 3597 4319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25720 >Feature sequence0450 636 1604 gene locus_tag LOCUS_25730 636 1604 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037397112.1 protein_id gnl|my_center|LOCUS_25730 1808 1545 gene locus_tag LOCUS_25740 1808 1545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25740 3538 2102 gene locus_tag LOCUS_25750 gene creC 3538 2102 CDS product two-component system sensor histidine kinase CreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113267.1 protein_id gnl|my_center|LOCUS_25750 4314 3535 gene locus_tag LOCUS_25760 gene creB 4314 3535 CDS product two-component system response regulator CreB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208148.1 protein_id gnl|my_center|LOCUS_25760 >Feature sequence0451 770 276 gene locus_tag LOCUS_25770 770 276 CDS product PaaI family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084025.1 protein_id gnl|my_center|LOCUS_25770 991 1629 gene locus_tag LOCUS_25780 991 1629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25780 2642 2040 gene locus_tag LOCUS_25790 2642 2040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25790 3442 2639 gene locus_tag LOCUS_25800 3442 2639 CDS product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766631.1 protein_id gnl|my_center|LOCUS_25800 4607 3942 gene locus_tag LOCUS_25810 4607 3942 CDS product DUF1345 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002115060.1 protein_id gnl|my_center|LOCUS_25810 >Feature sequence0452 <1 1855 gene locus_tag LOCUS_25820 <1 1855 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013230264.1:S53 family serine peptidase 2528 1932 gene locus_tag LOCUS_25830 2528 1932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25830 4065 2539 gene locus_tag LOCUS_25840 4065 2539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25840 >Feature sequence0453 708 307 gene locus_tag LOCUS_25850 708 307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25850 1388 705 gene locus_tag LOCUS_25860 1388 705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25860 1951 1463 gene locus_tag LOCUS_25870 1951 1463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_25870 2193 1948 gene locus_tag LOCUS_25880 2193 1948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_25880 2192 2743 gene locus_tag LOCUS_25890 2192 2743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25890 3676 4932 gene locus_tag LOCUS_25900 3676 4932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25900 >Feature sequence0454 3870 2068 gene locus_tag LOCUS_25910 3870 2068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25910 4648 3899 gene locus_tag LOCUS_25920 4648 3899 CDS product sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121635.1 protein_id gnl|my_center|LOCUS_25920 >Feature sequence0455 1564 1313 gene locus_tag LOCUS_25930 1564 1313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25930 1745 2068 gene locus_tag LOCUS_25940 1745 2068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25940 2065 2796 gene locus_tag LOCUS_25950 2065 2796 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259632.1 protein_id gnl|my_center|LOCUS_25950 4432 4716 gene locus_tag LOCUS_25960 4432 4716 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008139488.1 protein_id gnl|my_center|LOCUS_25960 >Feature sequence0456 1899 631 gene locus_tag LOCUS_25970 1899 631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25970 2402 1896 gene locus_tag LOCUS_25980 2402 1896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25980 3224 2415 gene locus_tag LOCUS_25990 3224 2415 CDS product phosphoadenosine phosphosulfate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727532.1 protein_id gnl|my_center|LOCUS_25990 >Feature sequence0457 703 521 gene locus_tag LOCUS_26000 703 521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26000 2997 700 gene locus_tag LOCUS_26010 gene yicI 2997 700 CDS product alpha-xylosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000702944.1 protein_id gnl|my_center|LOCUS_26010 4680 3367 gene locus_tag LOCUS_26020 gene xylA 4680 3367 CDS product xylose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118969.1 protein_id gnl|my_center|LOCUS_26020 >Feature sequence0458 1 648 gene locus_tag LOCUS_26030 1 648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26030 2370 1981 gene locus_tag LOCUS_26040 2370 1981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26040 2955 2440 gene locus_tag LOCUS_26050 2955 2440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26050 4185 3130 gene locus_tag LOCUS_26060 4185 3130 CDS product tartrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085700.1 protein_id gnl|my_center|LOCUS_26060 >Feature sequence0459 252 752 gene locus_tag LOCUS_26070 252 752 CDS product ferritin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038765.1 protein_id gnl|my_center|LOCUS_26070 953 1696 gene locus_tag LOCUS_26080 gene surE 953 1696 CDS product 5'/3'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229220.1 protein_id gnl|my_center|LOCUS_26080 2060 3514 gene locus_tag LOCUS_26090 2060 3514 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104041.1 protein_id gnl|my_center|LOCUS_26090 3851 4060 gene locus_tag LOCUS_26100 3851 4060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26100 4803 4285 gene locus_tag LOCUS_26110 4803 4285 CDS product DUF4142 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401379.1 protein_id gnl|my_center|LOCUS_26110 >Feature sequence0460 <1 753 gene locus_tag LOCUS_26120 <1 753 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_226986827.1:(E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase 886 1446 gene locus_tag LOCUS_26130 886 1446 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392680.1 protein_id gnl|my_center|LOCUS_26130 2637 1579 gene locus_tag LOCUS_26140 2637 1579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26140 2832 3944 gene locus_tag LOCUS_26150 2832 3944 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705009.1 protein_id gnl|my_center|LOCUS_26150 <4933 3955 gene locus_tag LOCUS_26160 <4933 3955 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_042440221.1:glucan biosynthesis protein D >Feature sequence0461 724 530 gene locus_tag LOCUS_26170 724 530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26170 1081 761 gene locus_tag LOCUS_26180 1081 761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26180 1477 1947 gene locus_tag LOCUS_26190 1477 1947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26190 2025 2516 gene locus_tag LOCUS_26200 2025 2516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26200 2968 4656 gene locus_tag LOCUS_26210 2968 4656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26210 >Feature sequence0462 3575 2475 gene locus_tag LOCUS_26220 gene mexE 3575 2475 CDS product multidrug efflux RND transporter periplasmic adaptor subunit MexE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103549.1 protein_id gnl|my_center|LOCUS_26220 4377 3775 gene locus_tag LOCUS_26230 4377 3775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26230 >Feature sequence0463 2214 1756 gene locus_tag LOCUS_26240 2214 1756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26240 2796 3476 gene locus_tag LOCUS_26250 2796 3476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26250 <4924 4163 gene locus_tag LOCUS_26260 <4924 4163 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013530729.1:DNA polymerase IV >Feature sequence0464 974 570 gene locus_tag LOCUS_26270 974 570 CDS product YciI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082795.1 protein_id gnl|my_center|LOCUS_26270 1604 1020 gene locus_tag LOCUS_26280 1604 1020 CDS product dihydrofolate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530118.1 protein_id gnl|my_center|LOCUS_26280 2288 1887 gene locus_tag LOCUS_26290 2288 1887 CDS product YciI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082795.1 protein_id gnl|my_center|LOCUS_26290 2837 2460 gene locus_tag LOCUS_26300 2837 2460 CDS product YciI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226523.1 protein_id gnl|my_center|LOCUS_26300 3553 2978 gene locus_tag LOCUS_26310 3553 2978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_26310 4231 3620 gene locus_tag LOCUS_26320 4231 3620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_26320 >Feature sequence0465 <1 786 gene locus_tag LOCUS_26330 <1 786 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012289150.1:NDP-sugar synthase 885 1109 gene locus_tag LOCUS_26340 885 1109 CDS product SWIB/MDM2 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814592.1 protein_id gnl|my_center|LOCUS_26340 1173 1889 gene locus_tag LOCUS_26350 1173 1889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26350 3407 2034 gene locus_tag LOCUS_26360 3407 2034 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404676.1 protein_id gnl|my_center|LOCUS_26360 >Feature sequence0466 2924 2064 gene locus_tag LOCUS_26370 2924 2064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26370 4291 3593 gene locus_tag LOCUS_26380 4291 3593 CDS product haloacid dehalogenase type II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087136.1 protein_id gnl|my_center|LOCUS_26380 >Feature sequence0467 2481 229 gene locus_tag LOCUS_26390 2481 229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26390 4466 2877 gene locus_tag LOCUS_26400 4466 2877 CDS product acyl CoA:acetate/3-ketoacid CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067378.1 protein_id gnl|my_center|LOCUS_26400 >Feature sequence0468 1404 367 gene locus_tag LOCUS_26410 gene gap 1404 367 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002668968.1 protein_id gnl|my_center|LOCUS_26410 4055 2031 gene locus_tag LOCUS_26420 gene ftsH 4055 2031 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_200858940.1 protein_id gnl|my_center|LOCUS_26420 >Feature sequence0469 636 1394 gene locus_tag LOCUS_26430 636 1394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26430 1853 2116 gene locus_tag LOCUS_26440 1853 2116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26440 2113 2556 gene locus_tag LOCUS_26450 2113 2556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26450 2610 3158 gene locus_tag LOCUS_26460 2610 3158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26460 3277 3915 gene locus_tag LOCUS_26470 3277 3915 CDS product hemolysin III family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037985.1 protein_id gnl|my_center|LOCUS_26470 4864 4082 gene locus_tag LOCUS_26480 4864 4082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26480 >Feature sequence0470 <1 740 gene locus_tag LOCUS_26490 <1 740 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164928965.1:CHAT domain-containing protein 2338 737 gene locus_tag LOCUS_26500 2338 737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26500 4034 2853 gene locus_tag LOCUS_26510 4034 2853 CDS product nucleoside monophosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615753.1 protein_id gnl|my_center|LOCUS_26510 4237 4635 gene locus_tag LOCUS_26520 4237 4635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26520 >Feature sequence0471 317 1198 gene locus_tag LOCUS_26530 317 1198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26530 1489 1935 gene locus_tag LOCUS_26540 1489 1935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26540 1943 2218 gene locus_tag LOCUS_26550 1943 2218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26550 2468 2920 gene locus_tag LOCUS_26560 2468 2920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26560 3436 3002 gene locus_tag LOCUS_26570 3436 3002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26570 3879 4034 gene locus_tag LOCUS_26580 3879 4034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26580 4414 4486 gene locus_tag LOCUS_t00160 4414 4486 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 4498 4752 gene locus_tag LOCUS_26590 4498 4752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26590 >Feature sequence0472 1422 1553 gene locus_tag LOCUS_26600 1422 1553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26600 1741 1517 gene locus_tag LOCUS_26610 1741 1517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26610 3553 2174 gene locus_tag LOCUS_26620 3553 2174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26620 3806 3591 gene locus_tag LOCUS_26630 3806 3591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26630 4337 4128 gene locus_tag LOCUS_26640 4337 4128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26640 >Feature sequence0473 849 1760 gene locus_tag LOCUS_26650 849 1760 CDS product haloalkane dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083907.1 protein_id gnl|my_center|LOCUS_26650 <4888 4093 gene locus_tag LOCUS_26660 <4888 4093 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012256259.1:RDD family protein >Feature sequence0474 2090 2224 gene locus_tag LOCUS_26670 2090 2224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26670 3044 4072 gene locus_tag LOCUS_26680 3044 4072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26680 <4887 4387 gene locus_tag LOCUS_26690 <4887 4387 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004550532.1:ATP-binding cassette domain-containing protein >Feature sequence0475 <1 1067 gene locus_tag LOCUS_26700 <1 1067 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_236615365.1:glycosyltransferase family 2 protein 1087 2349 gene locus_tag LOCUS_26710 1087 2349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26710 2359 4746 gene locus_tag LOCUS_26720 2359 4746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26720 >Feature sequence0476 <1 1465 gene locus_tag LOCUS_26730 <1 1465 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011404851.1:bifunctional acetate--CoA ligase family protein/GNAT family N-acetyltransferase 1562 2407 gene locus_tag LOCUS_26740 1562 2407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26740 >Feature sequence0477 2155 1109 gene locus_tag LOCUS_26750 2155 1109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26750 3391 2168 gene locus_tag LOCUS_26760 3391 2168 CDS product FxsB family radical SAM/SPASM domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229894.1 protein_id gnl|my_center|LOCUS_26760 3677 3498 gene locus_tag LOCUS_26770 3677 3498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26770 4201 4347 gene locus_tag LOCUS_26780 4201 4347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26780 >Feature sequence0478 3118 1874 gene locus_tag LOCUS_26790 3118 1874 CDS product nitric oxide synthase oxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_086848418.1 protein_id gnl|my_center|LOCUS_26790 4485 3124 gene locus_tag LOCUS_26800 4485 3124 CDS product cobalamin-dependent protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615609.1 protein_id gnl|my_center|LOCUS_26800 4874 4482 gene locus_tag LOCUS_26810 4874 4482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26810 >Feature sequence0479 794 471 gene locus_tag LOCUS_26820 794 471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26820 1668 1255 gene locus_tag LOCUS_26830 1668 1255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26830 2474 1980 gene locus_tag LOCUS_26840 2474 1980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_26840 2959 2609 gene locus_tag LOCUS_26850 2959 2609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_26850 3315 3148 gene locus_tag LOCUS_26860 3315 3148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26860 3736 4482 gene locus_tag LOCUS_26870 3736 4482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_26870 >Feature sequence0480 <1 874 gene locus_tag LOCUS_26880 <1 874 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_041272653.1:bifunctional 3'-5' exonuclease/DNA polymerase 1062 1637 gene locus_tag LOCUS_26890 1062 1637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26890 3209 2964 gene locus_tag LOCUS_26900 3209 2964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26900 3597 3944 gene locus_tag LOCUS_26910 3597 3944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26910 3958 4791 gene locus_tag LOCUS_26920 3958 4791 CDS product arsenite methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461623.1 protein_id gnl|my_center|LOCUS_26920 >Feature sequence0481 1169 204 gene locus_tag LOCUS_26930 1169 204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26930 <4861 1562 gene locus_tag LOCUS_26940 <4861 1562 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_123147513.1:adenylate/guanylate cyclase domain-containing protein >Feature sequence0482 3537 106 gene locus_tag LOCUS_26950 3537 106 CDS product autotransporter outer membrane beta-barrel domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967015.1 protein_id gnl|my_center|LOCUS_26950 3587 3772 gene locus_tag LOCUS_26960 3587 3772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26960 4077 3778 gene locus_tag LOCUS_26970 4077 3778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26970 4182 4109 gene locus_tag LOCUS_t00170 4182 4109 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence0483 1475 588 gene locus_tag LOCUS_26980 1475 588 CDS product haloalkane dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003413363.1 protein_id gnl|my_center|LOCUS_26980 1588 2181 gene locus_tag LOCUS_26990 1588 2181 CDS product ABATE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144389.1 protein_id gnl|my_center|LOCUS_26990 2650 2204 gene locus_tag LOCUS_27000 2650 2204 CDS product tautomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005089439.1 protein_id gnl|my_center|LOCUS_27000 3304 2729 gene locus_tag LOCUS_27010 3304 2729 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267916.1 protein_id gnl|my_center|LOCUS_27010 3837 3439 gene locus_tag LOCUS_27020 3837 3439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27020 >Feature sequence0484 2406 1618 gene locus_tag LOCUS_27030 2406 1618 CDS product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004201022.1 protein_id gnl|my_center|LOCUS_27030 4109 2502 gene locus_tag LOCUS_27040 4109 2502 CDS product carboxyl transferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004201021.1 protein_id gnl|my_center|LOCUS_27040 4306 4488 gene locus_tag LOCUS_27050 4306 4488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27050 >Feature sequence0485 <1 571 gene locus_tag LOCUS_27060 <1 571 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005483346.1:FAD-binding oxidoreductase 1554 2738 gene locus_tag LOCUS_27070 1554 2738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27070 2735 3367 gene locus_tag LOCUS_27080 2735 3367 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087542.1 protein_id gnl|my_center|LOCUS_27080 4366 4776 gene locus_tag LOCUS_27090 4366 4776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27090 >Feature sequence0486 222 377 gene locus_tag LOCUS_27100 222 377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27100 1475 3292 gene locus_tag LOCUS_27110 gene kdpA 1475 3292 CDS product potassium-transporting ATPase subunit KdpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883954.1 protein_id gnl|my_center|LOCUS_27110 >Feature sequence0487 723 2537 gene locus_tag LOCUS_27120 723 2537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27120 <4848 2903 gene locus_tag LOCUS_27130 <4848 2903 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002679930.1:DNA topoisomerase IV subunit A >Feature sequence0488 378 710 gene locus_tag LOCUS_27140 378 710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27140 3214 3050 gene locus_tag LOCUS_27150 3214 3050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27150 3299 3556 gene locus_tag LOCUS_27160 3299 3556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27160 >Feature sequence0489 649 1719 gene locus_tag LOCUS_27170 649 1719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27170 3429 2341 gene locus_tag LOCUS_27180 3429 2341 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018210119.1 protein_id gnl|my_center|LOCUS_27180 3849 4517 gene locus_tag LOCUS_27190 3849 4517 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257731.1 protein_id gnl|my_center|LOCUS_27190 >Feature sequence0490 314 3520 gene locus_tag LOCUS_27200 314 3520 CDS product glycoside hydrolase family 38 C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584105.1 protein_id gnl|my_center|LOCUS_27200 4505 3732 gene locus_tag LOCUS_27210 4505 3732 CDS product crotonase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969826.1 protein_id gnl|my_center|LOCUS_27210 >Feature sequence0491 294 452 gene locus_tag LOCUS_27220 294 452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27220 1868 2053 gene locus_tag LOCUS_27230 1868 2053 CDS product CsbD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388930.1 protein_id gnl|my_center|LOCUS_27230 2329 2655 gene locus_tag LOCUS_27240 2329 2655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27240 3831 4256 gene locus_tag LOCUS_27250 3831 4256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27250 >Feature sequence0492 1172 129 gene locus_tag LOCUS_27260 1172 129 CDS product NAD(P)-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966229.1 protein_id gnl|my_center|LOCUS_27260 1702 3606 gene locus_tag LOCUS_27270 1702 3606 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275257.1 protein_id gnl|my_center|LOCUS_27270 3898 4515 gene locus_tag LOCUS_27280 3898 4515 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034350382.1 protein_id gnl|my_center|LOCUS_27280 >Feature sequence0493 1212 142 gene locus_tag LOCUS_27290 gene queG 1212 142 CDS product tRNA epoxyqueuosine(34) reductase QueG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083539.1 protein_id gnl|my_center|LOCUS_27290 2006 1398 gene locus_tag LOCUS_27300 2006 1398 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546210.1 protein_id gnl|my_center|LOCUS_27300 2441 2232 gene locus_tag LOCUS_27310 2441 2232 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003816407.1 protein_id gnl|my_center|LOCUS_27310 2615 3115 gene locus_tag LOCUS_27320 gene purE 2615 3115 CDS product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172593.1 protein_id gnl|my_center|LOCUS_27320 3248 4240 gene locus_tag LOCUS_27330 3248 4240 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338457.1 protein_id gnl|my_center|LOCUS_27330 >Feature sequence0494 879 403 gene locus_tag LOCUS_27340 879 403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27340 2201 885 gene locus_tag LOCUS_27350 2201 885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27350 4296 3163 gene locus_tag LOCUS_27360 4296 3163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968622.1 protein_id gnl|my_center|LOCUS_27360 <4815 4293 gene locus_tag LOCUS_27370 <4815 4293 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010968621.1:DUF4365 domain-containing protein >Feature sequence0495 233 90 gene locus_tag LOCUS_27380 233 90 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27380 326 973 gene locus_tag LOCUS_27390 326 973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27390 1577 2530 gene locus_tag LOCUS_27400 1577 2530 CDS product L,D-transpeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038316.1 protein_id gnl|my_center|LOCUS_27400 2853 3326 gene locus_tag LOCUS_27410 2853 3326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27410 4196 3858 gene locus_tag LOCUS_27420 4196 3858 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143541.1 protein_id gnl|my_center|LOCUS_27420 4746 4384 gene locus_tag LOCUS_27430 4746 4384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27430 >Feature sequence0496 <1 2396 gene locus_tag LOCUS_27440 <1 2396 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_211477812.1:magnesium-translocating P-type ATPase 2513 3541 gene locus_tag LOCUS_27450 2513 3541 CDS product ROK family glucokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965901.1 protein_id gnl|my_center|LOCUS_27450 <4802 3708 gene locus_tag LOCUS_27460 <4802 3708 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012869086.1:polyphosphate:AMP phosphotransferase >Feature sequence0497 542 931 gene locus_tag LOCUS_27470 542 931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27470 2148 988 gene locus_tag LOCUS_27480 2148 988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27480 3686 2334 gene locus_tag LOCUS_27490 3686 2334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27490 >Feature sequence0498 1394 858 gene locus_tag LOCUS_27500 gene rplI 1394 858 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037379733.1 protein_id gnl|my_center|LOCUS_27500 2499 1639 gene locus_tag LOCUS_27510 2499 1639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27510 3205 3777 gene locus_tag LOCUS_27520 3205 3777 CDS product YceI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000749266.1 protein_id gnl|my_center|LOCUS_27520 3803 4651 gene locus_tag LOCUS_27530 3803 4651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27530 >Feature sequence0499 178 3645 gene locus_tag LOCUS_27540 178 3645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27540 >Feature sequence0500 <1 1036 gene locus_tag LOCUS_27550 <1 1036 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011056884.1:4-hydroxy-3-methylbut-2-enyl diphosphate reductase 1175 1612 gene locus_tag LOCUS_27560 1175 1612 CDS product NYN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003724086.1 protein_id gnl|my_center|LOCUS_27560 2837 1836 gene locus_tag LOCUS_27570 2837 1836 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056343.1 protein_id gnl|my_center|LOCUS_27570 3859 2834 gene locus_tag LOCUS_27580 gene purM 3859 2834 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393542.1 protein_id gnl|my_center|LOCUS_27580 <4772 3856 gene locus_tag LOCUS_27590 <4772 3856 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942281.1:amidophosphoribosyltransferase >Feature sequence0501 900 987 gene locus_tag LOCUS_t00180 900 987 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 1830 1114 gene locus_tag LOCUS_27600 1830 1114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27600 2138 1848 gene locus_tag LOCUS_27610 2138 1848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27610 3434 2346 gene locus_tag LOCUS_27620 gene ugpC 3434 2346 CDS product sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067526.1 protein_id gnl|my_center|LOCUS_27620 >Feature sequence0502 <1 1111 gene locus_tag LOCUS_27630 <1 1111 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011117973.1:RNA polymerase sigma factor 2360 1377 gene locus_tag LOCUS_27640 2360 1377 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968596.1 protein_id gnl|my_center|LOCUS_27640 2816 3430 gene locus_tag LOCUS_27650 2816 3430 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388643.1 protein_id gnl|my_center|LOCUS_27650 3488 3685 gene locus_tag LOCUS_27660 3488 3685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27660 4495 3962 gene locus_tag LOCUS_27670 4495 3962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27670 >Feature sequence0503 382 1071 gene locus_tag LOCUS_27680 382 1071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27680 1524 1201 gene locus_tag LOCUS_27690 gene cutA 1524 1201 CDS product divalent cation tolerance protein CutA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_174849537.1 protein_id gnl|my_center|LOCUS_27690 1987 1538 gene locus_tag LOCUS_27700 1987 1538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27700 <4763 2445 gene locus_tag LOCUS_27710 <4763 2445 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010940682.1:DNA gyrase subunit A >Feature sequence0504 580 296 gene locus_tag LOCUS_27720 580 296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27720 619 834 gene locus_tag LOCUS_27730 619 834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27730 2774 1440 gene locus_tag LOCUS_27740 2774 1440 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173508792.1 protein_id gnl|my_center|LOCUS_27740 3075 3287 gene locus_tag LOCUS_27750 3075 3287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27750 3513 3662 gene locus_tag LOCUS_27760 3513 3662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_27760 3659 4240 gene locus_tag LOCUS_27770 3659 4240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_27770 4567 4301 gene locus_tag LOCUS_27780 4567 4301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27780 >Feature sequence0505 <1 757 gene locus_tag LOCUS_27790 <1 757 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011267927.1:benzaldehyde dehydrogenase 2225 3175 gene locus_tag LOCUS_27800 2225 3175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27800 3138 3380 gene locus_tag LOCUS_27810 3138 3380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27810 3592 4350 gene locus_tag LOCUS_27820 3592 4350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27820 >Feature sequence0506 2080 224 gene locus_tag LOCUS_27830 gene kefC 2080 224 CDS product glutathione-regulated potassium-efflux system protein KefC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141343.1 protein_id gnl|my_center|LOCUS_27830 2728 2087 gene locus_tag LOCUS_27840 2728 2087 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141342.1 protein_id gnl|my_center|LOCUS_27840 4341 3169 gene locus_tag LOCUS_27850 gene bioF 4341 3169 CDS product 8-amino-7-oxononanoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943267.1 protein_id gnl|my_center|LOCUS_27850 4741 4511 gene locus_tag LOCUS_27860 4741 4511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27860 >Feature sequence0507 529 1581 gene locus_tag LOCUS_27870 529 1581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27870 2157 2333 gene locus_tag LOCUS_27880 2157 2333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27880 2333 2539 gene locus_tag LOCUS_27890 2333 2539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27890 3320 3679 gene locus_tag LOCUS_27900 3320 3679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27900 3982 4638 gene locus_tag LOCUS_27910 3982 4638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27910 >Feature sequence0508 2476 1352 gene locus_tag LOCUS_27920 2476 1352 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257503.1 protein_id gnl|my_center|LOCUS_27920 2975 2481 gene locus_tag LOCUS_27930 2975 2481 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061729.1 protein_id gnl|my_center|LOCUS_27930 4069 2987 gene locus_tag LOCUS_27940 4069 2987 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257502.1 protein_id gnl|my_center|LOCUS_27940 >Feature sequence0509 1345 866 gene locus_tag LOCUS_27950 1345 866 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257073.1 protein_id gnl|my_center|LOCUS_27950 2100 1396 gene locus_tag LOCUS_27960 gene hoxU 2100 1396 CDS product bidirectional hydrogenase complex protein HoxU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257072.1 protein_id gnl|my_center|LOCUS_27960 3867 2275 gene locus_tag LOCUS_27970 3867 2275 CDS product NADH-ubiquinone oxidoreductase-F iron-sulfur binding region domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257071.1 protein_id gnl|my_center|LOCUS_27970 4357 3857 gene locus_tag LOCUS_27980 gene hoxE 4357 3857 CDS product bidirectional hydrogenase complex protein HoxE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257070.1 protein_id gnl|my_center|LOCUS_27980 >Feature sequence0510 <1 2740 gene locus_tag LOCUS_27990 <1 2740 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011392382.1:isoleucine--tRNA ligase 2737 3228 gene locus_tag LOCUS_28000 gene lspA 2737 3228 CDS product signal peptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939214.1 protein_id gnl|my_center|LOCUS_28000 <4717 3512 gene locus_tag LOCUS_28010 <4717 3512 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002682344.1:HD domain-containing protein >Feature sequence0511 2037 1006 gene locus_tag LOCUS_28020 2037 1006 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067380.1 protein_id gnl|my_center|LOCUS_28020 2260 2502 gene locus_tag LOCUS_28030 2260 2502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28030 2505 3419 gene locus_tag LOCUS_28040 2505 3419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28040 3494 4447 gene locus_tag LOCUS_28050 3494 4447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28050 >Feature sequence0512 858 190 gene locus_tag LOCUS_28060 858 190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28060 2254 1298 gene locus_tag LOCUS_28070 2254 1298 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141439.1 protein_id gnl|my_center|LOCUS_28070 2369 3112 gene locus_tag LOCUS_28080 2369 3112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28080 3407 3700 gene locus_tag LOCUS_28090 3407 3700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28090 <4714 3693 gene locus_tag LOCUS_28100 <4714 3693 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012640051.1:aromatic ring-hydroxylating dioxygenase subunit alpha >Feature sequence0513 4036 1190 gene locus_tag LOCUS_28110 4036 1190 CDS product S8 family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143152.1 protein_id gnl|my_center|LOCUS_28110 >Feature sequence0514 1062 2339 gene locus_tag LOCUS_28120 1062 2339 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227054.1 protein_id gnl|my_center|LOCUS_28120 2699 2529 gene locus_tag LOCUS_28130 2699 2529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28130 4324 2759 gene locus_tag LOCUS_28140 4324 2759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28140 >Feature sequence0515 1688 696 gene locus_tag LOCUS_28150 1688 696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28150 2850 1789 gene locus_tag LOCUS_28160 2850 1789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28160 3857 2898 gene locus_tag LOCUS_28170 3857 2898 CDS product branched-chain amino acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257319.1 protein_id gnl|my_center|LOCUS_28170 >Feature sequence0516 931 1131 gene locus_tag LOCUS_28180 931 1131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28180 1364 1035 gene locus_tag LOCUS_28190 1364 1035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28190 1363 1884 gene locus_tag LOCUS_28200 1363 1884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28200 2980 2666 gene locus_tag LOCUS_28210 2980 2666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28210 3628 3813 gene locus_tag LOCUS_28220 3628 3813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28220 >Feature sequence0517 >Feature sequence0518 2 415 gene locus_tag LOCUS_28230 2 415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28230 >Feature sequence0519 1646 1122 gene locus_tag LOCUS_28240 gene rfbC 1646 1122 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142202.1 protein_id gnl|my_center|LOCUS_28240 2671 1646 gene locus_tag LOCUS_28250 2671 1646 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257100.1 protein_id gnl|my_center|LOCUS_28250 3975 2710 gene locus_tag LOCUS_28260 3975 2710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28260 <4695 4067 gene locus_tag LOCUS_28270 <4695 4067 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257788.1:glycosyltransferase >Feature sequence0520 587 928 gene locus_tag LOCUS_28280 587 928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28280 1277 1537 gene locus_tag LOCUS_28290 1277 1537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28290 2446 1565 gene locus_tag LOCUS_28300 2446 1565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_200810866.1 protein_id gnl|my_center|LOCUS_28300 4028 3630 gene locus_tag LOCUS_28310 4028 3630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28310 >Feature sequence0521 <1 620 gene locus_tag LOCUS_28320 <1 620 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010937705.1:cache domain-containing protein 1709 579 gene locus_tag LOCUS_28330 1709 579 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011214278.1 protein_id gnl|my_center|LOCUS_28330 <4692 1855 gene locus_tag LOCUS_28340 <4692 1855 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010903265.1:pentapeptide repeat-containing protein >Feature sequence0522 1365 673 gene locus_tag LOCUS_28350 1365 673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28350 1862 1635 gene locus_tag LOCUS_28360 1862 1635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28360 >Feature sequence0523 3952 134 gene locus_tag LOCUS_28370 gene rpoB 3952 134 CDS product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012263639.1 protein_id gnl|my_center|LOCUS_28370 >Feature sequence0524 147 743 gene locus_tag LOCUS_28380 147 743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28380 792 1220 gene locus_tag LOCUS_28390 792 1220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28390 1677 1895 gene locus_tag LOCUS_28400 1677 1895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28400 1874 2152 gene locus_tag LOCUS_28410 1874 2152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28410 2860 2318 gene locus_tag LOCUS_28420 2860 2318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28420 3237 4211 gene locus_tag LOCUS_28430 3237 4211 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050563345.1 protein_id gnl|my_center|LOCUS_28430 >Feature sequence0525 <1 1175 gene locus_tag LOCUS_28440 <1 1175 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003114649.1:tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG 1593 2141 gene locus_tag LOCUS_28450 gene yetL 1593 2141 CDS product transcriptional regulator YetL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233796.1 protein_id gnl|my_center|LOCUS_28450 2161 3381 gene locus_tag LOCUS_28460 2161 3381 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943408.1 protein_id gnl|my_center|LOCUS_28460 >Feature sequence0526 340 1587 gene locus_tag LOCUS_28470 340 1587 CDS product enolase C-terminal domain-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015445390.1 protein_id gnl|my_center|LOCUS_28470 2182 1721 gene locus_tag LOCUS_28480 2182 1721 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090322.1 protein_id gnl|my_center|LOCUS_28480 2977 2255 gene locus_tag LOCUS_28490 2977 2255 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970395.1 protein_id gnl|my_center|LOCUS_28490 3167 4312 gene locus_tag LOCUS_28500 3167 4312 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003408274.1 protein_id gnl|my_center|LOCUS_28500 >Feature sequence0527 <1 1285 gene locus_tag LOCUS_28510 <1 1285 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011268048.1:LLM class flavin-dependent oxidoreductase 1937 1326 gene locus_tag LOCUS_28520 1937 1326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28520 2123 3886 gene locus_tag LOCUS_28530 2123 3886 CDS product ABC transporter ATP-binding protein/permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090269.1 protein_id gnl|my_center|LOCUS_28530 >Feature sequence0528 1557 2225 gene locus_tag LOCUS_28540 1557 2225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28540 2746 2249 gene locus_tag LOCUS_28550 2746 2249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28550 3306 2752 gene locus_tag LOCUS_28560 3306 2752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28560 3709 3350 gene locus_tag LOCUS_28570 3709 3350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28570 >Feature sequence0529 424 1053 gene locus_tag LOCUS_28580 424 1053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28580 4209 1327 gene locus_tag LOCUS_28590 4209 1327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28590 >Feature sequence0530 <1 3293 gene locus_tag LOCUS_28600 <1 3293 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003147216.1:filamentous hemagglutinin family protein 4287 3730 gene locus_tag LOCUS_28610 4287 3730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28610 >Feature sequence0531 413 589 gene locus_tag LOCUS_28620 413 589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28620 2136 2357 gene locus_tag LOCUS_28630 2136 2357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28630 3590 3868 gene locus_tag LOCUS_28640 3590 3868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28640 >Feature sequence0532 395 2818 gene locus_tag LOCUS_28650 395 2818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28650 3104 2943 gene locus_tag LOCUS_28660 3104 2943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28660 >Feature sequence0533 1516 836 gene locus_tag LOCUS_28670 1516 836 CDS product heavy metal response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943577.1 protein_id gnl|my_center|LOCUS_28670 >Feature sequence0534 595 401 gene locus_tag LOCUS_28680 595 401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28680 836 2128 gene locus_tag LOCUS_28690 836 2128 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029023.1 protein_id gnl|my_center|LOCUS_28690 2229 3203 gene locus_tag LOCUS_28700 2229 3203 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029022.1 protein_id gnl|my_center|LOCUS_28700 3214 4035 gene locus_tag LOCUS_28710 3214 4035 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_107573728.1 protein_id gnl|my_center|LOCUS_28710 >Feature sequence0535 2370 1240 gene locus_tag LOCUS_28720 2370 1240 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388761.1 protein_id gnl|my_center|LOCUS_28720 4574 2502 gene locus_tag LOCUS_28730 gene fusA 4574 2502 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931838.1 protein_id gnl|my_center|LOCUS_28730 >Feature sequence0536 <4626 248 gene locus_tag LOCUS_28740 <4626 248 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007510795.1:CHAT domain-containing protein >Feature sequence0537 971 204 gene locus_tag LOCUS_28750 971 204 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028174100.1 protein_id gnl|my_center|LOCUS_28750 2502 1195 gene locus_tag LOCUS_28760 2502 1195 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338771.1 protein_id gnl|my_center|LOCUS_28760 3152 3754 gene locus_tag LOCUS_28770 3152 3754 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458832.1 protein_id gnl|my_center|LOCUS_28770 3766 4551 gene locus_tag LOCUS_28780 3766 4551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28780 >Feature sequence0538 1030 65 gene locus_tag LOCUS_28790 1030 65 CDS product threonine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114230.1 protein_id gnl|my_center|LOCUS_28790 1683 1210 gene locus_tag LOCUS_28800 1683 1210 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972895.1 protein_id gnl|my_center|LOCUS_28800 2577 2116 gene locus_tag LOCUS_28810 2577 2116 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971837.1 protein_id gnl|my_center|LOCUS_28810 2950 3957 gene locus_tag LOCUS_28820 2950 3957 CDS product proline iminopeptidase-family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404376.1 protein_id gnl|my_center|LOCUS_28820 >Feature sequence0539 75 839 gene locus_tag LOCUS_28830 75 839 CDS product DUF72 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880570.1 protein_id gnl|my_center|LOCUS_28830 976 1590 gene locus_tag LOCUS_28840 976 1590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28840 1904 2068 gene locus_tag LOCUS_28850 1904 2068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28850 3087 2272 gene locus_tag LOCUS_28860 3087 2272 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941787.1 protein_id gnl|my_center|LOCUS_28860 4033 3089 gene locus_tag LOCUS_28870 4033 3089 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949041.1 protein_id gnl|my_center|LOCUS_28870 >Feature sequence0540 3480 3710 gene locus_tag LOCUS_28880 3480 3710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28880 >Feature sequence0541 312 839 gene locus_tag LOCUS_28890 312 839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28890 870 2042 gene locus_tag LOCUS_28900 870 2042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28900 2042 3847 gene locus_tag LOCUS_28910 2042 3847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28910 >Feature sequence0542 3064 428 gene locus_tag LOCUS_28920 3064 428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_28920 3355 3477 gene locus_tag LOCUS_28930 3355 3477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28930 3646 3837 gene locus_tag LOCUS_28940 3646 3837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28940 >Feature sequence0543 1198 584 gene locus_tag LOCUS_28950 1198 584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28950 1219 1347 gene locus_tag LOCUS_28960 1219 1347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28960 1551 2177 gene locus_tag LOCUS_28970 1551 2177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28970 2703 2416 gene locus_tag LOCUS_28980 2703 2416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28980 3824 2994 gene locus_tag LOCUS_28990 3824 2994 CDS product transglutaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529017.1 protein_id gnl|my_center|LOCUS_28990 <4598 3824 gene locus_tag LOCUS_29000 <4598 3824 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008666936.1:amidohydrolase >Feature sequence0544 136 264 gene locus_tag LOCUS_29010 136 264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29010 464 592 gene locus_tag LOCUS_29020 464 592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29020 885 1040 gene locus_tag LOCUS_29030 885 1040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29030 1043 1357 gene locus_tag LOCUS_29040 1043 1357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29040 1418 1546 gene locus_tag LOCUS_29050 1418 1546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29050 >Feature sequence0545 2583 913 gene locus_tag LOCUS_29060 2583 913 CDS product 2Fe-2S iron-sulfur cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403178.1 protein_id gnl|my_center|LOCUS_29060 4040 2679 gene locus_tag LOCUS_29070 gene nuoF 4040 2679 CDS product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964317.1 protein_id gnl|my_center|LOCUS_29070 4536 4042 gene locus_tag LOCUS_29080 gene nuoE 4536 4042 CDS product NADH-quinone oxidoreductase subunit NuoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004597486.1 protein_id gnl|my_center|LOCUS_29080 >Feature sequence0546 424 705 gene locus_tag LOCUS_29090 424 705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29090 724 1761 gene locus_tag LOCUS_29100 724 1761 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259668.1 protein_id gnl|my_center|LOCUS_29100 1927 2085 gene locus_tag LOCUS_29110 1927 2085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29110 2630 2127 gene locus_tag LOCUS_29120 2630 2127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29120 2689 3048 gene locus_tag LOCUS_29130 2689 3048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29130 3086 3436 gene locus_tag LOCUS_29140 3086 3436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29140 <4586 3642 gene locus_tag LOCUS_29150 <4586 3642 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004186205.1:S53 family peptidase >Feature sequence0547 198 1634 gene locus_tag LOCUS_29160 gene hpnO 198 1634 CDS product aminobacteriohopanetriol synthase HpnO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085794.1 protein_id gnl|my_center|LOCUS_29160 2467 1943 gene locus_tag LOCUS_29170 2467 1943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29170 3079 3756 gene locus_tag LOCUS_29180 3079 3756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29180 4426 3956 gene locus_tag LOCUS_29190 4426 3956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29190 >Feature sequence0548 1288 365 gene locus_tag LOCUS_29200 1288 365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29200 1538 1305 gene locus_tag LOCUS_29210 1538 1305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29210 1674 2375 gene locus_tag LOCUS_29220 1674 2375 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086729.1 protein_id gnl|my_center|LOCUS_29220 >Feature sequence0549 <1 1435 gene locus_tag LOCUS_29230 <1 1435 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164927081.1:TonB-dependent receptor 1445 1993 gene locus_tag LOCUS_29240 1445 1993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29240 2674 3492 gene locus_tag LOCUS_29250 gene prcB 2674 3492 CDS product proteasome subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977182.1 protein_id gnl|my_center|LOCUS_29250 3489 4268 gene locus_tag LOCUS_29260 3489 4268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29260 >Feature sequence0550 <4561 226 gene locus_tag LOCUS_29270 <4561 226 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011674628.1:LysM peptidoglycan-binding domain-containing protein >Feature sequence0551 366 73 gene locus_tag LOCUS_29280 366 73 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29280 410 577 gene locus_tag LOCUS_29290 410 577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29290 1409 564 gene locus_tag LOCUS_29300 1409 564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29300 2060 1722 gene locus_tag LOCUS_29310 2060 1722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29310 2526 2107 gene locus_tag LOCUS_29320 2526 2107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29320 3227 2811 gene locus_tag LOCUS_29330 3227 2811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29330 4270 3473 gene locus_tag LOCUS_29340 4270 3473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29340 >Feature sequence0552 663 1823 gene locus_tag LOCUS_29350 663 1823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29350 4273 1925 gene locus_tag LOCUS_29360 4273 1925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29360 >Feature sequence0553 37 759 gene locus_tag LOCUS_29370 37 759 CDS product TerC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404948.1 protein_id gnl|my_center|LOCUS_29370 1396 887 gene locus_tag LOCUS_29380 1396 887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29380 1590 2681 gene locus_tag LOCUS_29390 gene rlmN 1590 2681 CDS product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232066.1 protein_id gnl|my_center|LOCUS_29390 2691 3320 gene locus_tag LOCUS_29400 2691 3320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29400 3455 4096 gene locus_tag LOCUS_29410 3455 4096 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583208.1 protein_id gnl|my_center|LOCUS_29410 >Feature sequence0554 342 31 gene locus_tag LOCUS_29420 342 31 CDS product NAD(P) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920741.1 protein_id gnl|my_center|LOCUS_29420 1644 499 gene locus_tag LOCUS_29430 1644 499 CDS product Re/Si-specific NAD(P)(+) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063838431.1 protein_id gnl|my_center|LOCUS_29430 2317 2658 gene locus_tag LOCUS_29440 2317 2658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29440 3452 2664 gene locus_tag LOCUS_29450 3452 2664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29450 >Feature sequence0555 879 190 gene locus_tag LOCUS_29460 879 190 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942828.1 protein_id gnl|my_center|LOCUS_29460 1242 1898 gene locus_tag LOCUS_29470 1242 1898 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017868968.1 protein_id gnl|my_center|LOCUS_29470 3386 2241 gene locus_tag LOCUS_29480 3386 2241 CDS product L,D-transpeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038316.1 protein_id gnl|my_center|LOCUS_29480 3392 3985 gene locus_tag LOCUS_29490 3392 3985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29490 >Feature sequence0556 180 1805 gene locus_tag LOCUS_29500 180 1805 CDS product lactate permease LctP family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940541.1 protein_id gnl|my_center|LOCUS_29500 2954 2106 gene locus_tag LOCUS_29510 2954 2106 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020663.1 protein_id gnl|my_center|LOCUS_29510 3265 4167 gene locus_tag LOCUS_29520 3265 4167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29520 >Feature sequence0557 238 1095 gene locus_tag LOCUS_29530 238 1095 CDS product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259324.1 protein_id gnl|my_center|LOCUS_29530 2289 1348 gene locus_tag LOCUS_29540 2289 1348 CDS product catalase family peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004549880.1 protein_id gnl|my_center|LOCUS_29540 3025 3690 gene locus_tag LOCUS_29550 3025 3690 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480641.1 protein_id gnl|my_center|LOCUS_29550 4099 4266 gene locus_tag LOCUS_29560 4099 4266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29560 >Feature sequence0558 2896 488 gene locus_tag LOCUS_29570 2896 488 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173615039.1 protein_id gnl|my_center|LOCUS_29570 4118 3099 gene locus_tag LOCUS_29580 gene deoC 4118 3099 CDS product deoxyribose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339574.1 protein_id gnl|my_center|LOCUS_29580 >Feature sequence0559 983 1372 gene locus_tag LOCUS_29590 983 1372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29590 3875 1500 gene locus_tag LOCUS_29600 3875 1500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29600 >Feature sequence0560 820 140 gene locus_tag LOCUS_29610 gene modB 820 140 CDS product molybdate ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003088068.1 protein_id gnl|my_center|LOCUS_29610 1637 843 gene locus_tag LOCUS_29620 gene modA 1637 843 CDS product molybdate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074080.1 protein_id gnl|my_center|LOCUS_29620 1886 1680 gene locus_tag LOCUS_29630 1886 1680 CDS product TOBE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002555770.1 protein_id gnl|my_center|LOCUS_29630 2762 2058 gene locus_tag LOCUS_29640 2762 2058 CDS product sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121635.1 protein_id gnl|my_center|LOCUS_29640 3738 3914 gene locus_tag LOCUS_29650 3738 3914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29650 >Feature sequence0561 875 429 gene locus_tag LOCUS_29660 875 429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29660 1243 884 gene locus_tag LOCUS_29670 1243 884 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721812.1 protein_id gnl|my_center|LOCUS_29670 4283 1224 gene locus_tag LOCUS_29680 4283 1224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29680 4430 4504 gene locus_tag LOCUS_t00190 4430 4504 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence0562 1577 4351 gene locus_tag LOCUS_29690 1577 4351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29690 >Feature sequence0563 <1 1231 gene locus_tag LOCUS_29700 <1 1231 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010888658.1:dipeptidase 1228 2349 gene locus_tag LOCUS_29710 1228 2349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29710 >Feature sequence0564 1068 1976 gene locus_tag LOCUS_29720 1068 1976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29720 2254 2664 gene locus_tag LOCUS_29730 2254 2664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29730 2661 2996 gene locus_tag LOCUS_29740 2661 2996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29740 2999 4132 gene locus_tag LOCUS_29750 2999 4132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29750 >Feature sequence0565 >Feature sequence0566 1223 249 gene locus_tag LOCUS_29760 1223 249 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122363.1 protein_id gnl|my_center|LOCUS_29760 2155 1592 gene locus_tag LOCUS_29770 2155 1592 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974638.1 protein_id gnl|my_center|LOCUS_29770 3087 2326 gene locus_tag LOCUS_29780 3087 2326 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085532.1 protein_id gnl|my_center|LOCUS_29780 3484 3119 gene locus_tag LOCUS_29790 3484 3119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_29790 4304 3456 gene locus_tag LOCUS_29800 4304 3456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_29800 >Feature sequence0567 3607 2666 gene locus_tag LOCUS_29810 3607 2666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29810 >Feature sequence0568 <1 2362 gene locus_tag LOCUS_29820 <1 2362 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_171602985.1:adenylate/guanylate cyclase domain-containing protein 3268 2381 gene locus_tag LOCUS_29830 3268 2381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29830 4273 3788 gene locus_tag LOCUS_29840 4273 3788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29840 >Feature sequence0569 <1 616 gene locus_tag LOCUS_29850 <1 616 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011090493.1:GTP-binding protein 1935 928 gene locus_tag LOCUS_29860 gene gmd 1935 928 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407639.1 protein_id gnl|my_center|LOCUS_29860 2967 1954 gene locus_tag LOCUS_29870 2967 1954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29870 3101 3844 gene locus_tag LOCUS_29880 gene thrB 3101 3844 CDS product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964548.1 protein_id gnl|my_center|LOCUS_29880 >Feature sequence0570 <1 699 gene locus_tag LOCUS_29890 <1 699 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_051218217.1:FAD-dependent oxidoreductase 811 1608 gene locus_tag LOCUS_29900 811 1608 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230706.1 protein_id gnl|my_center|LOCUS_29900 1999 3261 gene locus_tag LOCUS_29910 1999 3261 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026800.1 protein_id gnl|my_center|LOCUS_29910 3293 4144 gene locus_tag LOCUS_29920 3293 4144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29920 >Feature sequence0571 1497 1042 gene locus_tag LOCUS_29930 1497 1042 CDS product Fur family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930868.1 protein_id gnl|my_center|LOCUS_29930 2680 1667 gene locus_tag LOCUS_29940 2680 1667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29940 3384 2911 gene locus_tag LOCUS_29950 3384 2911 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707183.1 protein_id gnl|my_center|LOCUS_29950 >Feature sequence0572 520 365 gene locus_tag LOCUS_29960 520 365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29960 1088 597 gene locus_tag LOCUS_29970 1088 597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29970 1488 1258 gene locus_tag LOCUS_29980 1488 1258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29980 1714 2589 gene locus_tag LOCUS_29990 1714 2589 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267661.1 protein_id gnl|my_center|LOCUS_29990 2615 2923 gene locus_tag LOCUS_30000 2615 2923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30000 2957 3094 gene locus_tag LOCUS_30010 2957 3094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30010 <4464 3196 gene locus_tag LOCUS_30020 <4464 3196 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012256059.1:APC family permease >Feature sequence0573 264 1286 gene locus_tag LOCUS_30030 264 1286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30030 1400 2659 gene locus_tag LOCUS_30040 1400 2659 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193484988.1 protein_id gnl|my_center|LOCUS_30040 2656 3366 gene locus_tag LOCUS_30050 2656 3366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30050 >Feature sequence0574 868 2145 gene locus_tag LOCUS_30060 868 2145 CDS product multidrug effflux MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965865.1 protein_id gnl|my_center|LOCUS_30060 2886 3680 gene locus_tag LOCUS_30070 2886 3680 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804377.1 protein_id gnl|my_center|LOCUS_30070 >Feature sequence0575 2126 1431 gene locus_tag LOCUS_30080 2126 1431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30080 2134 3102 gene locus_tag LOCUS_30090 2134 3102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30090 3141 4007 gene locus_tag LOCUS_30100 3141 4007 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225935.1 protein_id gnl|my_center|LOCUS_30100 >Feature sequence0576 142 387 gene locus_tag LOCUS_30110 142 387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30110 1680 592 gene locus_tag LOCUS_30120 1680 592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30120 2010 2444 gene locus_tag LOCUS_30130 gene ndk 2010 2444 CDS product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008770040.1 protein_id gnl|my_center|LOCUS_30130 2532 3185 gene locus_tag LOCUS_30140 2532 3185 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258011.1 protein_id gnl|my_center|LOCUS_30140 >Feature sequence0577 1066 332 gene locus_tag LOCUS_30150 1066 332 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528170.1 protein_id gnl|my_center|LOCUS_30150 1184 2260 gene locus_tag LOCUS_30160 1184 2260 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226924.1 protein_id gnl|my_center|LOCUS_30160 2342 3313 gene locus_tag LOCUS_30170 2342 3313 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_093947876.1 protein_id gnl|my_center|LOCUS_30170 3310 4086 gene locus_tag LOCUS_30180 3310 4086 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226922.1 protein_id gnl|my_center|LOCUS_30180 >Feature sequence0578 <1 819 gene locus_tag LOCUS_30190 <1 819 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004544567.1:glycosyltransferase family 4 protein 2234 945 gene locus_tag LOCUS_30200 2234 945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30200 2364 3635 gene locus_tag LOCUS_30210 2364 3635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30210 >Feature sequence0579 1756 320 gene locus_tag LOCUS_30220 1756 320 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405092.1 protein_id gnl|my_center|LOCUS_30220 2113 2469 gene locus_tag LOCUS_30230 2113 2469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30230 3417 2491 gene locus_tag LOCUS_30240 3417 2491 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256896.1 protein_id gnl|my_center|LOCUS_30240 3885 3505 gene locus_tag LOCUS_30250 3885 3505 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088362.1 protein_id gnl|my_center|LOCUS_30250 >Feature sequence0580 641 390 gene locus_tag LOCUS_30260 641 390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30260 1179 676 gene locus_tag LOCUS_30270 1179 676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30270 2837 1389 gene locus_tag LOCUS_30280 2837 1389 CDS product DUF1254 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087657.1 protein_id gnl|my_center|LOCUS_30280 3701 3174 gene locus_tag LOCUS_30290 3701 3174 CDS product DUF1269 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967882.1 protein_id gnl|my_center|LOCUS_30290 >Feature sequence0581 1618 734 gene locus_tag LOCUS_30300 1618 734 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705289.1 protein_id gnl|my_center|LOCUS_30300 1730 3385 gene locus_tag LOCUS_30310 gene mdcA 1730 3385 CDS product malonate decarboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112666.1 protein_id gnl|my_center|LOCUS_30310 3385 4293 gene locus_tag LOCUS_30320 3385 4293 CDS product triphosphoribosyl-dephospho-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105305.1 protein_id gnl|my_center|LOCUS_30320 >Feature sequence0582 516 737 gene locus_tag LOCUS_30330 516 737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30330 1344 898 gene locus_tag LOCUS_30340 1344 898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30340 2532 2353 gene locus_tag LOCUS_30350 2532 2353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30350 3568 3239 gene locus_tag LOCUS_30360 3568 3239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30360 >Feature sequence0583 2 553 gene locus_tag LOCUS_30370 2 553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30370 714 2264 gene locus_tag LOCUS_30380 714 2264 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926191.1 protein_id gnl|my_center|LOCUS_30380 3307 2537 gene locus_tag LOCUS_30390 3307 2537 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830886.1 protein_id gnl|my_center|LOCUS_30390 3770 4150 gene locus_tag LOCUS_30400 3770 4150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30400 >Feature sequence0584 986 1921 gene locus_tag LOCUS_30410 986 1921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30410 2445 3482 gene locus_tag LOCUS_30420 2445 3482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30420 <4390 3574 gene locus_tag LOCUS_30430 <4390 3574 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941152.1:GTP cyclohydrolase FolE2 >Feature sequence0585 2652 631 gene locus_tag LOCUS_30440 2652 631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30440 3199 4107 gene locus_tag LOCUS_30450 gene rfbA 3199 4107 CDS product glucose-1-phosphate thymidylyltransferase RfbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_077983464.1 protein_id gnl|my_center|LOCUS_30450 >Feature sequence0586 <1 523 gene locus_tag LOCUS_30460 <1 523 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015064018.1:PA0069 family radical SAM protein 934 1962 gene locus_tag LOCUS_30470 934 1962 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250696.1 protein_id gnl|my_center|LOCUS_30470 2045 3085 gene locus_tag LOCUS_30480 2045 3085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30480 3098 3967 gene locus_tag LOCUS_30490 3098 3967 CDS product S-methyl-5'-thioadenosine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142419.1 protein_id gnl|my_center|LOCUS_30490 >Feature sequence0587 700 1734 gene locus_tag LOCUS_30500 700 1734 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943459.1 protein_id gnl|my_center|LOCUS_30500 1741 2157 gene locus_tag LOCUS_30510 gene rplQ 1741 2157 CDS product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919152.1 protein_id gnl|my_center|LOCUS_30510 2726 2220 gene locus_tag LOCUS_30520 2726 2220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30520 3239 2868 gene locus_tag LOCUS_30530 3239 2868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30530 >Feature sequence0588 1306 59 gene locus_tag LOCUS_30540 1306 59 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30540 1883 1236 gene locus_tag LOCUS_30550 1883 1236 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141682.1 protein_id gnl|my_center|LOCUS_30550 2274 3401 gene locus_tag LOCUS_30560 2274 3401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30560 3405 3866 gene locus_tag LOCUS_30570 3405 3866 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006316403.1 protein_id gnl|my_center|LOCUS_30570 >Feature sequence0589 1934 2878 gene locus_tag LOCUS_30580 1934 2878 CDS product S1/P1 nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062784820.1 protein_id gnl|my_center|LOCUS_30580 3205 4158 gene locus_tag LOCUS_30590 3205 4158 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875972.1 protein_id gnl|my_center|LOCUS_30590 >Feature sequence0590 <1 739 gene locus_tag LOCUS_30600 <1 739 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_169351683.1:sigma 54-interacting transcriptional regulator 1076 825 gene locus_tag LOCUS_30610 1076 825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30610 1128 1760 gene locus_tag LOCUS_30620 1128 1760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30620 1923 2801 gene locus_tag LOCUS_30630 1923 2801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30630 2961 3602 gene locus_tag LOCUS_30640 2961 3602 CDS product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_055723718.1 protein_id gnl|my_center|LOCUS_30640 3931 3614 gene locus_tag LOCUS_30650 3931 3614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30650 >Feature sequence0591 710 1381 gene locus_tag LOCUS_30660 710 1381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30660 1378 2076 gene locus_tag LOCUS_30670 1378 2076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30670 2184 2753 gene locus_tag LOCUS_30680 gene pgsA 2184 2753 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459962.1 protein_id gnl|my_center|LOCUS_30680 2892 4247 gene locus_tag LOCUS_30690 gene engA 2892 4247 CDS product ribosome-associated GTPase EngA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001125893.1 protein_id gnl|my_center|LOCUS_30690 >Feature sequence0592 1089 67 gene locus_tag LOCUS_30700 1089 67 CDS product SfnB family sulfur acquisition oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194614.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_30700 2757 1363 gene locus_tag LOCUS_30710 2757 1363 CDS product TIGR00366 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000580276.1 protein_id gnl|my_center|LOCUS_30710 3720 3139 gene locus_tag LOCUS_30720 3720 3139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30720 4211 3912 gene locus_tag LOCUS_30730 4211 3912 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001259906.1 protein_id gnl|my_center|LOCUS_30730 >Feature sequence0593 3657 772 gene locus_tag LOCUS_30740 3657 772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30740 <4335 3680 gene locus_tag LOCUS_30750 <4335 3680 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011121635.1:sigma factor >Feature sequence0594 1 705 gene locus_tag LOCUS_30760 1 705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30760 708 1550 gene locus_tag LOCUS_30770 708 1550 CDS product phosphoenolpyruvate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930246.1 protein_id gnl|my_center|LOCUS_30770 1590 2966 gene locus_tag LOCUS_30780 1590 2966 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722711.1 protein_id gnl|my_center|LOCUS_30780 3244 4110 gene locus_tag LOCUS_30790 3244 4110 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286787.1 protein_id gnl|my_center|LOCUS_30790 >Feature sequence0595 3 449 gene locus_tag LOCUS_30800 3 449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30800 1052 3151 gene locus_tag LOCUS_30810 1052 3151 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021363.1 protein_id gnl|my_center|LOCUS_30810 4160 3435 gene locus_tag LOCUS_30820 4160 3435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30820 >Feature sequence0596 >Feature sequence0597 565 876 gene locus_tag LOCUS_30830 565 876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30830 876 2171 gene locus_tag LOCUS_30840 876 2171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30840 2319 2522 gene locus_tag LOCUS_30850 2319 2522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30850 2523 3071 gene locus_tag LOCUS_30860 2523 3071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30860 4122 2983 gene locus_tag LOCUS_30870 4122 2983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30870 >Feature sequence0598 977 666 gene locus_tag LOCUS_30880 977 666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_30880 1228 932 gene locus_tag LOCUS_30890 1228 932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30890 1363 1632 gene locus_tag LOCUS_30900 1363 1632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30900 2739 1924 gene locus_tag LOCUS_30910 2739 1924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_30910 2886 4091 gene locus_tag LOCUS_30920 2886 4091 CDS product P1 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530336.1 protein_id gnl|my_center|LOCUS_30920 >Feature sequence0599 1476 163 gene locus_tag LOCUS_30930 1476 163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30930 2188 1529 gene locus_tag LOCUS_30940 2188 1529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30940 3114 2338 gene locus_tag LOCUS_30950 3114 2338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30950 3365 3862 gene locus_tag LOCUS_30960 3365 3862 CDS product nucleoside deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008768302.1 protein_id gnl|my_center|LOCUS_30960 >Feature sequence0600 1339 422 gene locus_tag LOCUS_30970 1339 422 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066710.1 protein_id gnl|my_center|LOCUS_30970 2241 1336 gene locus_tag LOCUS_30980 2241 1336 CDS product SMP-30/gluconolactonase/LRE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970198.1 protein_id gnl|my_center|LOCUS_30980 3532 2405 gene locus_tag LOCUS_30990 3532 2405 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064253048.1 protein_id gnl|my_center|LOCUS_30990 <4309 3575 gene locus_tag LOCUS_31000 <4309 3575 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_151613522.1:ABC transporter permease >Feature sequence0601 276 1649 gene locus_tag LOCUS_31010 276 1649 CDS product arsenic transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967094.1 protein_id gnl|my_center|LOCUS_31010 1767 2126 gene locus_tag LOCUS_31020 1767 2126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31020 3114 3755 gene locus_tag LOCUS_31030 3114 3755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31030 >Feature sequence0602 696 379 gene locus_tag LOCUS_31040 696 379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31040 1112 1789 gene locus_tag LOCUS_31050 1112 1789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31050 2045 2935 gene locus_tag LOCUS_31060 2045 2935 CDS product glutamate/aspartate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004531996.1 protein_id gnl|my_center|LOCUS_31060 3135 3926 gene locus_tag LOCUS_31070 3135 3926 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210338.1 protein_id gnl|my_center|LOCUS_31070 >Feature sequence0603 955 461 gene locus_tag LOCUS_31080 955 461 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064241839.1 protein_id gnl|my_center|LOCUS_31080 1142 2755 gene locus_tag LOCUS_31090 1142 2755 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530657.1 protein_id gnl|my_center|LOCUS_31090 2790 3248 gene locus_tag LOCUS_31100 2790 3248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31100 3374 3195 gene locus_tag LOCUS_31110 3374 3195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31110 3905 3525 gene locus_tag LOCUS_31120 3905 3525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31120 >Feature sequence0604 >Feature sequence0605 787 152 gene locus_tag LOCUS_31130 787 152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31130 977 771 gene locus_tag LOCUS_31140 977 771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31140 3373 2267 gene locus_tag LOCUS_31150 3373 2267 CDS product NUP-family purine nucleoside permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265508.1 protein_id gnl|my_center|LOCUS_31150 3778 3605 gene locus_tag LOCUS_31160 3778 3605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31160 >Feature sequence0606 938 1822 gene locus_tag LOCUS_31170 938 1822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31170 2640 2759 gene locus_tag LOCUS_31180 2640 2759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31180 >Feature sequence0607 1572 55 gene locus_tag LOCUS_31190 1572 55 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31190 2333 1677 gene locus_tag LOCUS_31200 2333 1677 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876433.1 protein_id gnl|my_center|LOCUS_31200 2465 3142 gene locus_tag LOCUS_31210 2465 3142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31210 3340 4167 gene locus_tag LOCUS_31220 3340 4167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31220 >Feature sequence0608 1122 517 gene locus_tag LOCUS_31230 1122 517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31230 1561 3453 gene locus_tag LOCUS_31240 1561 3453 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810859.1 protein_id gnl|my_center|LOCUS_31240 >Feature sequence0609 831 1958 gene locus_tag LOCUS_31250 831 1958 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545557.1 protein_id gnl|my_center|LOCUS_31250 3231 2140 gene locus_tag LOCUS_31260 gene ugpC 3231 2140 CDS product sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228038.1 protein_id gnl|my_center|LOCUS_31260 <4275 3509 gene locus_tag LOCUS_31270 <4275 3509 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013532185.1:carbohydrate ABC transporter permease >Feature sequence0610 <1 2080 gene locus_tag LOCUS_31280 <1 2080 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005814910.1:NHLP family bacteriocin export ABC transporter peptidase/permease/ATPase subunit >Feature sequence0611 226 852 gene locus_tag LOCUS_31290 226 852 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084526.1 protein_id gnl|my_center|LOCUS_31290 924 2441 gene locus_tag LOCUS_31300 924 2441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31300 3071 2508 gene locus_tag LOCUS_31310 3071 2508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31310 4174 3152 gene locus_tag LOCUS_31320 4174 3152 CDS product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205421550.1 protein_id gnl|my_center|LOCUS_31320 >Feature sequence0612 655 290 gene locus_tag LOCUS_31330 655 290 CDS product DUF2237 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009455671.1 protein_id gnl|my_center|LOCUS_31330 990 2018 gene locus_tag LOCUS_31340 990 2018 CDS product winged helix DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763966.1 protein_id gnl|my_center|LOCUS_31340 2229 3464 gene locus_tag LOCUS_31350 2229 3464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31350 <4272 3488 gene locus_tag LOCUS_31360 <4272 3488 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011969874.1:LacI family DNA-binding transcriptional regulator >Feature sequence0613 <1 506 gene locus_tag LOCUS_31370 <1 506 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005812528.1:alpha/beta hydrolase 659 1210 gene locus_tag LOCUS_31380 659 1210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31380 1348 1641 gene locus_tag LOCUS_31390 1348 1641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31390 2221 1769 gene locus_tag LOCUS_31400 2221 1769 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940309.1 protein_id gnl|my_center|LOCUS_31400 >Feature sequence0614 997 464 gene locus_tag LOCUS_31410 997 464 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403417.1 protein_id gnl|my_center|LOCUS_31410 1069 1572 gene locus_tag LOCUS_31420 gene traF 1069 1572 CDS product conjugative transfer signal peptidase TraF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028002726.1 protein_id gnl|my_center|LOCUS_31420 2389 2054 gene locus_tag LOCUS_31430 2389 2054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31430 2591 2343 gene locus_tag LOCUS_31440 2591 2343 CDS product DUF4160 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933584.1 protein_id gnl|my_center|LOCUS_31440 3799 2771 gene locus_tag LOCUS_31450 3799 2771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31450 >Feature sequence0615 2976 247 gene locus_tag LOCUS_31460 gene acnA 2976 247 CDS product aconitate hydratase AcnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004187807.1 protein_id gnl|my_center|LOCUS_31460 3473 2979 gene locus_tag LOCUS_31470 3473 2979 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080908.1 protein_id gnl|my_center|LOCUS_31470 >Feature sequence0616 1682 1425 gene locus_tag LOCUS_31480 1682 1425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31480 2736 1669 gene locus_tag LOCUS_31490 gene algW 2736 1669 CDS product Do family serine endopeptidase AlgW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003377590.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_31490 3373 3092 gene locus_tag LOCUS_31500 3373 3092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31500 3643 3834 gene locus_tag LOCUS_31510 3643 3834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31510 >Feature sequence0617 1 720 gene locus_tag LOCUS_31520 1 720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31520 701 1669 gene locus_tag LOCUS_31530 gene yjfF 701 1669 CDS product sugar ABC transporter permease YjfF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061822.1 protein_id gnl|my_center|LOCUS_31530 2120 2881 gene locus_tag LOCUS_31540 2120 2881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31540 3251 4081 gene locus_tag LOCUS_31550 3251 4081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31550 >Feature sequence0618 1426 674 gene locus_tag LOCUS_31560 1426 674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014329945.1 protein_id gnl|my_center|LOCUS_31560 1538 2263 gene locus_tag LOCUS_31570 1538 2263 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531519.1 protein_id gnl|my_center|LOCUS_31570 4197 2311 gene locus_tag LOCUS_31580 4197 2311 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775788.1 protein_id gnl|my_center|LOCUS_31580 >Feature sequence0619 212 472 gene locus_tag LOCUS_31590 212 472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31590 552 1622 gene locus_tag LOCUS_31600 552 1622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31600 1813 2289 gene locus_tag LOCUS_31610 1813 2289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31610 2458 2727 gene locus_tag LOCUS_31620 gene rpsT 2458 2727 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004113577.1 protein_id gnl|my_center|LOCUS_31620 3417 3055 gene locus_tag LOCUS_31630 3417 3055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31630 <4243 3462 gene locus_tag LOCUS_31640 <4243 3462 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011123135.1:VTT domain-containing protein >Feature sequence0620 416 1393 gene locus_tag LOCUS_31650 416 1393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31650 1543 2412 gene locus_tag LOCUS_31660 1543 2412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31660 3117 2446 gene locus_tag LOCUS_31670 3117 2446 CDS product cytidylate kinase-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325942.1 protein_id gnl|my_center|LOCUS_31670 3552 4211 gene locus_tag LOCUS_31680 3552 4211 CDS product phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258121.1 protein_id gnl|my_center|LOCUS_31680 >Feature sequence0621 1698 853 gene locus_tag LOCUS_31690 gene trpA 1698 853 CDS product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943006.1 protein_id gnl|my_center|LOCUS_31690 1830 2366 gene locus_tag LOCUS_31700 1830 2366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31700 2816 2475 gene locus_tag LOCUS_31710 2816 2475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31710 3307 4188 gene locus_tag LOCUS_31720 3307 4188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31720 >Feature sequence0622 950 87 gene locus_tag LOCUS_31730 gene mtnP 950 87 CDS product S-methyl-5'-thioadenosine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868192.1 protein_id gnl|my_center|LOCUS_31730 1457 1095 gene locus_tag LOCUS_31740 1457 1095 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496878.1 protein_id gnl|my_center|LOCUS_31740 1695 3494 gene locus_tag LOCUS_31750 1695 3494 CDS product adenine deaminase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085949.1 protein_id gnl|my_center|LOCUS_31750 >Feature sequence0623 18 1052 gene locus_tag LOCUS_31760 18 1052 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026966.1 protein_id gnl|my_center|LOCUS_31760 1243 1950 gene locus_tag LOCUS_31770 1243 1950 CDS product iron-sulfur cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086463.1 protein_id gnl|my_center|LOCUS_31770 2990 2553 gene locus_tag LOCUS_31780 2990 2553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31780 3947 3750 gene locus_tag LOCUS_31790 3947 3750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31790 >Feature sequence0624 1388 258 gene locus_tag LOCUS_31800 1388 258 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704993.1 protein_id gnl|my_center|LOCUS_31800 2138 2422 gene locus_tag LOCUS_31810 2138 2422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31810 2415 2831 gene locus_tag LOCUS_31820 2415 2831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31820 3282 2893 gene locus_tag LOCUS_31830 3282 2893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31830 >Feature sequence0625 2323 1259 gene locus_tag LOCUS_31840 2323 1259 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228156.1 protein_id gnl|my_center|LOCUS_31840 3116 2370 gene locus_tag LOCUS_31850 3116 2370 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141228.1 protein_id gnl|my_center|LOCUS_31850 4072 3188 gene locus_tag LOCUS_31860 4072 3188 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532847.1 protein_id gnl|my_center|LOCUS_31860 >Feature sequence0626 2419 1436 gene locus_tag LOCUS_31870 2419 1436 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706757.1 protein_id gnl|my_center|LOCUS_31870 >Feature sequence0627 733 650 gene locus_tag LOCUS_t00200 733 650 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 1467 913 gene locus_tag LOCUS_31880 1467 913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31880 1794 2492 gene locus_tag LOCUS_31890 1794 2492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31890 2496 4082 gene locus_tag LOCUS_31900 2496 4082 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533058.1 protein_id gnl|my_center|LOCUS_31900 >Feature sequence0628 <1 586 gene locus_tag LOCUS_31910 <1 586 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011986981.1:CpsD/CapB family tyrosine-protein kinase 531 1163 gene locus_tag LOCUS_31920 531 1163 CDS product polysaccharide biosynthesis/export family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265507.1 protein_id gnl|my_center|LOCUS_31920 2127 1555 gene locus_tag LOCUS_31930 gene pgsA 2127 1555 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009889106.1 protein_id gnl|my_center|LOCUS_31930 2522 2124 gene locus_tag LOCUS_31940 2522 2124 CDS product molybdenum cofactor biosynthesis protein MoaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257742.1 protein_id gnl|my_center|LOCUS_31940 >Feature sequence0629 >Feature sequence0630 133 834 gene locus_tag LOCUS_31950 133 834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31950 1624 845 gene locus_tag LOCUS_31960 1624 845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31960 3433 1715 gene locus_tag LOCUS_31970 3433 1715 CDS product thiamine pyrophosphate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037399307.1 protein_id gnl|my_center|LOCUS_31970 >Feature sequence0631 464 1537 gene locus_tag LOCUS_31980 464 1537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31980 2140 2721 gene locus_tag LOCUS_31990 2140 2721 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083269944.1 protein_id gnl|my_center|LOCUS_31990 3081 3611 gene locus_tag LOCUS_32000 3081 3611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32000 >Feature sequence0632 845 672 gene locus_tag LOCUS_32010 845 672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32010 1062 1724 gene locus_tag LOCUS_32020 1062 1724 CDS product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015365553.1 protein_id gnl|my_center|LOCUS_32020 >Feature sequence0633 1304 210 gene locus_tag LOCUS_32030 gene murG 1304 210 CDS product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943694.1 protein_id gnl|my_center|LOCUS_32030 2501 1311 gene locus_tag LOCUS_32040 gene ftsW 2501 1311 CDS product putative lipid II flippase FtsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943695.1 protein_id gnl|my_center|LOCUS_32040 3375 2689 gene locus_tag LOCUS_32050 3375 2689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32050 <4207 3372 gene locus_tag LOCUS_32060 <4207 3372 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010939776.1:UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase >Feature sequence0634 1592 579 gene locus_tag LOCUS_32070 1592 579 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012218138.1 protein_id gnl|my_center|LOCUS_32070 2049 1699 gene locus_tag LOCUS_32080 2049 1699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32080 4026 3352 gene locus_tag LOCUS_32090 4026 3352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32090 >Feature sequence0635 <1 1080 gene locus_tag LOCUS_32100 <1 1080 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010920919.1:NADH:flavin oxidoreductase/NADH oxidase family protein 1445 2341 gene locus_tag LOCUS_32110 1445 2341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32110 2599 2787 gene locus_tag LOCUS_32120 2599 2787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32120 3295 3753 gene locus_tag LOCUS_32130 3295 3753 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531012.1 protein_id gnl|my_center|LOCUS_32130 >Feature sequence0636 1332 376 gene locus_tag LOCUS_32140 1332 376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32140 2412 1705 gene locus_tag LOCUS_32150 2412 1705 CDS product 2-phosphosulfolactate phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025773678.1 protein_id gnl|my_center|LOCUS_32150 3498 2635 gene locus_tag LOCUS_32160 3498 2635 CDS product DNA-3-methyladenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023475.1 protein_id gnl|my_center|LOCUS_32160 >Feature sequence0637 864 1568 gene locus_tag LOCUS_32170 864 1568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32170 2189 1677 gene locus_tag LOCUS_32180 2189 1677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32180 3240 2407 gene locus_tag LOCUS_32190 3240 2407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32190 3594 3424 gene locus_tag LOCUS_32200 3594 3424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32200 <4197 3563 gene locus_tag LOCUS_32210 <4197 3563 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_197535735.1:alpha/beta hydrolase >Feature sequence0638 <1 621 gene locus_tag LOCUS_32220 <1 621 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_064509340.1:phosphatidylethanolamine N-methyltransferase family protein 710 1051 gene locus_tag LOCUS_32230 710 1051 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978039.1 protein_id gnl|my_center|LOCUS_32230 1751 1104 gene locus_tag LOCUS_32240 1751 1104 CDS product MOSC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141283.1 protein_id gnl|my_center|LOCUS_32240 1976 1791 gene locus_tag LOCUS_32250 1976 1791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32250 2342 2136 gene locus_tag LOCUS_32260 2342 2136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32260 2682 2449 gene locus_tag LOCUS_32270 2682 2449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32270 3024 2791 gene locus_tag LOCUS_32280 3024 2791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32280 >Feature sequence0639 1108 257 gene locus_tag LOCUS_32290 1108 257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32290 1322 1717 gene locus_tag LOCUS_32300 1322 1717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32300 2174 1797 gene locus_tag LOCUS_32310 2174 1797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32310 2483 2199 gene locus_tag LOCUS_32320 2483 2199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32320 2581 2922 gene locus_tag LOCUS_32330 2581 2922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32330 >Feature sequence0640 1516 1662 gene locus_tag LOCUS_32340 1516 1662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32340 1754 2128 gene locus_tag LOCUS_32350 1754 2128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32350 2272 3117 gene locus_tag LOCUS_32360 2272 3117 CDS product Stf0 family sulphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005093093.1 protein_id gnl|my_center|LOCUS_32360 >Feature sequence0641 <1 1093 gene locus_tag LOCUS_32370 <1 1093 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002287619.1:beta-ketoacyl-ACP synthase II 1347 2486 gene locus_tag LOCUS_32380 1347 2486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32380 2768 3205 gene locus_tag LOCUS_32390 gene mntR 2768 3205 CDS product transcriptional regulator MntR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003236923.1 protein_id gnl|my_center|LOCUS_32390 3548 4012 gene locus_tag LOCUS_32400 3548 4012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32400 >Feature sequence0642 692 1420 gene locus_tag LOCUS_32410 692 1420 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766298.1 protein_id gnl|my_center|LOCUS_32410 1555 1473 gene locus_tag LOCUS_t00210 1555 1473 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence0643 1371 340 gene locus_tag LOCUS_32420 gene tdh 1371 340 CDS product L-threonine 3-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194543.1 protein_id gnl|my_center|LOCUS_32420 1965 2459 gene locus_tag LOCUS_32430 1965 2459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32430 >Feature sequence0644 <1 755 gene locus_tag LOCUS_32440 <1 755 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943186.1:DNA-processing protein DprA 839 3307 gene locus_tag LOCUS_32450 839 3307 CDS product DNA topoisomerase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004200734.1 protein_id gnl|my_center|LOCUS_32450 <4173 3304 gene locus_tag LOCUS_32460 <4173 3304 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010930171.1:polyphosphate kinase 1 >Feature sequence0645 1466 450 gene locus_tag LOCUS_32470 gene fabK 1466 450 CDS product enoyl-[acyl-carrier-protein] reductase FabK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080864.1 protein_id gnl|my_center|LOCUS_32470 1585 2016 gene locus_tag LOCUS_32480 1585 2016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32480 2534 2758 gene locus_tag LOCUS_32490 2534 2758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32490 3425 3745 gene locus_tag LOCUS_32500 3425 3745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32500 3778 4095 gene locus_tag LOCUS_32510 3778 4095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_32510 >Feature sequence0646 255 986 gene locus_tag LOCUS_32520 gene gmk 255 986 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070724.1 protein_id gnl|my_center|LOCUS_32520 3172 1121 gene locus_tag LOCUS_32530 3172 1121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32530 >Feature sequence0647 272 1408 gene locus_tag LOCUS_32540 272 1408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32540 2074 2409 gene locus_tag LOCUS_32550 2074 2409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32550 <4161 2366 gene locus_tag LOCUS_32560 <4161 2366 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011038432.1:ligand-binding sensor domain-containing diguanylate cyclase >Feature sequence0648 781 50 gene locus_tag LOCUS_32570 781 50 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962306.1 protein_id gnl|my_center|LOCUS_32570 2610 778 gene locus_tag LOCUS_32580 2610 778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32580 4160 2640 gene locus_tag LOCUS_32590 4160 2640 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922174.1 protein_id gnl|my_center|LOCUS_32590 >Feature sequence0649 402 1682 gene locus_tag LOCUS_32600 402 1682 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803780.1 protein_id gnl|my_center|LOCUS_32600 1882 2784 gene locus_tag LOCUS_32610 1882 2784 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803782.1 protein_id gnl|my_center|LOCUS_32610 3079 3834 gene locus_tag LOCUS_32620 3079 3834 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803781.1 protein_id gnl|my_center|LOCUS_32620 >Feature sequence0650 <4142 3305 gene locus_tag LOCUS_32630 <4142 3305 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015703911.1:alpha/beta hydrolase-fold protein >Feature sequence0651 782 1744 gene locus_tag LOCUS_32640 782 1744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32640 1959 2426 gene locus_tag LOCUS_32650 1959 2426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32650 >Feature sequence0652 1377 2621 gene locus_tag LOCUS_32660 1377 2621 CDS product HupE/UreJ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142975.1 protein_id gnl|my_center|LOCUS_32660 <4124 2923 gene locus_tag LOCUS_32670 <4124 2923 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010920205.1:NCS1 family nucleobase:cation symporter-1 >Feature sequence0653 2470 956 gene locus_tag LOCUS_32680 2470 956 CDS product DegQ family serine endoprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545685.1 protein_id gnl|my_center|LOCUS_32680 <4123 2920 gene locus_tag LOCUS_32690 <4123 2920 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012545685.1:DegQ family serine endoprotease >Feature sequence0654 1781 1329 gene locus_tag LOCUS_32700 1781 1329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32700 2289 2627 gene locus_tag LOCUS_32710 2289 2627 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056439.1 protein_id gnl|my_center|LOCUS_32710 2957 3850 gene locus_tag LOCUS_32720 2957 3850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32720 >Feature sequence0655 1009 2655 gene locus_tag LOCUS_32730 1009 2655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32730 2936 3817 gene locus_tag LOCUS_32740 2936 3817 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064244087.1 protein_id gnl|my_center|LOCUS_32740 >Feature sequence0656 633 406 gene locus_tag LOCUS_32750 633 406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32750 3151 2330 gene locus_tag LOCUS_32760 3151 2330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32760 >Feature sequence0657 909 760 gene locus_tag LOCUS_32770 909 760 CDS product DUF5989 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976110.1 protein_id gnl|my_center|LOCUS_32770 1257 925 gene locus_tag LOCUS_32780 1257 925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32780 2301 1840 gene locus_tag LOCUS_32790 2301 1840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32790 2457 2335 gene locus_tag LOCUS_32800 2457 2335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32800 2526 4016 gene locus_tag LOCUS_32810 2526 4016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32810 >Feature sequence0658 1217 1038 gene locus_tag LOCUS_32820 1217 1038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32820 1533 2330 gene locus_tag LOCUS_32830 1533 2330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32830 2462 2707 gene locus_tag LOCUS_32840 2462 2707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32840 3147 3437 gene locus_tag LOCUS_32850 3147 3437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32850 3415 3840 gene locus_tag LOCUS_32860 3415 3840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32860 >Feature sequence0659 618 448 gene locus_tag LOCUS_32870 618 448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32870 1830 1585 gene locus_tag LOCUS_32880 1830 1585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32880 2425 1916 gene locus_tag LOCUS_32890 2425 1916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32890 2667 2422 gene locus_tag LOCUS_32900 2667 2422 CDS product type II toxin-antitoxin system HicA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813812.1 protein_id gnl|my_center|LOCUS_32900 3362 4039 gene locus_tag LOCUS_32910 3362 4039 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969876.1 protein_id gnl|my_center|LOCUS_32910 >Feature sequence0660 1501 1971 gene locus_tag LOCUS_32920 1501 1971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32920 2585 2427 gene locus_tag LOCUS_32930 2585 2427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32930 2718 3113 gene locus_tag LOCUS_32940 2718 3113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32940 3308 3673 gene locus_tag LOCUS_32950 3308 3673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32950 >Feature sequence0661 410 847 gene locus_tag LOCUS_32960 410 847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32960 898 1665 gene locus_tag LOCUS_32970 898 1665 CDS product isocitrate lyase/phosphoenolpyruvate mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919769.1 protein_id gnl|my_center|LOCUS_32970 2056 1886 gene locus_tag LOCUS_32980 2056 1886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32980 2437 2240 gene locus_tag LOCUS_32990 2437 2240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32990 2436 2936 gene locus_tag LOCUS_33000 2436 2936 CDS product DUF2147 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001043223.1 protein_id gnl|my_center|LOCUS_33000 <4082 3279 gene locus_tag LOCUS_33010 <4082 3279 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011141082.1:CHAD domain-containing protein >Feature sequence0662 3297 2020 gene locus_tag LOCUS_33020 3297 2020 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941985.1 protein_id gnl|my_center|LOCUS_33020 >Feature sequence0663 >Feature sequence0664 2910 1696 gene locus_tag LOCUS_33030 2910 1696 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193486.1 protein_id gnl|my_center|LOCUS_33030 <4075 3014 gene locus_tag LOCUS_33040 <4075 3014 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010888457.1:protein translocase subunit SecD >Feature sequence0665 <1 1104 gene locus_tag LOCUS_33050 <1 1104 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_066565680.1:Pup--protein ligase 1159 1638 gene locus_tag LOCUS_33060 1159 1638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33060 1778 3253 gene locus_tag LOCUS_33070 1778 3253 CDS product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808616.1 protein_id gnl|my_center|LOCUS_33070 3394 3996 gene locus_tag LOCUS_33080 gene pncA 3394 3996 CDS product bifunctional nicotinamidase/pyrazinamidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000030361.1 protein_id gnl|my_center|LOCUS_33080 >Feature sequence0666 225 1451 gene locus_tag LOCUS_33090 225 1451 CDS product FAD/NAD(P)-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206388.1 protein_id gnl|my_center|LOCUS_33090 1448 2359 gene locus_tag LOCUS_33100 1448 2359 CDS product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037553.1 protein_id gnl|my_center|LOCUS_33100 2684 2757 gene locus_tag LOCUS_t00220 2684 2757 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 3632 3066 gene locus_tag LOCUS_33110 3632 3066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33110 >Feature sequence0667 931 119 gene locus_tag LOCUS_33120 931 119 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031344.1 protein_id gnl|my_center|LOCUS_33120 1730 2758 gene locus_tag LOCUS_33130 1730 2758 CDS product aldehyde reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088575.1 protein_id gnl|my_center|LOCUS_33130 3378 2755 gene locus_tag LOCUS_33140 3378 2755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33140 >Feature sequence0668 679 1359 gene locus_tag LOCUS_33150 679 1359 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928484.1 protein_id gnl|my_center|LOCUS_33150 2063 1500 gene locus_tag LOCUS_33160 2063 1500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33160 <4059 2294 gene locus_tag LOCUS_33170 <4059 2294 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011022493.1:PQQ-binding-like beta-propeller repeat protein >Feature sequence0669 239 826 gene locus_tag LOCUS_33180 239 826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33180 1804 953 gene locus_tag LOCUS_33190 1804 953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33190 3171 1867 gene locus_tag LOCUS_33200 3171 1867 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776279.1 protein_id gnl|my_center|LOCUS_33200 3466 3326 gene locus_tag LOCUS_33210 3466 3326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33210 3630 3481 gene locus_tag LOCUS_33220 3630 3481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33220 >Feature sequence0670 1478 2527 gene locus_tag LOCUS_33230 1478 2527 CDS product NUP-family purine nucleoside permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265508.1 protein_id gnl|my_center|LOCUS_33230 2733 3737 gene locus_tag LOCUS_33240 2733 3737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33240 >Feature sequence0671 1840 215 gene locus_tag LOCUS_33250 1840 215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_33250 2889 1774 gene locus_tag LOCUS_33260 2889 1774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_33260 <4036 3007 gene locus_tag LOCUS_33270 <4036 3007 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005812939.1:recombinase RecA >Feature sequence0672 948 688 gene locus_tag LOCUS_33280 948 688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33280 2572 1490 gene locus_tag LOCUS_33290 2572 1490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_33290 3306 2569 gene locus_tag LOCUS_33300 3306 2569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_33300 <4033 3455 gene locus_tag LOCUS_33310 <4033 3455 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011268142.1:glycogen debranching protein GlgX >Feature sequence0673 391 113 gene locus_tag LOCUS_33320 gene yggU 391 113 CDS product DUF167 family protein YggU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005417561.1 protein_id gnl|my_center|LOCUS_33320 432 1526 gene locus_tag LOCUS_33330 432 1526 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975888.1 protein_id gnl|my_center|LOCUS_33330 1802 2644 gene locus_tag LOCUS_33340 1802 2644 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143083.1 protein_id gnl|my_center|LOCUS_33340 <4025 2800 gene locus_tag LOCUS_33350 <4025 2800 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010944006.1:L-glutamate gamma-semialdehyde dehydrogenase >Feature sequence0674 1034 528 gene locus_tag LOCUS_33360 1034 528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33360 1298 1708 gene locus_tag LOCUS_33370 1298 1708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33370 1798 2169 gene locus_tag LOCUS_33380 1798 2169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33380 2187 2417 gene locus_tag LOCUS_33390 2187 2417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33390 2670 2452 gene locus_tag LOCUS_33400 2670 2452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33400 3469 2864 gene locus_tag LOCUS_33410 3469 2864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33410 3913 3563 gene locus_tag LOCUS_33420 3913 3563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33420 >Feature sequence0675 <1 860 gene locus_tag LOCUS_33430 <1 860 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010882963.1:30S ribosomal protein S1 1017 1355 gene locus_tag LOCUS_33440 1017 1355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33440 2608 1721 gene locus_tag LOCUS_33450 2608 1721 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880152.1 protein_id gnl|my_center|LOCUS_33450 3776 2691 gene locus_tag LOCUS_33460 3776 2691 CDS product lysylphosphatidylglycerol synthase transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926844.1 protein_id gnl|my_center|LOCUS_33460 >Feature sequence0676 688 530 gene locus_tag LOCUS_33470 688 530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33470 1243 1560 gene locus_tag LOCUS_33480 1243 1560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33480 1935 3149 gene locus_tag LOCUS_33490 1935 3149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33490 >Feature sequence0677 3318 1063 gene locus_tag LOCUS_33500 3318 1063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33500 >Feature sequence0678 <1 824 gene locus_tag LOCUS_33510 <1 824 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942985.1:potassium transporter Kup 1297 1707 gene locus_tag LOCUS_33520 1297 1707 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006311406.1 protein_id gnl|my_center|LOCUS_33520 1943 2464 gene locus_tag LOCUS_33530 1943 2464 CDS product DUF417 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_077743720.1 protein_id gnl|my_center|LOCUS_33530 2490 2963 gene locus_tag LOCUS_33540 2490 2963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33540 3059 3640 gene locus_tag LOCUS_33550 3059 3640 CDS product DUF417 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111736.1 protein_id gnl|my_center|LOCUS_33550 >Feature sequence0679 <1 645 gene locus_tag LOCUS_33560 <1 645 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012803699.1:Gfo/Idh/MocA family oxidoreductase 1231 686 gene locus_tag LOCUS_33570 1231 686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33570 1285 1824 gene locus_tag LOCUS_33580 1285 1824 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403005.1 protein_id gnl|my_center|LOCUS_33580 2405 1872 gene locus_tag LOCUS_33590 2405 1872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33590 3947 2607 gene locus_tag LOCUS_33600 3947 2607 CDS product efflux transporter outer membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087094.1 protein_id gnl|my_center|LOCUS_33600 >Feature sequence0680 2385 2897 gene locus_tag LOCUS_33610 2385 2897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33610 3923 3138 gene locus_tag LOCUS_33620 3923 3138 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530716.1 protein_id gnl|my_center|LOCUS_33620 >Feature sequence0681 8 559 gene locus_tag LOCUS_33630 8 559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33630 687 1505 gene locus_tag LOCUS_33640 687 1505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33640 1859 2947 gene locus_tag LOCUS_33650 1859 2947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33650 >Feature sequence0682 <1 607 gene locus_tag LOCUS_33660 <1 607 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257845.1:NADH-quinone oxidoreductase subunit N 1170 1388 gene locus_tag LOCUS_33670 1170 1388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33670 1619 1425 gene locus_tag LOCUS_33680 1619 1425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33680 1871 3064 gene locus_tag LOCUS_33690 1871 3064 CDS product hydrogenase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460190.1 protein_id gnl|my_center|LOCUS_33690 >Feature sequence0683 747 34 gene locus_tag LOCUS_33700 747 34 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066671.1 protein_id gnl|my_center|LOCUS_33700 953 1957 gene locus_tag LOCUS_33710 953 1957 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088659.1 protein_id gnl|my_center|LOCUS_33710 2839 2210 gene locus_tag LOCUS_33720 2839 2210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33720 3011 3709 gene locus_tag LOCUS_33730 3011 3709 CDS product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392145.1 protein_id gnl|my_center|LOCUS_33730 >Feature sequence0684 <1 2042 gene locus_tag LOCUS_33740 <1 2042 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_151611289.1:xanthine dehydrogenase family protein molybdopterin-binding subunit 2492 2965 gene locus_tag LOCUS_33750 2492 2965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33750 3891 3058 gene locus_tag LOCUS_33760 3891 3058 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193469.1 protein_id gnl|my_center|LOCUS_33760 >Feature sequence0685 3413 3910 gene locus_tag LOCUS_33770 3413 3910 CDS product tail fiber protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528765.1 protein_id gnl|my_center|LOCUS_33770 >Feature sequence0686 <1 830 gene locus_tag LOCUS_33780 <1 830 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011141201.1:ABC transporter permease 1316 2020 gene locus_tag LOCUS_33790 1316 2020 CDS product Type 1 glutamine amidotransferase-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245002.1 protein_id gnl|my_center|LOCUS_33790 >Feature sequence0687 594 1766 gene locus_tag LOCUS_33800 594 1766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33800 2775 3188 gene locus_tag LOCUS_33810 2775 3188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33810 >Feature sequence0688 551 1438 gene locus_tag LOCUS_33820 gene miaA 551 1438 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942643.1 protein_id gnl|my_center|LOCUS_33820 2204 1512 gene locus_tag LOCUS_33830 2204 1512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33830 3383 2838 gene locus_tag LOCUS_33840 gene sufT 3383 2838 CDS product putative Fe-S cluster assembly protein SufT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770997.1 protein_id gnl|my_center|LOCUS_33840 3859 3380 gene locus_tag LOCUS_33850 3859 3380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33850 >Feature sequence0689 3123 3482 gene locus_tag LOCUS_33860 3123 3482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33860 >Feature sequence0690 567 424 gene locus_tag LOCUS_33870 567 424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33870 829 626 gene locus_tag LOCUS_33880 829 626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33880 1251 1721 gene locus_tag LOCUS_33890 1251 1721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33890 2101 3129 gene locus_tag LOCUS_33900 2101 3129 CDS product nitronate monooxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087851.1 protein_id gnl|my_center|LOCUS_33900 >Feature sequence0691 2029 158 gene locus_tag LOCUS_33910 2029 158 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140102.1 protein_id gnl|my_center|LOCUS_33910 3005 2112 gene locus_tag LOCUS_33920 3005 2112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33920 <3952 3174 gene locus_tag LOCUS_33930 <3952 3174 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_038744192.1:alkaline phosphatase family protein >Feature sequence0692 1286 1134 gene locus_tag LOCUS_33940 1286 1134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33940 1457 2368 gene locus_tag LOCUS_33950 1457 2368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33950 <3952 2384 gene locus_tag LOCUS_33960 <3952 2384 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164920852.1:ABC transporter ATP-binding protein/permease >Feature sequence0693 355 128 gene locus_tag LOCUS_33970 355 128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33970 876 436 gene locus_tag LOCUS_33980 876 436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33980 1193 1771 gene locus_tag LOCUS_33990 1193 1771 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087829.1 protein_id gnl|my_center|LOCUS_33990 2305 2517 gene locus_tag LOCUS_34000 2305 2517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34000 2915 2583 gene locus_tag LOCUS_34010 2915 2583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34010 2962 3351 gene locus_tag LOCUS_34020 2962 3351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34020 3679 3344 gene locus_tag LOCUS_34030 3679 3344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34030 >Feature sequence0694 335 820 gene locus_tag LOCUS_34040 335 820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34040 1353 1997 gene locus_tag LOCUS_34050 1353 1997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34050 >Feature sequence0695 1137 397 gene locus_tag LOCUS_34060 1137 397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34060 1382 2647 gene locus_tag LOCUS_34070 1382 2647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34070 >Feature sequence0696 543 2492 gene locus_tag LOCUS_34080 gene acs 543 2492 CDS product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228545.1 protein_id gnl|my_center|LOCUS_34080 2558 3862 gene locus_tag LOCUS_34090 gene aceA 2558 3862 CDS product isocitrate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259719.1 protein_id gnl|my_center|LOCUS_34090 >Feature sequence0697 1642 1223 gene locus_tag LOCUS_34100 1642 1223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34100 2292 3311 gene locus_tag LOCUS_34110 gene prfB 2292 3311 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_096948712.1 protein_id gnl|my_center|LOCUS_34110 >Feature sequence0698 569 1165 gene locus_tag LOCUS_34120 569 1165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34120 1580 1711 gene locus_tag LOCUS_34130 1580 1711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34130 1875 2462 gene locus_tag LOCUS_34140 1875 2462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34140 2885 2493 gene locus_tag LOCUS_34150 2885 2493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34150 3310 2942 gene locus_tag LOCUS_34160 3310 2942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34160 3335 3484 gene locus_tag LOCUS_34170 3335 3484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34170 >Feature sequence0699 1044 475 gene locus_tag LOCUS_34180 1044 475 CDS product putative glycolipid-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529457.1 protein_id gnl|my_center|LOCUS_34180 1322 2113 gene locus_tag LOCUS_34190 1322 2113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34190 <3942 2428 gene locus_tag LOCUS_34200 <3942 2428 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004080133.1:beta-galactosidase >Feature sequence0700 701 417 gene locus_tag LOCUS_34210 701 417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34210 2220 1375 gene locus_tag LOCUS_34220 2220 1375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34220 2819 2247 gene locus_tag LOCUS_34230 2819 2247 CDS product YceI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000749269.1 protein_id gnl|my_center|LOCUS_34230 3107 3583 gene locus_tag LOCUS_34240 3107 3583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34240 >Feature sequence0701 1117 290 gene locus_tag LOCUS_34250 1117 290 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122036.1 protein_id gnl|my_center|LOCUS_34250 1449 1228 gene locus_tag LOCUS_34260 1449 1228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34260 1700 2422 gene locus_tag LOCUS_34270 1700 2422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34270 2942 2700 gene locus_tag LOCUS_34280 2942 2700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34280 <3927 3053 gene locus_tag LOCUS_34290 <3927 3053 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_208974886.1:thiol reductant ABC exporter subunit CydC >Feature sequence0702 2333 963 gene locus_tag LOCUS_34300 2333 963 CDS product cytochrome ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722078.1 protein_id gnl|my_center|LOCUS_34300 2973 2482 gene locus_tag LOCUS_34310 2973 2482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34310 3491 3006 gene locus_tag LOCUS_34320 3491 3006 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228279.1 protein_id gnl|my_center|LOCUS_34320 >Feature sequence0703 1576 305 gene locus_tag LOCUS_34330 1576 305 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392573.1 protein_id gnl|my_center|LOCUS_34330 2278 1622 gene locus_tag LOCUS_34340 gene ispD 2278 1622 CDS product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393964.1 protein_id gnl|my_center|LOCUS_34340 3075 2623 gene locus_tag LOCUS_34350 3075 2623 CDS product GatB/YqeY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939079.1 protein_id gnl|my_center|LOCUS_34350 >Feature sequence0704 966 1550 gene locus_tag LOCUS_34360 966 1550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34360 3573 2788 gene locus_tag LOCUS_34370 3573 2788 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522439.1 protein_id gnl|my_center|LOCUS_34370 >Feature sequence0705 176 2011 gene locus_tag LOCUS_34380 gene cydD 176 2011 CDS product thiol reductant ABC exporter subunit CydD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393587.1 protein_id gnl|my_center|LOCUS_34380 2008 3681 gene locus_tag LOCUS_34390 gene cydC 2008 3681 CDS product thiol reductant ABC exporter subunit CydC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461539.1 protein_id gnl|my_center|LOCUS_34390 >Feature sequence0706 <1 1949 gene locus_tag LOCUS_34400 <1 1949 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010920498.1:oligopeptide transporter, OPT family 2205 2909 gene locus_tag LOCUS_34410 2205 2909 CDS product DUF72 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546323.1 protein_id gnl|my_center|LOCUS_34410 3755 3228 gene locus_tag LOCUS_34420 3755 3228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34420 >Feature sequence0707 <1 834 gene locus_tag LOCUS_34430 <1 834 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_038966893.1:NADP-dependent oxidoreductase 1704 877 gene locus_tag LOCUS_34440 1704 877 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064636.1 protein_id gnl|my_center|LOCUS_34440 1902 3080 gene locus_tag LOCUS_34450 1902 3080 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192717.1 protein_id gnl|my_center|LOCUS_34450 >Feature sequence0708 177 1937 gene locus_tag LOCUS_34460 177 1937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34460 2891 2244 gene locus_tag LOCUS_34470 gene ubiE 2891 2244 CDS product bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228961.1 protein_id gnl|my_center|LOCUS_34470 3207 3126 gene locus_tag LOCUS_t00230 3207 3126 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence0709 441 1331 gene locus_tag LOCUS_34480 441 1331 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528056.1 protein_id gnl|my_center|LOCUS_34480 2556 1837 gene locus_tag LOCUS_34490 2556 1837 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403448.1 protein_id gnl|my_center|LOCUS_34490 <3903 2823 gene locus_tag LOCUS_34500 <3903 2823 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011119546.1:four-carbon acid sugar kinase family protein >Feature sequence0710 535 1293 gene locus_tag LOCUS_34510 535 1293 CDS product class II aldolase/adducin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582812.1 protein_id gnl|my_center|LOCUS_34510 2533 1556 gene locus_tag LOCUS_34520 2533 1556 CDS product carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083014.1 protein_id gnl|my_center|LOCUS_34520 3340 2657 gene locus_tag LOCUS_34530 3340 2657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34530 >Feature sequence0711 591 2468 gene locus_tag LOCUS_34540 591 2468 CDS product DUF2341 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112717.1 protein_id gnl|my_center|LOCUS_34540 2667 3071 gene locus_tag LOCUS_34550 2667 3071 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085366.1 protein_id gnl|my_center|LOCUS_34550 3171 3887 gene locus_tag LOCUS_34560 3171 3887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34560 >Feature sequence0712 556 486 gene locus_tag LOCUS_t00240 556 486 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 1004 3148 gene locus_tag LOCUS_34570 gene rnr 1004 3148 CDS product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228386.1 protein_id gnl|my_center|LOCUS_34570 3233 3508 gene locus_tag LOCUS_34580 3233 3508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34580 >Feature sequence0713 1538 903 gene locus_tag LOCUS_34590 1538 903 CDS product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977382.1 protein_id gnl|my_center|LOCUS_34590 1835 2773 gene locus_tag LOCUS_34600 gene trxB 1835 2773 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932523.1 protein_id gnl|my_center|LOCUS_34600 >Feature sequence0714 734 303 gene locus_tag LOCUS_34610 734 303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_34610 1480 758 gene locus_tag LOCUS_34620 1480 758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34620 2503 1535 gene locus_tag LOCUS_34630 2503 1535 CDS product alpha-ketoacid dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258974.1 protein_id gnl|my_center|LOCUS_34630 3534 2500 gene locus_tag LOCUS_34640 3534 2500 CDS product thiamine pyrophosphate-dependent dehydrogenase E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258973.1 protein_id gnl|my_center|LOCUS_34640 >Feature sequence0715 2079 13 gene locus_tag LOCUS_34650 2079 13 CDS product beta-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000575935.1 protein_id gnl|my_center|LOCUS_34650 3117 2302 gene locus_tag LOCUS_34660 3117 2302 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031642.1 protein_id gnl|my_center|LOCUS_34660 3116 3358 gene locus_tag LOCUS_34670 3116 3358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34670 <3899 3268 gene locus_tag LOCUS_34680 <3899 3268 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013225935.1:sugar ABC transporter permease >Feature sequence0716 <1 1125 gene locus_tag LOCUS_34690 <1 1125 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011015826.1:tetratricopeptide repeat protein 1372 2250 gene locus_tag LOCUS_34700 1372 2250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34700 2957 2721 gene locus_tag LOCUS_34710 2957 2721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34710 <3897 3084 gene locus_tag LOCUS_34720 <3897 3084 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010919291.1:adenylate/guanylate cyclase domain-containing protein >Feature sequence0717 589 164 gene locus_tag LOCUS_34730 589 164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34730 3294 937 gene locus_tag LOCUS_34740 3294 937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34740 3803 3333 gene locus_tag LOCUS_34750 3803 3333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34750 >Feature sequence0718 1219 311 gene locus_tag LOCUS_34760 1219 311 CDS product NADP-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020817.1 protein_id gnl|my_center|LOCUS_34760 1418 1263 gene locus_tag LOCUS_34770 1418 1263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34770 1506 2402 gene locus_tag LOCUS_34780 1506 2402 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978781.1 protein_id gnl|my_center|LOCUS_34780 3401 2637 gene locus_tag LOCUS_34790 3401 2637 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966801.1 protein_id gnl|my_center|LOCUS_34790 >Feature sequence0719 >Feature sequence0720 166 294 gene locus_tag LOCUS_34800 166 294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34800 291 635 gene locus_tag LOCUS_34810 291 635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34810 1996 1082 gene locus_tag LOCUS_34820 1996 1082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34820 3230 1962 gene locus_tag LOCUS_34830 3230 1962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34830 3693 3475 gene locus_tag LOCUS_34840 3693 3475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34840 >Feature sequence0721 2013 1594 gene locus_tag LOCUS_34850 2013 1594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34850 3073 2150 gene locus_tag LOCUS_34860 3073 2150 CDS product hydroxymethylglutaryl-CoA lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522997.1 protein_id gnl|my_center|LOCUS_34860 <3872 3338 gene locus_tag LOCUS_34870 <3872 3338 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004555739.1:acetyl/propionyl/methylcrotonyl-CoA carboxylase subunit alpha >Feature sequence0722 292 516 gene locus_tag LOCUS_34880 292 516 CDS product addiction module protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932270.1 protein_id gnl|my_center|LOCUS_34880 513 827 gene locus_tag LOCUS_34890 513 827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34890 785 1216 gene locus_tag LOCUS_34900 785 1216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34900 1778 3097 gene locus_tag LOCUS_34910 1778 3097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34910 3250 3555 gene locus_tag LOCUS_34920 3250 3555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34920 >Feature sequence0723 1052 114 gene locus_tag LOCUS_34930 1052 114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34930 2036 1068 gene locus_tag LOCUS_34940 2036 1068 CDS product hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970705.1 protein_id gnl|my_center|LOCUS_34940 2203 3012 gene locus_tag LOCUS_34950 2203 3012 CDS product aldolase/citrate lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027133324.1 protein_id gnl|my_center|LOCUS_34950 3374 3754 gene locus_tag LOCUS_34960 3374 3754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34960 >Feature sequence0724 2023 839 gene locus_tag LOCUS_34970 2023 839 CDS product HlyD family secretion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931799.1 protein_id gnl|my_center|LOCUS_34970 2733 2047 gene locus_tag LOCUS_34980 2733 2047 CDS product CerR family C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937368.1 protein_id gnl|my_center|LOCUS_34980 3204 2848 gene locus_tag LOCUS_34990 3204 2848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34990 >Feature sequence0725 155 1249 gene locus_tag LOCUS_35000 155 1249 CDS product glycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004554710.1 protein_id gnl|my_center|LOCUS_35000 1779 2801 gene locus_tag LOCUS_35010 gene dinB 1779 2801 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946300.1 protein_id gnl|my_center|LOCUS_35010 >Feature sequence0726 481 2277 gene locus_tag LOCUS_35020 481 2277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35020 >Feature sequence0727 326 1702 gene locus_tag LOCUS_35030 326 1702 CDS product phospholipase C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900400.1 protein_id gnl|my_center|LOCUS_35030 2659 2117 gene locus_tag LOCUS_35040 2659 2117 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005094783.1 protein_id gnl|my_center|LOCUS_35040 3436 2873 gene locus_tag LOCUS_35050 3436 2873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35050 >Feature sequence0728 2855 1647 gene locus_tag LOCUS_35060 2855 1647 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084682.1 protein_id gnl|my_center|LOCUS_35060 <3854 2893 gene locus_tag LOCUS_35070 <3854 2893 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_038965460.1:CoA transferase >Feature sequence0729 308 829 gene locus_tag LOCUS_35080 308 829 CDS product O-acetyl-ADP-ribose deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941194.1 protein_id gnl|my_center|LOCUS_35080 1208 1134 gene locus_tag LOCUS_t00250 1208 1134 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 2116 1361 gene locus_tag LOCUS_35090 2116 1361 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532870.1 protein_id gnl|my_center|LOCUS_35090 3338 2412 gene locus_tag LOCUS_35100 3338 2412 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532869.1 protein_id gnl|my_center|LOCUS_35100 >Feature sequence0730 1826 750 gene locus_tag LOCUS_35110 gene pheA 1826 750 CDS product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943245.1 protein_id gnl|my_center|LOCUS_35110 2611 1829 gene locus_tag LOCUS_35120 2611 1829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35120 3704 2973 gene locus_tag LOCUS_35130 3704 2973 CDS product segregation/condensation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942476.1 protein_id gnl|my_center|LOCUS_35130 >Feature sequence0731 2522 612 gene locus_tag LOCUS_35140 2522 612 CDS product fumarate reductase/succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257750.1 protein_id gnl|my_center|LOCUS_35140 3304 2525 gene locus_tag LOCUS_35150 3304 2525 CDS product succinate dehydrogenase cytochrome b subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225081.1 protein_id gnl|my_center|LOCUS_35150 <3844 3317 gene locus_tag LOCUS_35160 <3844 3317 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010907650.1:class II fructose-bisphosphate aldolase >Feature sequence0732 1688 351 gene locus_tag LOCUS_35170 1688 351 CDS product S1C family serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000125226.1 protein_id gnl|my_center|LOCUS_35170 1817 1692 gene locus_tag LOCUS_35180 1817 1692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35180 3434 2205 gene locus_tag LOCUS_35190 gene fabF 3434 2205 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438103.1 protein_id gnl|my_center|LOCUS_35190 >Feature sequence0733 1496 192 gene locus_tag LOCUS_35200 1496 192 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085208.1 protein_id gnl|my_center|LOCUS_35200 1994 2893 gene locus_tag LOCUS_35210 1994 2893 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143349.1 protein_id gnl|my_center|LOCUS_35210 <3837 3221 gene locus_tag LOCUS_35220 <3837 3221 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010905460.1:MDR family MFS transporter >Feature sequence0734 486 1532 gene locus_tag LOCUS_35230 486 1532 CDS product HoxN/HupN/NixA family nickel/cobalt transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004266608.1 protein_id gnl|my_center|LOCUS_35230 3349 2207 gene locus_tag LOCUS_35240 gene hypE 3349 2207 CDS product hydrogenase expression/formation protein HypE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933452.1 protein_id gnl|my_center|LOCUS_35240 >Feature sequence0735 420 1133 gene locus_tag LOCUS_35250 420 1133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35250 2030 1941 gene locus_tag LOCUS_t00260 2030 1941 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 2938 2399 gene locus_tag LOCUS_35260 2938 2399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35260 >Feature sequence0736 <1 1736 gene locus_tag LOCUS_35270 <1 1736 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012545409.1:molecular chaperone DnaK 1840 2133 gene locus_tag LOCUS_35280 gene groES 1840 2133 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583322.1 protein_id gnl|my_center|LOCUS_35280 2168 3802 gene locus_tag LOCUS_35290 gene groL 2168 3802 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943952.1 protein_id gnl|my_center|LOCUS_35290 >Feature sequence0737 1672 410 gene locus_tag LOCUS_35300 1672 410 CDS product glutamate-5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114089.1 protein_id gnl|my_center|LOCUS_35300 2782 2021 gene locus_tag LOCUS_35310 2782 2021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35310 >Feature sequence0738 <1 705 gene locus_tag LOCUS_35320 <1 705 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000047473.1:LPS export ABC transporter ATP-binding protein 856 1485 gene locus_tag LOCUS_35330 gene raiA 856 1485 CDS product ribosome-associated translation inhibitor RaiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003360537.1 protein_id gnl|my_center|LOCUS_35330 1722 2678 gene locus_tag LOCUS_35340 gene hprK 1722 2678 CDS product HPr(Ser) kinase/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228097.1 protein_id gnl|my_center|LOCUS_35340 2679 2978 gene locus_tag LOCUS_35350 2679 2978 CDS product HPr family phosphocarrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090869.1 protein_id gnl|my_center|LOCUS_35350 >Feature sequence0739 1807 1418 gene locus_tag LOCUS_35360 1807 1418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35360 2525 2779 gene locus_tag LOCUS_35370 2525 2779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35370 2783 3385 gene locus_tag LOCUS_35380 2783 3385 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011166893.1 protein_id gnl|my_center|LOCUS_35380 >Feature sequence0740 <1 648 gene locus_tag LOCUS_35390 <1 648 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003106429.1:protease modulator HflC 1242 838 gene locus_tag LOCUS_35400 1242 838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35400 1761 3017 gene locus_tag LOCUS_35410 1761 3017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35410 <3819 3219 gene locus_tag LOCUS_35420 <3819 3219 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001226275.1:Maf family protein >Feature sequence0741 <1 638 gene locus_tag LOCUS_35430 <1 638 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_009887810.1:thiamine pyrophosphate-dependent dehydrogenase E1 component subunit alpha 984 1997 gene locus_tag LOCUS_35440 984 1997 CDS product alpha-ketoacid dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056059.1 protein_id gnl|my_center|LOCUS_35440 3128 1992 gene locus_tag LOCUS_35450 3128 1992 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769287.1 protein_id gnl|my_center|LOCUS_35450 3340 3714 gene locus_tag LOCUS_35460 3340 3714 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088312.1 protein_id gnl|my_center|LOCUS_35460 >Feature sequence0742 <1 1358 gene locus_tag LOCUS_35470 <1 1358 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004528841.1:S53 family peptidase 1519 3594 gene locus_tag LOCUS_35480 1519 3594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35480 >Feature sequence0743 <1 978 gene locus_tag LOCUS_35490 <1 978 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_037393085.1:amidohydrolase family protein 1358 3022 gene locus_tag LOCUS_35500 1358 3022 CDS product fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940904.1 protein_id gnl|my_center|LOCUS_35500 >Feature sequence0744 1509 397 gene locus_tag LOCUS_35510 gene mraY 1509 397 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383222.1 protein_id gnl|my_center|LOCUS_35510 2894 1506 gene locus_tag LOCUS_35520 2894 1506 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392358.1 protein_id gnl|my_center|LOCUS_35520 <3811 2884 gene locus_tag LOCUS_35530 <3811 2884 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011392357.1:UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase >Feature sequence0745 2575 1757 gene locus_tag LOCUS_35540 2575 1757 CDS product FAD binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088901.1 protein_id gnl|my_center|LOCUS_35540 <3811 2599 gene locus_tag LOCUS_35550 <3811 2599 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004535402.1:8-oxoguanine deaminase >Feature sequence0746 137 1834 gene locus_tag LOCUS_35560 137 1834 CDS product Na+/H+ antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083762.1 protein_id gnl|my_center|LOCUS_35560 2872 2255 gene locus_tag LOCUS_35570 2872 2255 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084526.1 protein_id gnl|my_center|LOCUS_35570 3428 2922 gene locus_tag LOCUS_35580 3428 2922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35580 >Feature sequence0747 <1 1629 gene locus_tag LOCUS_35590 <1 1629 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011142422.1:ABC transporter permease 2892 2161 gene locus_tag LOCUS_35600 2892 2161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35600 3396 3028 gene locus_tag LOCUS_35610 3396 3028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35610 >Feature sequence0748 943 140 gene locus_tag LOCUS_35620 943 140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_35620 2004 937 gene locus_tag LOCUS_35630 2004 937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_35630 2443 2171 gene locus_tag LOCUS_35640 2443 2171 CDS product metal/formaldehyde-sensitive transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005308614.1 protein_id gnl|my_center|LOCUS_35640 >Feature sequence0749 187 699 gene locus_tag LOCUS_35650 187 699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35650 1395 817 gene locus_tag LOCUS_35660 1395 817 CDS product CGNR zinc finger domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391021.1 protein_id gnl|my_center|LOCUS_35660 1547 2011 gene locus_tag LOCUS_35670 1547 2011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35670 2056 2754 gene locus_tag LOCUS_35680 2056 2754 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816772.1 protein_id gnl|my_center|LOCUS_35680 3669 2917 gene locus_tag LOCUS_35690 3669 2917 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528853.1 protein_id gnl|my_center|LOCUS_35690 >Feature sequence0750 3 2411 gene locus_tag LOCUS_35700 3 2411 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615514.1 protein_id gnl|my_center|LOCUS_35700 3120 2608 gene locus_tag LOCUS_35710 3120 2608 CDS product L,D-transpeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957994.1 protein_id gnl|my_center|LOCUS_35710 >Feature sequence0751 710 916 gene locus_tag LOCUS_35720 710 916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35720 1014 2165 gene locus_tag LOCUS_35730 1014 2165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35730 >Feature sequence0752 583 458 gene locus_tag LOCUS_35740 583 458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35740 921 1205 gene locus_tag LOCUS_35750 921 1205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35750 2147 1374 gene locus_tag LOCUS_35760 2147 1374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35760 2397 2149 gene locus_tag LOCUS_35770 2397 2149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35770 <3790 2577 gene locus_tag LOCUS_35780 <3790 2577 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012259329.1:molybdopterin-synthase adenylyltransferase MoeB >Feature sequence0753 441 166 gene locus_tag LOCUS_35790 gene rplX 441 166 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000558200.1 protein_id gnl|my_center|LOCUS_35790 806 441 gene locus_tag LOCUS_35800 gene rplN 806 441 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326806.1 protein_id gnl|my_center|LOCUS_35800 1136 816 gene locus_tag LOCUS_35810 1136 816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35810 1376 1173 gene locus_tag LOCUS_35820 gene rpmC 1376 1173 CDS product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288664.1 protein_id gnl|my_center|LOCUS_35820 1816 1394 gene locus_tag LOCUS_35830 gene rplP 1816 1394 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933835.1 protein_id gnl|my_center|LOCUS_35830 2533 1841 gene locus_tag LOCUS_35840 gene rpsC 2533 1841 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943480.1 protein_id gnl|my_center|LOCUS_35840 3124 2537 gene locus_tag LOCUS_35850 gene rplV 3124 2537 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403587.1 protein_id gnl|my_center|LOCUS_35850 3414 3139 gene locus_tag LOCUS_35860 gene rpsS 3414 3139 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545511.1 protein_id gnl|my_center|LOCUS_35860 >Feature sequence0754 969 1292 gene locus_tag LOCUS_35870 969 1292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35870 1451 1603 gene locus_tag LOCUS_35880 1451 1603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35880 1600 1788 gene locus_tag LOCUS_35890 1600 1788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35890 2400 2095 gene locus_tag LOCUS_35900 2400 2095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35900 2595 2404 gene locus_tag LOCUS_35910 2595 2404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35910 >Feature sequence0755 228 1769 gene locus_tag LOCUS_35920 228 1769 CDS product glycosyltransferase family 39 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227051.1 protein_id gnl|my_center|LOCUS_35920 2576 2761 gene locus_tag LOCUS_35930 2576 2761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35930 2815 3033 gene locus_tag LOCUS_35940 2815 3033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35940 <3784 3051 gene locus_tag LOCUS_35950 <3784 3051 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011085040.1:MBL fold metallo-hydrolase >Feature sequence0756 2218 947 gene locus_tag LOCUS_35960 2218 947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35960 2208 2432 gene locus_tag LOCUS_35970 2208 2432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35970 2456 3316 gene locus_tag LOCUS_35980 2456 3316 CDS product TIGR00282 family metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941799.1 protein_id gnl|my_center|LOCUS_35980 3639 3714 gene locus_tag LOCUS_t00270 3639 3714 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence0757 1677 523 gene locus_tag LOCUS_35990 1677 523 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067002.1 protein_id gnl|my_center|LOCUS_35990 2748 1711 gene locus_tag LOCUS_36000 2748 1711 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007333876.1 protein_id gnl|my_center|LOCUS_36000 >Feature sequence0758 40 282 gene locus_tag LOCUS_36010 40 282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36010 1338 379 gene locus_tag LOCUS_36020 1338 379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36020 1994 1659 gene locus_tag LOCUS_36030 1994 1659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36030 2301 2693 gene locus_tag LOCUS_36040 2301 2693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36040 3081 2824 gene locus_tag LOCUS_36050 3081 2824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36050 <3776 3205 gene locus_tag LOCUS_36060 <3776 3205 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011143043.1:SAM-dependent methyltransferase >Feature sequence0759 112 585 gene locus_tag LOCUS_36070 112 585 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056942.1 protein_id gnl|my_center|LOCUS_36070 2145 1477 gene locus_tag LOCUS_36080 2145 1477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36080 <3772 2382 gene locus_tag LOCUS_36090 <3772 2382 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013224369.1:methylmalonyl-CoA mutase family protein >Feature sequence0760 505 224 gene locus_tag LOCUS_36100 505 224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36100 >Feature sequence0761 <1 1237 gene locus_tag LOCUS_36110 <1 1237 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013095044.1:maltose ABC transporter permease MalF 1568 2476 gene locus_tag LOCUS_36120 gene malG 1568 2476 CDS product maltose ABC transporter permease MalG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005299600.1 protein_id gnl|my_center|LOCUS_36120 2496 3623 gene locus_tag LOCUS_36130 gene ugpC 2496 3623 CDS product sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966512.1 protein_id gnl|my_center|LOCUS_36130 >Feature sequence0762 562 1503 gene locus_tag LOCUS_36140 562 1503 CDS product selenium metabolism-associated LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393377.1 protein_id gnl|my_center|LOCUS_36140 1713 2459 gene locus_tag LOCUS_36150 1713 2459 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703673.1 protein_id gnl|my_center|LOCUS_36150 2765 3607 gene locus_tag LOCUS_36160 2765 3607 CDS product ureidoglycolate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190287.1 protein_id gnl|my_center|LOCUS_36160 >Feature sequence0763 1703 408 gene locus_tag LOCUS_36170 gene serS 1703 408 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880145.1 protein_id gnl|my_center|LOCUS_36170 2074 3399 gene locus_tag LOCUS_36180 2074 3399 CDS product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888658.1 protein_id gnl|my_center|LOCUS_36180 >Feature sequence0764 1027 2562 gene locus_tag LOCUS_36190 1027 2562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36190 2886 3248 gene locus_tag LOCUS_36200 2886 3248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36200 3636 3274 gene locus_tag LOCUS_36210 3636 3274 CDS product DUF1330 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028171395.1 protein_id gnl|my_center|LOCUS_36210 >Feature sequence0765 1200 256 gene locus_tag LOCUS_36220 1200 256 CDS product C-terminal binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062075126.1 protein_id gnl|my_center|LOCUS_36220 1500 2927 gene locus_tag LOCUS_36230 1500 2927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_36230 >Feature sequence0766 1532 2407 gene locus_tag LOCUS_36240 1532 2407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36240 2404 2925 gene locus_tag LOCUS_36250 2404 2925 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529609.1 protein_id gnl|my_center|LOCUS_36250 3107 3754 gene locus_tag LOCUS_36260 gene surE 3107 3754 CDS product 5'/3'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919864.1 protein_id gnl|my_center|LOCUS_36260 >Feature sequence0767 2184 1576 gene locus_tag LOCUS_36270 2184 1576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36270 <3760 2165 gene locus_tag LOCUS_36280 <3760 2165 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010918053.1:polysaccharide biosynthesis tyrosine autokinase >Feature sequence0768 2152 1736 gene locus_tag LOCUS_36290 2152 1736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36290 <3759 2168 gene locus_tag LOCUS_36300 <3759 2168 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_162494117.1:arylsulfatase >Feature sequence0769 1507 56 gene locus_tag LOCUS_36310 1507 56 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36310 3080 2043 gene locus_tag LOCUS_36320 3080 2043 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085059.1 protein_id gnl|my_center|LOCUS_36320 >Feature sequence0770 188 616 gene locus_tag LOCUS_36330 188 616 CDS product lipocalin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209946.1 protein_id gnl|my_center|LOCUS_36330 1024 1392 gene locus_tag LOCUS_36340 1024 1392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36340 2204 1383 gene locus_tag LOCUS_36350 2204 1383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36350 2387 2683 gene locus_tag LOCUS_36360 2387 2683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36360 >Feature sequence0771 1555 1118 gene locus_tag LOCUS_36370 1555 1118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36370 1627 2361 gene locus_tag LOCUS_36380 1627 2361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36380 2561 3112 gene locus_tag LOCUS_36390 2561 3112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36390 >Feature sequence0772 1866 349 gene locus_tag LOCUS_36400 1866 349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36400 2070 2258 gene locus_tag LOCUS_36410 2070 2258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36410 2968 3480 gene locus_tag LOCUS_36420 2968 3480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_36420 >Feature sequence0773 646 1953 gene locus_tag LOCUS_36430 646 1953 CDS product 3-deoxy-D-manno-octulosonic acid transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123393.1 protein_id gnl|my_center|LOCUS_36430 2046 2119 gene locus_tag LOCUS_t00280 2046 2119 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 2358 3215 gene locus_tag LOCUS_36440 2358 3215 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963402.1 protein_id gnl|my_center|LOCUS_36440 >Feature sequence0774 4 2640 gene locus_tag LOCUS_36450 4 2640 CDS product serine/threonine-protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144060.1 protein_id gnl|my_center|LOCUS_36450 3697 2786 gene locus_tag LOCUS_36460 3697 2786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36460 >Feature sequence0775 593 784 gene locus_tag LOCUS_36470 593 784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36470 1351 2463 gene locus_tag LOCUS_36480 1351 2463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36480 >Feature sequence0776 322 3516 gene locus_tag LOCUS_36490 322 3516 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140878.1 protein_id gnl|my_center|LOCUS_36490 >Feature sequence0777 1537 512 gene locus_tag LOCUS_36500 1537 512 CDS product zinc-dependent alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892758.1 protein_id gnl|my_center|LOCUS_36500 2883 1702 gene locus_tag LOCUS_36510 2883 1702 CDS product ROK family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530260.1 protein_id gnl|my_center|LOCUS_36510 3681 3322 gene locus_tag LOCUS_36520 3681 3322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36520 >Feature sequence0778 1506 289 gene locus_tag LOCUS_36530 1506 289 CDS product GuaB3 family IMP dehydrogenase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141602.1 protein_id gnl|my_center|LOCUS_36530 2904 2179 gene locus_tag LOCUS_36540 2904 2179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36540 3305 2901 gene locus_tag LOCUS_36550 3305 2901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36550 >Feature sequence0779 280 939 gene locus_tag LOCUS_36560 280 939 CDS product cysteine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797789.1 protein_id gnl|my_center|LOCUS_36560 1532 1167 gene locus_tag LOCUS_36570 1532 1167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36570 2015 1587 gene locus_tag LOCUS_36580 2015 1587 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970383.1 protein_id gnl|my_center|LOCUS_36580 >Feature sequence0780 686 354 gene locus_tag LOCUS_36590 686 354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36590 1328 774 gene locus_tag LOCUS_36600 1328 774 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084272.1 protein_id gnl|my_center|LOCUS_36600 2691 1495 gene locus_tag LOCUS_36610 2691 1495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36610 2680 3678 gene locus_tag LOCUS_36620 gene hflK 2680 3678 CDS product FtsH protease activity modulator HflK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678884.1 protein_id gnl|my_center|LOCUS_36620 >Feature sequence0781 265 1137 gene locus_tag LOCUS_36630 265 1137 CDS product YicC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942879.1 protein_id gnl|my_center|LOCUS_36630 1304 1837 gene locus_tag LOCUS_36640 1304 1837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36640 3107 1854 gene locus_tag LOCUS_36650 3107 1854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36650 >Feature sequence0782 479 1453 gene locus_tag LOCUS_36660 479 1453 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583297.1 protein_id gnl|my_center|LOCUS_36660 1770 2720 gene locus_tag LOCUS_36670 1770 2720 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583298.1 protein_id gnl|my_center|LOCUS_36670 >Feature sequence0783 290 1717 gene locus_tag LOCUS_36680 gene htrA 290 1717 CDS product serine protease HtrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009873435.1 protein_id gnl|my_center|LOCUS_36680 1916 2620 gene locus_tag LOCUS_36690 1916 2620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36690 3624 2935 gene locus_tag LOCUS_36700 3624 2935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36700 >Feature sequence0784 1133 1264 gene locus_tag LOCUS_36710 1133 1264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36710 1352 2584 gene locus_tag LOCUS_36720 1352 2584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_36720 2593 3147 gene locus_tag LOCUS_36730 2593 3147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_36730 >Feature sequence0785 1131 199 gene locus_tag LOCUS_36740 1131 199 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057313.1 protein_id gnl|my_center|LOCUS_36740 1492 3039 gene locus_tag LOCUS_36750 1492 3039 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940879.1 protein_id gnl|my_center|LOCUS_36750 <3709 3201 gene locus_tag LOCUS_36760 <3709 3201 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004191609.1:SDR family oxidoreductase >Feature sequence0786 >Feature sequence0787 <1 564 gene locus_tag LOCUS_36770 <1 564 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000985571.1:sugar-phosphatase 677 1174 gene locus_tag LOCUS_36780 677 1174 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000617356.1 protein_id gnl|my_center|LOCUS_36780 2237 1254 gene locus_tag LOCUS_36790 2237 1254 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970070.1 protein_id gnl|my_center|LOCUS_36790 2500 3486 gene locus_tag LOCUS_36800 2500 3486 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000048017.1 protein_id gnl|my_center|LOCUS_36800 >Feature sequence0788 1972 122 gene locus_tag LOCUS_36810 gene glmS 1972 122 CDS product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328387.1 protein_id gnl|my_center|LOCUS_36810 2457 2230 gene locus_tag LOCUS_36820 2457 2230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36820 2689 2447 gene locus_tag LOCUS_36830 2689 2447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36830 2871 3056 gene locus_tag LOCUS_36840 2871 3056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36840 >Feature sequence0789 2616 91 gene locus_tag LOCUS_36850 2616 91 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36850 3240 3383 gene locus_tag LOCUS_36860 3240 3383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36860 >Feature sequence0790 3300 1252 gene locus_tag LOCUS_36870 gene pbpC 3300 1252 CDS product penicillin-binding protein 1C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444434.1 protein_id gnl|my_center|LOCUS_36870 >Feature sequence0791 662 312 gene locus_tag LOCUS_36880 662 312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36880 1405 758 gene locus_tag LOCUS_36890 1405 758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36890 2088 1399 gene locus_tag LOCUS_36900 2088 1399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_36900 2353 2841 gene locus_tag LOCUS_36910 2353 2841 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087869.1 protein_id gnl|my_center|LOCUS_36910 3350 2976 gene locus_tag LOCUS_36920 3350 2976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36920 >Feature sequence0792 1669 65 gene locus_tag LOCUS_36930 1669 65 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_36930 2141 1908 gene locus_tag LOCUS_36940 2141 1908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36940 3284 2307 gene locus_tag LOCUS_36950 gene trpS 3284 2307 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016366.1 protein_id gnl|my_center|LOCUS_36950 >Feature sequence0793 55 981 gene locus_tag LOCUS_36960 55 981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36960 2279 1401 gene locus_tag LOCUS_36970 2279 1401 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198511.1 protein_id gnl|my_center|LOCUS_36970 3253 2288 gene locus_tag LOCUS_36980 3253 2288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36980 >Feature sequence0794 502 131 gene locus_tag LOCUS_36990 502 131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36990 907 1401 gene locus_tag LOCUS_37000 907 1401 CDS product HdeD family acid-resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965451.1 protein_id gnl|my_center|LOCUS_37000 1856 1434 gene locus_tag LOCUS_37010 1856 1434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37010 2782 2138 gene locus_tag LOCUS_37020 2782 2138 CDS product BON domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_140230840.1 protein_id gnl|my_center|LOCUS_37020 3640 2855 gene locus_tag LOCUS_37030 3640 2855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37030 >Feature sequence0795 1250 2167 gene locus_tag LOCUS_37040 1250 2167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37040 2786 2301 gene locus_tag LOCUS_37050 2786 2301 CDS product DUF1203 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385570.1 protein_id gnl|my_center|LOCUS_37050 <3672 3003 gene locus_tag LOCUS_37060 <3672 3003 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011085060.1:carbohydrate porin >Feature sequence0796 1326 142 gene locus_tag LOCUS_37070 1326 142 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257503.1 protein_id gnl|my_center|LOCUS_37070 2397 1402 gene locus_tag LOCUS_37080 2397 1402 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257502.1 protein_id gnl|my_center|LOCUS_37080 3500 2910 gene locus_tag LOCUS_37090 3500 2910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37090 >Feature sequence0797 1566 49 gene locus_tag LOCUS_37100 1566 49 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37100 1989 2255 gene locus_tag LOCUS_37110 1989 2255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37110 <3668 2564 gene locus_tag LOCUS_37120 <3668 2564 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011037305.1:class III poly(R)-hydroxyalkanoic acid synthase subunit PhaC >Feature sequence0798 736 527 gene locus_tag LOCUS_37130 736 527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37130 1101 910 gene locus_tag LOCUS_37140 1101 910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37140 2921 1116 gene locus_tag LOCUS_37150 2921 1116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37150 <3667 3046 gene locus_tag LOCUS_37160 <3667 3046 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941763.1:response regulator transcription factor >Feature sequence0799 225 1040 gene locus_tag LOCUS_37170 225 1040 CDS product aquaporin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197530129.1 protein_id gnl|my_center|LOCUS_37170 1140 1505 gene locus_tag LOCUS_37180 1140 1505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37180 3091 1802 gene locus_tag LOCUS_37190 3091 1802 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037393085.1 protein_id gnl|my_center|LOCUS_37190 >Feature sequence0800 246 629 gene locus_tag LOCUS_37200 gene hisI 246 629 CDS product phosphoribosyl-AMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061191.1 protein_id gnl|my_center|LOCUS_37200 626 2122 gene locus_tag LOCUS_37210 gene trpE 626 2122 CDS product anthranilate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943019.1 protein_id gnl|my_center|LOCUS_37210 2119 2682 gene locus_tag LOCUS_37220 2119 2682 CDS product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257601.1 protein_id gnl|my_center|LOCUS_37220 >Feature sequence0801 1348 2511 gene locus_tag LOCUS_37230 1348 2511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37230 >Feature sequence0802 >Feature sequence0803 2437 1304 gene locus_tag LOCUS_37240 2437 1304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968622.1 protein_id gnl|my_center|LOCUS_37240 >Feature sequence0804 1075 782 gene locus_tag LOCUS_37250 1075 782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37250 2206 1358 gene locus_tag LOCUS_37260 2206 1358 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706486.1 protein_id gnl|my_center|LOCUS_37260 >Feature sequence0805 510 1244 gene locus_tag LOCUS_37270 510 1244 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888902.1 protein_id gnl|my_center|LOCUS_37270 3643 1259 gene locus_tag LOCUS_37280 3643 1259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37280 >Feature sequence0806 1037 696 gene locus_tag LOCUS_37290 1037 696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37290 1567 1103 gene locus_tag LOCUS_37300 1567 1103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37300 2700 1852 gene locus_tag LOCUS_37310 2700 1852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37310 3467 3270 gene locus_tag LOCUS_37320 3467 3270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37320 >Feature sequence0807 98 739 gene locus_tag LOCUS_37330 98 739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37330 1504 815 gene locus_tag LOCUS_37340 1504 815 CDS product beta-phosphoglucomutase family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927183.1 protein_id gnl|my_center|LOCUS_37340 3559 2021 gene locus_tag LOCUS_37350 3559 2021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37350 >Feature sequence0808 155 580 gene locus_tag LOCUS_37360 155 580 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031562.1 protein_id gnl|my_center|LOCUS_37360 573 1061 gene locus_tag LOCUS_37370 573 1061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37370 2215 1769 gene locus_tag LOCUS_37380 2215 1769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37380 2705 2304 gene locus_tag LOCUS_37390 2705 2304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37390 2984 3526 gene locus_tag LOCUS_37400 2984 3526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37400 >Feature sequence0809 1241 222 gene locus_tag LOCUS_37410 1241 222 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970282.1 protein_id gnl|my_center|LOCUS_37410 <3647 1238 gene locus_tag LOCUS_37420 <3647 1238 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_149764772.1:site-specific integrase >Feature sequence0810 <1 632 gene locus_tag LOCUS_37430 <1 632 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004530860.1:carbohydrate ABC transporter permease 1970 900 gene locus_tag LOCUS_37440 1970 900 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000700809.1 protein_id gnl|my_center|LOCUS_37440 3428 2112 gene locus_tag LOCUS_37450 3428 2112 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197580.1 protein_id gnl|my_center|LOCUS_37450 >Feature sequence0811 2637 1153 gene locus_tag LOCUS_37460 2637 1153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37460 2675 2848 gene locus_tag LOCUS_37470 2675 2848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37470 <3642 2862 gene locus_tag LOCUS_37480 <3642 2862 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014206215.1:transporter >Feature sequence0812 <1 1820 gene locus_tag LOCUS_37490 <1 1820 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000072238.1:valine--tRNA ligase >Feature sequence0813 596 880 gene locus_tag LOCUS_37500 596 880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37500 3639 976 gene locus_tag LOCUS_37510 3639 976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37510 >Feature sequence0814 1899 1132 gene locus_tag LOCUS_37520 1899 1132 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000868621.1 protein_id gnl|my_center|LOCUS_37520 2437 2165 gene locus_tag LOCUS_37530 2437 2165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37530 >Feature sequence0815 1076 399 gene locus_tag LOCUS_37540 1076 399 CDS product heavy metal response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_186914724.1 protein_id gnl|my_center|LOCUS_37540 1315 1082 gene locus_tag LOCUS_37550 1315 1082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37550 2749 1355 gene locus_tag LOCUS_37560 2749 1355 CDS product divalent metal cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550958.1 protein_id gnl|my_center|LOCUS_37560 3277 3423 gene locus_tag LOCUS_37570 3277 3423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37570 >Feature sequence0816 <1 622 gene locus_tag LOCUS_37580 <1 622 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_034100327.1:alpha/beta hydrolase 871 1287 gene locus_tag LOCUS_37590 gene dtd 871 1287 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796976.1 protein_id gnl|my_center|LOCUS_37590 1504 2304 gene locus_tag LOCUS_37600 1504 2304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37600 2301 3179 gene locus_tag LOCUS_37610 gene thiL 2301 3179 CDS product thiamine-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121111.1 protein_id gnl|my_center|LOCUS_37610 >Feature sequence0817 <1 649 gene locus_tag LOCUS_37620 <1 649 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003414906.1:[2-O-methyl-alpha-L-fucopyranosyl-(1->3)-alpha-L-rhamnopyranosyl-(1->3)-2-O-methyl-alpha-L-rhamnopyranosyl] dimycocerosyl phenol-phthiocerol 4'''-O-methyltransferase 877 1782 gene locus_tag LOCUS_37630 877 1782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37630 1779 2549 gene locus_tag LOCUS_37640 1779 2549 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813221.1 protein_id gnl|my_center|LOCUS_37640 2546 3586 gene locus_tag LOCUS_37650 2546 3586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37650 >Feature sequence0818 568 374 gene locus_tag LOCUS_37660 568 374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37660 1708 659 gene locus_tag LOCUS_37670 1708 659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37670 2216 3067 gene locus_tag LOCUS_37680 2216 3067 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975555.1 protein_id gnl|my_center|LOCUS_37680 >Feature sequence0819 <1 678 gene locus_tag LOCUS_37690 <1 678 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003095817.1:LysR family transcriptional regulator 961 692 gene locus_tag LOCUS_37700 961 692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_37700 1565 1011 gene locus_tag LOCUS_37710 1565 1011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37710 2761 3261 gene locus_tag LOCUS_37720 2761 3261 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083839.1 protein_id gnl|my_center|LOCUS_37720 >Feature sequence0820 2031 1891 gene locus_tag LOCUS_37730 2031 1891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37730 2491 2132 gene locus_tag LOCUS_37740 2491 2132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37740 3092 2514 gene locus_tag LOCUS_37750 3092 2514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37750 >Feature sequence0821 2944 1523 gene locus_tag LOCUS_37760 2944 1523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37760 >Feature sequence0822 1093 1515 gene locus_tag LOCUS_37770 1093 1515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37770 1487 1687 gene locus_tag LOCUS_37780 1487 1687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37780 3195 2212 gene locus_tag LOCUS_37790 3195 2212 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003529403.1 protein_id gnl|my_center|LOCUS_37790 >Feature sequence0823 1938 1351 gene locus_tag LOCUS_37800 gene kdsB 1938 1351 CDS product 3-deoxy-manno-octulosonate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933490.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_37800 2940 2422 gene locus_tag LOCUS_37810 gene gmhB 2940 2422 CDS product D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_044801009.1 protein_id gnl|my_center|LOCUS_37810 <3620 2967 gene locus_tag LOCUS_37820 <3620 2967 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942727.1:D-glycero-beta-D-manno-heptose-7-phosphate kinase >Feature sequence0824 816 367 gene locus_tag LOCUS_37830 816 367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37830 1143 1457 gene locus_tag LOCUS_37840 1143 1457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37840 1865 2215 gene locus_tag LOCUS_37850 1865 2215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37850 <3617 2617 gene locus_tag LOCUS_37860 <3617 2617 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010974270.1:Gfo/Idh/MocA family oxidoreductase >Feature sequence0825 1310 1143 gene locus_tag LOCUS_37870 1310 1143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37870 3545 1332 gene locus_tag LOCUS_37880 3545 1332 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275340.1 note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_37880 >Feature sequence0826 286 1182 gene locus_tag LOCUS_37890 286 1182 CDS product serine acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120272.1 protein_id gnl|my_center|LOCUS_37890 1491 1195 gene locus_tag LOCUS_37900 1491 1195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37900 1667 2728 gene locus_tag LOCUS_37910 1667 2728 CDS product mannose-1-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403343.1 protein_id gnl|my_center|LOCUS_37910 2730 3149 gene locus_tag LOCUS_37920 gene ruvX 2730 3149 CDS product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003730148.1 protein_id gnl|my_center|LOCUS_37920 >Feature sequence0827 2632 2303 gene locus_tag LOCUS_37930 2632 2303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37930 >Feature sequence0828 1550 996 gene locus_tag LOCUS_37940 1550 996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37940 1952 2392 gene locus_tag LOCUS_37950 1952 2392 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090322.1 protein_id gnl|my_center|LOCUS_37950 2441 3424 gene locus_tag LOCUS_37960 2441 3424 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640467.1 protein_id gnl|my_center|LOCUS_37960 >Feature sequence0829 1123 605 gene locus_tag LOCUS_37970 1123 605 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931941.1 protein_id gnl|my_center|LOCUS_37970 1663 2268 gene locus_tag LOCUS_37980 1663 2268 CDS product dihydrofolate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530118.1 protein_id gnl|my_center|LOCUS_37980 >Feature sequence0830 630 2702 gene locus_tag LOCUS_37990 630 2702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37990 >Feature sequence0831 264 728 gene locus_tag LOCUS_38000 264 728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38000 725 1543 gene locus_tag LOCUS_38010 725 1543 CDS product SCO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258006.1 protein_id gnl|my_center|LOCUS_38010 1540 2505 gene locus_tag LOCUS_38020 gene coxB 1540 2505 CDS product cytochrome c oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258007.1 protein_id gnl|my_center|LOCUS_38020 >Feature sequence0832 1679 738 gene locus_tag LOCUS_38030 1679 738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928827.1 protein_id gnl|my_center|LOCUS_38030 1678 2400 gene locus_tag LOCUS_38040 1678 2400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38040 >Feature sequence0833 2106 1111 gene locus_tag LOCUS_38050 2106 1111 CDS product autoinducer 2 ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_080577565.1 protein_id gnl|my_center|LOCUS_38050 2621 3229 gene locus_tag LOCUS_38060 2621 3229 CDS product DUF1326 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_148701912.1 protein_id gnl|my_center|LOCUS_38060 >Feature sequence0834 1453 65 gene locus_tag LOCUS_38070 1453 65 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082946.1 protein_id gnl|my_center|LOCUS_38070 2235 1450 gene locus_tag LOCUS_38080 2235 1450 CDS product sugar isomerase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804151.1 protein_id gnl|my_center|LOCUS_38080 3050 2232 gene locus_tag LOCUS_38090 3050 2232 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087367.1 protein_id gnl|my_center|LOCUS_38090 3136 3513 gene locus_tag LOCUS_38100 3136 3513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38100 >Feature sequence0835 702 502 gene locus_tag LOCUS_38110 702 502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38110 1077 1478 gene locus_tag LOCUS_38120 1077 1478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38120 2542 1760 gene locus_tag LOCUS_38130 2542 1760 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027504.1 protein_id gnl|my_center|LOCUS_38130 2701 3351 gene locus_tag LOCUS_38140 2701 3351 CDS product DUF1573 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943348.1 protein_id gnl|my_center|LOCUS_38140 >Feature sequence0836 1570 548 gene locus_tag LOCUS_38150 1570 548 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119158.1 protein_id gnl|my_center|LOCUS_38150 1854 1720 gene locus_tag LOCUS_38160 1854 1720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38160 2047 2568 gene locus_tag LOCUS_38170 2047 2568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38170 >Feature sequence0837 510 2429 gene locus_tag LOCUS_38180 510 2429 CDS product fumarate reductase/succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257750.1 protein_id gnl|my_center|LOCUS_38180 2485 3252 gene locus_tag LOCUS_38190 2485 3252 CDS product succinate dehydrogenase/fumarate reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257749.1 protein_id gnl|my_center|LOCUS_38190 >Feature sequence0838 403 975 gene locus_tag LOCUS_38200 403 975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38200 1441 1163 gene locus_tag LOCUS_38210 1441 1163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38210 2125 1556 gene locus_tag LOCUS_38220 2125 1556 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140873.1 protein_id gnl|my_center|LOCUS_38220 2126 2527 gene locus_tag LOCUS_38230 2126 2527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38230 2508 2942 gene locus_tag LOCUS_38240 2508 2942 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414624.1 protein_id gnl|my_center|LOCUS_38240 3498 3097 gene locus_tag LOCUS_38250 3498 3097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38250 >Feature sequence0839 802 1953 gene locus_tag LOCUS_38260 802 1953 CDS product anaerobic sulfatase maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208542.1 protein_id gnl|my_center|LOCUS_38260 2361 2663 gene locus_tag LOCUS_38270 2361 2663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38270 3363 2818 gene locus_tag LOCUS_38280 3363 2818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38280 >Feature sequence0840 149 574 gene locus_tag LOCUS_38290 149 574 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086548.1 protein_id gnl|my_center|LOCUS_38290 752 1573 gene locus_tag LOCUS_38300 752 1573 CDS product PhzF family phenazine biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_095645285.1 protein_id gnl|my_center|LOCUS_38300 1798 2247 gene locus_tag LOCUS_38310 1798 2247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38310 2390 2965 gene locus_tag LOCUS_38320 2390 2965 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000619543.1 protein_id gnl|my_center|LOCUS_38320 3210 3085 gene locus_tag LOCUS_38330 3210 3085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38330 >Feature sequence0841 2277 1432 gene locus_tag LOCUS_38340 gene ftsY 2277 1432 CDS product signal recognition particle-docking protein FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081293.1 protein_id gnl|my_center|LOCUS_38340 2857 2423 gene locus_tag LOCUS_38350 gene nusB 2857 2423 CDS product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460271.1 protein_id gnl|my_center|LOCUS_38350 3337 2861 gene locus_tag LOCUS_38360 gene ribE 3337 2861 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880027.1 protein_id gnl|my_center|LOCUS_38360 >Feature sequence0842 789 325 gene locus_tag LOCUS_38370 789 325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38370 2527 812 gene locus_tag LOCUS_38380 2527 812 CDS product FAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728639.1 protein_id gnl|my_center|LOCUS_38380 3053 2565 gene locus_tag LOCUS_38390 3053 2565 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229065.1 protein_id gnl|my_center|LOCUS_38390 >Feature sequence0843 612 1757 gene locus_tag LOCUS_38400 612 1757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38400 1951 2496 gene locus_tag LOCUS_38410 1951 2496 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206819219.1 protein_id gnl|my_center|LOCUS_38410 <3542 2733 gene locus_tag LOCUS_38420 <3542 2733 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011337640.1:iron-containing alcohol dehydrogenase >Feature sequence0844 3246 3389 gene locus_tag LOCUS_38430 3246 3389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38430 >Feature sequence0845 500 1246 gene locus_tag LOCUS_38440 gene fabG 500 1246 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000911773.1 protein_id gnl|my_center|LOCUS_38440 2217 1300 gene locus_tag LOCUS_38450 2217 1300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38450 3190 2198 gene locus_tag LOCUS_38460 3190 2198 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000418716.1 protein_id gnl|my_center|LOCUS_38460 >Feature sequence0846 1154 1345 gene locus_tag LOCUS_38470 1154 1345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38470 1845 1375 gene locus_tag LOCUS_38480 1845 1375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38480 2390 2794 gene locus_tag LOCUS_38490 2390 2794 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679941.1 protein_id gnl|my_center|LOCUS_38490 >Feature sequence0847 <1 1847 gene locus_tag LOCUS_38500 <1 1847 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010940273.1:asparagine synthase (glutamine-hydrolyzing) 2534 2094 gene locus_tag LOCUS_38510 2534 2094 CDS product PIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391721.1 protein_id gnl|my_center|LOCUS_38510 2754 2512 gene locus_tag LOCUS_38520 2754 2512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38520 >Feature sequence0848 663 274 gene locus_tag LOCUS_38530 663 274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38530 1369 1061 gene locus_tag LOCUS_38540 1369 1061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38540 2602 1658 gene locus_tag LOCUS_38550 2602 1658 CDS product YihY/virulence factor BrkB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929456.1 protein_id gnl|my_center|LOCUS_38550 >Feature sequence0849 <1 791 gene locus_tag LOCUS_38560 <1 791 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011971015.1:IS66 family transposase 1087 962 gene locus_tag LOCUS_38570 1087 962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38570 2276 1425 gene locus_tag LOCUS_38580 2276 1425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38580 2339 2608 gene locus_tag LOCUS_38590 2339 2608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38590 3164 2850 gene locus_tag LOCUS_38600 3164 2850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38600 >Feature sequence0850 1510 359 gene locus_tag LOCUS_38610 1510 359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38610 3029 1626 gene locus_tag LOCUS_38620 3029 1626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38620 >Feature sequence0851 581 2419 gene locus_tag LOCUS_38630 gene cysC 581 2419 CDS product adenylyl-sulfate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084291.1 protein_id gnl|my_center|LOCUS_38630 3478 2507 gene locus_tag LOCUS_38640 3478 2507 CDS product alpha-E domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920827.1 protein_id gnl|my_center|LOCUS_38640 >Feature sequence0852 <1 887 gene locus_tag LOCUS_38650 <1 887 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010940806.1:methionyl-tRNA formyltransferase 2401 1034 gene locus_tag LOCUS_38660 2401 1034 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002675346.1 protein_id gnl|my_center|LOCUS_38660 <3521 2509 gene locus_tag LOCUS_38670 <3521 2509 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002679701.1:ATP-binding protein >Feature sequence0853 1016 1426 gene locus_tag LOCUS_38680 1016 1426 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970383.1 protein_id gnl|my_center|LOCUS_38680 2115 1552 gene locus_tag LOCUS_38690 2115 1552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38690 <3510 2237 gene locus_tag LOCUS_38700 <3510 2237 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164921450.1:alpha/beta fold hydrolase >Feature sequence0854 335 1108 gene locus_tag LOCUS_38710 335 1108 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392394.1 protein_id gnl|my_center|LOCUS_38710 1338 2213 gene locus_tag LOCUS_38720 1338 2213 CDS product nucleoside hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014797.1 protein_id gnl|my_center|LOCUS_38720 >Feature sequence0855 1192 2502 gene locus_tag LOCUS_38730 1192 2502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38730 3368 2709 gene locus_tag LOCUS_38740 3368 2709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38740 >Feature sequence0856 <3504 2918 gene locus_tag LOCUS_38750 <3504 2918 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011028842.1:non-ribosomal peptide synthetase >Feature sequence0857 852 980 gene locus_tag LOCUS_38760 852 980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38760 2653 1478 gene locus_tag LOCUS_38770 2653 1478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38770 >Feature sequence0858 803 621 gene locus_tag LOCUS_38780 803 621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38780 1074 1235 gene locus_tag LOCUS_38790 1074 1235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38790 1321 2856 gene locus_tag LOCUS_38800 1321 2856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38800 >Feature sequence0859 31 453 gene locus_tag LOCUS_38810 31 453 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259124.1 protein_id gnl|my_center|LOCUS_38810 1460 600 gene locus_tag LOCUS_38820 1460 600 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390392.1 protein_id gnl|my_center|LOCUS_38820 1730 2251 gene locus_tag LOCUS_38830 1730 2251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925948.1 protein_id gnl|my_center|LOCUS_38830 2350 2868 gene locus_tag LOCUS_38840 2350 2868 CDS product arylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943052.1 protein_id gnl|my_center|LOCUS_38840 >Feature sequence0860 707 1090 gene locus_tag LOCUS_38850 707 1090 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970383.1 protein_id gnl|my_center|LOCUS_38850 1356 2000 gene locus_tag LOCUS_38860 1356 2000 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087542.1 protein_id gnl|my_center|LOCUS_38860 2357 2626 gene locus_tag LOCUS_38870 2357 2626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38870 2641 2826 gene locus_tag LOCUS_38880 2641 2826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38880 <3492 2849 gene locus_tag LOCUS_38890 <3492 2849 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_038967605.1:CHASE3 domain-containing protein >Feature sequence0861 <1 1293 gene locus_tag LOCUS_38900 <1 1293 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011268048.1:LLM class flavin-dependent oxidoreductase 1290 2279 gene locus_tag LOCUS_38910 1290 2279 CDS product sulfonate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269279.1 protein_id gnl|my_center|LOCUS_38910 2276 3385 gene locus_tag LOCUS_38920 gene ssuD 2276 3385 CDS product FMNH2-dependent alkanesulfonate monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104713.1 protein_id gnl|my_center|LOCUS_38920 >Feature sequence0862 687 1343 gene locus_tag LOCUS_38930 687 1343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38930 >Feature sequence0863 46 339 gene locus_tag LOCUS_38940 46 339 CDS product malonate decarboxylase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287548.1 protein_id gnl|my_center|LOCUS_38940 336 1205 gene locus_tag LOCUS_38950 336 1205 CDS product biotin-independent malonate decarboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206493.1 protein_id gnl|my_center|LOCUS_38950 1202 2023 gene locus_tag LOCUS_38960 gene mdcE 1202 2023 CDS product biotin-independent malonate decarboxylase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765423.1 protein_id gnl|my_center|LOCUS_38960 2034 2996 gene locus_tag LOCUS_38970 2034 2996 CDS product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099045.1 protein_id gnl|my_center|LOCUS_38970 >Feature sequence0864 792 1703 gene locus_tag LOCUS_38980 792 1703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38980 1733 2128 gene locus_tag LOCUS_38990 1733 2128 CDS product Rieske (2Fe-2S) protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804562.1 protein_id gnl|my_center|LOCUS_38990 2637 2257 gene locus_tag LOCUS_39000 2637 2257 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037384441.1 protein_id gnl|my_center|LOCUS_39000 >Feature sequence0865 2423 1269 gene locus_tag LOCUS_39010 2423 1269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39010 3211 2420 gene locus_tag LOCUS_39020 3211 2420 CDS product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582797.1 protein_id gnl|my_center|LOCUS_39020 >Feature sequence0866 >Feature sequence0867 134 328 gene locus_tag LOCUS_39030 134 328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39030 321 443 gene locus_tag LOCUS_39040 321 443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39040 986 1216 gene locus_tag LOCUS_39050 986 1216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39050 2158 1265 gene locus_tag LOCUS_39060 2158 1265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39060 >Feature sequence0868 779 51 gene locus_tag LOCUS_39070 779 51 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969876.1 protein_id gnl|my_center|LOCUS_39070 1244 1684 gene locus_tag LOCUS_39080 gene phnB 1244 1684 CDS product Dot/Icm type IV secretion system effector PhnB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957793.1 protein_id gnl|my_center|LOCUS_39080 1766 2263 gene locus_tag LOCUS_39090 1766 2263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39090 2273 2464 gene locus_tag LOCUS_39100 2273 2464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39100 2641 3165 gene locus_tag LOCUS_39110 2641 3165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39110 >Feature sequence0869 341 33 gene locus_tag LOCUS_39120 341 33 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39120 1270 551 gene locus_tag LOCUS_39130 1270 551 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941468.1 protein_id gnl|my_center|LOCUS_39130 1362 2279 gene locus_tag LOCUS_39140 1362 2279 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000423235.1 protein_id gnl|my_center|LOCUS_39140 >Feature sequence0870 955 1599 gene locus_tag LOCUS_39150 955 1599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39150 1602 1991 gene locus_tag LOCUS_39160 1602 1991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39160 1975 2406 gene locus_tag LOCUS_39170 1975 2406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39170 >Feature sequence0871 455 246 gene locus_tag LOCUS_39180 455 246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39180 2297 648 gene locus_tag LOCUS_39190 2297 648 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532183.1 protein_id gnl|my_center|LOCUS_39190 3366 2443 gene locus_tag LOCUS_39200 3366 2443 CDS product ribose ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095095.1 protein_id gnl|my_center|LOCUS_39200 >Feature sequence0872 3242 1728 gene locus_tag LOCUS_39210 3242 1728 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114382.1 protein_id gnl|my_center|LOCUS_39210 >Feature sequence0873 845 447 gene locus_tag LOCUS_39220 845 447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39220 1197 2147 gene locus_tag LOCUS_39230 1197 2147 CDS product C-terminal binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208809.1 protein_id gnl|my_center|LOCUS_39230 3042 2263 gene locus_tag LOCUS_39240 3042 2263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39240 >Feature sequence0874 <3464 1871 gene locus_tag LOCUS_39250 <3464 1871 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011141201.1:ABC transporter permease >Feature sequence0875 3162 2098 gene locus_tag LOCUS_39260 3162 2098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39260 >Feature sequence0876 193 1317 gene locus_tag LOCUS_39270 193 1317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39270 1314 2255 gene locus_tag LOCUS_39280 1314 2255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39280 2271 2750 gene locus_tag LOCUS_39290 2271 2750 CDS product YdeI/OmpD-associated family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039237.1 protein_id gnl|my_center|LOCUS_39290 3135 2764 gene locus_tag LOCUS_39300 3135 2764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39300 >Feature sequence0877 <1 1077 gene locus_tag LOCUS_39310 <1 1077 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164926839.1:alpha-amylase family glycosyl hydrolase 1345 2895 gene locus_tag LOCUS_39320 1345 2895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39320 >Feature sequence0878 >Feature sequence0879 311 3121 gene locus_tag LOCUS_39330 311 3121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39330 >Feature sequence0880 991 53 gene locus_tag LOCUS_39340 991 53 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118840171.1 protein_id gnl|my_center|LOCUS_39340 1228 1028 gene locus_tag LOCUS_39350 1228 1028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39350 1330 1872 gene locus_tag LOCUS_39360 1330 1872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39360 >Feature sequence0881 908 510 gene locus_tag LOCUS_39370 908 510 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_031500121.1 protein_id gnl|my_center|LOCUS_39370 >Feature sequence0882 233 1477 gene locus_tag LOCUS_39380 gene fahA 233 1477 CDS product fumarylacetoacetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405078.1 protein_id gnl|my_center|LOCUS_39380 1625 3427 gene locus_tag LOCUS_39390 1625 3427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39390 >Feature sequence0883 1032 532 gene locus_tag LOCUS_39400 gene hoxE 1032 532 CDS product bidirectional hydrogenase complex protein HoxE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257070.1 protein_id gnl|my_center|LOCUS_39400 1178 2503 gene locus_tag LOCUS_39410 1178 2503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39410 2549 3346 gene locus_tag LOCUS_39420 2549 3346 CDS product 2Fe-2S iron-sulfur cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939943.1 protein_id gnl|my_center|LOCUS_39420 >Feature sequence0884 887 150 gene locus_tag LOCUS_39430 887 150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39430 1258 1632 gene locus_tag LOCUS_39440 1258 1632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39440 1695 2453 gene locus_tag LOCUS_39450 1695 2453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39450 >Feature sequence0885 1980 967 gene locus_tag LOCUS_39460 1980 967 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206912.1 protein_id gnl|my_center|LOCUS_39460 2933 3172 gene locus_tag LOCUS_39470 2933 3172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39470 >Feature sequence0886 <1 992 gene locus_tag LOCUS_39480 <1 992 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010933711.1:NDP-sugar synthase 989 2005 gene locus_tag LOCUS_39490 989 2005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39490 >Feature sequence0887 239 1591 gene locus_tag LOCUS_39500 239 1591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39500 1741 2505 gene locus_tag LOCUS_39510 1741 2505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39510 >Feature sequence0888 382 2643 gene locus_tag LOCUS_39520 382 2643 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937404.1 protein_id gnl|my_center|LOCUS_39520 2879 3079 gene locus_tag LOCUS_39530 2879 3079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39530 >Feature sequence0889 345 106 gene locus_tag LOCUS_39540 345 106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39540 1085 630 gene locus_tag LOCUS_39550 1085 630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39550 1830 1093 gene locus_tag LOCUS_39560 1830 1093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39560 2147 2728 gene locus_tag LOCUS_39570 2147 2728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39570 >Feature sequence0890 2126 1638 gene locus_tag LOCUS_39580 2126 1638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39580 <3429 2466 gene locus_tag LOCUS_39590 <3429 2466 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_057443118.1:tyrosine-type recombinase/integrase >Feature sequence0891 2727 1711 gene locus_tag LOCUS_39600 2727 1711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39600 3073 2816 gene locus_tag LOCUS_39610 3073 2816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39610 >Feature sequence0892 1298 552 gene locus_tag LOCUS_39620 1298 552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39620 2804 1611 gene locus_tag LOCUS_39630 2804 1611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39630 3156 2797 gene locus_tag LOCUS_39640 3156 2797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39640 >Feature sequence0893 345 938 gene locus_tag LOCUS_39650 345 938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39650 1281 1787 gene locus_tag LOCUS_39660 1281 1787 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004530129.1 protein_id gnl|my_center|LOCUS_39660 2135 2845 gene locus_tag LOCUS_39670 2135 2845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39670 2898 3179 gene locus_tag LOCUS_39680 2898 3179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39680 >Feature sequence0894 189 1139 gene locus_tag LOCUS_39690 189 1139 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967749.1 protein_id gnl|my_center|LOCUS_39690 1287 2081 gene locus_tag LOCUS_39700 1287 2081 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729455.1 protein_id gnl|my_center|LOCUS_39700 >Feature sequence0895 1591 668 gene locus_tag LOCUS_39710 1591 668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39710 2140 1613 gene locus_tag LOCUS_39720 2140 1613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39720 >Feature sequence0896 2482 752 gene locus_tag LOCUS_39730 2482 752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39730 3054 2464 gene locus_tag LOCUS_39740 3054 2464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39740 >Feature sequence0897 444 1745 gene locus_tag LOCUS_39750 444 1745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39750 1755 2552 gene locus_tag LOCUS_39760 1755 2552 CDS product LytTR family transcriptional regulator DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460946.1 protein_id gnl|my_center|LOCUS_39760 3064 2765 gene locus_tag LOCUS_39770 3064 2765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39770 >Feature sequence0898 1376 426 gene locus_tag LOCUS_39780 1376 426 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528455.1 protein_id gnl|my_center|LOCUS_39780 2517 2005 gene locus_tag LOCUS_39790 2517 2005 CDS product cytochrome P460 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084016.1 protein_id gnl|my_center|LOCUS_39790 3016 2615 gene locus_tag LOCUS_39800 3016 2615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39800 3392 2931 gene locus_tag LOCUS_39810 3392 2931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39810 >Feature sequence0899 <3419 1895 gene locus_tag LOCUS_39820 <3419 1895 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010946829.1:efflux RND transporter periplasmic adaptor subunit >Feature sequence0900 <1 686 gene locus_tag LOCUS_39830 <1 686 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257346.1:3-oxoacyl-[acyl-carrier-protein] reductase 1946 1029 gene locus_tag LOCUS_39840 1946 1029 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142979.1 protein_id gnl|my_center|LOCUS_39840 2040 3176 gene locus_tag LOCUS_39850 gene prpC 2040 3176 CDS product 2-methylcitrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070709.1 protein_id gnl|my_center|LOCUS_39850 >Feature sequence0901 <1 922 gene locus_tag LOCUS_39860 <1 922 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011085023.1:LLM class flavin-dependent oxidoreductase 919 2571 gene locus_tag LOCUS_39870 gene almE 919 2571 CDS product lipid A modification system glycine--protein ligase AlmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001146752.1 protein_id gnl|my_center|LOCUS_39870 2587 2880 gene locus_tag LOCUS_39880 2587 2880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39880 >Feature sequence0902 747 1403 gene locus_tag LOCUS_39890 747 1403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39890 1658 2242 gene locus_tag LOCUS_39900 1658 2242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39900 2675 2878 gene locus_tag LOCUS_39910 2675 2878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39910 >Feature sequence0903 489 815 gene locus_tag LOCUS_39920 489 815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39920 1136 1747 gene locus_tag LOCUS_39930 1136 1747 CDS product superoxide dismutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012660625.1 protein_id gnl|my_center|LOCUS_39930 2016 3251 gene locus_tag LOCUS_39940 2016 3251 CDS product LL-diaminopimelate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057937.1 protein_id gnl|my_center|LOCUS_39940 >Feature sequence0904 8 1225 gene locus_tag LOCUS_39950 8 1225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39950 1259 3310 gene locus_tag LOCUS_39960 1259 3310 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123734.1 protein_id gnl|my_center|LOCUS_39960 >Feature sequence0905 1805 1119 gene locus_tag LOCUS_39970 1805 1119 CDS product glucose-1-phosphate thymidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583981.1 protein_id gnl|my_center|LOCUS_39970 <3405 2263 gene locus_tag LOCUS_39980 <3405 2263 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010883567.1:cysteine--tRNA ligase >Feature sequence0906 >Feature sequence0907 >Feature sequence0908 3388 2768 gene locus_tag LOCUS_39990 3388 2768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39990 >Feature sequence0909 1448 336 gene locus_tag LOCUS_40000 1448 336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729753.1 protein_id gnl|my_center|LOCUS_40000 2056 1574 gene locus_tag LOCUS_40010 2056 1574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40010 2935 2057 gene locus_tag LOCUS_40020 2935 2057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40020 >Feature sequence0910 <1 806 gene locus_tag LOCUS_40030 <1 806 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011338470.1:MATE family efflux transporter 1269 2561 gene locus_tag LOCUS_40040 gene hemL 1269 2561 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228305.1 protein_id gnl|my_center|LOCUS_40040 3078 2707 gene locus_tag LOCUS_40050 3078 2707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40050 3387 3235 gene locus_tag LOCUS_40060 3387 3235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40060 >Feature sequence0911 1897 1412 gene locus_tag LOCUS_40070 1897 1412 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933626.1 protein_id gnl|my_center|LOCUS_40070 2695 2336 gene locus_tag LOCUS_40080 2695 2336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40080 >Feature sequence0912 2508 739 gene locus_tag LOCUS_40090 gene ctaD 2508 739 CDS product cytochrome c oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142160.1 protein_id gnl|my_center|LOCUS_40090 <3383 2531 gene locus_tag LOCUS_40100 <3383 2531 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_136496851.1:cytochrome c oxidase subunit II >Feature sequence0913 2985 2383 gene locus_tag LOCUS_40110 gene pyrE 2985 2383 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460653.1 protein_id gnl|my_center|LOCUS_40110 3340 2957 gene locus_tag LOCUS_40120 3340 2957 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259566.1 protein_id gnl|my_center|LOCUS_40120 >Feature sequence0914 444 2087 gene locus_tag LOCUS_40130 444 2087 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020664.1 protein_id gnl|my_center|LOCUS_40130 2406 2747 gene locus_tag LOCUS_40140 2406 2747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40140 <3381 2866 gene locus_tag LOCUS_40150 <3381 2866 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_122195341.1:GNAT family N-acetyltransferase >Feature sequence0915 2812 1745 gene locus_tag LOCUS_40160 2812 1745 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975437.1 protein_id gnl|my_center|LOCUS_40160 >Feature sequence0916 <1 556 gene locus_tag LOCUS_40170 <1 556 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002295350.1:NADP-dependent phosphogluconate dehydrogenase 904 1815 gene locus_tag LOCUS_40180 gene folD 904 1815 CDS product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002666926.1 protein_id gnl|my_center|LOCUS_40180 1973 3271 gene locus_tag LOCUS_40190 gene lysA 1973 3271 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545292.1 protein_id gnl|my_center|LOCUS_40190 >Feature sequence0917 201 353 gene locus_tag LOCUS_40200 201 353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40200 354 896 gene locus_tag LOCUS_40210 354 896 CDS product haloacid dehalogenase type II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532669.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_40210 1547 999 gene locus_tag LOCUS_40220 1547 999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40220 1730 1915 gene locus_tag LOCUS_40230 1730 1915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40230 2890 3210 gene locus_tag LOCUS_40240 2890 3210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40240 >Feature sequence0918 907 449 gene locus_tag LOCUS_40250 907 449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_40250 1292 2212 gene locus_tag LOCUS_40260 1292 2212 CDS product sulfonate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091913.1 protein_id gnl|my_center|LOCUS_40260 2353 2964 gene locus_tag LOCUS_40270 2353 2964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40270 >Feature sequence0919 4 927 gene locus_tag LOCUS_40280 4 927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40280 1358 2215 gene locus_tag LOCUS_40290 1358 2215 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532185.1 protein_id gnl|my_center|LOCUS_40290 >Feature sequence0920 >Feature sequence0921 410 805 gene locus_tag LOCUS_40300 410 805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40300 1155 940 gene locus_tag LOCUS_40310 1155 940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40310 <3368 1145 gene locus_tag LOCUS_40320 <3368 1145 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011986841.1:Stk1 family PASTA domain-containing Ser/Thr kinase >Feature sequence0922 2422 884 gene locus_tag LOCUS_40330 2422 884 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046694565.1 protein_id gnl|my_center|LOCUS_40330 >Feature sequence0923 718 2019 gene locus_tag LOCUS_40340 718 2019 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763569.1 protein_id gnl|my_center|LOCUS_40340 2012 3097 gene locus_tag LOCUS_40350 2012 3097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40350 >Feature sequence0924 1237 326 gene locus_tag LOCUS_40360 1237 326 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064242817.1 protein_id gnl|my_center|LOCUS_40360 2871 1339 gene locus_tag LOCUS_40370 gene gguA 2871 1339 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080606.1 protein_id gnl|my_center|LOCUS_40370 >Feature sequence0925 <1 2042 gene locus_tag LOCUS_40380 <1 2042 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_171602985.1:adenylate/guanylate cyclase domain-containing protein 2336 2833 gene locus_tag LOCUS_40390 2336 2833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40390 >Feature sequence0926 1793 501 gene locus_tag LOCUS_40400 1793 501 CDS product diadenylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144122.1 protein_id gnl|my_center|LOCUS_40400 >Feature sequence0927 494 90 gene locus_tag LOCUS_40410 494 90 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40410 2270 621 gene locus_tag LOCUS_40420 gene hutU 2270 621 CDS product urocanate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000416707.1 protein_id gnl|my_center|LOCUS_40420 3355 2459 gene locus_tag LOCUS_40430 3355 2459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40430 >Feature sequence0928 763 1359 gene locus_tag LOCUS_40440 gene gmhA 763 1359 CDS product D-sedoheptulose 7-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016435.1 protein_id gnl|my_center|LOCUS_40440 1688 2746 gene locus_tag LOCUS_40450 1688 2746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40450 >Feature sequence0929 1014 634 gene locus_tag LOCUS_40460 1014 634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40460 >Feature sequence0930 102 734 gene locus_tag LOCUS_40470 102 734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_40470 1105 1950 gene locus_tag LOCUS_40480 1105 1950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40480 >Feature sequence0931 1164 1343 gene locus_tag LOCUS_40490 1164 1343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40490 >Feature sequence0932 1457 2191 gene locus_tag LOCUS_40500 1457 2191 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000868621.1 protein_id gnl|my_center|LOCUS_40500 <3351 2343 gene locus_tag LOCUS_40510 <3351 2343 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010989618.1:glycosyltransferase family 2 protein >Feature sequence0933 178 2316 gene locus_tag LOCUS_40520 178 2316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40520 2346 2723 gene locus_tag LOCUS_40530 2346 2723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40530 2841 3005 gene locus_tag LOCUS_40540 2841 3005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40540 3031 3294 gene locus_tag LOCUS_40550 3031 3294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40550 >Feature sequence0934 223 89 gene locus_tag LOCUS_40560 223 89 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40560 2085 2447 gene locus_tag LOCUS_40570 2085 2447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40570 >Feature sequence0935 >Feature sequence0936 <1 1636 gene locus_tag LOCUS_40580 <1 1636 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012259345.1:CHAT domain-containing protein 1614 3131 gene locus_tag LOCUS_40590 1614 3131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40590 >Feature sequence0937 296 1816 gene locus_tag LOCUS_40600 296 1816 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087652.1 protein_id gnl|my_center|LOCUS_40600 1895 2869 gene locus_tag LOCUS_40610 1895 2869 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087653.1 protein_id gnl|my_center|LOCUS_40610 >Feature sequence0938 175 474 gene locus_tag LOCUS_40620 175 474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40620 519 818 gene locus_tag LOCUS_40630 519 818 CDS product DUF1330 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028171395.1 protein_id gnl|my_center|LOCUS_40630 2592 1921 gene locus_tag LOCUS_40640 2592 1921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40640 >Feature sequence0939 869 153 gene locus_tag LOCUS_40650 869 153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40650 2141 969 gene locus_tag LOCUS_40660 2141 969 CDS product FIST C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140828.1 protein_id gnl|my_center|LOCUS_40660 2286 2921 gene locus_tag LOCUS_40670 2286 2921 CDS product phosphopantothenate--cysteine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014636373.1 protein_id gnl|my_center|LOCUS_40670 3174 3248 gene locus_tag LOCUS_t00290 3174 3248 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence0940 1184 1109 gene locus_tag LOCUS_t00300 1184 1109 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 1531 1455 gene locus_tag LOCUS_t00310 1531 1455 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence0941 1397 1699 gene locus_tag LOCUS_40680 1397 1699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40680 2720 1839 gene locus_tag LOCUS_40690 2720 1839 CDS product ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004534169.1 protein_id gnl|my_center|LOCUS_40690 >Feature sequence0942 1179 214 gene locus_tag LOCUS_40700 1179 214 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005113004.1 protein_id gnl|my_center|LOCUS_40700 2312 1176 gene locus_tag LOCUS_40710 2312 1176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40710 2581 2294 gene locus_tag LOCUS_40720 2581 2294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40720 >Feature sequence0943 569 291 gene locus_tag LOCUS_40730 569 291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40730 1047 694 gene locus_tag LOCUS_40740 1047 694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40740 1191 1313 gene locus_tag LOCUS_40750 1191 1313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40750 1729 1965 gene locus_tag LOCUS_40760 1729 1965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40760 1992 2171 gene locus_tag LOCUS_40770 1992 2171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40770 2845 3033 gene locus_tag LOCUS_40780 2845 3033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40780 >Feature sequence0944 136 1383 gene locus_tag LOCUS_40790 136 1383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_40790 1957 1706 gene locus_tag LOCUS_40800 1957 1706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40800 2350 3129 gene locus_tag LOCUS_40810 2350 3129 CDS product Ku protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958550.1 protein_id gnl|my_center|LOCUS_40810 >Feature sequence0945 316 1545 gene locus_tag LOCUS_40820 316 1545 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017657362.1 protein_id gnl|my_center|LOCUS_40820 2402 1839 gene locus_tag LOCUS_40830 2402 1839 CDS product phosphatidylethanolamine N-methyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064509340.1 protein_id gnl|my_center|LOCUS_40830 3114 2551 gene locus_tag LOCUS_40840 3114 2551 CDS product phosphatidylethanolamine N-methyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064509340.1 protein_id gnl|my_center|LOCUS_40840 >Feature sequence0946 2067 520 gene locus_tag LOCUS_40850 2067 520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40850 <3312 2442 gene locus_tag LOCUS_40860 <3312 2442 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_236615746.1:sugar phosphate isomerase/epimerase >Feature sequence0947 1649 1305 gene locus_tag LOCUS_40870 1649 1305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40870 1989 2501 gene locus_tag LOCUS_40880 1989 2501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40880 >Feature sequence0948 891 145 gene locus_tag LOCUS_40890 891 145 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036631.1 protein_id gnl|my_center|LOCUS_40890 2290 1370 gene locus_tag LOCUS_40900 2290 1370 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143217.1 protein_id gnl|my_center|LOCUS_40900 >Feature sequence0949 2395 2009 gene locus_tag LOCUS_40910 2395 2009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40910 2941 2435 gene locus_tag LOCUS_40920 2941 2435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40920 >Feature sequence0950 3229 1967 gene locus_tag LOCUS_40930 gene nusA 3229 1967 CDS product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024311294.1 protein_id gnl|my_center|LOCUS_40930 >Feature sequence0951 1539 1093 gene locus_tag LOCUS_40940 gene rplO 1539 1093 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393918.1 protein_id gnl|my_center|LOCUS_40940 2112 1603 gene locus_tag LOCUS_40950 gene rpsE 2112 1603 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393920.1 protein_id gnl|my_center|LOCUS_40950 2474 2118 gene locus_tag LOCUS_40960 gene rplR 2474 2118 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081803.1 protein_id gnl|my_center|LOCUS_40960 3027 2488 gene locus_tag LOCUS_40970 gene rplF 3027 2488 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869914.1 protein_id gnl|my_center|LOCUS_40970 >Feature sequence0952 1460 141 gene locus_tag LOCUS_40980 1460 141 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194658.1 protein_id gnl|my_center|LOCUS_40980 1855 1547 gene locus_tag LOCUS_40990 1855 1547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40990 <3296 1898 gene locus_tag LOCUS_41000 <3296 1898 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013224493.1:sodium:solute symporter >Feature sequence0953 <1 900 gene locus_tag LOCUS_41010 <1 900 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011229107.1:FdhF/YdeP family oxidoreductase 2846 2514 gene locus_tag LOCUS_41020 2846 2514 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729618.1 protein_id gnl|my_center|LOCUS_41020 >Feature sequence0954 701 456 gene locus_tag LOCUS_41030 701 456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41030 875 717 gene locus_tag LOCUS_41040 875 717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41040 1256 939 gene locus_tag LOCUS_41050 1256 939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41050 <3290 2453 gene locus_tag LOCUS_41060 <3290 2453 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005809852.1:DNA ligase D >Feature sequence0955 1098 1985 gene locus_tag LOCUS_41070 1098 1985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41070 2324 2067 gene locus_tag LOCUS_41080 2324 2067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41080 2477 2355 gene locus_tag LOCUS_41090 2477 2355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41090 2853 3176 gene locus_tag LOCUS_41100 2853 3176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41100 >Feature sequence0956 1330 2019 gene locus_tag LOCUS_41110 1330 2019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41110 2914 2024 gene locus_tag LOCUS_41120 2914 2024 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257988.1 protein_id gnl|my_center|LOCUS_41120 >Feature sequence0957 1230 781 gene locus_tag LOCUS_41130 1230 781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41130 1638 2084 gene locus_tag LOCUS_41140 gene cynS 1638 2084 CDS product cyanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896757.1 protein_id gnl|my_center|LOCUS_41140 2620 2955 gene locus_tag LOCUS_41150 gene glnB 2620 2955 CDS product nitrogen regulatory protein P-II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073353.1 protein_id gnl|my_center|LOCUS_41150 >Feature sequence0958 >Feature sequence0959 130 948 gene locus_tag LOCUS_41160 130 948 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971351.1 protein_id gnl|my_center|LOCUS_41160 945 1193 gene locus_tag LOCUS_41170 945 1193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41170 2323 1352 gene locus_tag LOCUS_41180 2323 1352 CDS product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970027.1 protein_id gnl|my_center|LOCUS_41180 <3281 2709 gene locus_tag LOCUS_41190 <3281 2709 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010970033.1:FGGY-family carbohydrate kinase >Feature sequence0960 975 241 gene locus_tag LOCUS_41200 975 241 CDS product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391693.1 protein_id gnl|my_center|LOCUS_41200 1330 2211 gene locus_tag LOCUS_41210 gene hemB 1330 2211 CDS product porphobilinogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460178.1 protein_id gnl|my_center|LOCUS_41210 2466 2906 gene locus_tag LOCUS_41220 2466 2906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41220 >Feature sequence0961 <1 765 gene locus_tag LOCUS_41230 <1 765 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_037391516.1:potassium-transporting ATPase subunit KdpB 798 1394 gene locus_tag LOCUS_41240 798 1394 CDS product K(+)-transporting ATPase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405322.1 protein_id gnl|my_center|LOCUS_41240 1674 2804 gene locus_tag LOCUS_41250 1674 2804 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940592.1 protein_id gnl|my_center|LOCUS_41250 >Feature sequence0962 >Feature sequence0963 573 1652 gene locus_tag LOCUS_41260 573 1652 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722143.1 protein_id gnl|my_center|LOCUS_41260 1953 2963 gene locus_tag LOCUS_41270 1953 2963 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144109.1 protein_id gnl|my_center|LOCUS_41270 >Feature sequence0964 998 513 gene locus_tag LOCUS_41280 gene queF 998 513 CDS product preQ(1) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003689837.1 protein_id gnl|my_center|LOCUS_41280 2239 1241 gene locus_tag LOCUS_41290 2239 1241 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036002.1 protein_id gnl|my_center|LOCUS_41290 >Feature sequence0965 3171 1846 gene locus_tag LOCUS_41300 3171 1846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41300 >Feature sequence0966 541 389 gene locus_tag LOCUS_41310 541 389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41310 1884 1675 gene locus_tag LOCUS_41320 1884 1675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41320 2161 1895 gene locus_tag LOCUS_41330 2161 1895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41330 2444 2914 gene locus_tag LOCUS_41340 2444 2914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41340 >Feature sequence0967 396 2027 gene locus_tag LOCUS_41350 396 2027 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114382.1 protein_id gnl|my_center|LOCUS_41350 2704 2024 gene locus_tag LOCUS_41360 2704 2024 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228785.1 protein_id gnl|my_center|LOCUS_41360 >Feature sequence0968 1070 1807 gene locus_tag LOCUS_41370 1070 1807 CDS product type 1 glutamine amidotransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294671.1 protein_id gnl|my_center|LOCUS_41370 1820 2608 gene locus_tag LOCUS_41380 1820 2608 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090466.1 protein_id gnl|my_center|LOCUS_41380 >Feature sequence0969 67 237 gene locus_tag LOCUS_41390 67 237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41390 1558 2571 gene locus_tag LOCUS_41400 1558 2571 CDS product zinc-binding alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142257.1 protein_id gnl|my_center|LOCUS_41400 <3253 2578 gene locus_tag LOCUS_41410 <3253 2578 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011086955.1:winged helix-turn-helix domain-containing protein >Feature sequence0970 <1 861 gene locus_tag LOCUS_41420 <1 861 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001891150.1:ribose ABC transporter permease 1283 1477 gene locus_tag LOCUS_41430 1283 1477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41430 1494 2261 gene locus_tag LOCUS_41440 1494 2261 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969908.1 protein_id gnl|my_center|LOCUS_41440 2783 2466 gene locus_tag LOCUS_41450 2783 2466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41450 >Feature sequence0971 939 190 gene locus_tag LOCUS_41460 939 190 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943289.1 protein_id gnl|my_center|LOCUS_41460 3081 1426 gene locus_tag LOCUS_41470 3081 1426 CDS product putative manganese-dependent inorganic diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326733.1 protein_id gnl|my_center|LOCUS_41470 >Feature sequence0972 496 1158 gene locus_tag LOCUS_41480 496 1158 CDS product type 1 glutamine amidotransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037891.1 protein_id gnl|my_center|LOCUS_41480 1717 2031 gene locus_tag LOCUS_41490 1717 2031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41490 2675 2160 gene locus_tag LOCUS_41500 2675 2160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41500 >Feature sequence0973 <1 972 gene locus_tag LOCUS_41510 <1 972 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_009058447.1:HD domain-containing protein <3231 1356 gene locus_tag LOCUS_41520 <3231 1356 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943409.1:efflux RND transporter permease subunit >Feature sequence0974 695 306 gene locus_tag LOCUS_41530 695 306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41530 890 1789 gene locus_tag LOCUS_41540 890 1789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41540 1941 2891 gene locus_tag LOCUS_41550 1941 2891 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393400.1 protein_id gnl|my_center|LOCUS_41550 >Feature sequence0975 3225 1906 gene locus_tag LOCUS_41560 3225 1906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41560 >Feature sequence0976 427 2313 gene locus_tag LOCUS_41570 gene ilvB 427 2313 CDS product biosynthetic-type acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880257.1 protein_id gnl|my_center|LOCUS_41570 >Feature sequence0977 <1 2563 gene locus_tag LOCUS_41580 <1 2563 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011144060.1:serine/threonine-protein kinase 3227 2856 gene locus_tag LOCUS_41590 3227 2856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41590 >Feature sequence0978 1426 1268 gene locus_tag LOCUS_41600 1426 1268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41600 >Feature sequence0979 286 729 gene locus_tag LOCUS_41610 286 729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41610 <3222 1082 gene locus_tag LOCUS_41620 <3222 1082 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013223297.1:alkaline phosphatase family protein >Feature sequence0980 334 149 gene locus_tag LOCUS_41630 334 149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41630 950 579 gene locus_tag LOCUS_41640 950 579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41640 1495 962 gene locus_tag LOCUS_41650 1495 962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41650 <3221 2069 gene locus_tag LOCUS_41660 <3221 2069 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010922066.1:AAA family ATPase >Feature sequence0981 707 1567 gene locus_tag LOCUS_41670 707 1567 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226917.1 protein_id gnl|my_center|LOCUS_41670 1601 2446 gene locus_tag LOCUS_41680 1601 2446 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088041.1 protein_id gnl|my_center|LOCUS_41680 >Feature sequence0982 822 2498 gene locus_tag LOCUS_41690 822 2498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41690 >Feature sequence0983 993 1676 gene locus_tag LOCUS_41700 993 1676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41700 >Feature sequence0984 1539 2324 gene locus_tag LOCUS_41710 1539 2324 CDS product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080418.1 protein_id gnl|my_center|LOCUS_41710 2305 3198 gene locus_tag LOCUS_41720 2305 3198 CDS product class II fructose-bisphosphate aldolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142528.1 protein_id gnl|my_center|LOCUS_41720 >Feature sequence0985 1614 328 gene locus_tag LOCUS_41730 1614 328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41730 2770 1742 gene locus_tag LOCUS_41740 2770 1742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41740 >Feature sequence0986 2265 703 gene locus_tag LOCUS_41750 2265 703 CDS product phytoene desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007334293.1 protein_id gnl|my_center|LOCUS_41750 2354 3184 gene locus_tag LOCUS_41760 2354 3184 CDS product cobalamin-dependent protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258543.1 protein_id gnl|my_center|LOCUS_41760 >Feature sequence0987 834 1049 gene locus_tag LOCUS_41770 834 1049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41770 2796 2071 gene locus_tag LOCUS_41780 2796 2071 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531519.1 protein_id gnl|my_center|LOCUS_41780 >Feature sequence0988 412 654 gene locus_tag LOCUS_41790 gene mazE 412 654 CDS product type II toxin-antitoxin system antitoxin MazE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000581940.1 protein_id gnl|my_center|LOCUS_41790 654 986 gene locus_tag LOCUS_41800 gene mazF 654 986 CDS product endoribonuclease MazF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000254750.1 protein_id gnl|my_center|LOCUS_41800 1286 1465 gene locus_tag LOCUS_41810 1286 1465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41810 1450 1575 gene locus_tag LOCUS_41820 1450 1575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41820 >Feature sequence0989 <1 1132 gene locus_tag LOCUS_41830 <1 1132 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005765121.1:aldose 1-epimerase family protein 1992 1300 gene locus_tag LOCUS_41840 1992 1300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41840 <3189 2121 gene locus_tag LOCUS_41850 <3189 2121 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013226511.1:MFS transporter >Feature sequence0990 187 723 gene locus_tag LOCUS_41860 187 723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41860 1080 1152 gene locus_tag LOCUS_t00320 1080 1152 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence0991 2143 242 gene locus_tag LOCUS_41870 2143 242 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582684.1 protein_id gnl|my_center|LOCUS_41870 2709 2302 gene locus_tag LOCUS_41880 2709 2302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41880 >Feature sequence0992 1668 1991 gene locus_tag LOCUS_41890 1668 1991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_41890 2681 2532 gene locus_tag LOCUS_41900 2681 2532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41900 >Feature sequence0993 1502 543 gene locus_tag LOCUS_41910 1502 543 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257102.1 protein_id gnl|my_center|LOCUS_41910 2278 1556 gene locus_tag LOCUS_41920 gene phoU 2278 1556 CDS product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941756.1 protein_id gnl|my_center|LOCUS_41920 <3177 2580 gene locus_tag LOCUS_41930 <3177 2580 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002225071.1:arginine--tRNA ligase >Feature sequence0994 1341 2336 gene locus_tag LOCUS_41940 1341 2336 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530853.1 protein_id gnl|my_center|LOCUS_41940 2659 2363 gene locus_tag LOCUS_41950 2659 2363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41950 3054 2659 gene locus_tag LOCUS_41960 3054 2659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41960 >Feature sequence0995 1569 475 gene locus_tag LOCUS_41970 1569 475 CDS product nitronate monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036394.1 protein_id gnl|my_center|LOCUS_41970 1904 1671 gene locus_tag LOCUS_41980 1904 1671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41980 1980 2879 gene locus_tag LOCUS_41990 1980 2879 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532847.1 protein_id gnl|my_center|LOCUS_41990 >Feature sequence0996 <1 752 gene locus_tag LOCUS_42000 <1 752 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_023619652.1:SDR family oxidoreductase 1363 905 gene locus_tag LOCUS_42010 1363 905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42010 1720 2106 gene locus_tag LOCUS_42020 1720 2106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42020 2486 2337 gene locus_tag LOCUS_42030 2486 2337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42030 >Feature sequence0997 1178 1501 gene locus_tag LOCUS_42040 1178 1501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42040 3168 2860 gene locus_tag LOCUS_42050 3168 2860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42050 >Feature sequence0998 702 1376 gene locus_tag LOCUS_42060 702 1376 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206235.1 protein_id gnl|my_center|LOCUS_42060 2070 1438 gene locus_tag LOCUS_42070 2070 1438 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393101.1 protein_id gnl|my_center|LOCUS_42070 <3166 2341 gene locus_tag LOCUS_42080 <3166 2341 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013228703.1:sugar phosphate isomerase/epimerase >Feature sequence0999 353 1009 gene locus_tag LOCUS_42090 353 1009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42090 1613 903 gene locus_tag LOCUS_42100 gene araD 1613 903 CDS product L-ribulose-5-phosphate 4-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000888652.1 protein_id gnl|my_center|LOCUS_42100 <3164 1832 gene locus_tag LOCUS_42110 <3164 1832 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010965898.1:L-fucose/L-arabinose isomerase family protein >Feature sequence1000 767 75 gene locus_tag LOCUS_42120 767 75 CDS product phosphoribosylanthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003687611.1 protein_id gnl|my_center|LOCUS_42120 905 1213 gene locus_tag LOCUS_42130 905 1213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42130 2311 1238 gene locus_tag LOCUS_42140 gene recF 2311 1238 CDS product DNA replication/repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726603.1 protein_id gnl|my_center|LOCUS_42140 <3164 2519 gene locus_tag LOCUS_42150 <3164 2519 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011705316.1:tRNA 2-thiouridine(34) synthase MnmA >Feature sequence1001 >Feature sequence1002 2423 573 gene locus_tag LOCUS_42160 gene glmS 2423 573 CDS product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328387.1 protein_id gnl|my_center|LOCUS_42160 2664 2491 gene locus_tag LOCUS_42170 2664 2491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42170 >Feature sequence1003 833 603 gene locus_tag LOCUS_42180 833 603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42180 1280 990 gene locus_tag LOCUS_42190 1280 990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42190 1359 1526 gene locus_tag LOCUS_42200 1359 1526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42200 1519 1806 gene locus_tag LOCUS_42210 1519 1806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42210 >Feature sequence1004 <3156 2370 gene locus_tag LOCUS_42220 <3156 2370 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013229769.1:ATP-binding protein >Feature sequence1005 299 715 gene locus_tag LOCUS_42230 299 715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42230 1042 1680 gene locus_tag LOCUS_42240 1042 1680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42240 >Feature sequence1006 641 1159 gene locus_tag LOCUS_42250 641 1159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42250 3125 2433 gene locus_tag LOCUS_42260 3125 2433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42260 >Feature sequence1007 <1 1167 gene locus_tag LOCUS_42270 <1 1167 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_024265799.1:hydantoinase B/oxoprolinase family protein 1164 1736 gene locus_tag LOCUS_42280 1164 1736 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929042.1 protein_id gnl|my_center|LOCUS_42280 2831 1785 gene locus_tag LOCUS_42290 2831 1785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42290 >Feature sequence1008 >Feature sequence1009 <1 963 gene locus_tag LOCUS_42300 <1 963 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_118840152.1:ATP-binding protein 1636 2487 gene locus_tag LOCUS_42310 1636 2487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42310 >Feature sequence1010 1969 2679 gene locus_tag LOCUS_42320 1969 2679 CDS product CGNR zinc finger domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161533709.1 protein_id gnl|my_center|LOCUS_42320 >Feature sequence1011 >Feature sequence1012 <1 742 gene locus_tag LOCUS_42330 <1 742 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010937401.1:GDP-L-fucose synthase 747 1430 gene locus_tag LOCUS_42340 747 1430 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682399.1 protein_id gnl|my_center|LOCUS_42340 <3134 1693 gene locus_tag LOCUS_42350 <3134 1693 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_118839113.1:acyl-CoA dehydrogenase >Feature sequence1013 1748 573 gene locus_tag LOCUS_42360 gene carA 1748 573 CDS product glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921837.1 protein_id gnl|my_center|LOCUS_42360 <3127 2054 gene locus_tag LOCUS_42370 <3127 2054 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013531089.1:winged helix-turn-helix domain-containing protein >Feature sequence1014 1627 851 gene locus_tag LOCUS_42380 1627 851 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143673.1 protein_id gnl|my_center|LOCUS_42380 2485 1634 gene locus_tag LOCUS_42390 gene fba 2485 1634 CDS product class II fructose-1,6-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392146.1 protein_id gnl|my_center|LOCUS_42390 <3123 2526 gene locus_tag LOCUS_42400 <3123 2526 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_028170688.1:dihydroxyacetone kinase subunit DhaK >Feature sequence1015 647 1174 gene locus_tag LOCUS_42410 647 1174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42410 2536 1490 gene locus_tag LOCUS_42420 2536 1490 CDS product low specificity L-threonine aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944019.1 protein_id gnl|my_center|LOCUS_42420 2994 2533 gene locus_tag LOCUS_42430 2994 2533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42430 >Feature sequence1016 1569 658 gene locus_tag LOCUS_42440 1569 658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42440 2427 2215 gene locus_tag LOCUS_42450 2427 2215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_42450 >Feature sequence1017 798 1547 gene locus_tag LOCUS_42460 798 1547 CDS product 2OG-Fe(II) oxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530732.1 protein_id gnl|my_center|LOCUS_42460 1839 2414 gene locus_tag LOCUS_42470 1839 2414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_42470 2420 2641 gene locus_tag LOCUS_42480 2420 2641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_42480 >Feature sequence1018 261 94 gene locus_tag LOCUS_42490 261 94 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42490 279 1052 gene locus_tag LOCUS_42500 279 1052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42500 1763 1335 gene locus_tag LOCUS_42510 gene ybgC 1763 1335 CDS product tol-pal system-associated acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086124.1 protein_id gnl|my_center|LOCUS_42510 <3093 1838 gene locus_tag LOCUS_42520 <3093 1838 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010932948.1:thioredoxin domain-containing protein >Feature sequence1019 359 670 gene locus_tag LOCUS_42530 359 670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42530 781 1065 gene locus_tag LOCUS_42540 781 1065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42540 2395 2871 gene locus_tag LOCUS_42550 2395 2871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42550 >Feature sequence1020 829 1002 gene locus_tag LOCUS_42560 829 1002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42560 1050 2057 gene locus_tag LOCUS_42570 1050 2057 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082273.1 protein_id gnl|my_center|LOCUS_42570 >Feature sequence1021 1341 850 gene locus_tag LOCUS_42580 gene ppiB 1341 850 CDS product peptidylprolyl isomerase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000256002.1 protein_id gnl|my_center|LOCUS_42580 2149 1454 gene locus_tag LOCUS_42590 2149 1454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42590 3079 2201 gene locus_tag LOCUS_42600 3079 2201 CDS product LD-carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100070.1 protein_id gnl|my_center|LOCUS_42600 >Feature sequence1022 1578 163 gene locus_tag LOCUS_42610 1578 163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42610 2131 1712 gene locus_tag LOCUS_42620 2131 1712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42620 <3089 2482 gene locus_tag LOCUS_42630 <3089 2482 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_051618838.1:sugar-binding transcriptional regulator >Feature sequence1023 <1 645 gene locus_tag LOCUS_42640 <1 645 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008770127.1:galactose mutarotase 668 2725 gene locus_tag LOCUS_42650 668 2725 CDS product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967085.1 protein_id gnl|my_center|LOCUS_42650 >Feature sequence1024 1362 886 gene locus_tag LOCUS_42660 1362 886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42660 2075 1455 gene locus_tag LOCUS_42670 2075 1455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42670 >Feature sequence1025 2041 407 gene locus_tag LOCUS_42680 2041 407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42680 2787 2398 gene locus_tag LOCUS_42690 2787 2398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42690 >Feature sequence1026 2484 34 gene locus_tag LOCUS_42700 2484 34 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42700 >Feature sequence1027 <1 658 gene locus_tag LOCUS_42710 <1 658 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_037393367.1:GMC family oxidoreductase 1748 1314 gene locus_tag LOCUS_42720 1748 1314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42720 2159 1752 gene locus_tag LOCUS_42730 2159 1752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42730 2815 2156 gene locus_tag LOCUS_42740 gene rpe 2815 2156 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000589966.1 protein_id gnl|my_center|LOCUS_42740 >Feature sequence1028 2944 1145 gene locus_tag LOCUS_42750 2944 1145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42750 >Feature sequence1029 230 472 gene locus_tag LOCUS_42760 230 472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42760 469 1578 gene locus_tag LOCUS_42770 469 1578 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024341.1 protein_id gnl|my_center|LOCUS_42770 1648 2757 gene locus_tag LOCUS_42780 1648 2757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42780 >Feature sequence1030 72 665 gene locus_tag LOCUS_42790 72 665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42790 669 842 gene locus_tag LOCUS_42800 gene rpmG 669 842 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933041.1 protein_id gnl|my_center|LOCUS_42800 846 1085 gene locus_tag LOCUS_42810 846 1085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42810 >Feature sequence1031 339 710 gene locus_tag LOCUS_42820 339 710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42820 1124 2827 gene locus_tag LOCUS_42830 1124 2827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42830 >Feature sequence1032 1082 321 gene locus_tag LOCUS_42840 1082 321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42840 1918 1130 gene locus_tag LOCUS_42850 1918 1130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42850 2173 2664 gene locus_tag LOCUS_42860 2173 2664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42860 >Feature sequence1033 919 2403 gene locus_tag LOCUS_42870 919 2403 CDS product DUF1254 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087657.1 protein_id gnl|my_center|LOCUS_42870 >Feature sequence1034 <1 502 gene locus_tag LOCUS_42880 <1 502 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010972767.1:carbohydrate ABC transporter permease 732 1733 gene locus_tag LOCUS_42890 732 1733 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876508.1 protein_id gnl|my_center|LOCUS_42890 1738 2100 gene locus_tag LOCUS_42900 1738 2100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42900 >Feature sequence1035 1495 434 gene locus_tag LOCUS_42910 gene hydE 1495 434 CDS product [FeFe] hydrogenase H-cluster radical SAM maturase HydE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393236.1 protein_id gnl|my_center|LOCUS_42910 <3069 1525 gene locus_tag LOCUS_42920 <3069 1525 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010881391.1:oxygen-independent coproporphyrinogen III oxidase >Feature sequence1036 1648 974 gene locus_tag LOCUS_42930 1648 974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42930 2489 1914 gene locus_tag LOCUS_42940 2489 1914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42940 >Feature sequence1037 846 1934 gene locus_tag LOCUS_42950 846 1934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42950 <3068 2409 gene locus_tag LOCUS_42960 <3068 2409 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011107422.1:aspartate-alanine antiporter >Feature sequence1038 242 1327 gene locus_tag LOCUS_42970 gene ampH 242 1327 CDS product D-alanyl-D-alanine-carboxypeptidase/endopeptidase AmpH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002228026.1 protein_id gnl|my_center|LOCUS_42970 1383 2141 gene locus_tag LOCUS_42980 1383 2141 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811135.1 protein_id gnl|my_center|LOCUS_42980 >Feature sequence1039 402 1736 gene locus_tag LOCUS_42990 402 1736 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393149.1 protein_id gnl|my_center|LOCUS_42990 <3066 2281 gene locus_tag LOCUS_43000 <3066 2281 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012258747.1:NADP-dependent isocitrate dehydrogenase >Feature sequence1040 226 1077 gene locus_tag LOCUS_43010 226 1077 CDS product phosphate/phosphite/phosphonate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010950573.1 protein_id gnl|my_center|LOCUS_43010 2552 1521 gene locus_tag LOCUS_43020 2552 1521 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003408279.1 protein_id gnl|my_center|LOCUS_43020 >Feature sequence1041 916 2598 gene locus_tag LOCUS_43030 916 2598 CDS product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228281.1 protein_id gnl|my_center|LOCUS_43030 >Feature sequence1042 2202 2888 gene locus_tag LOCUS_43040 2202 2888 CDS product polysaccharide biosynthesis/export family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532220.1 protein_id gnl|my_center|LOCUS_43040 >Feature sequence1043 2740 1910 gene locus_tag LOCUS_43050 gene trmD 2740 1910 CDS product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003724048.1 protein_id gnl|my_center|LOCUS_43050 >Feature sequence1044 277 107 gene locus_tag LOCUS_43060 277 107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43060 489 274 gene locus_tag LOCUS_43070 489 274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43070 >Feature sequence1045 <1 1413 gene locus_tag LOCUS_43080 <1 1413 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_046463799.1:autotransporter domain-containing protein 1962 1636 gene locus_tag LOCUS_43090 1962 1636 CDS product PIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679685.1 protein_id gnl|my_center|LOCUS_43090 2201 1959 gene locus_tag LOCUS_43100 2201 1959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43100 <3055 2397 gene locus_tag LOCUS_43110 <3055 2397 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004398583.1:superoxide dismutase SodA >Feature sequence1046 2166 1009 gene locus_tag LOCUS_43120 2166 1009 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532944.1 protein_id gnl|my_center|LOCUS_43120 >Feature sequence1047 <1 1346 gene locus_tag LOCUS_43130 <1 1346 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003147894.1:SGNH/GDSL hydrolase family protein 2731 1358 gene locus_tag LOCUS_43140 2731 1358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43140 >Feature sequence1048 763 1437 gene locus_tag LOCUS_43150 763 1437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43150 2525 2088 gene locus_tag LOCUS_43160 2525 2088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43160 >Feature sequence1049 2405 2103 gene locus_tag LOCUS_43170 2405 2103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43170 >Feature sequence1050 3 167 gene locus_tag LOCUS_43180 3 167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43180 1645 695 gene locus_tag LOCUS_43190 1645 695 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257603.1 protein_id gnl|my_center|LOCUS_43190 2509 2177 gene locus_tag LOCUS_43200 2509 2177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43200 >Feature sequence1051 758 1384 gene locus_tag LOCUS_43210 758 1384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43210 2398 1637 gene locus_tag LOCUS_43220 2398 1637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43220 3038 2373 gene locus_tag LOCUS_43230 3038 2373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43230 >Feature sequence1052 1554 298 gene locus_tag LOCUS_43240 gene waaF 1554 298 CDS product lipopolysaccharide heptosyltransferase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197552.1 protein_id gnl|my_center|LOCUS_43240 1731 2972 gene locus_tag LOCUS_43250 1731 2972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43250 >Feature sequence1053 <1 1596 gene locus_tag LOCUS_43260 <1 1596 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164929427.1:PAS domain S-box protein 1593 2306 gene locus_tag LOCUS_43270 1593 2306 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141682.1 protein_id gnl|my_center|LOCUS_43270 >Feature sequence1054 843 37 gene locus_tag LOCUS_43280 843 37 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43280 <3034 1771 gene locus_tag LOCUS_43290 <3034 1771 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003113101.1:ABC transporter substrate-binding protein >Feature sequence1055 1111 2457 gene locus_tag LOCUS_43300 1111 2457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43300 >Feature sequence1056 1821 2459 gene locus_tag LOCUS_43310 1821 2459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43310 2773 2591 gene locus_tag LOCUS_43320 2773 2591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43320 >Feature sequence1057 1306 257 gene locus_tag LOCUS_43330 1306 257 CDS product NAD(P)-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_151612376.1 protein_id gnl|my_center|LOCUS_43330 1978 1517 gene locus_tag LOCUS_43340 1978 1517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43340 >Feature sequence1058 314 240 gene locus_tag LOCUS_t00330 314 240 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 1477 332 gene locus_tag LOCUS_43350 1477 332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43350 2347 1733 gene locus_tag LOCUS_43360 2347 1733 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167392103.1 protein_id gnl|my_center|LOCUS_43360 >Feature sequence1059 678 1211 gene locus_tag LOCUS_43370 678 1211 CDS product dihydrofolate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_106726554.1 protein_id gnl|my_center|LOCUS_43370 1233 1709 gene locus_tag LOCUS_43380 1233 1709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43380 1781 1924 gene locus_tag LOCUS_43390 1781 1924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43390 2105 2461 gene locus_tag LOCUS_43400 2105 2461 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087349.1 protein_id gnl|my_center|LOCUS_43400 2467 2766 gene locus_tag LOCUS_43410 2467 2766 CDS product DUF1330 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028171395.1 protein_id gnl|my_center|LOCUS_43410 >Feature sequence1060 >Feature sequence1061 <1 774 gene locus_tag LOCUS_43420 <1 774 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004081072.1:bifunctional phosphoglycerate kinase/triose-phosphate isomerase note possible pseudo, frameshifted 809 1579 gene locus_tag LOCUS_43430 gene tpiA 809 1579 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391808.1 protein_id gnl|my_center|LOCUS_43430 <3017 1985 gene locus_tag LOCUS_43440 <3017 1985 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011085719.1:efflux RND transporter periplasmic adaptor subunit >Feature sequence1062 1185 472 gene locus_tag LOCUS_43450 1185 472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43450 2587 1739 gene locus_tag LOCUS_43460 2587 1739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43460 2869 2627 gene locus_tag LOCUS_43470 2869 2627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43470 >Feature sequence1063 2078 387 gene locus_tag LOCUS_43480 2078 387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43480 3010 2834 gene locus_tag LOCUS_43490 3010 2834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43490 >Feature sequence1064 2 613 gene locus_tag LOCUS_43500 gene lexA 2 613 CDS product transcriptional repressor LexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403693.1 protein_id gnl|my_center|LOCUS_43500 769 2316 gene locus_tag LOCUS_43510 769 2316 CDS product glucan biosynthesis protein G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095915.1 protein_id gnl|my_center|LOCUS_43510 2292 2867 gene locus_tag LOCUS_43520 2292 2867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43520 >Feature sequence1065 <1 648 gene locus_tag LOCUS_43530 <1 648 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003978098.1:lactate 2-monooxygenase 2593 728 gene locus_tag LOCUS_43540 gene treZ 2593 728 CDS product malto-oligosyltrehalose trehalohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389950.1 protein_id gnl|my_center|LOCUS_43540 >Feature sequence1066 791 2149 gene locus_tag LOCUS_43550 791 2149 CDS product aminotransferase class III-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869430.1 protein_id gnl|my_center|LOCUS_43550 2491 2267 gene locus_tag LOCUS_43560 2491 2267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43560 2795 2595 gene locus_tag LOCUS_43570 2795 2595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43570 >Feature sequence1067 1963 950 gene locus_tag LOCUS_43580 1963 950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43580 <3008 2121 gene locus_tag LOCUS_43590 <3008 2121 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011228453.1:(Fe-S)-binding protein >Feature sequence1068 <1 1218 gene locus_tag LOCUS_43600 <1 1218 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003245240.1:formate dehydrogenase subunit alpha 1236 1709 gene locus_tag LOCUS_43610 1236 1709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43610 2363 2587 gene locus_tag LOCUS_43620 2363 2587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43620 >Feature sequence1069 1240 674 gene locus_tag LOCUS_43630 gene rfbC 1240 674 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387749.1 protein_id gnl|my_center|LOCUS_43630 2038 1286 gene locus_tag LOCUS_43640 2038 1286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43640 2645 2100 gene locus_tag LOCUS_43650 2645 2100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43650 >Feature sequence1070 1503 1036 gene locus_tag LOCUS_43660 1503 1036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43660 1757 1599 gene locus_tag LOCUS_43670 1757 1599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43670 <2997 2043 gene locus_tag LOCUS_43680 <2997 2043 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010884013.1:1-phosphofructokinase >Feature sequence1071 265 1278 gene locus_tag LOCUS_43690 265 1278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43690 1408 1824 gene locus_tag LOCUS_43700 1408 1824 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922377.1 protein_id gnl|my_center|LOCUS_43700 2010 2411 gene locus_tag LOCUS_43710 gene tsaA 2010 2411 CDS product tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229491.1 protein_id gnl|my_center|LOCUS_43710 >Feature sequence1072 837 229 gene locus_tag LOCUS_43720 837 229 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004114385.1 protein_id gnl|my_center|LOCUS_43720 1301 1711 gene locus_tag LOCUS_43730 1301 1711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43730 1773 2417 gene locus_tag LOCUS_43740 1773 2417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_43740 >Feature sequence1073 968 648 gene locus_tag LOCUS_43750 968 648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43750 1153 938 gene locus_tag LOCUS_43760 1153 938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43760 1584 1465 gene locus_tag LOCUS_43770 1584 1465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43770 1931 1857 gene locus_tag LOCUS_t00340 1931 1857 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 <2982 2161 gene locus_tag LOCUS_43780 <2982 2161 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011085539.1:amylo-alpha-1,6-glucosidase >Feature sequence1074 <2978 2253 gene locus_tag LOCUS_43790 <2978 2253 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011107551.1:magnesium-translocating P-type ATPase >Feature sequence1075 <1 743 gene locus_tag LOCUS_43800 <1 743 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_069460376.1:TolC family protein 951 2276 gene locus_tag LOCUS_43810 951 2276 CDS product copper oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004529973.1 protein_id gnl|my_center|LOCUS_43810 <2976 2363 gene locus_tag LOCUS_43820 <2976 2363 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004524131.1:CusA/CzcA family heavy metal efflux RND transporter >Feature sequence1076 <2975 2022 gene locus_tag LOCUS_43830 <2975 2022 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010883618.1:ribonucleotide-diphosphate reductase subunit beta >Feature sequence1077 1718 186 gene locus_tag LOCUS_43840 1718 186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43840 2875 1736 gene locus_tag LOCUS_43850 2875 1736 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228257.1 protein_id gnl|my_center|LOCUS_43850 >Feature sequence1078 92 670 gene locus_tag LOCUS_43860 92 670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_43860 1526 1242 gene locus_tag LOCUS_43870 1526 1242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43870 1723 1914 gene locus_tag LOCUS_43880 1723 1914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43880 1918 2223 gene locus_tag LOCUS_43890 1918 2223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43890 >Feature sequence1079 <1 1298 gene locus_tag LOCUS_43900 <1 1298 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012546286.1:PBP1A family penicillin-binding protein 2340 1405 gene locus_tag LOCUS_43910 2340 1405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43910 >Feature sequence1080 150 302 gene locus_tag LOCUS_43920 150 302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43920 1421 273 gene locus_tag LOCUS_43930 1421 273 CDS product epoxide hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525171.1 protein_id gnl|my_center|LOCUS_43930 <2967 1510 gene locus_tag LOCUS_43940 <2967 1510 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011086584.1:potassium transporter Kup >Feature sequence1081 <1 2573 gene locus_tag LOCUS_43950 <1 2573 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013532875.1:multidrug efflux RND transporter permease subunit >Feature sequence1082 980 270 gene locus_tag LOCUS_43960 980 270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43960 1205 1888 gene locus_tag LOCUS_43970 1205 1888 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530710.1 protein_id gnl|my_center|LOCUS_43970 2184 2864 gene locus_tag LOCUS_43980 2184 2864 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528918.1 protein_id gnl|my_center|LOCUS_43980 >Feature sequence1083 <1 1250 gene locus_tag LOCUS_43990 <1 1250 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011142422.1:ABC transporter permease 1632 2240 gene locus_tag LOCUS_44000 1632 2240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44000 2167 2484 gene locus_tag LOCUS_44010 2167 2484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44010 2900 2415 gene locus_tag LOCUS_44020 2900 2415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44020 >Feature sequence1084 48 380 gene locus_tag LOCUS_44030 48 380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44030 1239 742 gene locus_tag LOCUS_44040 1239 742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44040 1759 2109 gene locus_tag LOCUS_44050 1759 2109 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226515.1 protein_id gnl|my_center|LOCUS_44050 2106 2540 gene locus_tag LOCUS_44060 2106 2540 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005081306.1 protein_id gnl|my_center|LOCUS_44060 >Feature sequence1085 514 122 gene locus_tag LOCUS_44070 514 122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44070 1734 1048 gene locus_tag LOCUS_44080 1734 1048 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141682.1 protein_id gnl|my_center|LOCUS_44080 <2956 2066 gene locus_tag LOCUS_44090 <2956 2066 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011085718.1:efflux RND transporter permease subunit >Feature sequence1086 1161 277 gene locus_tag LOCUS_44100 1161 277 CDS product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037401438.1 protein_id gnl|my_center|LOCUS_44100 1300 1935 gene locus_tag LOCUS_44110 1300 1935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44110 1932 2483 gene locus_tag LOCUS_44120 1932 2483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44120 >Feature sequence1087 215 1012 gene locus_tag LOCUS_44130 215 1012 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000891825.1 protein_id gnl|my_center|LOCUS_44130 2236 1226 gene locus_tag LOCUS_44140 2236 1226 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973778.1 protein_id gnl|my_center|LOCUS_44140 >Feature sequence1088 583 1233 gene locus_tag LOCUS_44150 583 1233 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087542.1 protein_id gnl|my_center|LOCUS_44150 >Feature sequence1089 152 2125 gene locus_tag LOCUS_44160 152 2125 CDS product bifunctional aldolase/short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211122.1 protein_id gnl|my_center|LOCUS_44160 2511 2182 gene locus_tag LOCUS_44170 2511 2182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44170 >Feature sequence1090 868 2115 gene locus_tag LOCUS_44180 868 2115 CDS product tagaturonate epimerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119734.1 protein_id gnl|my_center|LOCUS_44180 >Feature sequence1091 <1 2266 gene locus_tag LOCUS_44190 <1 2266 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164929427.1:PAS domain S-box protein >Feature sequence1092 642 1535 gene locus_tag LOCUS_44200 642 1535 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000423235.1 protein_id gnl|my_center|LOCUS_44200 1991 1539 gene locus_tag LOCUS_44210 1991 1539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44210 2310 2065 gene locus_tag LOCUS_44220 2310 2065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44220 >Feature sequence1093 416 210 gene locus_tag LOCUS_44230 416 210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44230 661 461 gene locus_tag LOCUS_44240 661 461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44240 887 681 gene locus_tag LOCUS_44250 887 681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44250 2132 1899 gene locus_tag LOCUS_44260 2132 1899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44260 >Feature sequence1094 722 438 gene locus_tag LOCUS_44270 722 438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44270 1366 719 gene locus_tag LOCUS_44280 1366 719 CDS product cytochrome c oxidase subunit 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258009.1 protein_id gnl|my_center|LOCUS_44280 <2937 1865 gene locus_tag LOCUS_44290 <2937 1865 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012258008.1:cytochrome c oxidase subunit I >Feature sequence1095 <1 708 gene locus_tag LOCUS_44300 <1 708 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_162992484.1:glycoside hydrolase family 127 protein 937 1608 gene locus_tag LOCUS_44310 937 1608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44310 1601 1828 gene locus_tag LOCUS_44320 1601 1828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44320 >Feature sequence1096 1480 1887 gene locus_tag LOCUS_44330 1480 1887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44330 1907 2290 gene locus_tag LOCUS_44340 1907 2290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_44340 >Feature sequence1097 455 384 gene locus_tag LOCUS_t00350 455 384 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 884 1579 gene locus_tag LOCUS_44350 884 1579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44350 2610 1690 gene locus_tag LOCUS_44360 gene rihA 2610 1690 CDS product pyrimidine-specific ribonucleoside hydrolase RihA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001207423.1 protein_id gnl|my_center|LOCUS_44360 >Feature sequence1098 2619 106 gene locus_tag LOCUS_44370 2619 106 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938723.1 protein_id gnl|my_center|LOCUS_44370 >Feature sequence1099 <1 698 gene locus_tag LOCUS_44380 <1 698 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003113984.1:NADH:ubiquinone reductase (Na(+)-transporting) subunit F 979 1491 gene locus_tag LOCUS_44390 979 1491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44390 1715 2764 gene locus_tag LOCUS_44400 1715 2764 CDS product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530638.1 protein_id gnl|my_center|LOCUS_44400 >Feature sequence1100 1293 280 gene locus_tag LOCUS_44410 gene hlyD 1293 280 CDS product secretion protein HlyD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000976400.1 protein_id gnl|my_center|LOCUS_44410 2066 1290 gene locus_tag LOCUS_44420 2066 1290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44420 >Feature sequence1101 <1 898 gene locus_tag LOCUS_44430 <1 898 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003112616.1:efflux RND transporter periplasmic adaptor subunit 885 2426 gene locus_tag LOCUS_44440 885 2426 CDS product DHA2 family efflux MFS transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524545.1 protein_id gnl|my_center|LOCUS_44440 >Feature sequence1102 <1 1363 gene locus_tag LOCUS_44450 <1 1363 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010939521.1:Tex family protein 1689 1877 gene locus_tag LOCUS_44460 1689 1877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44460 1983 2531 gene locus_tag LOCUS_44470 1983 2531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44470 >Feature sequence1103 319 771 gene locus_tag LOCUS_44480 319 771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44480 2686 872 gene locus_tag LOCUS_44490 2686 872 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967072.1 protein_id gnl|my_center|LOCUS_44490 >Feature sequence1104 71 1252 gene locus_tag LOCUS_44500 71 1252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44500 1783 1445 gene locus_tag LOCUS_44510 1783 1445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44510 <2917 1784 gene locus_tag LOCUS_44520 <2917 1784 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002292812.1:phosphopyruvate hydratase >Feature sequence1105 1645 1929 gene locus_tag LOCUS_44530 1645 1929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44530 >Feature sequence1106 1801 2007 gene locus_tag LOCUS_44540 1801 2007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44540 2677 2165 gene locus_tag LOCUS_44550 2677 2165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_44550 >Feature sequence1107 <1 662 gene locus_tag LOCUS_44560 <1 662 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011142488.1:SirB1 family protein 732 1952 gene locus_tag LOCUS_44570 732 1952 CDS product competence/damage-inducible protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582488.1 protein_id gnl|my_center|LOCUS_44570 <2913 2384 gene locus_tag LOCUS_44580 <2913 2384 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004082693.1:sugar ABC transporter ATP-binding protein >Feature sequence1108 375 1823 gene locus_tag LOCUS_44590 375 1823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44590 2197 2892 gene locus_tag LOCUS_44600 2197 2892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44600 >Feature sequence1109 807 1580 gene locus_tag LOCUS_44610 807 1580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44610 2745 2023 gene locus_tag LOCUS_44620 2745 2023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44620 >Feature sequence1110 <1 1681 gene locus_tag LOCUS_44630 <1 1681 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011140636.1:response regulator >Feature sequence1111 632 2719 gene locus_tag LOCUS_44640 632 2719 CDS product propionyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084127.1 protein_id gnl|my_center|LOCUS_44640 >Feature sequence1112 311 673 gene locus_tag LOCUS_44650 311 673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44650 777 2099 gene locus_tag LOCUS_44660 777 2099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44660 2260 2655 gene locus_tag LOCUS_44670 2260 2655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44670 >Feature sequence1113 1684 764 gene locus_tag LOCUS_44680 1684 764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44680 2618 1773 gene locus_tag LOCUS_44690 2618 1773 CDS product glucose-1-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142182.1 protein_id gnl|my_center|LOCUS_44690 >Feature sequence1114 >Feature sequence1115 1465 605 gene locus_tag LOCUS_44700 1465 605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44700 1464 1676 gene locus_tag LOCUS_44710 1464 1676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44710 1799 2257 gene locus_tag LOCUS_44720 1799 2257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44720 >Feature sequence1116 1056 1766 gene locus_tag LOCUS_44730 1056 1766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44730 1797 2360 gene locus_tag LOCUS_44740 1797 2360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_44740 >Feature sequence1117 1983 1027 gene locus_tag LOCUS_44750 1983 1027 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940255.1 protein_id gnl|my_center|LOCUS_44750 <2886 2021 gene locus_tag LOCUS_44760 <2886 2021 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012256879.1:glycosyltransferase family 4 protein >Feature sequence1118 1185 538 gene locus_tag LOCUS_44770 1185 538 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141682.1 protein_id gnl|my_center|LOCUS_44770 >Feature sequence1119 373 522 gene locus_tag LOCUS_44780 373 522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44780 1166 654 gene locus_tag LOCUS_44790 1166 654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44790 2448 1174 gene locus_tag LOCUS_44800 2448 1174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44800 >Feature sequence1120 753 520 gene locus_tag LOCUS_44810 753 520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44810 <2880 753 gene locus_tag LOCUS_44820 <2880 753 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011268254.1:glycoside hydrolase family 3 C-terminal domain-containing protein >Feature sequence1121 407 63 gene locus_tag LOCUS_44830 407 63 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44830 952 446 gene locus_tag LOCUS_44840 952 446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44840 1086 1466 gene locus_tag LOCUS_44850 1086 1466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44850 1463 1798 gene locus_tag LOCUS_44860 1463 1798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44860 2686 1823 gene locus_tag LOCUS_44870 2686 1823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44870 >Feature sequence1122 290 979 gene locus_tag LOCUS_44880 290 979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44880 2445 1609 gene locus_tag LOCUS_44890 2445 1609 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112398.1 protein_id gnl|my_center|LOCUS_44890 >Feature sequence1123 <1 654 gene locus_tag LOCUS_44900 <1 654 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164929427.1:PAS domain S-box protein <2873 1778 gene locus_tag LOCUS_44910 <2873 1778 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013384127.1:OpgC domain-containing protein >Feature sequence1124 324 995 gene locus_tag LOCUS_44920 324 995 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022096.1 protein_id gnl|my_center|LOCUS_44920 1136 1957 gene locus_tag LOCUS_44930 1136 1957 CDS product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000020273.1 protein_id gnl|my_center|LOCUS_44930 >Feature sequence1125 1825 1010 gene locus_tag LOCUS_44940 gene iolB 1825 1010 CDS product 5-deoxy-glucuronate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196071.1 protein_id gnl|my_center|LOCUS_44940 2841 1822 gene locus_tag LOCUS_44950 gene iolG 2841 1822 CDS product inositol 2-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083264.1 protein_id gnl|my_center|LOCUS_44950 >Feature sequence1126 403 1710 gene locus_tag LOCUS_44960 403 1710 CDS product ATP-dependent 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000448293.1 protein_id gnl|my_center|LOCUS_44960 1785 2417 gene locus_tag LOCUS_44970 1785 2417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44970 2462 2713 gene locus_tag LOCUS_44980 2462 2713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44980 >Feature sequence1127 1002 232 gene locus_tag LOCUS_44990 1002 232 CDS product sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121635.1 protein_id gnl|my_center|LOCUS_44990 2452 1739 gene locus_tag LOCUS_45000 2452 1739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45000 >Feature sequence1128 1832 678 gene locus_tag LOCUS_45010 gene mak 1832 678 CDS product fructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704548.1 protein_id gnl|my_center|LOCUS_45010 <2867 1965 gene locus_tag LOCUS_45020 <2867 1965 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010970632.1:ROK family transcriptional regulator >Feature sequence1129 845 1066 gene locus_tag LOCUS_45030 845 1066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45030 1457 1239 gene locus_tag LOCUS_45040 1457 1239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45040 1562 2422 gene locus_tag LOCUS_45050 1562 2422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45050 >Feature sequence1130 1027 425 gene locus_tag LOCUS_45060 1027 425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45060 1729 1403 gene locus_tag LOCUS_45070 1729 1403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45070 >Feature sequence1131 1418 381 gene locus_tag LOCUS_45080 gene trpD 1418 381 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022929.1 protein_id gnl|my_center|LOCUS_45080 1697 2527 gene locus_tag LOCUS_45090 1697 2527 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902154.1 protein_id gnl|my_center|LOCUS_45090 >Feature sequence1132 286 2382 gene locus_tag LOCUS_45100 286 2382 CDS product 3-hydroxyacyl-CoA dehydrogenase NAD-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957672.1 protein_id gnl|my_center|LOCUS_45100 >Feature sequence1133 <1 2440 gene locus_tag LOCUS_45110 <1 2440 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010938280.1:phosphoenolpyruvate--protein phosphotransferase >Feature sequence1134 934 479 gene locus_tag LOCUS_45120 934 479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45120 1125 1289 gene locus_tag LOCUS_45130 1125 1289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45130 1293 1439 gene locus_tag LOCUS_45140 1293 1439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45140 >Feature sequence1135 1059 1223 gene locus_tag LOCUS_45150 1059 1223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45150 1195 2358 gene locus_tag LOCUS_45160 1195 2358 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081188.1 protein_id gnl|my_center|LOCUS_45160 >Feature sequence1136 1591 1019 gene locus_tag LOCUS_45170 1591 1019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45170 1719 1588 gene locus_tag LOCUS_45180 1719 1588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45180 2597 1737 gene locus_tag LOCUS_45190 2597 1737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45190 >Feature sequence1137 <1 843 gene locus_tag LOCUS_45200 <1 843 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011260947.1:DNA polymerase I 1388 2302 gene locus_tag LOCUS_45210 1388 2302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45210 2563 2639 gene locus_tag LOCUS_t00360 2563 2639 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence1138 50 1909 gene locus_tag LOCUS_45220 50 1909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45220 >Feature sequence1139 <1 537 gene locus_tag LOCUS_45230 <1 537 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015064405.1:GntR family transcriptional regulator 1206 757 gene locus_tag LOCUS_45240 1206 757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45240 1926 1261 gene locus_tag LOCUS_45250 1926 1261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45250 2704 2453 gene locus_tag LOCUS_45260 2704 2453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45260 >Feature sequence1140 302 574 gene locus_tag LOCUS_45270 302 574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45270 624 1733 gene locus_tag LOCUS_45280 gene mdtN 624 1733 CDS product multidrug efflux transporter periplasmic adaptor subunit MdtN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000446384.1 protein_id gnl|my_center|LOCUS_45280 >Feature sequence1141 <1 800 gene locus_tag LOCUS_45290 <1 800 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011015826.1:tetratricopeptide repeat protein 2827 1040 gene locus_tag LOCUS_45300 2827 1040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45300 >Feature sequence1142 36 1412 gene locus_tag LOCUS_45310 36 1412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45310 1806 1450 gene locus_tag LOCUS_45320 1806 1450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45320 >Feature sequence1143 289 71 gene locus_tag LOCUS_45330 289 71 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45330 1605 334 gene locus_tag LOCUS_45340 gene larA 1605 334 CDS product nickel-dependent lactate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964087.1 protein_id gnl|my_center|LOCUS_45340 1834 1983 gene locus_tag LOCUS_45350 1834 1983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45350 >Feature sequence1144 >Feature sequence1145 1521 316 gene locus_tag LOCUS_45360 1521 316 CDS product acetate/propionate family kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927045.1 protein_id gnl|my_center|LOCUS_45360 >Feature sequence1146 42 114 gene locus_tag LOCUS_t00370 42 114 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 1448 243 gene locus_tag LOCUS_45370 1448 243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45370 <2837 1481 gene locus_tag LOCUS_45380 <2837 1481 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011976109.1:carbamoyltransferase >Feature sequence1147 381 1529 gene locus_tag LOCUS_45390 381 1529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45390 1542 2279 gene locus_tag LOCUS_45400 1542 2279 CDS product DUF1638 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816516.1 protein_id gnl|my_center|LOCUS_45400 2276 2755 gene locus_tag LOCUS_45410 2276 2755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45410 >Feature sequence1148 52 2358 gene locus_tag LOCUS_45420 52 2358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45420 >Feature sequence1149 724 1011 gene locus_tag LOCUS_45430 724 1011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45430 2263 1388 gene locus_tag LOCUS_45440 2263 1388 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000689435.1 protein_id gnl|my_center|LOCUS_45440 2667 2356 gene locus_tag LOCUS_45450 2667 2356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45450 >Feature sequence1150 1060 857 gene locus_tag LOCUS_45460 1060 857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45460 1165 1518 gene locus_tag LOCUS_45470 1165 1518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45470 >Feature sequence1151 <1 546 gene locus_tag LOCUS_45480 <1 546 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010976015.1:GguC family protein 914 603 gene locus_tag LOCUS_45490 914 603 CDS product GxxExxY protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119424.1 protein_id gnl|my_center|LOCUS_45490 1249 2685 gene locus_tag LOCUS_45500 1249 2685 CDS product aldehyde dehydrogenase (NADP(+)) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920632.1 protein_id gnl|my_center|LOCUS_45500 >Feature sequence1152 1414 533 gene locus_tag LOCUS_45510 1414 533 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920701.1 protein_id gnl|my_center|LOCUS_45510 2478 1627 gene locus_tag LOCUS_45520 gene pdxY 2478 1627 CDS product pyridoxal kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034349874.1 protein_id gnl|my_center|LOCUS_45520 2462 2692 gene locus_tag LOCUS_45530 2462 2692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45530 >Feature sequence1153 2083 1127 gene locus_tag LOCUS_45540 2083 1127 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001237475.1 protein_id gnl|my_center|LOCUS_45540 2462 2301 gene locus_tag LOCUS_45550 2462 2301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45550 >Feature sequence1154 944 537 gene locus_tag LOCUS_45560 gene rsbW 944 537 CDS product anti-sigma B factor RsbW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000970573.1 protein_id gnl|my_center|LOCUS_45560 2215 941 gene locus_tag LOCUS_45570 2215 941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45570 >Feature sequence1155 657 310 gene locus_tag LOCUS_45580 657 310 CDS product YciI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089353.1 protein_id gnl|my_center|LOCUS_45580 765 2057 gene locus_tag LOCUS_45590 765 2057 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143936.1 protein_id gnl|my_center|LOCUS_45590 <2819 2122 gene locus_tag LOCUS_45600 <2819 2122 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011038431.1:LysR family transcriptional regulator >Feature sequence1156 >Feature sequence1157 2560 320 gene locus_tag LOCUS_45610 2560 320 CDS product xanthine dehydrogenase family protein molybdopterin-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224904.1 protein_id gnl|my_center|LOCUS_45610 >Feature sequence1158 711 352 gene locus_tag LOCUS_45620 711 352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45620 1972 656 gene locus_tag LOCUS_45630 1972 656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_45630 >Feature sequence1159 433 1752 gene locus_tag LOCUS_45640 433 1752 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225440.1 protein_id gnl|my_center|LOCUS_45640 >Feature sequence1160 <1 1127 gene locus_tag LOCUS_45650 <1 1127 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_038967234.1:PAS domain S-box protein 1124 1768 gene locus_tag LOCUS_45660 1124 1768 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087542.1 protein_id gnl|my_center|LOCUS_45660 >Feature sequence1161 >Feature sequence1162 140 463 gene locus_tag LOCUS_45670 140 463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45670 1252 797 gene locus_tag LOCUS_45680 1252 797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45680 1427 1786 gene locus_tag LOCUS_45690 1427 1786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45690 >Feature sequence1163 <1 1054 gene locus_tag LOCUS_45700 <1 1054 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012067250.1:sugar-binding transcriptional regulator <2808 1432 gene locus_tag LOCUS_45710 <2808 1432 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010939857.1:HAMP domain-containing sensor histidine kinase >Feature sequence1164 <1 946 gene locus_tag LOCUS_45720 <1 946 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_235624176.1:amidohydrolase family protein 1086 1814 gene locus_tag LOCUS_45730 1086 1814 CDS product 3-oxoacyl-ACP reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084048.1 protein_id gnl|my_center|LOCUS_45730 >Feature sequence1165 783 142 gene locus_tag LOCUS_45740 783 142 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921359.1 protein_id gnl|my_center|LOCUS_45740 1117 1413 gene locus_tag LOCUS_45750 1117 1413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_45750 <2804 2158 gene locus_tag LOCUS_45760 <2804 2158 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_065355591.1:glycoside hydrolase family 31 protein >Feature sequence1166 <1 682 gene locus_tag LOCUS_45770 <1 682 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_118838309.1:PAS domain S-box protein 679 1350 gene locus_tag LOCUS_45780 679 1350 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403448.1 protein_id gnl|my_center|LOCUS_45780 >Feature sequence1167 241 954 gene locus_tag LOCUS_45790 241 954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45790 >Feature sequence1168 657 992 gene locus_tag LOCUS_45800 657 992 CDS product YciI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089353.1 protein_id gnl|my_center|LOCUS_45800 989 2209 gene locus_tag LOCUS_45810 989 2209 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082803.1 protein_id gnl|my_center|LOCUS_45810 >Feature sequence1169 2066 510 gene locus_tag LOCUS_45820 2066 510 CDS product alpha/beta hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742093.1 protein_id gnl|my_center|LOCUS_45820 >Feature sequence1170 1753 725 gene locus_tag LOCUS_45830 1753 725 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902253.1 protein_id gnl|my_center|LOCUS_45830 1836 2459 gene locus_tag LOCUS_45840 1836 2459 CDS product YdbC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973215.1 protein_id gnl|my_center|LOCUS_45840 >Feature sequence1171 694 1554 gene locus_tag LOCUS_45850 694 1554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45850 1463 2269 gene locus_tag LOCUS_45860 1463 2269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45860 2367 2790 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtctccattgcctttcggctaattcgtcctctcggac >Feature sequence1172 1460 873 gene locus_tag LOCUS_45870 1460 873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45870 2017 1463 gene locus_tag LOCUS_45880 2017 1463 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485931.1 protein_id gnl|my_center|LOCUS_45880 >Feature sequence1173 <1 2280 gene locus_tag LOCUS_45890 <1 2280 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003814283.1:excinuclease ABC subunit UvrA >Feature sequence1174 373 1173 gene locus_tag LOCUS_45900 gene tagJ 373 1173 CDS product type VI secretion system accessory protein TagJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119488.1 protein_id gnl|my_center|LOCUS_45900 1222 1725 gene locus_tag LOCUS_45910 gene tssE 1222 1725 CDS product type VI secretion system baseplate subunit TssE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096188.1 protein_id gnl|my_center|LOCUS_45910 >Feature sequence1175 1711 389 gene locus_tag LOCUS_45920 1711 389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45920 1872 2078 gene locus_tag LOCUS_45930 1872 2078 CDS product DUF6290 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011171671.1 protein_id gnl|my_center|LOCUS_45930 2062 2331 gene locus_tag LOCUS_45940 2062 2331 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016227.1 protein_id gnl|my_center|LOCUS_45940 >Feature sequence1176 <2780 2147 gene locus_tag LOCUS_45950 <2780 2147 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003107490.1:LLM class flavin-dependent oxidoreductase >Feature sequence1177 1826 270 gene locus_tag LOCUS_45960 1826 270 CDS product family 1 glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143220.1 protein_id gnl|my_center|LOCUS_45960 <2780 1830 gene locus_tag LOCUS_45970 <2780 1830 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012870487.1:glycosyltransferase >Feature sequence1178 270 359 gene locus_tag LOCUS_t00380 270 359 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 1511 372 gene locus_tag LOCUS_45980 1511 372 CDS product DSD1 family PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929856.1 protein_id gnl|my_center|LOCUS_45980 2717 1959 gene locus_tag LOCUS_45990 gene ydfG 2717 1959 CDS product bifunctional NADP-dependent 3-hydroxy acid dehydrogenase/3-hydroxypropionate dehydrogenase YdfG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050078046.1 protein_id gnl|my_center|LOCUS_45990 >Feature sequence1179 1286 1930 gene locus_tag LOCUS_46000 1286 1930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46000 >Feature sequence1180 732 1121 gene locus_tag LOCUS_46010 732 1121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46010 1272 1511 gene locus_tag LOCUS_46020 1272 1511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46020 1946 1539 gene locus_tag LOCUS_46030 1946 1539 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_075890604.1 protein_id gnl|my_center|LOCUS_46030 2169 1915 gene locus_tag LOCUS_46040 2169 1915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46040 2519 2662 gene locus_tag LOCUS_46050 2519 2662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46050 >Feature sequence1181 506 625 gene locus_tag LOCUS_46060 506 625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46060 622 1083 gene locus_tag LOCUS_46070 gene trxC 622 1083 CDS product thioredoxin TrxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036377.1 protein_id gnl|my_center|LOCUS_46070 1997 1224 gene locus_tag LOCUS_46080 1997 1224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46080 2364 2558 gene locus_tag LOCUS_46090 2364 2558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46090 >Feature sequence1182 1473 901 gene locus_tag LOCUS_46100 1473 901 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256521.1 protein_id gnl|my_center|LOCUS_46100 2015 1470 gene locus_tag LOCUS_46110 2015 1470 CDS product DUF3341 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256520.1 protein_id gnl|my_center|LOCUS_46110 <2768 2012 gene locus_tag LOCUS_46120 <2768 2012 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012256519.1:polysulfide reductase NrfD >Feature sequence1183 841 1296 gene locus_tag LOCUS_46130 841 1296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46130 1972 1772 gene locus_tag LOCUS_46140 1972 1772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46140 >Feature sequence1184 227 469 gene locus_tag LOCUS_46150 227 469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46150 549 1226 gene locus_tag LOCUS_46160 549 1226 CDS product heavy metal response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098784.1 protein_id gnl|my_center|LOCUS_46160 1223 2254 gene locus_tag LOCUS_46170 1223 2254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46170 >Feature sequence1185 997 128 gene locus_tag LOCUS_46180 997 128 CDS product STAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051618919.1 protein_id gnl|my_center|LOCUS_46180 1290 1475 gene locus_tag LOCUS_46190 1290 1475 CDS product CsbD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388930.1 protein_id gnl|my_center|LOCUS_46190 2766 1609 gene locus_tag LOCUS_46200 2766 1609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46200 >Feature sequence1186 2097 715 gene locus_tag LOCUS_46210 gene ftsZ 2097 715 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023171980.1 protein_id gnl|my_center|LOCUS_46210 <2766 2107 gene locus_tag LOCUS_46220 <2766 2107 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001294722.1:cell division protein FtsA >Feature sequence1187 800 612 gene locus_tag LOCUS_46230 800 612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46230 978 1289 gene locus_tag LOCUS_46240 978 1289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46240 1296 1505 gene locus_tag LOCUS_46250 1296 1505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46250 1933 2577 gene locus_tag LOCUS_46260 1933 2577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46260 >Feature sequence1188 2434 260 gene locus_tag LOCUS_46270 gene uvrB 2434 260 CDS product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403914.1 protein_id gnl|my_center|LOCUS_46270 >Feature sequence1189 1640 1341 gene locus_tag LOCUS_46280 1640 1341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46280 1816 1538 gene locus_tag LOCUS_46290 1816 1538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46290 >Feature sequence1190 1219 839 gene locus_tag LOCUS_46300 1219 839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46300 1434 1240 gene locus_tag LOCUS_46310 1434 1240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46310 1972 1406 gene locus_tag LOCUS_46320 1972 1406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46320 >Feature sequence1191 1285 473 gene locus_tag LOCUS_46330 1285 473 CDS product cobalt-factor II C(20)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836533.1 protein_id gnl|my_center|LOCUS_46330 1882 1325 gene locus_tag LOCUS_46340 gene cobU 1882 1325 CDS product bifunctional adenosylcobinamide kinase/adenosylcobinamide-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766684.1 protein_id gnl|my_center|LOCUS_46340 2673 1879 gene locus_tag LOCUS_46350 2673 1879 CDS product adenosylcobinamide-GDP ribazoletransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_031778770.1 protein_id gnl|my_center|LOCUS_46350 >Feature sequence1192 243 40 gene locus_tag LOCUS_46360 243 40 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46360 484 942 gene locus_tag LOCUS_46370 484 942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46370 1338 2708 gene locus_tag LOCUS_46380 1338 2708 CDS product aromatic acid/H+ symport family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113292.1 protein_id gnl|my_center|LOCUS_46380 >Feature sequence1193 2198 1440 gene locus_tag LOCUS_46390 gene hisF 2198 1440 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817210.1 protein_id gnl|my_center|LOCUS_46390 >Feature sequence1194 999 2729 gene locus_tag LOCUS_46400 999 2729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46400 >Feature sequence1195 1579 362 gene locus_tag LOCUS_46410 1579 362 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097689.1 protein_id gnl|my_center|LOCUS_46410 >Feature sequence1196 <1 506 gene locus_tag LOCUS_46420 <1 506 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011026977.1:carbohydrate ABC transporter permease 675 1985 gene locus_tag LOCUS_46430 675 1985 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804375.1 protein_id gnl|my_center|LOCUS_46430 >Feature sequence1197 290 664 gene locus_tag LOCUS_46440 290 664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46440 2039 1440 gene locus_tag LOCUS_46450 2039 1440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46450 2463 2248 gene locus_tag LOCUS_46460 2463 2248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46460 >Feature sequence1198 1104 778 gene locus_tag LOCUS_46470 1104 778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46470 1561 2202 gene locus_tag LOCUS_46480 1561 2202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_46480 >Feature sequence1199 <1 944 gene locus_tag LOCUS_46490 <1 944 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011405197.1:carboxypeptidase M32 1208 2023 gene locus_tag LOCUS_46500 1208 2023 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404480.1 protein_id gnl|my_center|LOCUS_46500 2309 2382 gene locus_tag LOCUS_t00390 2309 2382 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence1200 290 709 gene locus_tag LOCUS_46510 290 709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46510 676 1035 gene locus_tag LOCUS_46520 676 1035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46520 <2735 1435 gene locus_tag LOCUS_46530 <2735 1435 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010968841.1:DNA mismatch repair endonuclease MutL >Feature sequence1201 1112 783 gene locus_tag LOCUS_46540 1112 783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46540 <2735 1767 gene locus_tag LOCUS_46550 <2735 1767 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010940506.1:multidrug efflux RND transporter permease subunit >Feature sequence1202 662 1723 gene locus_tag LOCUS_46560 662 1723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46560 1921 2214 gene locus_tag LOCUS_46570 1921 2214 CDS product DUF1330 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_153440932.1 protein_id gnl|my_center|LOCUS_46570 >Feature sequence1203 275 90 gene locus_tag LOCUS_46580 275 90 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46580 676 302 gene locus_tag LOCUS_46590 676 302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46590 1339 1001 gene locus_tag LOCUS_46600 1339 1001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46600 1801 1382 gene locus_tag LOCUS_46610 1801 1382 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037396390.1 protein_id gnl|my_center|LOCUS_46610 2058 2336 gene locus_tag LOCUS_46620 2058 2336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46620 >Feature sequence1204 >Feature sequence1205 <1 859 gene locus_tag LOCUS_46630 <1 859 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010976187.1:SDR family oxidoreductase 2273 849 gene locus_tag LOCUS_46640 2273 849 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920905.1 protein_id gnl|my_center|LOCUS_46640 >Feature sequence1206 1048 2178 gene locus_tag LOCUS_46650 1048 2178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46650 2542 2276 gene locus_tag LOCUS_46660 2542 2276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46660 >Feature sequence1207 <2724 793 gene locus_tag LOCUS_46670 <2724 793 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_223294574.1:ATP-dependent helicase HrpB >Feature sequence1208 1637 1101 gene locus_tag LOCUS_46680 1637 1101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46680 >Feature sequence1209 <1 806 gene locus_tag LOCUS_46690 <1 806 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010933174.1:agmatine deiminase family protein 1773 940 gene locus_tag LOCUS_46700 gene dapF 1773 940 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583145.1 protein_id gnl|my_center|LOCUS_46700 <2722 1968 gene locus_tag LOCUS_46710 <2722 1968 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942567.1:LPS export ABC transporter permease LptF >Feature sequence1210 80 571 gene locus_tag LOCUS_46720 80 571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46720 1455 910 gene locus_tag LOCUS_46730 1455 910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46730 2284 1643 gene locus_tag LOCUS_46740 2284 1643 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229197.1 protein_id gnl|my_center|LOCUS_46740 >Feature sequence1211 <1 657 gene locus_tag LOCUS_46750 <1 657 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012545424.1:glutamine-hydrolyzing GMP synthase 794 1285 gene locus_tag LOCUS_46760 gene coaD 794 1285 CDS product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459625.1 protein_id gnl|my_center|LOCUS_46760 1740 2201 gene locus_tag LOCUS_46770 1740 2201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46770 >Feature sequence1212 1073 441 gene locus_tag LOCUS_46780 1073 441 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962669.1 protein_id gnl|my_center|LOCUS_46780 1238 2521 gene locus_tag LOCUS_46790 1238 2521 CDS product FAD-dependent monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_093954241.1 protein_id gnl|my_center|LOCUS_46790 >Feature sequence1213 232 648 gene locus_tag LOCUS_46800 232 648 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932691.1 protein_id gnl|my_center|LOCUS_46800 916 2436 gene locus_tag LOCUS_46810 gene xylB 916 2436 CDS product xylulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393521.1 protein_id gnl|my_center|LOCUS_46810 >Feature sequence1214 990 574 gene locus_tag LOCUS_46820 990 574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_46820 2001 1009 gene locus_tag LOCUS_46830 2001 1009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_46830 >Feature sequence1215 1075 509 gene locus_tag LOCUS_46840 1075 509 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000506639.1 protein_id gnl|my_center|LOCUS_46840 1958 1179 gene locus_tag LOCUS_46850 1958 1179 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_087915427.1 protein_id gnl|my_center|LOCUS_46850 >Feature sequence1216 169 1098 gene locus_tag LOCUS_46860 169 1098 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030032.1 protein_id gnl|my_center|LOCUS_46860 1579 2535 gene locus_tag LOCUS_46870 1579 2535 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974938.1 protein_id gnl|my_center|LOCUS_46870 >Feature sequence1217 2190 1534 gene locus_tag LOCUS_46880 2190 1534 CDS product MOSC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141283.1 protein_id gnl|my_center|LOCUS_46880 >Feature sequence1218 26 496 gene locus_tag LOCUS_46890 gene rpsG 26 496 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892787.1 protein_id gnl|my_center|LOCUS_46890 535 2676 gene locus_tag LOCUS_46900 gene fusA 535 2676 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393940.1 protein_id gnl|my_center|LOCUS_46900 >Feature sequence1219 452 114 gene locus_tag LOCUS_46910 452 114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46910 1316 603 gene locus_tag LOCUS_46920 1316 603 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064405.1 protein_id gnl|my_center|LOCUS_46920 1410 1916 gene locus_tag LOCUS_46930 1410 1916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46930 >Feature sequence1220 1621 185 gene locus_tag LOCUS_46940 1621 185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46940 2186 1632 gene locus_tag LOCUS_46950 2186 1632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46950 >Feature sequence1221 119 280 gene locus_tag LOCUS_46960 119 280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46960 1710 664 gene locus_tag LOCUS_46970 1710 664 CDS product L-idonate 5-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088034.1 protein_id gnl|my_center|LOCUS_46970 <2702 1766 gene locus_tag LOCUS_46980 <2702 1766 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011090223.1:GMC family oxidoreductase >Feature sequence1222 <1 778 gene locus_tag LOCUS_46990 <1 778 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011086694.1:sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC 889 743 gene locus_tag LOCUS_47000 889 743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47000 1975 1016 gene locus_tag LOCUS_47010 1975 1016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47010 <2700 1972 gene locus_tag LOCUS_47020 <2700 1972 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007478814.1:AAA family ATPase >Feature sequence1223 995 246 gene locus_tag LOCUS_47030 995 246 CDS product sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121635.1 protein_id gnl|my_center|LOCUS_47030 1505 1350 gene locus_tag LOCUS_47040 1505 1350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47040 2169 1450 gene locus_tag LOCUS_47050 2169 1450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47050 >Feature sequence1224 331 116 gene locus_tag LOCUS_47060 331 116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47060 2292 727 gene locus_tag LOCUS_47070 2292 727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47070 >Feature sequence1225 793 1410 gene locus_tag LOCUS_47080 793 1410 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_171463838.1 protein_id gnl|my_center|LOCUS_47080 1735 2115 gene locus_tag LOCUS_47090 1735 2115 CDS product glyoxalase/bleomycin resistance/dioxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061392.1 protein_id gnl|my_center|LOCUS_47090 >Feature sequence1226 264 395 gene locus_tag LOCUS_47100 264 395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47100 1253 1468 gene locus_tag LOCUS_47110 1253 1468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47110 1834 2154 gene locus_tag LOCUS_47120 1834 2154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47120 2467 2601 gene locus_tag LOCUS_47130 2467 2601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47130 >Feature sequence1227 2 2170 gene locus_tag LOCUS_47140 2 2170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47140 >Feature sequence1228 2231 867 gene locus_tag LOCUS_47150 gene paaF 2231 867 CDS product phenylacetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038746825.1 protein_id gnl|my_center|LOCUS_47150 >Feature sequence1229 <1 1965 gene locus_tag LOCUS_47160 <1 1965 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011141201.1:ABC transporter permease 2303 1986 gene locus_tag LOCUS_47170 2303 1986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47170 >Feature sequence1230 <1 592 gene locus_tag LOCUS_47180 <1 592 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011141000.1:glycogen/starch/alpha-glucan phosphorylase 1228 2541 gene locus_tag LOCUS_47190 1228 2541 CDS product ATP-dependent 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000448293.1 protein_id gnl|my_center|LOCUS_47190 >Feature sequence1231 376 783 gene locus_tag LOCUS_47200 gene ybeY 376 783 CDS product rRNA maturation RNase YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392132.1 protein_id gnl|my_center|LOCUS_47200 2109 907 gene locus_tag LOCUS_47210 2109 907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088279.1 protein_id gnl|my_center|LOCUS_47210 <2681 2146 gene locus_tag LOCUS_47220 <2681 2146 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011088280.1:amino acid permease >Feature sequence1232 2116 2601 gene locus_tag LOCUS_47230 gene dadR 2116 2601 CDS product transcriptional regulator DadR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003314011.1 protein_id gnl|my_center|LOCUS_47230 >Feature sequence1233 1092 685 gene locus_tag LOCUS_47240 1092 685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47240 1246 1671 gene locus_tag LOCUS_47250 1246 1671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47250 <2678 1725 gene locus_tag LOCUS_47260 <2678 1725 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011393738.1:2-isopropylmalate synthase >Feature sequence1234 281 742 gene locus_tag LOCUS_47270 281 742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47270 1056 655 gene locus_tag LOCUS_47280 1056 655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47280 1410 1323 gene locus_tag LOCUS_t00400 1410 1323 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 1635 1823 gene locus_tag LOCUS_47290 1635 1823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47290 >Feature sequence1235 418 1158 gene locus_tag LOCUS_47300 418 1158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47300 1183 1392 gene locus_tag LOCUS_47310 1183 1392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47310 1807 1466 gene locus_tag LOCUS_47320 1807 1466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47320 2134 1877 gene locus_tag LOCUS_47330 2134 1877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47330 2484 2254 gene locus_tag LOCUS_47340 2484 2254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47340 >Feature sequence1236 1306 2106 gene locus_tag LOCUS_47350 gene proC 1306 2106 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023994.1 protein_id gnl|my_center|LOCUS_47350 >Feature sequence1237 483 1772 gene locus_tag LOCUS_47360 483 1772 CDS product lactate racemase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777076.1 protein_id gnl|my_center|LOCUS_47360 <2663 2103 gene locus_tag LOCUS_47370 <2663 2103 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011269279.1:sulfonate ABC transporter substrate-binding protein >Feature sequence1238 289 17 gene locus_tag LOCUS_47380 289 17 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47380 2042 1662 gene locus_tag LOCUS_47390 2042 1662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47390 >Feature sequence1239 1438 2433 gene locus_tag LOCUS_47400 1438 2433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_47400 >Feature sequence1240 338 1306 gene locus_tag LOCUS_47410 338 1306 CDS product D-2-hydroxyacid dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104476.1 protein_id gnl|my_center|LOCUS_47410 2362 2210 gene locus_tag LOCUS_47420 2362 2210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47420 >Feature sequence1241 1871 1305 gene locus_tag LOCUS_47430 1871 1305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47430 2191 1868 gene locus_tag LOCUS_47440 gene erpA 2191 1868 CDS product iron-sulfur cluster insertion protein ErpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531288.1 protein_id gnl|my_center|LOCUS_47440 >Feature sequence1242 <1 609 gene locus_tag LOCUS_47450 <1 609 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011460894.1:GTPase ObgE 1665 739 gene locus_tag LOCUS_47460 1665 739 CDS product TIGR01777 family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056318.1 protein_id gnl|my_center|LOCUS_47460 <2654 1796 gene locus_tag LOCUS_47470 <2654 1796 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011948459.1:N-acetylmuramoyl-L-alanine amidase >Feature sequence1243 920 1762 gene locus_tag LOCUS_47480 920 1762 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966304.1 protein_id gnl|my_center|LOCUS_47480 >Feature sequence1244 2310 1507 gene locus_tag LOCUS_47490 2310 1507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47490 >Feature sequence1245 1052 69 gene locus_tag LOCUS_47500 1052 69 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192697.1 protein_id gnl|my_center|LOCUS_47500 2060 1113 gene locus_tag LOCUS_47510 2060 1113 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223780.1 protein_id gnl|my_center|LOCUS_47510 <2651 2115 gene locus_tag LOCUS_47520 <2651 2115 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013226344.1:DeoR/GlpR family DNA-binding transcription regulator >Feature sequence1246 1898 615 gene locus_tag LOCUS_47530 1898 615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47530 2584 1895 gene locus_tag LOCUS_47540 2584 1895 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941763.1 protein_id gnl|my_center|LOCUS_47540 >Feature sequence1247 <2648 1165 gene locus_tag LOCUS_47550 <2648 1165 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941348.1:squalene--hopene cyclase >Feature sequence1248 509 925 gene locus_tag LOCUS_47560 509 925 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011174007.1 protein_id gnl|my_center|LOCUS_47560 922 1704 gene locus_tag LOCUS_47570 gene sufC 922 1704 CDS product Fe-S cluster assembly ATPase SufC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722442.1 protein_id gnl|my_center|LOCUS_47570 >Feature sequence1249 297 1595 gene locus_tag LOCUS_47580 gene bioA 297 1595 CDS product adenosylmethionine--8-amino-7-oxononanoate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942227.1 protein_id gnl|my_center|LOCUS_47580 2373 1801 gene locus_tag LOCUS_47590 2373 1801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47590 >Feature sequence1250 423 725 gene locus_tag LOCUS_47600 423 725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47600 1371 2099 gene locus_tag LOCUS_47610 1371 2099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47610 >Feature sequence1251 735 388 gene locus_tag LOCUS_47620 735 388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47620 969 1841 gene locus_tag LOCUS_47630 969 1841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47630 2569 1817 gene locus_tag LOCUS_47640 2569 1817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47640 >Feature sequence1252 837 295 gene locus_tag LOCUS_47650 837 295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47650 2382 1189 gene locus_tag LOCUS_47660 2382 1189 CDS product sulfotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005094688.1 protein_id gnl|my_center|LOCUS_47660 >Feature sequence1253 678 2381 gene locus_tag LOCUS_47670 678 2381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47670 >Feature sequence1254 >Feature sequence1255 <1 575 gene locus_tag LOCUS_47680 <1 575 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010903488.1:aldo/keto reductase 1545 625 gene locus_tag LOCUS_47690 1545 625 CDS product 3-hydroxyacyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963142.1 protein_id gnl|my_center|LOCUS_47690 2386 1598 gene locus_tag LOCUS_47700 2386 1598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47700 2385 2597 gene locus_tag LOCUS_47710 2385 2597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47710 >Feature sequence1256 <1 1908 gene locus_tag LOCUS_47720 <1 1908 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011030640.1:glycogen debranching protein GlgX >Feature sequence1257 502 927 gene locus_tag LOCUS_47730 gene menI 502 927 CDS product 1,4-dihydroxy-2-naphthoyl-CoA thioesterase MenI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722411.1 protein_id gnl|my_center|LOCUS_47730 1382 2392 gene locus_tag LOCUS_47740 1382 2392 CDS product IS630 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042779412.1 protein_id gnl|my_center|LOCUS_47740 >Feature sequence1258 151 1191 gene locus_tag LOCUS_47750 151 1191 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089194.1 protein_id gnl|my_center|LOCUS_47750 1185 1979 gene locus_tag LOCUS_47760 1185 1979 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817405.1 protein_id gnl|my_center|LOCUS_47760 >Feature sequence1259 127 5 gene locus_tag LOCUS_47770 127 5 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47770 389 589 gene locus_tag LOCUS_47780 389 589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47780 840 679 gene locus_tag LOCUS_47790 840 679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47790 2249 1752 gene locus_tag LOCUS_47800 2249 1752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47800 >Feature sequence1260 <1 2058 gene locus_tag LOCUS_47810 <1 2058 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010973505.1:TonB-dependent siderophore receptor 2205 2573 gene locus_tag LOCUS_47820 2205 2573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47820 >Feature sequence1261 <1 1167 gene locus_tag LOCUS_47830 <1 1167 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011393399.1:ABC transporter permease >Feature sequence1262 943 1434 gene locus_tag LOCUS_47840 943 1434 CDS product ferritin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966726.1 protein_id gnl|my_center|LOCUS_47840 1723 2079 gene locus_tag LOCUS_47850 1723 2079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47850 >Feature sequence1263 624 2177 gene locus_tag LOCUS_47860 624 2177 CDS product GMC family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141163.1 protein_id gnl|my_center|LOCUS_47860 >Feature sequence1264 1258 752 gene locus_tag LOCUS_47870 1258 752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47870 >Feature sequence1265 616 849 gene locus_tag LOCUS_47880 616 849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47880 >Feature sequence1266 24 2138 gene locus_tag LOCUS_47890 gene acs 24 2138 CDS product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404429.1 protein_id gnl|my_center|LOCUS_47890 >Feature sequence1267 598 131 gene locus_tag LOCUS_47900 598 131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47900 576 809 gene locus_tag LOCUS_47910 576 809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47910 1194 880 gene locus_tag LOCUS_47920 1194 880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47920 1697 1200 gene locus_tag LOCUS_47930 1697 1200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47930 2402 2542 gene locus_tag LOCUS_47940 2402 2542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47940 >Feature sequence1268 912 484 gene locus_tag LOCUS_47950 912 484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47950 1146 913 gene locus_tag LOCUS_47960 1146 913 CDS product AbrB/MazE/SpoVT family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064244189.1 protein_id gnl|my_center|LOCUS_47960 1599 1910 gene locus_tag LOCUS_47970 1599 1910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47970 >Feature sequence1269 1943 882 gene locus_tag LOCUS_47980 1943 882 CDS product sulfate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112406.1 protein_id gnl|my_center|LOCUS_47980 >Feature sequence1270 1034 162 gene locus_tag LOCUS_47990 1034 162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47990 1389 1820 gene locus_tag LOCUS_48000 1389 1820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48000 1867 2223 gene locus_tag LOCUS_48010 1867 2223 CDS product aspartate 1-decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001167581.1 protein_id gnl|my_center|LOCUS_48010 >Feature sequence1271 1414 257 gene locus_tag LOCUS_48020 gene holA 1414 257 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002320835.1 protein_id gnl|my_center|LOCUS_48020 2449 1835 gene locus_tag LOCUS_48030 2449 1835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48030 >Feature sequence1272 <1 789 gene locus_tag LOCUS_48040 <1 789 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010875973.1:DegT/DnrJ/EryC1/StrS family aminotransferase 792 1280 gene locus_tag LOCUS_48050 792 1280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48050 1296 2081 gene locus_tag LOCUS_48060 1296 2081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48060 >Feature sequence1273 897 1331 gene locus_tag LOCUS_48070 897 1331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48070 >Feature sequence1274 1363 113 gene locus_tag LOCUS_48080 gene nuoD 1363 113 CDS product NADH dehydrogenase (quinone) subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941009.1 protein_id gnl|my_center|LOCUS_48080 >Feature sequence1275 <2578 257 gene locus_tag LOCUS_48090 <2578 257 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011144060.1:serine/threonine-protein kinase >Feature sequence1276 <1 538 gene locus_tag LOCUS_48100 <1 538 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010933292.1:pyruvate:ferredoxin (flavodoxin) oxidoreductase 1408 2112 gene locus_tag LOCUS_48110 1408 2112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48110 2381 2503 gene locus_tag LOCUS_48120 2381 2503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48120 >Feature sequence1277 344 952 gene locus_tag LOCUS_48130 344 952 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189279.1 protein_id gnl|my_center|LOCUS_48130 1153 1413 gene locus_tag LOCUS_48140 1153 1413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48140 >Feature sequence1278 1953 1234 gene locus_tag LOCUS_48150 1953 1234 CDS product cytidylate kinase-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325942.1 protein_id gnl|my_center|LOCUS_48150 <2575 2023 gene locus_tag LOCUS_48160 <2575 2023 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011173968.1:6-phosphofructokinase >Feature sequence1279 547 717 gene locus_tag LOCUS_48170 547 717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48170 911 1699 gene locus_tag LOCUS_48180 911 1699 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000868927.1 protein_id gnl|my_center|LOCUS_48180 1831 2049 gene locus_tag LOCUS_48190 1831 2049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48190 >Feature sequence1280 1356 88 gene locus_tag LOCUS_48200 gene clpX 1356 88 CDS product ATP-dependent protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144180.1 protein_id gnl|my_center|LOCUS_48200 2062 1397 gene locus_tag LOCUS_48210 gene clpP 2062 1397 CDS product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392065.1 protein_id gnl|my_center|LOCUS_48210 >Feature sequence1281 <1 1298 gene locus_tag LOCUS_48220 <1 1298 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004195339.1:N-acetylglucosamine-specific PTS transporter subunit IIBC 2006 1311 gene locus_tag LOCUS_48230 2006 1311 CDS product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974742.1 protein_id gnl|my_center|LOCUS_48230 >Feature sequence1282 350 1552 gene locus_tag LOCUS_48240 350 1552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48240 1570 2064 gene locus_tag LOCUS_48250 1570 2064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48250 >Feature sequence1283 2270 627 gene locus_tag LOCUS_48260 2270 627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48260 >Feature sequence1284 297 491 gene locus_tag LOCUS_48270 297 491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48270 1391 759 gene locus_tag LOCUS_48280 1391 759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48280 >Feature sequence1285 576 310 gene locus_tag LOCUS_48290 576 310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48290 1661 639 gene locus_tag LOCUS_48300 1661 639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48300 >Feature sequence1286 <1 711 gene locus_tag LOCUS_48310 <1 711 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011143074.1:MOSC domain-containing protein 2494 1604 gene locus_tag LOCUS_48320 gene yghX 2494 1604 CDS product YghX family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267754.1 protein_id gnl|my_center|LOCUS_48320 >Feature sequence1287 39 521 gene locus_tag LOCUS_48330 gene hcp 39 521 CDS product type VI secretion system receptor/chaperone Hcp inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083670.1 protein_id gnl|my_center|LOCUS_48330 543 1214 gene locus_tag LOCUS_48340 543 1214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48340 1233 1499 gene locus_tag LOCUS_48350 1233 1499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48350 1800 2225 gene locus_tag LOCUS_48360 1800 2225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48360 >Feature sequence1288 192 473 gene locus_tag LOCUS_48370 192 473 CDS product type II toxin-antitoxin system prevent-host-death family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929718.1 protein_id gnl|my_center|LOCUS_48370 460 726 gene locus_tag LOCUS_48380 460 726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48380 1791 883 gene locus_tag LOCUS_48390 1791 883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48390 <2554 1946 gene locus_tag LOCUS_48400 <2554 1946 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_176724209.1:fibronectin type III domain-containing protein >Feature sequence1289 514 1905 gene locus_tag LOCUS_48410 514 1905 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460069.1 protein_id gnl|my_center|LOCUS_48410 >Feature sequence1290 675 2411 gene locus_tag LOCUS_48420 gene yidC 675 2411 CDS product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944075.1 protein_id gnl|my_center|LOCUS_48420 >Feature sequence1291 465 1367 gene locus_tag LOCUS_48430 465 1367 CDS product fructose bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681313.1 protein_id gnl|my_center|LOCUS_48430 2317 1445 gene locus_tag LOCUS_48440 2317 1445 CDS product RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140671.1 protein_id gnl|my_center|LOCUS_48440 2442 2317 gene locus_tag LOCUS_48450 2442 2317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48450 >Feature sequence1292 >Feature sequence1293 1115 210 gene locus_tag LOCUS_48460 1115 210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48460 1753 1169 gene locus_tag LOCUS_48470 1753 1169 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530706.1 protein_id gnl|my_center|LOCUS_48470 1771 1908 gene locus_tag LOCUS_48480 1771 1908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48480 <2542 2016 gene locus_tag LOCUS_48490 <2542 2016 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011263462.1:YHS domain-containing (seleno)protein >Feature sequence1294 >Feature sequence1295 <2541 667 gene locus_tag LOCUS_48500 <2541 667 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003114864.1:TonB-dependent receptor >Feature sequence1296 245 547 gene locus_tag LOCUS_48510 245 547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48510 564 2186 gene locus_tag LOCUS_48520 564 2186 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969307.1 protein_id gnl|my_center|LOCUS_48520 >Feature sequence1297 2526 316 gene locus_tag LOCUS_48530 gene priA 2526 316 CDS product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989822.1 protein_id gnl|my_center|LOCUS_48530 >Feature sequence1298 14 1810 gene locus_tag LOCUS_48540 gene dnaG 14 1810 CDS product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392160.1 protein_id gnl|my_center|LOCUS_48540 >Feature sequence1299 212 505 gene locus_tag LOCUS_48550 212 505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_48550 2462 735 gene locus_tag LOCUS_48560 gene poxB 2462 735 CDS product ubiquinone-dependent pyruvate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090021.1 protein_id gnl|my_center|LOCUS_48560 >Feature sequence1300 <1 1753 gene locus_tag LOCUS_48570 <1 1753 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004193177.1:acid phosphatase >Feature sequence1301 353 505 gene locus_tag LOCUS_48580 353 505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48580 2064 715 gene locus_tag LOCUS_48590 gene chrA 2064 715 CDS product chromate efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087813.1 protein_id gnl|my_center|LOCUS_48590 >Feature sequence1302 485 231 gene locus_tag LOCUS_48600 485 231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48600 1177 995 gene locus_tag LOCUS_48610 1177 995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48610 1751 1260 gene locus_tag LOCUS_48620 1751 1260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48620 >Feature sequence1303 250 756 gene locus_tag LOCUS_48630 250 756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48630 1079 2011 gene locus_tag LOCUS_48640 1079 2011 CDS product aldose 1-epimerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101568.1 protein_id gnl|my_center|LOCUS_48640 >Feature sequence1304 <1 1193 gene locus_tag LOCUS_48650 <1 1193 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003112884.1:MBOAT family protein >Feature sequence1305 1639 482 gene locus_tag LOCUS_48660 1639 482 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706757.1 protein_id gnl|my_center|LOCUS_48660 >Feature sequence1306 864 568 gene locus_tag LOCUS_48670 864 568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48670 1504 857 gene locus_tag LOCUS_48680 1504 857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48680 1648 1968 gene locus_tag LOCUS_48690 1648 1968 CDS product DUF4242 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528685.1 protein_id gnl|my_center|LOCUS_48690 >Feature sequence1307 1232 138 gene locus_tag LOCUS_48700 gene meaB 1232 138 CDS product methylmalonyl Co-A mutase-associated GTPase MeaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390231.1 protein_id gnl|my_center|LOCUS_48700 <2524 1247 gene locus_tag LOCUS_48710 <2524 1247 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005790883.1:methylmalonyl-CoA mutase >Feature sequence1308 2172 1489 gene locus_tag LOCUS_48720 2172 1489 CDS product zinc metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932468.1 protein_id gnl|my_center|LOCUS_48720 >Feature sequence1309 75 890 gene locus_tag LOCUS_48730 75 890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48730 904 2316 gene locus_tag LOCUS_48740 904 2316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48740 >Feature sequence1310 411 1469 gene locus_tag LOCUS_48750 411 1469 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197530021.1 protein_id gnl|my_center|LOCUS_48750 >Feature sequence1311 >Feature sequence1312 <2516 1115 gene locus_tag LOCUS_48760 <2516 1115 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003147216.1:filamentous hemagglutinin family protein >Feature sequence1313 215 1489 gene locus_tag LOCUS_48770 215 1489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48770 2393 2193 gene locus_tag LOCUS_48780 2393 2193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48780 >Feature sequence1314 38 442 gene locus_tag LOCUS_48790 38 442 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970656.1 protein_id gnl|my_center|LOCUS_48790 591 1820 gene locus_tag LOCUS_48800 591 1820 CDS product Tm-1-like ATP-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949085.1 protein_id gnl|my_center|LOCUS_48800 >Feature sequence1315 <1 577 gene locus_tag LOCUS_48810 <1 577 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011122363.1:alpha/beta hydrolase 1030 872 gene locus_tag LOCUS_48820 1030 872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48820 1559 1272 gene locus_tag LOCUS_48830 1559 1272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48830 2070 2315 gene locus_tag LOCUS_48840 2070 2315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48840 >Feature sequence1316 1869 493 gene locus_tag LOCUS_48850 gene zwf 1869 493 CDS product glucose-6-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528919.1 protein_id gnl|my_center|LOCUS_48850 <2509 1880 gene locus_tag LOCUS_48860 <2509 1880 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013528920.1:decarboxylating 6-phosphogluconate dehydrogenase >Feature sequence1317 1201 2361 gene locus_tag LOCUS_48870 1201 2361 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027080.1 protein_id gnl|my_center|LOCUS_48870 >Feature sequence1318 1595 495 gene locus_tag LOCUS_48880 1595 495 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528460.1 protein_id gnl|my_center|LOCUS_48880 <2506 1857 gene locus_tag LOCUS_48890 <2506 1857 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011173996.1:ABC transporter substrate-binding protein >Feature sequence1319 1 291 gene locus_tag LOCUS_48900 1 291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48900 893 375 gene locus_tag LOCUS_48910 893 375 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141436.1 protein_id gnl|my_center|LOCUS_48910 1237 890 gene locus_tag LOCUS_48920 1237 890 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967099.1 protein_id gnl|my_center|LOCUS_48920 1891 1817 gene locus_tag LOCUS_t00410 1891 1817 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence1320 134 706 gene locus_tag LOCUS_48930 134 706 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256521.1 protein_id gnl|my_center|LOCUS_48930 696 1847 gene locus_tag LOCUS_48940 696 1847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256522.1 protein_id gnl|my_center|LOCUS_48940 1859 2323 gene locus_tag LOCUS_48950 1859 2323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48950 >Feature sequence1321 437 796 gene locus_tag LOCUS_48960 437 796 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265525.1 protein_id gnl|my_center|LOCUS_48960 1329 940 gene locus_tag LOCUS_48970 1329 940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48970 2272 2445 gene locus_tag LOCUS_48980 2272 2445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48980 >Feature sequence1322 400 828 gene locus_tag LOCUS_48990 400 828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48990 1954 1085 gene locus_tag LOCUS_49000 1954 1085 CDS product F0F1 ATP synthase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022404.1 protein_id gnl|my_center|LOCUS_49000 >Feature sequence1323 416 901 gene locus_tag LOCUS_49010 416 901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49010 1589 1837 gene locus_tag LOCUS_49020 1589 1837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49020 1834 2052 gene locus_tag LOCUS_49030 1834 2052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49030 >Feature sequence1324 124 603 gene locus_tag LOCUS_49040 124 603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49040 940 2076 gene locus_tag LOCUS_49050 940 2076 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000844385.1 protein_id gnl|my_center|LOCUS_49050 >Feature sequence1325 >Feature sequence1326 869 1057 gene locus_tag LOCUS_49060 869 1057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49060 >Feature sequence1327 953 726 gene locus_tag LOCUS_49070 953 726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49070 1332 1033 gene locus_tag LOCUS_49080 1332 1033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49080 >Feature sequence1328 >Feature sequence1329 >Feature sequence1330 >Feature sequence1331 <1 915 gene locus_tag LOCUS_49090 <1 915 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_028171412.1:alpha/beta hydrolase >Feature sequence1332 <1 696 gene locus_tag LOCUS_49100 <1 696 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011460521.1:Stk1 family PASTA domain-containing Ser/Thr kinase note possible pseudo, frameshifted 660 1631 gene locus_tag LOCUS_49110 660 1631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_49110 2443 2075 gene locus_tag LOCUS_49120 2443 2075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49120 >Feature sequence1333 810 241 gene locus_tag LOCUS_49130 810 241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49130 1814 816 gene locus_tag LOCUS_49140 1814 816 CDS product MlaD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403121.1 protein_id gnl|my_center|LOCUS_49140 2470 1811 gene locus_tag LOCUS_49150 2470 1811 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403122.1 protein_id gnl|my_center|LOCUS_49150 >Feature sequence1334 <1 562 gene locus_tag LOCUS_49160 <1 562 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_185271872.1:amidohydrolase family protein <2475 698 gene locus_tag LOCUS_49170 <2475 698 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011268249.1:type II secretion system secretin GspD >Feature sequence1335 <1 2196 gene locus_tag LOCUS_49180 <1 2196 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011727162.1:aerobic carbon-monoxide dehydrogenase large subunit >Feature sequence1336 833 36 gene locus_tag LOCUS_49190 833 36 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007244130.1 protein_id gnl|my_center|LOCUS_49190 1463 1212 gene locus_tag LOCUS_49200 1463 1212 CDS product ribbon-helix-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417286.1 protein_id gnl|my_center|LOCUS_49200 1715 1903 gene locus_tag LOCUS_49210 1715 1903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49210 1896 2303 gene locus_tag LOCUS_49220 1896 2303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49220 >Feature sequence1337 383 1333 gene locus_tag LOCUS_49230 383 1333 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530866.1 protein_id gnl|my_center|LOCUS_49230 2202 1675 gene locus_tag LOCUS_49240 2202 1675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49240 >Feature sequence1338 360 76 gene locus_tag LOCUS_49250 360 76 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49250 800 372 gene locus_tag LOCUS_49260 800 372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49260 1861 872 gene locus_tag LOCUS_49270 1861 872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49270 2358 1957 gene locus_tag LOCUS_49280 2358 1957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49280 >Feature sequence1339 1870 1532 gene locus_tag LOCUS_49290 1870 1532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49290 >Feature sequence1340 192 1574 gene locus_tag LOCUS_49300 gene lpdA 192 1574 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393264.1 protein_id gnl|my_center|LOCUS_49300 1748 1888 gene locus_tag LOCUS_49310 1748 1888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49310 2028 1909 gene locus_tag LOCUS_49320 2028 1909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49320 >Feature sequence1341 1307 354 gene locus_tag LOCUS_49330 1307 354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49330 >Feature sequence1342 830 537 gene locus_tag LOCUS_49340 830 537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49340 1528 1058 gene locus_tag LOCUS_49350 1528 1058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49350 1762 2223 gene locus_tag LOCUS_49360 1762 2223 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206818398.1 protein_id gnl|my_center|LOCUS_49360 >Feature sequence1343 650 468 gene locus_tag LOCUS_49370 650 468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49370 1784 657 gene locus_tag LOCUS_49380 1784 657 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028170959.1 protein_id gnl|my_center|LOCUS_49380 >Feature sequence1344 64 1251 gene locus_tag LOCUS_49390 gene sucC 64 1251 CDS product ADP-forming succinate--CoA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388966.1 protein_id gnl|my_center|LOCUS_49390 1279 1647 gene locus_tag LOCUS_49400 1279 1647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49400 >Feature sequence1345 463 1284 gene locus_tag LOCUS_49410 463 1284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49410 2406 1726 gene locus_tag LOCUS_49420 2406 1726 CDS product haloacid dehalogenase type II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099263006.1 protein_id gnl|my_center|LOCUS_49420 >Feature sequence1346 1304 1137 gene locus_tag LOCUS_49430 1304 1137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49430 1536 1387 gene locus_tag LOCUS_49440 1536 1387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49440 2109 2366 gene locus_tag LOCUS_49450 2109 2366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_49450 >Feature sequence1347 757 972 gene locus_tag LOCUS_49460 757 972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49460 1550 1708 gene locus_tag LOCUS_49470 1550 1708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49470 1665 1814 gene locus_tag LOCUS_49480 1665 1814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49480 2343 1807 gene locus_tag LOCUS_49490 2343 1807 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043551827.1 protein_id gnl|my_center|LOCUS_49490 >Feature sequence1348 436 852 gene locus_tag LOCUS_49500 436 852 CDS product F0F1 ATP synthase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003687159.1 protein_id gnl|my_center|LOCUS_49500 2187 874 gene locus_tag LOCUS_49510 gene hisD 2187 874 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461463.1 protein_id gnl|my_center|LOCUS_49510 >Feature sequence1349 723 2132 gene locus_tag LOCUS_49520 723 2132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49520 >Feature sequence1350 320 715 gene locus_tag LOCUS_49530 320 715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49530 806 1795 gene locus_tag LOCUS_49540 806 1795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_49540 >Feature sequence1351 612 1100 gene locus_tag LOCUS_49550 612 1100 CDS product YajQ family cyclic di-GMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809252.1 protein_id gnl|my_center|LOCUS_49550 <2436 1097 gene locus_tag LOCUS_49560 <2436 1097 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011015826.1:tetratricopeptide repeat protein >Feature sequence1352 589 284 gene locus_tag LOCUS_49570 589 284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49570 784 593 gene locus_tag LOCUS_49580 784 593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49580 926 1198 gene locus_tag LOCUS_49590 926 1198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49590 1177 1329 gene locus_tag LOCUS_49600 1177 1329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49600 1755 1973 gene locus_tag LOCUS_49610 1755 1973 CDS product dodecin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084181.1 protein_id gnl|my_center|LOCUS_49610 >Feature sequence1353 1244 330 gene locus_tag LOCUS_49620 1244 330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_49620 2162 1281 gene locus_tag LOCUS_49630 2162 1281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_49630 2210 2338 gene locus_tag LOCUS_49640 2210 2338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49640 >Feature sequence1354 480 1121 gene locus_tag LOCUS_49650 480 1121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_49650 2122 1349 gene locus_tag LOCUS_49660 2122 1349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49660 >Feature sequence1355 457 2319 gene locus_tag LOCUS_49670 gene thrS 457 2319 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228977.1 protein_id gnl|my_center|LOCUS_49670 >Feature sequence1356 61 1245 gene locus_tag LOCUS_49680 61 1245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49680 2008 1562 gene locus_tag LOCUS_49690 2008 1562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49690 >Feature sequence1357 438 680 gene locus_tag LOCUS_49700 438 680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49700 1613 1218 gene locus_tag LOCUS_49710 1613 1218 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_031500121.1 protein_id gnl|my_center|LOCUS_49710 1904 1776 gene locus_tag LOCUS_49720 1904 1776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49720 <2426 1901 gene locus_tag LOCUS_49730 <2426 1901 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011268523.1:MFS transporter >Feature sequence1358 1971 1486 gene locus_tag LOCUS_49740 1971 1486 CDS product organic hydroperoxide resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263218.1 protein_id gnl|my_center|LOCUS_49740 >Feature sequence1359 268 711 gene locus_tag LOCUS_49750 268 711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49750 919 1896 gene locus_tag LOCUS_49760 919 1896 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706757.1 protein_id gnl|my_center|LOCUS_49760 >Feature sequence1360 >Feature sequence1361 >Feature sequence1362 1009 389 gene locus_tag LOCUS_49770 gene thiE 1009 389 CDS product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172766.1 protein_id gnl|my_center|LOCUS_49770 <2416 1036 gene locus_tag LOCUS_49780 <2416 1036 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010931851.1:acetyl-CoA carboxylase biotin carboxylase subunit >Feature sequence1363 <1 539 gene locus_tag LOCUS_49790 <1 539 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010971599.1:L-idonate 5-dehydrogenase 596 2122 gene locus_tag LOCUS_49800 596 2122 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064243748.1 protein_id gnl|my_center|LOCUS_49800 >Feature sequence1364 434 1618 gene locus_tag LOCUS_49810 434 1618 CDS product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966157.1 protein_id gnl|my_center|LOCUS_49810 1774 2280 gene locus_tag LOCUS_49820 1774 2280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49820 >Feature sequence1365 <1 822 gene locus_tag LOCUS_49830 <1 822 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013383327.1:extracellular solute-binding protein 909 1844 gene locus_tag LOCUS_49840 909 1844 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383328.1 protein_id gnl|my_center|LOCUS_49840 >Feature sequence1366 144 1379 gene locus_tag LOCUS_49850 gene gspF 144 1379 CDS product type II secretion system inner membrane protein GspF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196821.1 protein_id gnl|my_center|LOCUS_49850 1568 2371 gene locus_tag LOCUS_49860 1568 2371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49860 >Feature sequence1367 754 1440 gene locus_tag LOCUS_49870 754 1440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49870 <2409 1751 gene locus_tag LOCUS_49880 <2409 1751 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010907817.1:transaldolase >Feature sequence1368 726 94 gene locus_tag LOCUS_49890 726 94 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970398.1 protein_id gnl|my_center|LOCUS_49890 <2409 723 gene locus_tag LOCUS_49900 <2409 723 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011085545.1:PAS domain-containing sensor histidine kinase >Feature sequence1369 <1 1092 gene locus_tag LOCUS_49910 <1 1092 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011021995.1:glycogen debranching protein GlgX 1349 1678 gene locus_tag LOCUS_49920 1349 1678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49920 >Feature sequence1370 1 333 gene locus_tag LOCUS_49930 1 333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49930 323 679 gene locus_tag LOCUS_49940 323 679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49940 1063 1800 gene locus_tag LOCUS_49950 1063 1800 CDS product cytidylate kinase-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583266.1 protein_id gnl|my_center|LOCUS_49950 2372 2037 gene locus_tag LOCUS_49960 2372 2037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49960 >Feature sequence1371 801 1886 gene locus_tag LOCUS_49970 801 1886 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014528694.1 protein_id gnl|my_center|LOCUS_49970 >Feature sequence1372 1097 75 gene locus_tag LOCUS_49980 1097 75 CDS product sulfate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112406.1 protein_id gnl|my_center|LOCUS_49980 2223 1453 gene locus_tag LOCUS_49990 2223 1453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49990 >Feature sequence1373 349 1023 gene locus_tag LOCUS_50000 349 1023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50000 <2400 1211 gene locus_tag LOCUS_50010 <2400 1211 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014626100.1:FAD-linked oxidase C-terminal domain-containing protein >Feature sequence1374 940 389 gene locus_tag LOCUS_50020 940 389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50020 1143 1661 gene locus_tag LOCUS_50030 1143 1661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50030 >Feature sequence1375 <2397 198 gene locus_tag LOCUS_50040 <2397 198 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013095415.1:ATP-binding sensor histidine kinase >Feature sequence1376 <1 563 gene locus_tag LOCUS_50050 <1 563 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007326180.1:Gfo/Idh/MocA family oxidoreductase 852 1715 gene locus_tag LOCUS_50060 852 1715 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837697.1 protein_id gnl|my_center|LOCUS_50060 1763 2308 gene locus_tag LOCUS_50070 1763 2308 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039946.1 protein_id gnl|my_center|LOCUS_50070 >Feature sequence1377 <1 1123 gene locus_tag LOCUS_50080 <1 1123 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011107422.1:aspartate-alanine antiporter >Feature sequence1378 714 1460 gene locus_tag LOCUS_50090 714 1460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50090 1549 2046 gene locus_tag LOCUS_50100 1549 2046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50100 >Feature sequence1379 753 286 gene locus_tag LOCUS_50110 753 286 CDS product DUF1348 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529396.1 protein_id gnl|my_center|LOCUS_50110 899 1795 gene locus_tag LOCUS_50120 899 1795 CDS product class II fructose-1,6-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393881.1 protein_id gnl|my_center|LOCUS_50120 >Feature sequence1380 719 1087 gene locus_tag LOCUS_50130 719 1087 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013087171.1 protein_id gnl|my_center|LOCUS_50130 1080 1907 gene locus_tag LOCUS_50140 1080 1907 CDS product arsenite methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461623.1 protein_id gnl|my_center|LOCUS_50140 1994 2383 gene locus_tag LOCUS_50150 1994 2383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50150 >Feature sequence1381 39 305 gene locus_tag LOCUS_50160 39 305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50160 936 463 gene locus_tag LOCUS_50170 936 463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50170 1066 2184 gene locus_tag LOCUS_50180 1066 2184 CDS product zinc-dependent alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_092772473.1 protein_id gnl|my_center|LOCUS_50180 >Feature sequence1382 <1 1064 gene locus_tag LOCUS_50190 <1 1064 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_026955981.1:long-chain fatty acid--CoA ligase >Feature sequence1383 <2376 1510 gene locus_tag LOCUS_50200 <2376 1510 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011705558.1:maltose/maltodextrin ABC transporter substrate-binding protein MalE >Feature sequence1384 432 767 gene locus_tag LOCUS_50210 432 767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_50210 900 1073 gene locus_tag LOCUS_50220 900 1073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50220 1197 1949 gene locus_tag LOCUS_50230 1197 1949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50230 >Feature sequence1385 <2374 644 gene locus_tag LOCUS_50240 <2374 644 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014208195.1:type II secretion system secretin GspD >Feature sequence1386 1598 321 gene locus_tag LOCUS_50250 1598 321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50250 <2372 1588 gene locus_tag LOCUS_50260 <2372 1588 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000686845.1:AAA family ATPase note possible pseudo, frameshifted >Feature sequence1387 146 985 gene locus_tag LOCUS_50270 146 985 CDS product prephenate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545810.1 protein_id gnl|my_center|LOCUS_50270 993 2348 gene locus_tag LOCUS_50280 gene aroA 993 2348 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943243.1 protein_id gnl|my_center|LOCUS_50280 >Feature sequence1388 901 542 gene locus_tag LOCUS_50290 901 542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50290 1467 1066 gene locus_tag LOCUS_50300 1467 1066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50300 1859 1464 gene locus_tag LOCUS_50310 1859 1464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50310 >Feature sequence1389 811 221 gene locus_tag LOCUS_50320 811 221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50320 1878 808 gene locus_tag LOCUS_50330 1878 808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50330 >Feature sequence1390 1148 39 gene locus_tag LOCUS_50340 1148 39 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000654739.1 protein_id gnl|my_center|LOCUS_50340 1192 1698 gene locus_tag LOCUS_50350 1192 1698 CDS product adenylyltransferase/cytidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258042.1 protein_id gnl|my_center|LOCUS_50350 1695 2288 gene locus_tag LOCUS_50360 gene purN 1695 2288 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545849.1 protein_id gnl|my_center|LOCUS_50360 >Feature sequence1391 1023 1943 gene locus_tag LOCUS_50370 gene moaA 1023 1943 CDS product GTP 3',8-cyclase MoaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393625.1 protein_id gnl|my_center|LOCUS_50370 >Feature sequence1392 <2368 1452 gene locus_tag LOCUS_50380 <2368 1452 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011393989.1:nickel pincer cofactor biosynthesis protein LarC >Feature sequence1393 <1 1172 gene locus_tag LOCUS_50390 <1 1172 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257786.1:kelch repeat-containing protein 1535 1843 gene locus_tag LOCUS_50400 1535 1843 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058088.1 protein_id gnl|my_center|LOCUS_50400 2057 2275 gene locus_tag LOCUS_50410 gene infA 2057 2275 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002556767.1 protein_id gnl|my_center|LOCUS_50410 >Feature sequence1394 1041 376 gene locus_tag LOCUS_50420 1041 376 CDS product CerR family C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937368.1 protein_id gnl|my_center|LOCUS_50420 <2364 1653 gene locus_tag LOCUS_50430 <2364 1653 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011729120.1:FAD-dependent oxidoreductase >Feature sequence1395 940 1644 gene locus_tag LOCUS_50440 940 1644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50440 1789 2223 gene locus_tag LOCUS_50450 1789 2223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50450 >Feature sequence1396 1103 9 gene locus_tag LOCUS_50460 gene lpxD 1103 9 CDS product UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387804.1 protein_id gnl|my_center|LOCUS_50460 <2363 1294 gene locus_tag LOCUS_50470 <2363 1294 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011387804.1:UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase >Feature sequence1397 1210 719 gene locus_tag LOCUS_50480 1210 719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50480 <2362 1514 gene locus_tag LOCUS_50490 <2362 1514 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011975826.1:adenylate/guanylate cyclase domain-containing protein >Feature sequence1398 >Feature sequence1399 260 928 gene locus_tag LOCUS_50500 gene dhaL 260 928 CDS product dihydroxyacetone kinase subunit DhaL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533066.1 protein_id gnl|my_center|LOCUS_50500 >Feature sequence1400 453 10 gene locus_tag LOCUS_50510 453 10 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50510 1665 772 gene locus_tag LOCUS_50520 1665 772 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197330.1 protein_id gnl|my_center|LOCUS_50520 <2354 1693 gene locus_tag LOCUS_50530 <2354 1693 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_009968280.1:ribokinase >Feature sequence1401 2096 759 gene locus_tag LOCUS_50540 gene pcaF 2096 759 CDS product 3-oxoadipyl-CoA thiolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206932.1 protein_id gnl|my_center|LOCUS_50540 2351 2214 gene locus_tag LOCUS_50550 2351 2214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50550 >Feature sequence1402 <2353 1333 gene locus_tag LOCUS_50560 <2353 1333 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011403448.1:response regulator transcription factor >Feature sequence1403 >Feature sequence1404 311 646 gene locus_tag LOCUS_50570 311 646 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729618.1 protein_id gnl|my_center|LOCUS_50570 643 1176 gene locus_tag LOCUS_50580 643 1176 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729619.1 protein_id gnl|my_center|LOCUS_50580 1369 1959 gene locus_tag LOCUS_50590 gene azoR1 1369 1959 CDS product FMN-dependent NADH-azoreductase AzoR1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114189.1 protein_id gnl|my_center|LOCUS_50590 >Feature sequence1405 118 1110 gene locus_tag LOCUS_50600 118 1110 CDS product nitronate monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087852.1 protein_id gnl|my_center|LOCUS_50600 1233 2186 gene locus_tag LOCUS_50610 gene mgrA 1233 2186 CDS product L-glyceraldehyde 3-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227010.1 protein_id gnl|my_center|LOCUS_50610 >Feature sequence1406 350 1321 gene locus_tag LOCUS_50620 350 1321 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161532938.1 protein_id gnl|my_center|LOCUS_50620 1497 2264 gene locus_tag LOCUS_50630 1497 2264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50630 >Feature sequence1407 109 1113 gene locus_tag LOCUS_50640 109 1113 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582577.1 protein_id gnl|my_center|LOCUS_50640 1118 1975 gene locus_tag LOCUS_50650 1118 1975 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584068.1 protein_id gnl|my_center|LOCUS_50650 >Feature sequence1408 2013 937 gene locus_tag LOCUS_50660 2013 937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50660 1994 2128 gene locus_tag LOCUS_50670 1994 2128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50670 >Feature sequence1409 >Feature sequence1410 1445 1206 gene locus_tag LOCUS_50680 1445 1206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50680 1683 1991 gene locus_tag LOCUS_50690 1683 1991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50690 >Feature sequence1411 766 206 gene locus_tag LOCUS_50700 766 206 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393557.1 protein_id gnl|my_center|LOCUS_50700 1511 858 gene locus_tag LOCUS_50710 1511 858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50710 >Feature sequence1412 713 540 gene locus_tag LOCUS_50720 713 540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50720 1088 786 gene locus_tag LOCUS_50730 1088 786 CDS product antibiotic biosynthesis monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249692.1 protein_id gnl|my_center|LOCUS_50730 1548 1198 gene locus_tag LOCUS_50740 1548 1198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50740 2231 1650 gene locus_tag LOCUS_50750 2231 1650 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972734.1 protein_id gnl|my_center|LOCUS_50750 >Feature sequence1413 331 1365 gene locus_tag LOCUS_50760 331 1365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50760 <2336 1753 gene locus_tag LOCUS_50770 <2336 1753 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164928497.1:TIGR03118 family protein >Feature sequence1414 1112 897 gene locus_tag LOCUS_50780 1112 897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50780 1554 1297 gene locus_tag LOCUS_50790 1554 1297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50790 >Feature sequence1415 322 642 gene locus_tag LOCUS_50800 322 642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_50800 652 945 gene locus_tag LOCUS_50810 652 945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50810 >Feature sequence1416 1854 1321 gene locus_tag LOCUS_50820 1854 1321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50820 >Feature sequence1417 <1 608 gene locus_tag LOCUS_50830 <1 608 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010880118.1:class I SAM-dependent methyltransferase 745 1629 gene locus_tag LOCUS_50840 745 1629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50840 >Feature sequence1418 <2331 1264 gene locus_tag LOCUS_50850 <2331 1264 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_048066275.1:PKD domain-containing protein >Feature sequence1419 1017 34 gene locus_tag LOCUS_50860 1017 34 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50860 2245 1481 gene locus_tag LOCUS_50870 2245 1481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50870 >Feature sequence1420 1511 774 gene locus_tag LOCUS_50880 1511 774 CDS product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922137.1 protein_id gnl|my_center|LOCUS_50880 >Feature sequence1421 <1 1495 gene locus_tag LOCUS_50890 <1 1495 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942706.1:DNA repair protein RecN >Feature sequence1422 <1 646 gene locus_tag LOCUS_50900 <1 646 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011338355.1:SDR family NAD(P)-dependent oxidoreductase 693 1331 gene locus_tag LOCUS_50910 693 1331 CDS product NAD(P)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027478.1 protein_id gnl|my_center|LOCUS_50910 1793 1443 gene locus_tag LOCUS_50920 1793 1443 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090094.1 protein_id gnl|my_center|LOCUS_50920 2259 1807 gene locus_tag LOCUS_50930 2259 1807 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525102.1 protein_id gnl|my_center|LOCUS_50930 >Feature sequence1423 75 851 gene locus_tag LOCUS_50940 75 851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50940 2105 1056 gene locus_tag LOCUS_50950 2105 1056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50950 >Feature sequence1424 <1 1221 gene locus_tag LOCUS_50960 <1 1221 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012584014.1:sugar ABC transporter ATP-binding protein >Feature sequence1425 1239 424 gene locus_tag LOCUS_50970 gene tolQ 1239 424 CDS product protein TolQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940706.1 protein_id gnl|my_center|LOCUS_50970 1516 2292 gene locus_tag LOCUS_50980 1516 2292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50980 >Feature sequence1426 243 515 gene locus_tag LOCUS_50990 243 515 CDS product acylphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243829.1 protein_id gnl|my_center|LOCUS_50990 613 1335 gene locus_tag LOCUS_51000 613 1335 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088429.1 protein_id gnl|my_center|LOCUS_51000 1332 2315 gene locus_tag LOCUS_51010 gene waaC 1332 2315 CDS product lipopolysaccharide heptosyltransferase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546021.1 protein_id gnl|my_center|LOCUS_51010 >Feature sequence1427 73 1038 gene locus_tag LOCUS_51020 73 1038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51020 >Feature sequence1428 >Feature sequence1429 8 628 gene locus_tag LOCUS_51030 8 628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51030 1571 1017 gene locus_tag LOCUS_51040 1571 1017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51040 >Feature sequence1430 >Feature sequence1431 >Feature sequence1432 648 25 gene locus_tag LOCUS_51050 648 25 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51050 1057 863 gene locus_tag LOCUS_51060 1057 863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51060 >Feature sequence1433 980 228 gene locus_tag LOCUS_51070 980 228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_51070 1942 1370 gene locus_tag LOCUS_51080 1942 1370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51080 >Feature sequence1434 618 1655 gene locus_tag LOCUS_51090 618 1655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51090 >Feature sequence1435 1033 167 gene locus_tag LOCUS_51100 gene tal 1033 167 CDS product transaldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143366.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_51100 1914 2135 gene locus_tag LOCUS_51110 1914 2135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51110 >Feature sequence1436 983 432 gene locus_tag LOCUS_51120 983 432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51120 2009 2140 gene locus_tag LOCUS_51130 2009 2140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51130 >Feature sequence1437 <2287 1672 gene locus_tag LOCUS_51140 <2287 1672 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011143748.1:NAD(P)-dependent oxidoreductase >Feature sequence1438 44 1369 gene locus_tag LOCUS_51150 44 1369 CDS product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943920.1 protein_id gnl|my_center|LOCUS_51150 <2286 1599 gene locus_tag LOCUS_51160 <2286 1599 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_071541499.1:isoprenyl transferase >Feature sequence1439 <1 1582 gene locus_tag LOCUS_51170 <1 1582 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_118838628.1:glutamate synthase subunit beta 1634 2257 gene locus_tag LOCUS_51180 1634 2257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51180 >Feature sequence1440 <1 997 gene locus_tag LOCUS_51190 <1 997 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_038967605.1:CHASE3 domain-containing protein >Feature sequence1441 1552 809 gene locus_tag LOCUS_51200 gene surE 1552 809 CDS product 5'/3'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919864.1 protein_id gnl|my_center|LOCUS_51200 >Feature sequence1442 >Feature sequence1443 796 524 gene locus_tag LOCUS_51210 796 524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51210 948 1226 gene locus_tag LOCUS_51220 948 1226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51220 >Feature sequence1444 722 1444 gene locus_tag LOCUS_51230 722 1444 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975106.1 protein_id gnl|my_center|LOCUS_51230 >Feature sequence1445 774 493 gene locus_tag LOCUS_51240 774 493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51240 >Feature sequence1446 704 922 gene locus_tag LOCUS_51250 704 922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51250 2147 1296 gene locus_tag LOCUS_51260 2147 1296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51260 >Feature sequence1447 301 1293 gene locus_tag LOCUS_51270 301 1293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51270 <2267 1523 gene locus_tag LOCUS_51280 <2267 1523 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941582.1:DEAD/DEAH box helicase >Feature sequence1448 1499 237 gene locus_tag LOCUS_51290 1499 237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51290 1571 1873 gene locus_tag LOCUS_51300 1571 1873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51300 >Feature sequence1449 843 10 gene locus_tag LOCUS_51310 843 10 CDS product cyclase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878166.1 protein_id gnl|my_center|LOCUS_51310 1753 1412 gene locus_tag LOCUS_51320 1753 1412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51320 >Feature sequence1450 >Feature sequence1451 1251 940 gene locus_tag LOCUS_51330 1251 940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51330 >Feature sequence1452 623 1324 gene locus_tag LOCUS_51340 gene rplA 623 1324 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545797.1 protein_id gnl|my_center|LOCUS_51340 1336 1872 gene locus_tag LOCUS_51350 gene rplJ 1336 1872 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700677.1 protein_id gnl|my_center|LOCUS_51350 >Feature sequence1453 <1 1885 gene locus_tag LOCUS_51360 <1 1885 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_016328122.1:formylglycine-generating enzyme family protein >Feature sequence1454 291 1157 gene locus_tag LOCUS_51370 gene rpoS 291 1157 CDS product RNA polymerase sigma factor RpoS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704778.1 protein_id gnl|my_center|LOCUS_51370 1508 1215 gene locus_tag LOCUS_51380 1508 1215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51380 1742 1554 gene locus_tag LOCUS_51390 1742 1554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51390 >Feature sequence1455 210 1691 gene locus_tag LOCUS_51400 gene gatA 210 1691 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393505.1 protein_id gnl|my_center|LOCUS_51400 >Feature sequence1456 260 1093 gene locus_tag LOCUS_51410 gene pcaD 260 1093 CDS product 3-oxoadipate enol-lactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530131.1 protein_id gnl|my_center|LOCUS_51410 1217 1804 gene locus_tag LOCUS_51420 1217 1804 CDS product YceI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391428.1 protein_id gnl|my_center|LOCUS_51420 >Feature sequence1457 <1 815 gene locus_tag LOCUS_51430 <1 815 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011035988.1:adenosylhomocysteinase 2194 965 gene locus_tag LOCUS_51440 2194 965 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016234.1 protein_id gnl|my_center|LOCUS_51440 >Feature sequence1458 2031 538 gene locus_tag LOCUS_51450 2031 538 CDS product FGGY-family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970033.1 protein_id gnl|my_center|LOCUS_51450 >Feature sequence1459 682 314 gene locus_tag LOCUS_51460 682 314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51460 956 1624 gene locus_tag LOCUS_51470 956 1624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51470 >Feature sequence1460 1293 490 gene locus_tag LOCUS_51480 gene mreC 1293 490 CDS product rod shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015945174.1 protein_id gnl|my_center|LOCUS_51480 <2253 1314 gene locus_tag LOCUS_51490 <2253 1314 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010938090.1:rod shape-determining protein >Feature sequence1461 625 137 gene locus_tag LOCUS_51500 625 137 CDS product DUF5947 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467021.1 protein_id gnl|my_center|LOCUS_51500 1075 1662 gene locus_tag LOCUS_51510 1075 1662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51510 >Feature sequence1462 >Feature sequence1463 <1 1126 gene locus_tag LOCUS_51520 <1 1126 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004199088.1:galactonate dehydratase >Feature sequence1464 15 608 gene locus_tag LOCUS_51530 15 608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51530 628 1095 gene locus_tag LOCUS_51540 628 1095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51540 1874 1125 gene locus_tag LOCUS_51550 1874 1125 CDS product 3-keto-5-aminohexanoate cleavage protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967295.1 protein_id gnl|my_center|LOCUS_51550 >Feature sequence1465 1948 497 gene locus_tag LOCUS_51560 1948 497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141950.1 protein_id gnl|my_center|LOCUS_51560 >Feature sequence1466 89 757 gene locus_tag LOCUS_51570 89 757 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097004.1 protein_id gnl|my_center|LOCUS_51570 851 1681 gene locus_tag LOCUS_51580 851 1681 CDS product MetQ/NlpA family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093057.1 protein_id gnl|my_center|LOCUS_51580 >Feature sequence1467 >Feature sequence1468 51 446 gene locus_tag LOCUS_51590 51 446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51590 >Feature sequence1469 402 956 gene locus_tag LOCUS_51600 402 956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51600 1256 1762 gene locus_tag LOCUS_51610 1256 1762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51610 >Feature sequence1470 311 985 gene locus_tag LOCUS_51620 311 985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_220138722.1 protein_id gnl|my_center|LOCUS_51620 >Feature sequence1471 1039 68 gene locus_tag LOCUS_51630 1039 68 CDS product zinc-binding alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729488.1 protein_id gnl|my_center|LOCUS_51630 >Feature sequence1472 1638 769 gene locus_tag LOCUS_51640 gene iolE 1638 769 CDS product myo-inosose-2 dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016356924.1 protein_id gnl|my_center|LOCUS_51640 <2239 1635 gene locus_tag LOCUS_51650 <2239 1635 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011729994.1:3D-(3,5/4)-trihydroxycyclohexane-1,2-dione acylhydrolase (decyclizing) >Feature sequence1473 297 148 gene locus_tag LOCUS_51660 297 148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51660 <2239 749 gene locus_tag LOCUS_51670 <2239 749 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011026811.1:oxidoreductase >Feature sequence1474 980 807 gene locus_tag LOCUS_51680 980 807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51680 >Feature sequence1475 98 1102 gene locus_tag LOCUS_51690 98 1102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51690 >Feature sequence1476 2177 975 gene locus_tag LOCUS_51700 2177 975 CDS product glycine C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005772253.1 protein_id gnl|my_center|LOCUS_51700 >Feature sequence1477 1597 734 gene locus_tag LOCUS_51710 1597 734 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004543285.1 protein_id gnl|my_center|LOCUS_51710 <2237 1587 gene locus_tag LOCUS_51720 <2237 1587 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012584089.1:sugar ABC transporter permease >Feature sequence1478 1544 54 gene locus_tag LOCUS_51730 1544 54 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007332558.1 protein_id gnl|my_center|LOCUS_51730 1682 2131 gene locus_tag LOCUS_51740 1682 2131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51740 >Feature sequence1479 289 996 gene locus_tag LOCUS_51750 289 996 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005171793.1 protein_id gnl|my_center|LOCUS_51750 1018 1797 gene locus_tag LOCUS_51760 1018 1797 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002118209.1 protein_id gnl|my_center|LOCUS_51760 >Feature sequence1480 >Feature sequence1481 <1 552 gene locus_tag LOCUS_51770 <1 552 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164922102.1:sigma-70 family RNA polymerase sigma factor >Feature sequence1482 183 578 gene locus_tag LOCUS_51780 183 578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51780 1232 1648 gene locus_tag LOCUS_51790 1232 1648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51790 >Feature sequence1483 702 1874 gene locus_tag LOCUS_51800 702 1874 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000666062.1 protein_id gnl|my_center|LOCUS_51800 >Feature sequence1484 89 541 gene locus_tag LOCUS_51810 gene tnpA 89 541 CDS product IS200/IS605 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120397.1 protein_id gnl|my_center|LOCUS_51810 <2232 658 gene locus_tag LOCUS_51820 <2232 658 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011404851.1:bifunctional acetate--CoA ligase family protein/GNAT family N-acetyltransferase >Feature sequence1485 416 1249 gene locus_tag LOCUS_51830 gene fdhD 416 1249 CDS product formate dehydrogenase accessory sulfurtransferase FdhD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031006.1 protein_id gnl|my_center|LOCUS_51830 2046 1483 gene locus_tag LOCUS_51840 2046 1483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51840 >Feature sequence1486 <1 637 gene locus_tag LOCUS_51850 <1 637 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010932327.1:molecular chaperone DnaK 640 1512 gene locus_tag LOCUS_51860 640 1512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51860 >Feature sequence1487 192 764 gene locus_tag LOCUS_51870 192 764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51870 1881 757 gene locus_tag LOCUS_51880 1881 757 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_060563245.1 protein_id gnl|my_center|LOCUS_51880 >Feature sequence1488 388 1401 gene locus_tag LOCUS_51890 388 1401 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014508984.1 protein_id gnl|my_center|LOCUS_51890 <2220 1693 gene locus_tag LOCUS_51900 <2220 1693 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011393521.1:xylulokinase >Feature sequence1489 1931 297 gene locus_tag LOCUS_51910 1931 297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51910 >Feature sequence1490 1284 607 gene locus_tag LOCUS_51920 1284 607 CDS product isoprenylcysteine carboxylmethyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037378250.1 protein_id gnl|my_center|LOCUS_51920 >Feature sequence1491 <1 557 gene locus_tag LOCUS_51930 <1 557 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010972957.1:trehalose utilization protein ThuA 857 666 gene locus_tag LOCUS_51940 857 666 CDS product DUF2905 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941743.1 protein_id gnl|my_center|LOCUS_51940 963 1982 gene locus_tag LOCUS_51950 gene lgt 963 1982 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816984.1 protein_id gnl|my_center|LOCUS_51950 >Feature sequence1492 843 376 gene locus_tag LOCUS_51960 843 376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51960 >Feature sequence1493 <1 847 gene locus_tag LOCUS_51970 <1 847 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011035548.1:nucleoside hydrolase 1970 2122 gene locus_tag LOCUS_51980 1970 2122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51980 >Feature sequence1494 339 539 gene locus_tag LOCUS_51990 339 539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51990 539 2002 gene locus_tag LOCUS_52000 539 2002 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942946.1 protein_id gnl|my_center|LOCUS_52000 >Feature sequence1495 840 1205 gene locus_tag LOCUS_52010 840 1205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52010 >Feature sequence1496 1301 405 gene locus_tag LOCUS_52020 1301 405 CDS product transglutaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088305.1 protein_id gnl|my_center|LOCUS_52020 >Feature sequence1497 <1 559 gene locus_tag LOCUS_52030 <1 559 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013530163.1:FMN-dependent NADH-azoreductase 1034 1939 gene locus_tag LOCUS_52040 1034 1939 CDS product SMP-30/gluconolactonase/LRE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037402577.1 protein_id gnl|my_center|LOCUS_52040 >Feature sequence1498 >Feature sequence1499 1219 479 gene locus_tag LOCUS_52050 1219 479 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_184768134.1 protein_id gnl|my_center|LOCUS_52050 2201 1212 gene locus_tag LOCUS_52060 2201 1212 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969403.1 protein_id gnl|my_center|LOCUS_52060 >Feature sequence1500 1325 432 gene locus_tag LOCUS_52070 gene pstA 1325 432 CDS product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140450.1 protein_id gnl|my_center|LOCUS_52070 <2204 1330 gene locus_tag LOCUS_52080 <2204 1330 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011140449.1:phosphate ABC transporter permease subunit PstC >Feature sequence1501 137 637 gene locus_tag LOCUS_52090 137 637 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100847.1 protein_id gnl|my_center|LOCUS_52090 1019 1309 gene locus_tag LOCUS_52100 1019 1309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52100 2008 1616 gene locus_tag LOCUS_52110 2008 1616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52110 >Feature sequence1502 575 1195 gene locus_tag LOCUS_52120 575 1195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_52120 1620 1459 gene locus_tag LOCUS_52130 1620 1459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52130 >Feature sequence1503 >Feature sequence1504 1505 375 gene locus_tag LOCUS_52140 1505 375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52140 >Feature sequence1505 <1 1002 gene locus_tag LOCUS_52150 <1 1002 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011140878.1:efflux RND transporter permease subunit >Feature sequence1506 33 257 gene locus_tag LOCUS_52160 33 257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52160 1390 392 gene locus_tag LOCUS_52170 gene rfaD 1390 392 CDS product ADP-glyceromanno-heptose 6-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546025.1 protein_id gnl|my_center|LOCUS_52170 1447 1890 gene locus_tag LOCUS_52180 1447 1890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52180 >Feature sequence1507 1488 28 gene locus_tag LOCUS_52190 1488 28 CDS product cbb3-type cytochrome c oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403101.1 protein_id gnl|my_center|LOCUS_52190 >Feature sequence1508 <1 976 gene locus_tag LOCUS_52200 <1 976 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012545838.1:RIP metalloprotease RseP >Feature sequence1509 188 331 gene locus_tag LOCUS_52210 188 331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52210 756 1922 gene locus_tag LOCUS_52220 756 1922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52220 >Feature sequence1510 2155 1121 gene locus_tag LOCUS_52230 2155 1121 CDS product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050984011.1 protein_id gnl|my_center|LOCUS_52230 >Feature sequence1511 1570 1115 gene locus_tag LOCUS_52240 1570 1115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52240 >Feature sequence1512 <1 796 gene locus_tag LOCUS_52250 <1 796 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011392461.1:ketoacyl-ACP synthase III 881 1726 gene locus_tag LOCUS_52260 881 1726 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087286.1 protein_id gnl|my_center|LOCUS_52260 >Feature sequence1513 <2187 768 gene locus_tag LOCUS_52270 <2187 768 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003147216.1:filamentous hemagglutinin family protein >Feature sequence1514 3 530 gene locus_tag LOCUS_52280 3 530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52280 552 2066 gene locus_tag LOCUS_52290 552 2066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52290 >Feature sequence1515 <2184 1353 gene locus_tag LOCUS_52300 <2184 1353 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003896540.1:GH1 family beta-glucosidase >Feature sequence1516 516 1550 gene locus_tag LOCUS_52310 516 1550 CDS product zinc-dependent alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258144.1 protein_id gnl|my_center|LOCUS_52310 >Feature sequence1517 1289 642 gene locus_tag LOCUS_52320 1289 642 CDS product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811973.1 protein_id gnl|my_center|LOCUS_52320 >Feature sequence1518 830 2011 gene locus_tag LOCUS_52330 830 2011 CDS product cell wall biogenesis glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008659403.1 protein_id gnl|my_center|LOCUS_52330 >Feature sequence1519 245 865 gene locus_tag LOCUS_52340 245 865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52340 1181 876 gene locus_tag LOCUS_52350 1181 876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52350 >Feature sequence1520 1414 296 gene locus_tag LOCUS_52360 1414 296 CDS product calcium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808328.1 protein_id gnl|my_center|LOCUS_52360 <2177 1571 gene locus_tag LOCUS_52370 <2177 1571 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011035556.1:LysR family transcriptional regulator >Feature sequence1521 151 29 gene locus_tag LOCUS_52380 151 29 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52380 >Feature sequence1522 380 1006 gene locus_tag LOCUS_52390 380 1006 CDS product GTPase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940776.1 protein_id gnl|my_center|LOCUS_52390 990 1421 gene locus_tag LOCUS_52400 990 1421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52400 >Feature sequence1523 190 327 gene locus_tag LOCUS_52410 190 327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52410 324 818 gene locus_tag LOCUS_52420 324 818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_52420 1287 850 gene locus_tag LOCUS_52430 1287 850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52430 >Feature sequence1524 203 1219 gene locus_tag LOCUS_52440 203 1219 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808483.1 protein_id gnl|my_center|LOCUS_52440 1378 1647 gene locus_tag LOCUS_52450 1378 1647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52450 <2162 1634 gene locus_tag LOCUS_52460 <2162 1634 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011073458.1:sigma-54-dependent Fis family transcriptional regulator >Feature sequence1525 1950 916 gene locus_tag LOCUS_52470 1950 916 CDS product 2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037393144.1 protein_id gnl|my_center|LOCUS_52470 >Feature sequence1526 1434 1042 gene locus_tag LOCUS_52480 1434 1042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52480 1811 1401 gene locus_tag LOCUS_52490 1811 1401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52490 1945 2151 gene locus_tag LOCUS_52500 1945 2151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52500 >Feature sequence1527 1227 925 gene locus_tag LOCUS_52510 1227 925 CDS product YbaB/EbfC family nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001996460.1 protein_id gnl|my_center|LOCUS_52510 >Feature sequence1528 756 526 gene locus_tag LOCUS_52520 756 526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52520 <2159 937 gene locus_tag LOCUS_52530 <2159 937 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011088606.1:MFS transporter >Feature sequence1529 1641 397 gene locus_tag LOCUS_52540 1641 397 CDS product IS4 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229302.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_52540 1915 1652 gene locus_tag LOCUS_52550 1915 1652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52550 >Feature sequence1530 >Feature sequence1531 71 478 gene locus_tag LOCUS_52560 71 478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52560 809 2104 gene locus_tag LOCUS_52570 809 2104 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545828.1 protein_id gnl|my_center|LOCUS_52570 >Feature sequence1532 455 631 gene locus_tag LOCUS_52580 455 631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52580 1092 2093 gene locus_tag LOCUS_52590 1092 2093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52590 >Feature sequence1533 <1 803 gene locus_tag LOCUS_52600 <1 803 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012258815.1:pyruvate, phosphate dikinase <2148 943 gene locus_tag LOCUS_52610 <2148 943 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011391455.1:acyltransferase >Feature sequence1534 872 1783 gene locus_tag LOCUS_52620 872 1783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52620 >Feature sequence1535 894 1106 gene locus_tag LOCUS_52630 894 1106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52630 >Feature sequence1536 1733 150 gene locus_tag LOCUS_52640 1733 150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52640 1943 2083 gene locus_tag LOCUS_52650 1943 2083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52650 >Feature sequence1537 556 1422 gene locus_tag LOCUS_52660 556 1422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52660 <2142 1582 gene locus_tag LOCUS_52670 <2142 1582 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011085666.1:cytochrome P450 >Feature sequence1538 24 1922 gene locus_tag LOCUS_52680 24 1922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52680 >Feature sequence1539 1055 1981 gene locus_tag LOCUS_52690 1055 1981 CDS product phosphosulfolactate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402811.1 protein_id gnl|my_center|LOCUS_52690 >Feature sequence1540 1080 676 gene locus_tag LOCUS_52700 1080 676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52700 <2140 1185 gene locus_tag LOCUS_52710 <2140 1185 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012256582.1:NADPH-dependent assimilatory sulfite reductase hemoprotein subunit >Feature sequence1541 1338 127 gene locus_tag LOCUS_52720 1338 127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52720 >Feature sequence1542 1355 324 gene locus_tag LOCUS_52730 1355 324 CDS product ribose ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001074641.1 protein_id gnl|my_center|LOCUS_52730 <2131 1339 gene locus_tag LOCUS_52740 <2131 1339 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001217684.1:ribose ABC transporter ATP-binding protein RbsA >Feature sequence1543 1083 1517 gene locus_tag LOCUS_52750 1083 1517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52750 <2131 1593 gene locus_tag LOCUS_52760 <2131 1593 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943252.1:single-stranded-DNA-specific exonuclease RecJ >Feature sequence1544 1781 735 gene locus_tag LOCUS_52770 1781 735 CDS product aliphatic nitrilase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877947.1 protein_id gnl|my_center|LOCUS_52770 >Feature sequence1545 1422 394 gene locus_tag LOCUS_52780 gene pstS 1422 394 CDS product phosphate ABC transporter substrate-binding protein PstS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479753.1 protein_id gnl|my_center|LOCUS_52780 <2128 1439 gene locus_tag LOCUS_52790 <2128 1439 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_038966619.1:ABC transporter substrate-binding protein >Feature sequence1546 1661 960 gene locus_tag LOCUS_52800 1661 960 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957920.1 protein_id gnl|my_center|LOCUS_52800 >Feature sequence1547 1296 226 gene locus_tag LOCUS_52810 1296 226 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226924.1 protein_id gnl|my_center|LOCUS_52810 >Feature sequence1548 813 1340 gene locus_tag LOCUS_52820 813 1340 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405595.1 protein_id gnl|my_center|LOCUS_52820 >Feature sequence1549 <1 1352 gene locus_tag LOCUS_52830 <1 1352 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_038967605.1:CHASE3 domain-containing protein 2123 1500 gene locus_tag LOCUS_52840 2123 1500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52840 >Feature sequence1550 671 744 gene locus_tag LOCUS_t00420 671 744 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 1509 1090 gene locus_tag LOCUS_52850 1509 1090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52850 1691 1518 gene locus_tag LOCUS_52860 1691 1518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52860 >Feature sequence1551 <1 507 gene locus_tag LOCUS_52870 <1 507 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007330748.1:glucosamine-6-phosphate deaminase 928 1236 gene locus_tag LOCUS_52880 928 1236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52880 1233 1793 gene locus_tag LOCUS_52890 1233 1793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52890 >Feature sequence1552 <1 587 gene locus_tag LOCUS_52900 <1 587 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_207280508.1:AAA family ATPase 591 1793 gene locus_tag LOCUS_52910 591 1793 CDS product putative DNA binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039748.1 protein_id gnl|my_center|LOCUS_52910 >Feature sequence1553 233 787 gene locus_tag LOCUS_52920 233 787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52920 1652 1990 gene locus_tag LOCUS_52930 1652 1990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52930 >Feature sequence1554 509 1720 gene locus_tag LOCUS_52940 509 1720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52940 >Feature sequence1555 1453 401 gene locus_tag LOCUS_52950 1453 401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52950 >Feature sequence1556 >Feature sequence1557 1663 287 gene locus_tag LOCUS_52960 1663 287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52960 >Feature sequence1558 <2106 1216 gene locus_tag LOCUS_52970 <2106 1216 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010940732.1:type I-U CRISPR-associated protein Csb2 >Feature sequence1559 <2104 1033 gene locus_tag LOCUS_52980 <2104 1033 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011763569.1:DegT/DnrJ/EryC1/StrS family aminotransferase >Feature sequence1560 1525 575 gene locus_tag LOCUS_52990 1525 575 CDS product ring-cleaving dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086031.1 protein_id gnl|my_center|LOCUS_52990 >Feature sequence1561 576 1598 gene locus_tag LOCUS_53000 576 1598 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383326.1 protein_id gnl|my_center|LOCUS_53000 >Feature sequence1562 1903 1241 gene locus_tag LOCUS_53010 1903 1241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53010 >Feature sequence1563 <1 628 gene locus_tag LOCUS_53020 <1 628 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013222894.1:NAD(P)H-binding protein 1341 925 gene locus_tag LOCUS_53030 1341 925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53030 >Feature sequence1564 386 93 gene locus_tag LOCUS_53040 386 93 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53040 814 1497 gene locus_tag LOCUS_53050 814 1497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53050 >Feature sequence1565 <1 995 gene locus_tag LOCUS_53060 <1 995 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_197530067.1:glycosyltransferase family 2 protein 1239 2024 gene locus_tag LOCUS_53070 1239 2024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53070 >Feature sequence1566 >Feature sequence1567 1893 856 gene locus_tag LOCUS_53080 1893 856 CDS product TIM barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123542.1 protein_id gnl|my_center|LOCUS_53080 >Feature sequence1568 206 1156 gene locus_tag LOCUS_53090 206 1156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53090 1146 1877 gene locus_tag LOCUS_53100 1146 1877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53100 >Feature sequence1569 102 1265 gene locus_tag LOCUS_53110 gene nagA 102 1265 CDS product N-acetylglucosamine-6-phosphate deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108898.1 protein_id gnl|my_center|LOCUS_53110 1670 2008 gene locus_tag LOCUS_53120 1670 2008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53120 >Feature sequence1570 260 78 gene locus_tag LOCUS_53130 260 78 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53130 942 1124 gene locus_tag LOCUS_53140 942 1124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53140 >Feature sequence1571 513 52 gene locus_tag LOCUS_53150 513 52 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53150 1291 737 gene locus_tag LOCUS_53160 1291 737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53160 >Feature sequence1572 367 933 gene locus_tag LOCUS_53170 367 933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53170 1065 1985 gene locus_tag LOCUS_53180 1065 1985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53180 >Feature sequence1573 528 683 gene locus_tag LOCUS_53190 528 683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53190 >Feature sequence1574 16 768 gene locus_tag LOCUS_53200 16 768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53200 794 1549 gene locus_tag LOCUS_53210 794 1549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53210 >Feature sequence1575 >Feature sequence1576 936 442 gene locus_tag LOCUS_53220 936 442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53220 1911 973 gene locus_tag LOCUS_53230 gene lpxB 1911 973 CDS product lipid-A-disaccharide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942901.1 note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_53230 >Feature sequence1577 >Feature sequence1578 1739 366 gene locus_tag LOCUS_53240 gene nrfD 1739 366 CDS product polysulfide reductase NrfD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256519.1 protein_id gnl|my_center|LOCUS_53240 >Feature sequence1579 931 794 gene locus_tag LOCUS_53250 931 794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53250 962 1756 gene locus_tag LOCUS_53260 962 1756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53260 >Feature sequence1580 1496 774 gene locus_tag LOCUS_53270 1496 774 CDS product ComF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940800.1 protein_id gnl|my_center|LOCUS_53270 >Feature sequence1581 804 526 gene locus_tag LOCUS_53280 804 526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_53280 1334 801 gene locus_tag LOCUS_53290 1334 801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53290 1398 1631 gene locus_tag LOCUS_53300 1398 1631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53300 >Feature sequence1582 <1 633 gene locus_tag LOCUS_53310 <1 633 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011707916.1:ParA family protein 630 1253 gene locus_tag LOCUS_53320 630 1253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53320 >Feature sequence1583 1863 1291 gene locus_tag LOCUS_53330 1863 1291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53330 >Feature sequence1584 >Feature sequence1585 985 1983 gene locus_tag LOCUS_53340 985 1983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53340 >Feature sequence1586 804 1952 gene locus_tag LOCUS_53350 804 1952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53350 >Feature sequence1587 221 994 gene locus_tag LOCUS_53360 221 994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53360 1694 1846 gene locus_tag LOCUS_53370 1694 1846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53370 >Feature sequence1588 1464 595 gene locus_tag LOCUS_53380 1464 595 CDS product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090604.1 protein_id gnl|my_center|LOCUS_53380 >Feature sequence1589 1070 912 gene locus_tag LOCUS_53390 1070 912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53390 1334 1783 gene locus_tag LOCUS_53400 1334 1783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53400 >Feature sequence1590 264 2012 gene locus_tag LOCUS_53410 264 2012 CDS product ABC transporter ATP-binding protein/permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090269.1 protein_id gnl|my_center|LOCUS_53410 >Feature sequence1591 454 1884 gene locus_tag LOCUS_53420 454 1884 CDS product anion permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366800.1 protein_id gnl|my_center|LOCUS_53420 >Feature sequence1592 <2049 1251 gene locus_tag LOCUS_53430 <2049 1251 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003527033.1:ABC transporter permease >Feature sequence1593 >Feature sequence1594 223 2040 gene locus_tag LOCUS_53440 223 2040 CDS product glycoside hydrolase family 15 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267573.1 protein_id gnl|my_center|LOCUS_53440 >Feature sequence1595 2046 1111 gene locus_tag LOCUS_53450 2046 1111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53450 >Feature sequence1596 487 1383 gene locus_tag LOCUS_53460 487 1383 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228409.1 protein_id gnl|my_center|LOCUS_53460 >Feature sequence1597 1706 1254 gene locus_tag LOCUS_53470 1706 1254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049832451.1 protein_id gnl|my_center|LOCUS_53470 >Feature sequence1598 654 1559 gene locus_tag LOCUS_53480 654 1559 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531211.1 protein_id gnl|my_center|LOCUS_53480 >Feature sequence1599 419 2029 gene locus_tag LOCUS_53490 419 2029 CDS product FAD-dependent monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004544143.1 protein_id gnl|my_center|LOCUS_53490 >Feature sequence1600 <2044 948 gene locus_tag LOCUS_53500 <2044 948 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941985.1:efflux RND transporter periplasmic adaptor subunit >Feature sequence1601 996 1445 gene locus_tag LOCUS_53510 996 1445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53510 >Feature sequence1602 289 1398 gene locus_tag LOCUS_53520 289 1398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53520 >Feature sequence1603 >Feature sequence1604 523 942 gene locus_tag LOCUS_53530 523 942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53530 >Feature sequence1605 <1 717 gene locus_tag LOCUS_53540 <1 717 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011020340.1:ATP-binding cassette domain-containing protein 934 1539 gene locus_tag LOCUS_53550 934 1539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53550 >Feature sequence1606 196 714 gene locus_tag LOCUS_53560 196 714 CDS product ferritin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337983.1 protein_id gnl|my_center|LOCUS_53560 1514 1960 gene locus_tag LOCUS_53570 1514 1960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_53570 >Feature sequence1607 <1 1832 gene locus_tag LOCUS_53580 <1 1832 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004192418.1:ClcB-like voltage-gated chloride channel protein >Feature sequence1608 642 214 gene locus_tag LOCUS_53590 642 214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53590 1227 1391 gene locus_tag LOCUS_53600 1227 1391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53600 1619 1410 gene locus_tag LOCUS_53610 1619 1410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53610 >Feature sequence1609 567 277 gene locus_tag LOCUS_53620 567 277 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764805.1 protein_id gnl|my_center|LOCUS_53620 826 1374 gene locus_tag LOCUS_53630 826 1374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53630 1770 1378 gene locus_tag LOCUS_53640 1770 1378 CDS product nitrile hydratase accessory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028174057.1 protein_id gnl|my_center|LOCUS_53640 >Feature sequence1610 283 98 gene locus_tag LOCUS_53650 283 98 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53650 622 359 gene locus_tag LOCUS_53660 622 359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53660 1105 770 gene locus_tag LOCUS_53670 1105 770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53670 1290 1511 gene locus_tag LOCUS_53680 1290 1511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53680 >Feature sequence1611 268 1152 gene locus_tag LOCUS_53690 268 1152 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928686.1 protein_id gnl|my_center|LOCUS_53690 1523 1359 gene locus_tag LOCUS_53700 1523 1359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53700 >Feature sequence1612 >Feature sequence1613 311 1786 gene locus_tag LOCUS_53710 311 1786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53710 >Feature sequence1614 264 731 gene locus_tag LOCUS_53720 264 731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53720 929 1300 gene locus_tag LOCUS_53730 929 1300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53730 >Feature sequence1615 >Feature sequence1616 1144 209 gene locus_tag LOCUS_53740 gene ribF 1144 209 CDS product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073366.1 protein_id gnl|my_center|LOCUS_53740 1871 1149 gene locus_tag LOCUS_53750 gene truB 1871 1149 CDS product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942236.1 protein_id gnl|my_center|LOCUS_53750 >Feature sequence1617 216 2003 gene locus_tag LOCUS_53760 216 2003 CDS product ABC transporter ATP-binding protein/permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090269.1 protein_id gnl|my_center|LOCUS_53760 >Feature sequence1618 703 891 gene locus_tag LOCUS_53770 703 891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53770 1190 1501 gene locus_tag LOCUS_53780 1190 1501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53780 >Feature sequence1619 <1 757 gene locus_tag LOCUS_53790 <1 757 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011016983.1:ATP/GTP-binding protein 750 1400 gene locus_tag LOCUS_53800 750 1400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53800 1397 1651 gene locus_tag LOCUS_53810 1397 1651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53810 >Feature sequence1620 >Feature sequence1621 877 1983 gene locus_tag LOCUS_53820 877 1983 CDS product NADH:flavin oxidoreductase/NADH oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143817.1 protein_id gnl|my_center|LOCUS_53820 >Feature sequence1622 519 154 gene locus_tag LOCUS_53830 519 154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53830 1246 800 gene locus_tag LOCUS_53840 1246 800 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405616.1 protein_id gnl|my_center|LOCUS_53840 >Feature sequence1623 541 1479 gene locus_tag LOCUS_53850 541 1479 CDS product 2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384661.1 protein_id gnl|my_center|LOCUS_53850 >Feature sequence1624 1308 151 gene locus_tag LOCUS_53860 1308 151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53860 <2019 1305 gene locus_tag LOCUS_53870 <2019 1305 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010967321.1:DUF2092 domain-containing protein >Feature sequence1625 1708 188 gene locus_tag LOCUS_53880 1708 188 CDS product IS1182-like element ISMac1 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020521.1 protein_id gnl|my_center|LOCUS_53880 >Feature sequence1626 531 1178 gene locus_tag LOCUS_53890 531 1178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53890 1157 1519 gene locus_tag LOCUS_53900 1157 1519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53900 1951 1667 gene locus_tag LOCUS_53910 1951 1667 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087485.1 protein_id gnl|my_center|LOCUS_53910 >Feature sequence1627 736 401 gene locus_tag LOCUS_53920 736 401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53920 1209 787 gene locus_tag LOCUS_53930 1209 787 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544974.1 protein_id gnl|my_center|LOCUS_53930 1967 1206 gene locus_tag LOCUS_53940 1967 1206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53940 >Feature sequence1628 885 1418 gene locus_tag LOCUS_53950 885 1418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53950 >Feature sequence1629 1004 1552 gene locus_tag LOCUS_53960 1004 1552 CDS product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022408.1 protein_id gnl|my_center|LOCUS_53960 1568 1849 gene locus_tag LOCUS_53970 1568 1849 CDS product F0F1 ATP synthase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022407.1 protein_id gnl|my_center|LOCUS_53970 >Feature sequence1630 >Feature sequence1631 955 1341 gene locus_tag LOCUS_53980 955 1341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53980 1538 1338 gene locus_tag LOCUS_53990 1538 1338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53990 >Feature sequence1632 >Feature sequence1633 >Feature sequence1634 1898 1263 gene locus_tag LOCUS_54000 1898 1263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54000 >Feature sequence1635 1123 362 gene locus_tag LOCUS_54010 1123 362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54010 >Feature sequence1636 >Feature sequence1637 1544 1275 gene locus_tag LOCUS_54020 1544 1275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54020