>Feature sequence001 2413 1424 gene locus_tag LOCUS_00010 2413 1424 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941286.1 protein_id gnl|my_center|LOCUS_00010 4096 2582 gene locus_tag LOCUS_00020 4096 2582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00020 4854 4111 gene locus_tag LOCUS_00030 4854 4111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00030 6053 4860 gene locus_tag LOCUS_00040 6053 4860 CDS product type IV pilus twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940822.1 protein_id gnl|my_center|LOCUS_00040 6426 8543 gene locus_tag LOCUS_00050 6426 8543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00050 9708 8620 gene locus_tag LOCUS_00060 gene ilvE 9708 8620 CDS product branched-chain-amino-acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061049.1 protein_id gnl|my_center|LOCUS_00060 9962 11155 gene locus_tag LOCUS_00070 9962 11155 CDS product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_222927961.1 protein_id gnl|my_center|LOCUS_00070 11260 12168 gene locus_tag LOCUS_00080 11260 12168 CDS product deoxyribonuclease IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256944.1 protein_id gnl|my_center|LOCUS_00080 12174 13352 gene locus_tag LOCUS_00090 12174 13352 CDS product sorbosone dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_040383028.1 protein_id gnl|my_center|LOCUS_00090 13376 14224 gene locus_tag LOCUS_00100 13376 14224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00100 >Feature sequence002 <1 5098 gene locus_tag LOCUS_00110 <1 5098 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_169347939.1:non-ribosomal peptide synthase/polyketide synthase 5153 5830 gene locus_tag LOCUS_00120 5153 5830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00120 5850 10487 gene locus_tag LOCUS_00130 5850 10487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00130 10480 11754 gene locus_tag LOCUS_00140 10480 11754 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973236.1 protein_id gnl|my_center|LOCUS_00140 >Feature sequence003 <1 937 gene locus_tag LOCUS_00150 <1 937 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001046741.1:efflux RND transporter permease subunit 1064 3229 gene locus_tag LOCUS_00160 1064 3229 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121893.1 protein_id gnl|my_center|LOCUS_00160 3830 4243 gene locus_tag LOCUS_00170 3830 4243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00170 5265 4354 gene locus_tag LOCUS_00180 5265 4354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00180 5717 5343 gene locus_tag LOCUS_00190 5717 5343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00190 6342 5731 gene locus_tag LOCUS_00200 6342 5731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00200 8615 6444 gene locus_tag LOCUS_00210 8615 6444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00210 12033 8746 gene locus_tag LOCUS_00220 12033 8746 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537777.1 protein_id gnl|my_center|LOCUS_00220 13475 12138 gene locus_tag LOCUS_00230 13475 12138 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057580.1 protein_id gnl|my_center|LOCUS_00230 >Feature sequence004 7 1095 gene locus_tag LOCUS_00240 7 1095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00240 1181 2275 gene locus_tag LOCUS_00250 1181 2275 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141745.1 protein_id gnl|my_center|LOCUS_00250 3366 2386 gene locus_tag LOCUS_00260 3366 2386 CDS product diacylglycerol kinase family lipid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808357.1 protein_id gnl|my_center|LOCUS_00260 4586 3639 gene locus_tag LOCUS_00270 4586 3639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00270 8195 4659 gene locus_tag LOCUS_00280 gene metH 8195 4659 CDS product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921137.1 protein_id gnl|my_center|LOCUS_00280 8508 9002 gene locus_tag LOCUS_00290 gene coaD 8508 9002 CDS product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545514.1 protein_id gnl|my_center|LOCUS_00290 9094 9390 gene locus_tag LOCUS_00300 9094 9390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00300 9409 9780 gene locus_tag LOCUS_00310 9409 9780 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971062.1 protein_id gnl|my_center|LOCUS_00310 9773 10975 gene locus_tag LOCUS_00320 9773 10975 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545898.1 protein_id gnl|my_center|LOCUS_00320 <11766 11080 gene locus_tag LOCUS_00330 <11766 11080 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011142299.1:VCBS repeat-containing protein >Feature sequence005 2976 832 gene locus_tag LOCUS_00340 2976 832 CDS product DUF885 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141209.1 protein_id gnl|my_center|LOCUS_00340 2887 3090 gene locus_tag LOCUS_00350 2887 3090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00350 3851 3219 gene locus_tag LOCUS_00360 3851 3219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00360 4319 3906 gene locus_tag LOCUS_00370 4319 3906 CDS product M67 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816173.1 protein_id gnl|my_center|LOCUS_00370 5586 4402 gene locus_tag LOCUS_00380 5586 4402 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546471.1 protein_id gnl|my_center|LOCUS_00380 7532 5724 gene locus_tag LOCUS_00390 gene aspS 7532 5724 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942109.1 protein_id gnl|my_center|LOCUS_00390 8150 7536 gene locus_tag LOCUS_00400 8150 7536 CDS product DUF1572 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963698.1 protein_id gnl|my_center|LOCUS_00400 8322 8143 gene locus_tag LOCUS_00410 8322 8143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00410 8783 8319 gene locus_tag LOCUS_00420 8783 8319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00420 10286 8832 gene locus_tag LOCUS_00430 gene hisS 10286 8832 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142552.1 protein_id gnl|my_center|LOCUS_00430 >Feature sequence006 1018 185 gene locus_tag LOCUS_00440 1018 185 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809408.1 protein_id gnl|my_center|LOCUS_00440 2674 1040 gene locus_tag LOCUS_00450 2674 1040 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941163.1 protein_id gnl|my_center|LOCUS_00450 3026 3607 gene locus_tag LOCUS_00460 3026 3607 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256813.1 protein_id gnl|my_center|LOCUS_00460 3604 4104 gene locus_tag LOCUS_00470 3604 4104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00470 4104 4526 gene locus_tag LOCUS_00480 4104 4526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00480 5884 4586 gene locus_tag LOCUS_00490 5884 4586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00490 7961 6186 gene locus_tag LOCUS_00500 7961 6186 CDS product winged helix-turn-helix domain-containing tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525359.1 protein_id gnl|my_center|LOCUS_00500 8159 8977 gene locus_tag LOCUS_00510 8159 8977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00510 9078 10472 gene locus_tag LOCUS_00520 9078 10472 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142542.1 protein_id gnl|my_center|LOCUS_00520 >Feature sequence007 1035 1949 gene locus_tag LOCUS_00530 1035 1949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00530 2104 3675 gene locus_tag LOCUS_00540 2104 3675 CDS product mechanosensitive ion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704452.1 protein_id gnl|my_center|LOCUS_00540 3800 4744 gene locus_tag LOCUS_00550 3800 4744 CDS product YihY/virulence factor BrkB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005767549.1 protein_id gnl|my_center|LOCUS_00550 4787 5686 gene locus_tag LOCUS_00560 gene psuG 4787 5686 CDS product pseudouridine-5'-phosphate glycosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001293144.1 protein_id gnl|my_center|LOCUS_00560 5712 6965 gene locus_tag LOCUS_00570 5712 6965 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142821.1 protein_id gnl|my_center|LOCUS_00570 9104 7248 gene locus_tag LOCUS_00580 9104 7248 CDS product CocE/NonD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003409258.1 protein_id gnl|my_center|LOCUS_00580 >Feature sequence008 381 1946 gene locus_tag LOCUS_00590 381 1946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00590 2617 1967 gene locus_tag LOCUS_00600 2617 1967 CDS product DNA-3-methyladenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000653302.1 protein_id gnl|my_center|LOCUS_00600 2695 3591 gene locus_tag LOCUS_00610 2695 3591 CDS product DUF5996 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929027.1 protein_id gnl|my_center|LOCUS_00610 3711 5369 gene locus_tag LOCUS_00620 3711 5369 CDS product MDR family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258986.1 protein_id gnl|my_center|LOCUS_00620 5942 5394 gene locus_tag LOCUS_00630 gene msrA 5942 5394 CDS product peptide-methionine (S)-S-oxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257533.1 protein_id gnl|my_center|LOCUS_00630 6071 8128 gene locus_tag LOCUS_00640 6071 8128 CDS product NAD(+) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257258.1 protein_id gnl|my_center|LOCUS_00640 8156 9505 gene locus_tag LOCUS_00650 8156 9505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255956.1 protein_id gnl|my_center|LOCUS_00650 >Feature sequence009 444 1094 gene locus_tag LOCUS_00660 444 1094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00660 1843 1091 gene locus_tag LOCUS_00670 1843 1091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00670 1982 2329 gene locus_tag LOCUS_00680 1982 2329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00680 2331 2906 gene locus_tag LOCUS_00690 gene pyrE 2331 2906 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393616.1 protein_id gnl|my_center|LOCUS_00690 2976 3728 gene locus_tag LOCUS_00700 gene truA 2976 3728 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000553118.1 protein_id gnl|my_center|LOCUS_00700 3761 4552 gene locus_tag LOCUS_00710 3761 4552 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071541499.1 protein_id gnl|my_center|LOCUS_00710 4639 5466 gene locus_tag LOCUS_00720 4639 5466 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259407.1 protein_id gnl|my_center|LOCUS_00720 5463 5873 gene locus_tag LOCUS_00730 5463 5873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00730 5885 7081 gene locus_tag LOCUS_00740 5885 7081 CDS product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931819.1 protein_id gnl|my_center|LOCUS_00740 7182 8579 gene locus_tag LOCUS_00750 gene rseP 7182 8579 CDS product RIP metalloprotease RseP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881281.1 protein_id gnl|my_center|LOCUS_00750 8586 9695 gene locus_tag LOCUS_00760 gene ispG 8586 9695 CDS product flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942105.1 protein_id gnl|my_center|LOCUS_00760 >Feature sequence010 577 1197 gene locus_tag LOCUS_00770 577 1197 CDS product cysteine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003247139.1 protein_id gnl|my_center|LOCUS_00770 2951 1266 gene locus_tag LOCUS_00780 2951 1266 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933908.1 protein_id gnl|my_center|LOCUS_00780 3169 4026 gene locus_tag LOCUS_00790 3169 4026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00790 4058 4858 gene locus_tag LOCUS_00800 4058 4858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00800 6031 4925 gene locus_tag LOCUS_00810 6031 4925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00810 6795 6028 gene locus_tag LOCUS_00820 6795 6028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00820 9178 7064 gene locus_tag LOCUS_00830 9178 7064 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975433.1 protein_id gnl|my_center|LOCUS_00830 >Feature sequence011 383 2311 gene locus_tag LOCUS_00840 383 2311 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902257.1 protein_id gnl|my_center|LOCUS_00840 2391 3647 gene locus_tag LOCUS_00850 gene hutI 2391 3647 CDS product imidazolonepropionase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011285756.1 protein_id gnl|my_center|LOCUS_00850 4269 4036 gene locus_tag LOCUS_00860 4269 4036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00860 4389 5690 gene locus_tag LOCUS_00870 4389 5690 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038867.1 protein_id gnl|my_center|LOCUS_00870 6280 5693 gene locus_tag LOCUS_00880 6280 5693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00880 7847 6330 gene locus_tag LOCUS_00890 gene gltX 7847 6330 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545418.1 protein_id gnl|my_center|LOCUS_00890 8094 8004 gene locus_tag LOCUS_t00010 8094 8004 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence012 1446 1273 gene locus_tag LOCUS_00900 1446 1273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00900 1474 2337 gene locus_tag LOCUS_00910 1474 2337 CDS product class II glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444000.1 protein_id gnl|my_center|LOCUS_00910 2349 4652 gene locus_tag LOCUS_00920 2349 4652 CDS product prolyl oligopeptidase family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070944.1 protein_id gnl|my_center|LOCUS_00920 4797 5723 gene locus_tag LOCUS_00930 4797 5723 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942460.1 protein_id gnl|my_center|LOCUS_00930 6153 7124 gene locus_tag LOCUS_00940 6153 7124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00940 >Feature sequence013 2109 1207 gene locus_tag LOCUS_00950 2109 1207 CDS product xanthine dehydrogenase family protein subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064243136.1 protein_id gnl|my_center|LOCUS_00950 3189 2119 gene locus_tag LOCUS_00960 3189 2119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00960 4279 3212 gene locus_tag LOCUS_00970 4279 3212 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090392.1 protein_id gnl|my_center|LOCUS_00970 5328 4294 gene locus_tag LOCUS_00980 5328 4294 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090392.1 protein_id gnl|my_center|LOCUS_00980 5790 5452 gene locus_tag LOCUS_00990 5790 5452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00990 6630 5965 gene locus_tag LOCUS_01000 6630 5965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01000 8379 6712 gene locus_tag LOCUS_01010 8379 6712 CDS product multicopper oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071802696.1 protein_id gnl|my_center|LOCUS_01010 >Feature sequence014 806 45 gene locus_tag LOCUS_01020 806 45 CDS product enoyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258763.1 protein_id gnl|my_center|LOCUS_01020 1811 828 gene locus_tag LOCUS_01030 1811 828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01030 3529 1922 gene locus_tag LOCUS_01040 gene purH 3529 1922 CDS product bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456445.1 protein_id gnl|my_center|LOCUS_01040 4398 3529 gene locus_tag LOCUS_01050 4398 3529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01050 7385 4845 gene locus_tag LOCUS_01060 7385 4845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01060 7984 7562 gene locus_tag LOCUS_01070 7984 7562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01070 >Feature sequence015 1864 707 gene locus_tag LOCUS_01080 1864 707 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839725.1 protein_id gnl|my_center|LOCUS_01080 2495 2899 gene locus_tag LOCUS_01090 2495 2899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01090 3334 7155 gene locus_tag LOCUS_01100 3334 7155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01100 7276 7680 gene locus_tag LOCUS_01110 7276 7680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01110 >Feature sequence016 4731 2347 gene locus_tag LOCUS_01120 4731 2347 CDS product ATP-dependent Clp protease ATP-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583832.1 protein_id gnl|my_center|LOCUS_01120 5133 7196 gene locus_tag LOCUS_01130 5133 7196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01130 7951 7244 gene locus_tag LOCUS_01140 7951 7244 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942909.1 protein_id gnl|my_center|LOCUS_01140 <8870 7956 gene locus_tag LOCUS_01150 <8870 7956 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010939648.1:lipoprotein-releasing ABC transporter permease subunit >Feature sequence017 35 964 gene locus_tag LOCUS_01160 35 964 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528466.1 protein_id gnl|my_center|LOCUS_01160 976 2700 gene locus_tag LOCUS_01170 976 2700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01170 2884 3171 gene locus_tag LOCUS_01180 2884 3171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01180 3211 4092 gene locus_tag LOCUS_01190 3211 4092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01190 4129 5538 gene locus_tag LOCUS_01200 4129 5538 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764161.1 protein_id gnl|my_center|LOCUS_01200 5592 7064 gene locus_tag LOCUS_01210 5592 7064 CDS product HlyD family secretion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942127.1 protein_id gnl|my_center|LOCUS_01210 7236 7057 gene locus_tag LOCUS_01220 7236 7057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01220 >Feature sequence018 3159 103 gene locus_tag LOCUS_01230 3159 103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01230 4728 3337 gene locus_tag LOCUS_01240 gene argH 4728 3337 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401567.1 protein_id gnl|my_center|LOCUS_01240 4872 5294 gene locus_tag LOCUS_01250 gene argR 4872 5294 CDS product arginine repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_054935393.1 protein_id gnl|my_center|LOCUS_01250 5303 6502 gene locus_tag LOCUS_01260 5303 6502 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227831.1 protein_id gnl|my_center|LOCUS_01260 6499 7578 gene locus_tag LOCUS_01270 6499 7578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01270 >Feature sequence019 <1 910 gene locus_tag LOCUS_01280 <1 910 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_034349507.1:NAD(P)/FAD-dependent oxidoreductase 1389 1000 gene locus_tag LOCUS_01290 1389 1000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01290 1735 3375 gene locus_tag LOCUS_01300 gene nadB 1735 3375 CDS product L-aspartate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545397.1 protein_id gnl|my_center|LOCUS_01300 3732 4424 gene locus_tag LOCUS_01310 gene nfi 3732 4424 CDS product endonuclease V inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082416.1 protein_id gnl|my_center|LOCUS_01310 6146 4512 gene locus_tag LOCUS_01320 6146 4512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01320 7532 6453 gene locus_tag LOCUS_01330 7532 6453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01330 8058 7585 gene locus_tag LOCUS_01340 8058 7585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01340 >Feature sequence020 1462 968 gene locus_tag LOCUS_01350 1462 968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01350 2795 1479 gene locus_tag LOCUS_01360 2795 1479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01360 3883 2828 gene locus_tag LOCUS_01370 gene thiO 3883 2828 CDS product glycine oxidase ThiO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205421597.1 protein_id gnl|my_center|LOCUS_01370 3764 3973 gene locus_tag LOCUS_01380 3764 3973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01380 4081 4491 gene locus_tag LOCUS_01390 4081 4491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_01390 4576 5082 gene locus_tag LOCUS_01400 4576 5082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_01400 6627 5290 gene locus_tag LOCUS_01410 6627 5290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01410 <8338 6871 gene locus_tag LOCUS_01420 <8338 6871 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_043553261.1:pitrilysin family protein >Feature sequence021 252 695 gene locus_tag LOCUS_01430 252 695 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056201.1 protein_id gnl|my_center|LOCUS_01430 1914 778 gene locus_tag LOCUS_01440 gene ald 1914 778 CDS product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704256.1 protein_id gnl|my_center|LOCUS_01440 3536 1965 gene locus_tag LOCUS_01450 3536 1965 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257638.1 protein_id gnl|my_center|LOCUS_01450 5205 3622 gene locus_tag LOCUS_01460 5205 3622 CDS product DegQ family serine endoprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009565602.1 protein_id gnl|my_center|LOCUS_01460 6421 5465 gene locus_tag LOCUS_01470 6421 5465 CDS product alcohol dehydrogenase catalytic domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255943.1 protein_id gnl|my_center|LOCUS_01470 7024 6842 gene locus_tag LOCUS_01480 7024 6842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01480 7633 7124 gene locus_tag LOCUS_01490 7633 7124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01490 >Feature sequence022 594 400 gene locus_tag LOCUS_01500 594 400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01500 2813 783 gene locus_tag LOCUS_01510 2813 783 CDS product M3 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206614.1 protein_id gnl|my_center|LOCUS_01510 3194 5776 gene locus_tag LOCUS_01520 3194 5776 CDS product serine/threonine-protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144060.1 protein_id gnl|my_center|LOCUS_01520 6453 5800 gene locus_tag LOCUS_01530 6453 5800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01530 6876 7112 gene locus_tag LOCUS_01540 6876 7112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01540 >Feature sequence023 2385 1117 gene locus_tag LOCUS_01550 2385 1117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01550 2790 2401 gene locus_tag LOCUS_01560 2790 2401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01560 5189 2904 gene locus_tag LOCUS_01570 5189 2904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01570 7353 5161 gene locus_tag LOCUS_01580 7353 5161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01580 >Feature sequence024 1799 315 gene locus_tag LOCUS_01590 1799 315 CDS product leucyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259178.1 protein_id gnl|my_center|LOCUS_01590 1978 3579 gene locus_tag LOCUS_01600 1978 3579 CDS product 5'-nucleotidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390236.1 protein_id gnl|my_center|LOCUS_01600 3601 4098 gene locus_tag LOCUS_01610 3601 4098 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930822.1 protein_id gnl|my_center|LOCUS_01610 4565 4188 gene locus_tag LOCUS_01620 4565 4188 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853315.1 protein_id gnl|my_center|LOCUS_01620 5273 4608 gene locus_tag LOCUS_01630 5273 4608 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384250.1 protein_id gnl|my_center|LOCUS_01630 5798 5403 gene locus_tag LOCUS_01640 5798 5403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01640 5984 6496 gene locus_tag LOCUS_01650 5984 6496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01650 >Feature sequence025 352 1164 gene locus_tag LOCUS_01660 352 1164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01660 1256 1837 gene locus_tag LOCUS_01670 1256 1837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01670 1907 2344 gene locus_tag LOCUS_01680 1907 2344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01680 2350 3288 gene locus_tag LOCUS_01690 2350 3288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01690 3409 4377 gene locus_tag LOCUS_01700 3409 4377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01700 4889 4386 gene locus_tag LOCUS_01710 4889 4386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01710 5281 5030 gene locus_tag LOCUS_01720 5281 5030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01720 5791 7446 gene locus_tag LOCUS_01730 5791 7446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01730 >Feature sequence026 493 1641 gene locus_tag LOCUS_01740 gene dnaJ 493 1641 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392123.1 protein_id gnl|my_center|LOCUS_01740 1760 2125 gene locus_tag LOCUS_01750 1760 2125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01750 2487 4460 gene locus_tag LOCUS_01760 2487 4460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01760 4532 6412 gene locus_tag LOCUS_01770 4532 6412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01770 7092 6679 gene locus_tag LOCUS_01780 7092 6679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01780 >Feature sequence027 1598 219 gene locus_tag LOCUS_01790 gene murC 1598 219 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943693.1 protein_id gnl|my_center|LOCUS_01790 2780 1704 gene locus_tag LOCUS_01800 gene murG 2780 1704 CDS product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943694.1 protein_id gnl|my_center|LOCUS_01800 3898 2780 gene locus_tag LOCUS_01810 gene ftsW 3898 2780 CDS product putative lipid II flippase FtsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943695.1 protein_id gnl|my_center|LOCUS_01810 5334 3940 gene locus_tag LOCUS_01820 gene murD 5334 3940 CDS product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943696.1 protein_id gnl|my_center|LOCUS_01820 6472 5336 gene locus_tag LOCUS_01830 gene mraY 6472 5336 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388708.1 protein_id gnl|my_center|LOCUS_01830 <7765 6473 gene locus_tag LOCUS_01840 <7765 6473 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943698.1:UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase >Feature sequence028 278 784 gene locus_tag LOCUS_01850 278 784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01850 1253 810 gene locus_tag LOCUS_01860 1253 810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01860 2701 1253 gene locus_tag LOCUS_01870 gene moeB 2701 1253 CDS product molybdopterin-synthase adenylyltransferase MoeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259329.1 protein_id gnl|my_center|LOCUS_01870 3138 2692 gene locus_tag LOCUS_01880 3138 2692 CDS product M67 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143403.1 protein_id gnl|my_center|LOCUS_01880 5255 3153 gene locus_tag LOCUS_01890 5255 3153 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197524145.1 protein_id gnl|my_center|LOCUS_01890 5450 5256 gene locus_tag LOCUS_01900 5450 5256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01900 5827 5528 gene locus_tag LOCUS_01910 5827 5528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01910 6108 6467 gene locus_tag LOCUS_01920 6108 6467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01920 6604 6963 gene locus_tag LOCUS_01930 6604 6963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01930 7159 7518 gene locus_tag LOCUS_01940 7159 7518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01940 >Feature sequence029 631 1254 gene locus_tag LOCUS_01950 631 1254 CDS product DUF47 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941056.1 protein_id gnl|my_center|LOCUS_01950 1367 2410 gene locus_tag LOCUS_01960 1367 2410 CDS product inorganic phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037390645.1 protein_id gnl|my_center|LOCUS_01960 2774 2412 gene locus_tag LOCUS_01970 2774 2412 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496878.1 protein_id gnl|my_center|LOCUS_01970 2995 3558 gene locus_tag LOCUS_01980 2995 3558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01980 3993 3709 gene locus_tag LOCUS_01990 3993 3709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01990 4725 4650 gene locus_tag LOCUS_t00020 4725 4650 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 5602 4769 gene locus_tag LOCUS_02000 5602 4769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02000 5820 6242 gene locus_tag LOCUS_02010 5820 6242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02010 6448 6894 gene locus_tag LOCUS_02020 6448 6894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02020 6946 7275 gene locus_tag LOCUS_02030 6946 7275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02030 >Feature sequence030 1460 411 gene locus_tag LOCUS_02040 gene wecB 1460 411 CDS product UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390550.1 protein_id gnl|my_center|LOCUS_02040 2559 1351 gene locus_tag LOCUS_02050 2559 1351 CDS product polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390551.1 protein_id gnl|my_center|LOCUS_02050 3439 2549 gene locus_tag LOCUS_02060 3439 2549 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942887.1 protein_id gnl|my_center|LOCUS_02060 4763 3576 gene locus_tag LOCUS_02070 4763 3576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02070 5695 4763 gene locus_tag LOCUS_02080 5695 4763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02080 6838 5705 gene locus_tag LOCUS_02090 6838 5705 CDS product glycosyltransferase family 9 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532810.1 protein_id gnl|my_center|LOCUS_02090 <7616 6882 gene locus_tag LOCUS_02100 <7616 6882 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942727.1:D-glycero-beta-D-manno-heptose-7-phosphate kinase >Feature sequence031 3693 1666 gene locus_tag LOCUS_02110 3693 1666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02110 4590 4090 gene locus_tag LOCUS_02120 4590 4090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02120 5293 4706 gene locus_tag LOCUS_02130 5293 4706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02130 6178 5315 gene locus_tag LOCUS_02140 6178 5315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02140 6651 6187 gene locus_tag LOCUS_02150 6651 6187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02150 >Feature sequence032 661 2742 gene locus_tag LOCUS_02160 661 2742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02160 2838 3602 gene locus_tag LOCUS_02170 2838 3602 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038826.1 protein_id gnl|my_center|LOCUS_02170 5850 4624 gene locus_tag LOCUS_02180 5850 4624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02180 6021 6917 gene locus_tag LOCUS_02190 6021 6917 CDS product A24 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942686.1 protein_id gnl|my_center|LOCUS_02190 >Feature sequence033 164 3730 gene locus_tag LOCUS_02200 164 3730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02200 4204 4073 gene locus_tag LOCUS_02210 4204 4073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02210 4414 4686 gene locus_tag LOCUS_02220 4414 4686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02220 4784 5617 gene locus_tag LOCUS_02230 4784 5617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02230 5628 6872 gene locus_tag LOCUS_02240 5628 6872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02240 >Feature sequence034 2566 1679 gene locus_tag LOCUS_02250 2566 1679 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402958.1 protein_id gnl|my_center|LOCUS_02250 2932 4284 gene locus_tag LOCUS_02260 gene tssK 2932 4284 CDS product type VI secretion system baseplate subunit TssK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003343637.1 protein_id gnl|my_center|LOCUS_02260 4506 5120 gene locus_tag LOCUS_02270 4506 5120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02270 >Feature sequence035 1473 502 gene locus_tag LOCUS_02280 1473 502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02280 3903 1852 gene locus_tag LOCUS_02290 3903 1852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02290 4484 3969 gene locus_tag LOCUS_02300 4484 3969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02300 6140 4629 gene locus_tag LOCUS_02310 6140 4629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02310 6908 6246 gene locus_tag LOCUS_02320 gene rpe 6908 6246 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943985.1 protein_id gnl|my_center|LOCUS_02320 7520 6927 gene locus_tag LOCUS_02330 7520 6927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02330 >Feature sequence036 1520 255 gene locus_tag LOCUS_02340 1520 255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02340 2074 3231 gene locus_tag LOCUS_02350 2074 3231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02350 3228 3800 gene locus_tag LOCUS_02360 3228 3800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02360 3979 5067 gene locus_tag LOCUS_02370 3979 5067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02370 5521 5372 gene locus_tag LOCUS_02380 5521 5372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02380 5895 6362 gene locus_tag LOCUS_02390 5895 6362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02390 6366 6800 gene locus_tag LOCUS_02400 6366 6800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02400 6797 6994 gene locus_tag LOCUS_02410 6797 6994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02410 >Feature sequence037 917 2329 gene locus_tag LOCUS_02420 917 2329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02420 3116 2844 gene locus_tag LOCUS_02430 3116 2844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02430 >Feature sequence038 397 1164 gene locus_tag LOCUS_02440 397 1164 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973515.1 protein_id gnl|my_center|LOCUS_02440 1326 4319 gene locus_tag LOCUS_02450 1326 4319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02450 4625 4404 gene locus_tag LOCUS_02460 4625 4404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02460 4838 6562 gene locus_tag LOCUS_02470 4838 6562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02470 6585 6989 gene locus_tag LOCUS_02480 6585 6989 CDS product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000156908.1 protein_id gnl|my_center|LOCUS_02480 >Feature sequence039 2297 1182 gene locus_tag LOCUS_02490 2297 1182 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583708.1 protein_id gnl|my_center|LOCUS_02490 3392 2397 gene locus_tag LOCUS_02500 3392 2397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02500 5101 3401 gene locus_tag LOCUS_02510 5101 3401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02510 6250 5219 gene locus_tag LOCUS_02520 6250 5219 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257502.1 protein_id gnl|my_center|LOCUS_02520 <7396 6258 gene locus_tag LOCUS_02530 <7396 6258 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257503.1:DegT/DnrJ/EryC1/StrS family aminotransferase >Feature sequence040 3752 741 gene locus_tag LOCUS_02540 3752 741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02540 3913 4494 gene locus_tag LOCUS_02550 3913 4494 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243181.1 protein_id gnl|my_center|LOCUS_02550 4550 5176 gene locus_tag LOCUS_02560 4550 5176 CDS product NAD(P)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388219.1 protein_id gnl|my_center|LOCUS_02560 5207 6262 gene locus_tag LOCUS_02570 5207 6262 CDS product alkene reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036508.1 protein_id gnl|my_center|LOCUS_02570 <7338 6340 gene locus_tag LOCUS_02580 <7338 6340 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011119811.1:Dyp-type peroxidase >Feature sequence041 981 328 gene locus_tag LOCUS_02590 981 328 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256556.1 protein_id gnl|my_center|LOCUS_02590 2192 978 gene locus_tag LOCUS_02600 2192 978 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256557.1 protein_id gnl|my_center|LOCUS_02600 3560 2232 gene locus_tag LOCUS_02610 3560 2232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02610 4460 3723 gene locus_tag LOCUS_02620 4460 3723 CDS product SIMPL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002683251.1 protein_id gnl|my_center|LOCUS_02620 6103 4673 gene locus_tag LOCUS_02630 6103 4673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02630 <7302 6140 gene locus_tag LOCUS_02640 <7302 6140 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011141097.1:serine/threonine-protein kinase >Feature sequence042 6 1298 gene locus_tag LOCUS_02650 6 1298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02650 1295 1852 gene locus_tag LOCUS_02660 1295 1852 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228308.1 protein_id gnl|my_center|LOCUS_02660 1976 2356 gene locus_tag LOCUS_02670 1976 2356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02670 2356 3522 gene locus_tag LOCUS_02680 2356 3522 CDS product 2-oxoacid:ferredoxin oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324151.1 protein_id gnl|my_center|LOCUS_02680 3612 5426 gene locus_tag LOCUS_02690 gene murJ 3612 5426 CDS product murein biosynthesis integral membrane protein MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946821.1 protein_id gnl|my_center|LOCUS_02690 >Feature sequence043 856 2286 gene locus_tag LOCUS_02700 856 2286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02700 2405 3031 gene locus_tag LOCUS_02710 2405 3031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02710 3028 3597 gene locus_tag LOCUS_02720 3028 3597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02720 3632 4201 gene locus_tag LOCUS_02730 3632 4201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02730 5802 4303 gene locus_tag LOCUS_02740 5802 4303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02740 6575 5880 gene locus_tag LOCUS_02750 6575 5880 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942483.1 protein_id gnl|my_center|LOCUS_02750 <7174 6672 gene locus_tag LOCUS_02760 <7174 6672 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011970751.1:DUF1003 domain-containing protein >Feature sequence044 <1 1370 gene locus_tag LOCUS_02770 <1 1370 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941157.1:YifB family Mg chelatase-like AAA ATPase 2485 2931 gene locus_tag LOCUS_02780 2485 2931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02780 >Feature sequence045 1218 403 gene locus_tag LOCUS_02790 1218 403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02790 2501 1215 gene locus_tag LOCUS_02800 2501 1215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02800 4270 2711 gene locus_tag LOCUS_02810 4270 2711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02810 4681 5100 gene locus_tag LOCUS_02820 4681 5100 CDS product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583632.1 protein_id gnl|my_center|LOCUS_02820 5165 6628 gene locus_tag LOCUS_02830 5165 6628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02830 >Feature sequence046 695 1054 gene locus_tag LOCUS_02840 695 1054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02840 1286 1059 gene locus_tag LOCUS_02850 1286 1059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02850 2005 1394 gene locus_tag LOCUS_02860 2005 1394 CDS product YggT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404543.1 protein_id gnl|my_center|LOCUS_02860 2803 2120 gene locus_tag LOCUS_02870 2803 2120 CDS product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256816.1 protein_id gnl|my_center|LOCUS_02870 3236 3430 gene locus_tag LOCUS_02880 3236 3430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02880 3470 3555 gene locus_tag LOCUS_t00030 3470 3555 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 4073 3639 gene locus_tag LOCUS_02890 4073 3639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02890 6113 4095 gene locus_tag LOCUS_02900 gene ligA 6113 4095 CDS product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140729.1 protein_id gnl|my_center|LOCUS_02900 <6976 6137 gene locus_tag LOCUS_02910 <6976 6137 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012256756.1:M20/M25/M40 family metallo-hydrolase >Feature sequence047 404 1900 gene locus_tag LOCUS_02920 404 1900 CDS product NFACT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679249.1 protein_id gnl|my_center|LOCUS_02920 1985 3157 gene locus_tag LOCUS_02930 1985 3157 CDS product lipocalin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258602.1 protein_id gnl|my_center|LOCUS_02930 3357 3854 gene locus_tag LOCUS_02940 gene kbp 3357 3854 CDS product potassium binding protein Kbp inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000522413.1 protein_id gnl|my_center|LOCUS_02940 3900 4193 gene locus_tag LOCUS_02950 3900 4193 CDS product GlsB/YeaQ/YmgE family stress response membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367020.1 protein_id gnl|my_center|LOCUS_02950 4301 5605 gene locus_tag LOCUS_02960 gene hemL 4301 5605 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941005.1 protein_id gnl|my_center|LOCUS_02960 5820 5611 gene locus_tag LOCUS_02970 5820 5611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02970 6077 5829 gene locus_tag LOCUS_02980 6077 5829 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011171672.1 protein_id gnl|my_center|LOCUS_02980 <6975 6100 gene locus_tag LOCUS_02990 <6975 6100 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942140.1:ATP-binding protein >Feature sequence048 <1 1383 gene locus_tag LOCUS_03000 <1 1383 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_235044964.1:MFS transporter 1909 1478 gene locus_tag LOCUS_03010 1909 1478 CDS product DUF2442 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975642.1 protein_id gnl|my_center|LOCUS_03010 2096 1878 gene locus_tag LOCUS_03020 2096 1878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03020 5783 2235 gene locus_tag LOCUS_03030 5783 2235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03030 <6965 6088 gene locus_tag LOCUS_03040 <6965 6088 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942684.1:sigma-54 dependent transcriptional regulator >Feature sequence049 1617 973 gene locus_tag LOCUS_03050 gene grpE 1617 973 CDS product nucleotide exchange factor GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392121.1 protein_id gnl|my_center|LOCUS_03050 2173 1730 gene locus_tag LOCUS_03060 2173 1730 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941206.1 protein_id gnl|my_center|LOCUS_03060 4791 2194 gene locus_tag LOCUS_03070 gene clpB 4791 2194 CDS product ATP-dependent chaperone ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941319.1 protein_id gnl|my_center|LOCUS_03070 5414 4878 gene locus_tag LOCUS_03080 5414 4878 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941206.1 protein_id gnl|my_center|LOCUS_03080 5643 6113 gene locus_tag LOCUS_03090 5643 6113 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977532.1 protein_id gnl|my_center|LOCUS_03090 >Feature sequence050 86 271 gene locus_tag LOCUS_03100 86 271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03100 281 775 gene locus_tag LOCUS_03110 281 775 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228194.1 protein_id gnl|my_center|LOCUS_03110 849 2261 gene locus_tag LOCUS_03120 849 2261 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142346.1 protein_id gnl|my_center|LOCUS_03120 2308 3432 gene locus_tag LOCUS_03130 gene iaaA 2308 3432 CDS product beta-aspartyl-peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704837.1 protein_id gnl|my_center|LOCUS_03130 3703 4407 gene locus_tag LOCUS_03140 3703 4407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03140 4628 5926 gene locus_tag LOCUS_03150 4628 5926 CDS product UDP-glucose/GDP-mannose dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389965.1 protein_id gnl|my_center|LOCUS_03150 >Feature sequence051 923 1801 gene locus_tag LOCUS_03160 923 1801 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000013300.1 protein_id gnl|my_center|LOCUS_03160 2209 2805 gene locus_tag LOCUS_03170 2209 2805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03170 3018 4817 gene locus_tag LOCUS_03180 gene lepA 3018 4817 CDS product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941921.1 protein_id gnl|my_center|LOCUS_03180 4822 5082 gene locus_tag LOCUS_03190 4822 5082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03190 5107 6756 gene locus_tag LOCUS_03200 5107 6756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929090.1 protein_id gnl|my_center|LOCUS_03200 >Feature sequence052 164 427 gene locus_tag LOCUS_03210 164 427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03210 683 841 gene locus_tag LOCUS_03220 683 841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03220 957 3470 gene locus_tag LOCUS_03230 957 3470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03230 3858 3481 gene locus_tag LOCUS_03240 gene acpS 3858 3481 CDS product holo-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963811.1 protein_id gnl|my_center|LOCUS_03240 3845 4687 gene locus_tag LOCUS_03250 gene pgeF 3845 4687 CDS product peptidoglycan editing factor PgeF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931720.1 protein_id gnl|my_center|LOCUS_03250 5272 4772 gene locus_tag LOCUS_03260 5272 4772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03260 6548 5451 gene locus_tag LOCUS_03270 gene rlmN 6548 5451 CDS product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941772.1 protein_id gnl|my_center|LOCUS_03270 >Feature sequence053 1235 660 gene locus_tag LOCUS_03280 1235 660 CDS product RNA polymerase sigma factor SigX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392473.1 protein_id gnl|my_center|LOCUS_03280 2640 1546 gene locus_tag LOCUS_03290 2640 1546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03290 2926 3981 gene locus_tag LOCUS_03300 2926 3981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03300 3992 5002 gene locus_tag LOCUS_03310 3992 5002 CDS product ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121766.1 protein_id gnl|my_center|LOCUS_03310 5119 6150 gene locus_tag LOCUS_03320 5119 6150 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000697701.1 protein_id gnl|my_center|LOCUS_03320 6415 6197 gene locus_tag LOCUS_03330 6415 6197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03330 >Feature sequence054 2429 882 gene locus_tag LOCUS_03340 2429 882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03340 3103 4413 gene locus_tag LOCUS_03350 3103 4413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03350 4818 6044 gene locus_tag LOCUS_03360 4818 6044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03360 >Feature sequence055 <1 619 gene locus_tag LOCUS_03370 <1 619 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011142299.1:VCBS repeat-containing protein 1322 1975 gene locus_tag LOCUS_03380 1322 1975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03380 3466 2069 gene locus_tag LOCUS_03390 3466 2069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03390 6635 3783 gene locus_tag LOCUS_03400 6635 3783 CDS product CHAT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223261.1 protein_id gnl|my_center|LOCUS_03400 >Feature sequence056 158 1015 gene locus_tag LOCUS_03410 158 1015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03410 1092 1508 gene locus_tag LOCUS_03420 1092 1508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03420 2644 1517 gene locus_tag LOCUS_03430 2644 1517 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056272.1 protein_id gnl|my_center|LOCUS_03430 3212 2661 gene locus_tag LOCUS_03440 3212 2661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03440 3824 3345 gene locus_tag LOCUS_03450 3824 3345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03450 4242 3898 gene locus_tag LOCUS_03460 4242 3898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03460 5873 4365 gene locus_tag LOCUS_03470 gene dhaS 5873 4365 CDS product aldehyde dehydrogenase DhaS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000080288.1 protein_id gnl|my_center|LOCUS_03470 6257 5904 gene locus_tag LOCUS_03480 6257 5904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03480 >Feature sequence057 1310 189 gene locus_tag LOCUS_03490 1310 189 CDS product glycosyltransferase family 9 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532810.1 protein_id gnl|my_center|LOCUS_03490 1476 1285 gene locus_tag LOCUS_03500 1476 1285 CDS product Trm112 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937959.1 protein_id gnl|my_center|LOCUS_03500 2883 1507 gene locus_tag LOCUS_03510 2883 1507 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258472.1 protein_id gnl|my_center|LOCUS_03510 2989 3594 gene locus_tag LOCUS_03520 2989 3594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03520 3594 4355 gene locus_tag LOCUS_03530 3594 4355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03530 5235 4456 gene locus_tag LOCUS_03540 5235 4456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03540 5662 6336 gene locus_tag LOCUS_03550 5662 6336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03550 >Feature sequence058 966 91 gene locus_tag LOCUS_03560 966 91 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03560 1401 973 gene locus_tag LOCUS_03570 1401 973 CDS product DUF420 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231280.1 protein_id gnl|my_center|LOCUS_03570 1678 1436 gene locus_tag LOCUS_03580 1678 1436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03580 2104 1700 gene locus_tag LOCUS_03590 2104 1700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03590 2437 2132 gene locus_tag LOCUS_03600 2437 2132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03600 4101 2497 gene locus_tag LOCUS_03610 4101 2497 CDS product fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110588.1 protein_id gnl|my_center|LOCUS_03610 4478 4224 gene locus_tag LOCUS_03620 4478 4224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03620 5086 4475 gene locus_tag LOCUS_03630 5086 4475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03630 5769 5113 gene locus_tag LOCUS_03640 5769 5113 CDS product heme-copper oxidase subunit III family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066651.1 protein_id gnl|my_center|LOCUS_03640 6470 5778 gene locus_tag LOCUS_03650 6470 5778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03650 >Feature sequence059 901 512 gene locus_tag LOCUS_03660 901 512 CDS product nuclease A inhibitor family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142296.1 protein_id gnl|my_center|LOCUS_03660 929 1897 gene locus_tag LOCUS_03670 929 1897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03670 2100 2363 gene locus_tag LOCUS_03680 2100 2363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03680 3157 2489 gene locus_tag LOCUS_03690 gene msrA 3157 2489 CDS product peptide-methionine (S)-S-oxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928865.1 protein_id gnl|my_center|LOCUS_03690 3317 5986 gene locus_tag LOCUS_03700 3317 5986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03700 >Feature sequence060 <1 1439 gene locus_tag LOCUS_03710 <1 1439 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_009993767.1:aminopeptidase N 1659 1423 gene locus_tag LOCUS_03720 1659 1423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03720 1762 2607 gene locus_tag LOCUS_03730 1762 2607 CDS product neutral zinc metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117757.1 protein_id gnl|my_center|LOCUS_03730 4040 2718 gene locus_tag LOCUS_03740 gene egtB 4040 2718 CDS product ergothioneine biosynthesis protein EgtB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027439.1 protein_id gnl|my_center|LOCUS_03740 4144 5154 gene locus_tag LOCUS_03750 gene egtD 4144 5154 CDS product L-histidine N(alpha)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205453.1 protein_id gnl|my_center|LOCUS_03750 >Feature sequence061 727 584 gene locus_tag LOCUS_03760 727 584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03760 1382 804 gene locus_tag LOCUS_03770 1382 804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03770 1381 2346 gene locus_tag LOCUS_03780 gene truB 1381 2346 CDS product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244678.1 protein_id gnl|my_center|LOCUS_03780 2645 4582 gene locus_tag LOCUS_03790 2645 4582 CDS product PrkA family serine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392047.1 protein_id gnl|my_center|LOCUS_03790 4685 5683 gene locus_tag LOCUS_03800 4685 5683 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223699.1 protein_id gnl|my_center|LOCUS_03800 >Feature sequence062 314 703 gene locus_tag LOCUS_03810 314 703 CDS product gamma-glutamylcyclotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010871037.1 protein_id gnl|my_center|LOCUS_03810 681 1520 gene locus_tag LOCUS_03820 681 1520 CDS product aminoglycoside phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034360134.1 protein_id gnl|my_center|LOCUS_03820 1535 2320 gene locus_tag LOCUS_03830 1535 2320 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480304.1 protein_id gnl|my_center|LOCUS_03830 4272 2425 gene locus_tag LOCUS_03840 4272 2425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03840 4680 6197 gene locus_tag LOCUS_03850 gene trpE 4680 6197 CDS product anthranilate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943019.1 protein_id gnl|my_center|LOCUS_03850 >Feature sequence063 1713 346 gene locus_tag LOCUS_03860 1713 346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03860 2695 1736 gene locus_tag LOCUS_03870 2695 1736 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403405.1 protein_id gnl|my_center|LOCUS_03870 3625 2699 gene locus_tag LOCUS_03880 3625 2699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03880 3874 5223 gene locus_tag LOCUS_03890 3874 5223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03890 >Feature sequence064 161 1027 gene locus_tag LOCUS_03900 161 1027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03900 1204 1527 gene locus_tag LOCUS_03910 1204 1527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03910 1533 4016 gene locus_tag LOCUS_03920 gene lon 1533 4016 CDS product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583909.1 protein_id gnl|my_center|LOCUS_03920 4274 5602 gene locus_tag LOCUS_03930 4274 5602 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197530104.1 protein_id gnl|my_center|LOCUS_03930 5639 5944 gene locus_tag LOCUS_03940 5639 5944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03940 >Feature sequence065 924 646 gene locus_tag LOCUS_03950 924 646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03950 4079 1605 gene locus_tag LOCUS_03960 4079 1605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03960 5505 4294 gene locus_tag LOCUS_03970 5505 4294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03970 >Feature sequence066 769 2118 gene locus_tag LOCUS_03980 769 2118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03980 2291 3322 gene locus_tag LOCUS_03990 2291 3322 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257393.1 protein_id gnl|my_center|LOCUS_03990 3390 3647 gene locus_tag LOCUS_04000 3390 3647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04000 4125 3742 gene locus_tag LOCUS_04010 4125 3742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04010 4764 4414 gene locus_tag LOCUS_04020 4764 4414 CDS product DUF5615 family PIN-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142949.1 protein_id gnl|my_center|LOCUS_04020 5121 4798 gene locus_tag LOCUS_04030 5121 4798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04030 5285 5521 gene locus_tag LOCUS_04040 5285 5521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04040 >Feature sequence067 551 1375 gene locus_tag LOCUS_04050 551 1375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04050 1507 2943 gene locus_tag LOCUS_04060 1507 2943 CDS product sigma 54-interacting transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940636.1 protein_id gnl|my_center|LOCUS_04060 2940 4757 gene locus_tag LOCUS_04070 2940 4757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04070 >Feature sequence068 1800 1057 gene locus_tag LOCUS_04080 gene queC 1800 1057 CDS product 7-cyano-7-deazaguanine synthase QueC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932219.1 protein_id gnl|my_center|LOCUS_04080 2480 1836 gene locus_tag LOCUS_04090 gene queE 2480 1836 CDS product 7-carboxy-7-deazaguanine synthase QueE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003120697.1 protein_id gnl|my_center|LOCUS_04090 2649 3605 gene locus_tag LOCUS_04100 2649 3605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04100 3833 3645 gene locus_tag LOCUS_04110 3833 3645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04110 3762 5051 gene locus_tag LOCUS_04120 3762 5051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04120 5272 5736 gene locus_tag LOCUS_04130 5272 5736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04130 >Feature sequence069 289 999 gene locus_tag LOCUS_04140 289 999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04140 1113 2504 gene locus_tag LOCUS_04150 gene accC 1113 2504 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944627.1 protein_id gnl|my_center|LOCUS_04150 2583 2891 gene locus_tag LOCUS_04160 gene rplU 2583 2891 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000457386.1 protein_id gnl|my_center|LOCUS_04160 2980 3279 gene locus_tag LOCUS_04170 gene rpmA 2980 3279 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140826.1 protein_id gnl|my_center|LOCUS_04170 3366 4409 gene locus_tag LOCUS_04180 gene obgE 3366 4409 CDS product GTPase ObgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881354.1 protein_id gnl|my_center|LOCUS_04180 4425 5105 gene locus_tag LOCUS_04190 gene nadD 4425 5105 CDS product nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015061.1 protein_id gnl|my_center|LOCUS_04190 5102 5590 gene locus_tag LOCUS_04200 gene rsfS 5102 5590 CDS product ribosome silencing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976226.1 protein_id gnl|my_center|LOCUS_04200 >Feature sequence070 2066 78 gene locus_tag LOCUS_04210 gene ctaD 2066 78 CDS product cytochrome c oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066868161.1 protein_id gnl|my_center|LOCUS_04210 3255 2176 gene locus_tag LOCUS_04220 gene coxB 3255 2176 CDS product cytochrome c oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525141.1 protein_id gnl|my_center|LOCUS_04220 3821 3252 gene locus_tag LOCUS_04230 3821 3252 CDS product c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011971125.1 protein_id gnl|my_center|LOCUS_04230 4704 3826 gene locus_tag LOCUS_04240 4704 3826 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063174003.1 protein_id gnl|my_center|LOCUS_04240 <6216 4685 gene locus_tag LOCUS_04250 <6216 4685 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013525144.1:methanol/ethanol family PQQ-dependent dehydrogenase >Feature sequence071 455 1369 gene locus_tag LOCUS_04260 455 1369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04260 1375 2871 gene locus_tag LOCUS_04270 gene crtD 1375 2871 CDS product C-3',4' desaturase CrtD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142868.1 protein_id gnl|my_center|LOCUS_04270 3018 3398 gene locus_tag LOCUS_04280 3018 3398 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080932.1 protein_id gnl|my_center|LOCUS_04280 3395 4501 gene locus_tag LOCUS_04290 3395 4501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04290 >Feature sequence072 177 3227 gene locus_tag LOCUS_04300 177 3227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04300 3586 3801 gene locus_tag LOCUS_04310 3586 3801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04310 3973 4410 gene locus_tag LOCUS_04320 3973 4410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04320 5345 4497 gene locus_tag LOCUS_04330 5345 4497 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880152.1 protein_id gnl|my_center|LOCUS_04330 <6194 5349 gene locus_tag LOCUS_04340 <6194 5349 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941110.1:aminofutalosine synthase MqnE >Feature sequence073 1911 1333 gene locus_tag LOCUS_04350 gene yihA 1911 1333 CDS product ribosome biogenesis GTP-binding protein YihA/YsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005894870.1 protein_id gnl|my_center|LOCUS_04350 2427 1984 gene locus_tag LOCUS_04360 2427 1984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04360 4993 2561 gene locus_tag LOCUS_04370 gene lon 4993 2561 CDS product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392068.1 protein_id gnl|my_center|LOCUS_04370 <6174 5229 gene locus_tag LOCUS_04380 <6174 5229 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008547851.1:ATP-dependent Clp protease ATP-binding subunit ClpX >Feature sequence074 1883 1266 gene locus_tag LOCUS_04390 1883 1266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04390 2852 1932 gene locus_tag LOCUS_04400 2852 1932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04400 3561 3019 gene locus_tag LOCUS_04410 3561 3019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04410 5618 3669 gene locus_tag LOCUS_04420 gene asnB 5618 3669 CDS product asparagine synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027075.1 protein_id gnl|my_center|LOCUS_04420 6007 5618 gene locus_tag LOCUS_04430 6007 5618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04430 >Feature sequence075 543 1028 gene locus_tag LOCUS_04440 543 1028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04440 4544 1137 gene locus_tag LOCUS_04450 4544 1137 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793715.1 protein_id gnl|my_center|LOCUS_04450 5754 4615 gene locus_tag LOCUS_04460 5754 4615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04460 >Feature sequence076 <1 953 gene locus_tag LOCUS_04470 <1 953 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011392432.1:bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD 1023 1829 gene locus_tag LOCUS_04480 gene rsmA 1023 1829 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000651552.1 protein_id gnl|my_center|LOCUS_04480 2471 1842 gene locus_tag LOCUS_04490 2471 1842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04490 4033 2582 gene locus_tag LOCUS_04500 4033 2582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04500 4384 5898 gene locus_tag LOCUS_04510 4384 5898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04510 >Feature sequence077 2012 672 gene locus_tag LOCUS_04520 2012 672 CDS product 5'-deoxyadenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392738.1 protein_id gnl|my_center|LOCUS_04520 2253 3617 gene locus_tag LOCUS_04530 2253 3617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04530 4807 3725 gene locus_tag LOCUS_04540 gene recA 4807 3725 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189458.1 protein_id gnl|my_center|LOCUS_04540 5446 5751 gene locus_tag LOCUS_04550 5446 5751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04550 6067 5798 gene locus_tag LOCUS_04560 6067 5798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04560 >Feature sequence078 1506 829 gene locus_tag LOCUS_04570 gene scpB 1506 829 CDS product SMC-Scp complex subunit ScpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028842431.1 protein_id gnl|my_center|LOCUS_04570 2316 1513 gene locus_tag LOCUS_04580 2316 1513 CDS product segregation/condensation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942476.1 protein_id gnl|my_center|LOCUS_04580 3353 2358 gene locus_tag LOCUS_04590 gene trpS 3353 2358 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001862742.1 protein_id gnl|my_center|LOCUS_04590 4046 3363 gene locus_tag LOCUS_04600 4046 3363 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021249004.1 protein_id gnl|my_center|LOCUS_04600 5182 4154 gene locus_tag LOCUS_04610 5182 4154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04610 >Feature sequence079 790 497 gene locus_tag LOCUS_04620 790 497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04620 1752 781 gene locus_tag LOCUS_04630 gene corA 1752 781 CDS product magnesium/cobalt transporter CorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259376.1 protein_id gnl|my_center|LOCUS_04630 1860 2711 gene locus_tag LOCUS_04640 1860 2711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04640 2830 3252 gene locus_tag LOCUS_04650 2830 3252 CDS product low affinity iron permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113677.1 protein_id gnl|my_center|LOCUS_04650 3484 4383 gene locus_tag LOCUS_04660 3484 4383 CDS product fatty acid desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057556.1 protein_id gnl|my_center|LOCUS_04660 4425 4871 gene locus_tag LOCUS_04670 4425 4871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04670 4868 5368 gene locus_tag LOCUS_04680 4868 5368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04680 >Feature sequence080 2283 1018 gene locus_tag LOCUS_04690 2283 1018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04690 2724 2308 gene locus_tag LOCUS_04700 2724 2308 CDS product ester cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929224.1 protein_id gnl|my_center|LOCUS_04700 2902 4374 gene locus_tag LOCUS_04710 2902 4374 CDS product TldD/PmbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920663.1 protein_id gnl|my_center|LOCUS_04710 4371 5717 gene locus_tag LOCUS_04720 4371 5717 CDS product TldD/PmbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035351.1 protein_id gnl|my_center|LOCUS_04720 >Feature sequence081 1862 558 gene locus_tag LOCUS_04730 1862 558 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943373.1 protein_id gnl|my_center|LOCUS_04730 2116 1889 gene locus_tag LOCUS_04740 2116 1889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04740 2629 2177 gene locus_tag LOCUS_04750 2629 2177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04750 3358 2789 gene locus_tag LOCUS_04760 3358 2789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04760 3860 3402 gene locus_tag LOCUS_04770 3860 3402 CDS product PA2169 family four-helix-bundle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003314059.1 protein_id gnl|my_center|LOCUS_04770 4660 3914 gene locus_tag LOCUS_04780 4660 3914 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391312.1 protein_id gnl|my_center|LOCUS_04780 <5986 4781 gene locus_tag LOCUS_04790 <5986 4781 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011143713.1:dicarboxylate/amino acid:cation symporter >Feature sequence082 <1 544 gene locus_tag LOCUS_04800 <1 544 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011057497.1:AarF/ABC1/UbiB kinase family protein 831 1904 gene locus_tag LOCUS_04810 831 1904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04810 2037 2441 gene locus_tag LOCUS_04820 2037 2441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04820 2497 3909 gene locus_tag LOCUS_04830 2497 3909 CDS product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141364.1 protein_id gnl|my_center|LOCUS_04830 3919 5124 gene locus_tag LOCUS_04840 3919 5124 CDS product DUF790 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890489.1 protein_id gnl|my_center|LOCUS_04840 5109 5582 gene locus_tag LOCUS_04850 5109 5582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256549.1 protein_id gnl|my_center|LOCUS_04850 >Feature sequence083 596 1612 gene locus_tag LOCUS_04860 596 1612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04860 2043 3032 gene locus_tag LOCUS_04870 2043 3032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04870 3061 3513 gene locus_tag LOCUS_04880 3061 3513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04880 4968 3601 gene locus_tag LOCUS_04890 4968 3601 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888807.1 protein_id gnl|my_center|LOCUS_04890 5357 5037 gene locus_tag LOCUS_04900 5357 5037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04900 <5978 5430 gene locus_tag LOCUS_04910 <5978 5430 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011404958.1:alpha/beta fold hydrolase >Feature sequence084 1316 84 gene locus_tag LOCUS_04920 1316 84 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728743.1 protein_id gnl|my_center|LOCUS_04920 1850 1548 gene locus_tag LOCUS_04930 1850 1548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04930 4270 1904 gene locus_tag LOCUS_04940 4270 1904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04940 5187 4267 gene locus_tag LOCUS_04950 5187 4267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04950 >Feature sequence085 422 610 gene locus_tag LOCUS_04960 422 610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04960 619 3303 gene locus_tag LOCUS_04970 619 3303 CDS product glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141168.1 protein_id gnl|my_center|LOCUS_04970 3445 4542 gene locus_tag LOCUS_04980 3445 4542 CDS product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141167.1 protein_id gnl|my_center|LOCUS_04980 4570 5622 gene locus_tag LOCUS_04990 4570 5622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04990 >Feature sequence086 <1 1026 gene locus_tag LOCUS_05000 <1 1026 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012546627.1:DNA-directed RNA polymerase subunit beta 1122 5342 gene locus_tag LOCUS_05010 gene rpoC 1122 5342 CDS product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943492.1 protein_id gnl|my_center|LOCUS_05010 5466 5699 gene locus_tag LOCUS_05020 5466 5699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05020 >Feature sequence087 <1 2012 gene locus_tag LOCUS_05030 <1 2012 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011142299.1:VCBS repeat-containing protein 2253 2026 gene locus_tag LOCUS_05040 2253 2026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05040 2323 2565 gene locus_tag LOCUS_05050 2323 2565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05050 3072 2647 gene locus_tag LOCUS_05060 3072 2647 CDS product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227914.1 protein_id gnl|my_center|LOCUS_05060 3228 4388 gene locus_tag LOCUS_05070 gene sucC 3228 4388 CDS product ADP-forming succinate--CoA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932072.1 protein_id gnl|my_center|LOCUS_05070 4395 4871 gene locus_tag LOCUS_05080 4395 4871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05080 5894 4983 gene locus_tag LOCUS_05090 5894 4983 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942084.1 protein_id gnl|my_center|LOCUS_05090 >Feature sequence088 4621 8 gene locus_tag LOCUS_05100 4621 8 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05100 4869 5765 gene locus_tag LOCUS_05110 4869 5765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05110 >Feature sequence089 2420 3466 gene locus_tag LOCUS_05120 2420 3466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05120 3473 5230 gene locus_tag LOCUS_05130 3473 5230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05130 >Feature sequence090 624 1484 gene locus_tag LOCUS_05140 gene ttcA 624 1484 CDS product tRNA 2-thiocytidine(32) synthetase TtcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189298.1 protein_id gnl|my_center|LOCUS_05140 1620 2510 gene locus_tag LOCUS_05150 1620 2510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05150 2994 2479 gene locus_tag LOCUS_05160 2994 2479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05160 3641 3066 gene locus_tag LOCUS_05170 3641 3066 CDS product inorganic diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090374.1 protein_id gnl|my_center|LOCUS_05170 4200 3628 gene locus_tag LOCUS_05180 4200 3628 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140095.1 protein_id gnl|my_center|LOCUS_05180 4815 4228 gene locus_tag LOCUS_05190 4815 4228 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197529990.1 protein_id gnl|my_center|LOCUS_05190 <5837 4821 gene locus_tag LOCUS_05200 <5837 4821 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011392090.1:NAD+ synthase >Feature sequence091 1626 85 gene locus_tag LOCUS_05210 1626 85 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048142299.1 protein_id gnl|my_center|LOCUS_05210 1955 1776 gene locus_tag LOCUS_05220 1955 1776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05220 3139 1970 gene locus_tag LOCUS_05230 3139 1970 CDS product zinc-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140737.1 protein_id gnl|my_center|LOCUS_05230 4109 3264 gene locus_tag LOCUS_05240 4109 3264 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197530111.1 protein_id gnl|my_center|LOCUS_05240 5285 4326 gene locus_tag LOCUS_05250 gene galE 5285 4326 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255969.1 protein_id gnl|my_center|LOCUS_05250 >Feature sequence092 367 966 gene locus_tag LOCUS_05260 367 966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05260 1060 2262 gene locus_tag LOCUS_05270 1060 2262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05270 2291 2875 gene locus_tag LOCUS_05280 2291 2875 CDS product L,D-transpeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721677.1 protein_id gnl|my_center|LOCUS_05280 3493 4434 gene locus_tag LOCUS_05290 3493 4434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05290 5627 4503 gene locus_tag LOCUS_05300 5627 4503 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838638.1 protein_id gnl|my_center|LOCUS_05300 >Feature sequence093 1011 55 gene locus_tag LOCUS_05310 1011 55 CDS product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942950.1 protein_id gnl|my_center|LOCUS_05310 1124 1930 gene locus_tag LOCUS_05320 1124 1930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05320 1949 2947 gene locus_tag LOCUS_05330 1949 2947 CDS product xanthine dehydrogenase family protein subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105102.1 protein_id gnl|my_center|LOCUS_05330 2944 5211 gene locus_tag LOCUS_05340 2944 5211 CDS product xanthine dehydrogenase family protein molybdopterin-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_081163175.1 protein_id gnl|my_center|LOCUS_05340 >Feature sequence094 1378 683 gene locus_tag LOCUS_05350 1378 683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05350 3189 1522 gene locus_tag LOCUS_05360 3189 1522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05360 3772 3203 gene locus_tag LOCUS_05370 3772 3203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05370 <5768 3789 gene locus_tag LOCUS_05380 <5768 3789 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_226990677.1:PKD domain-containing protein >Feature sequence095 565 1245 gene locus_tag LOCUS_05390 565 1245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05390 1242 1721 gene locus_tag LOCUS_05400 1242 1721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05400 1825 2460 gene locus_tag LOCUS_05410 1825 2460 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142152.1 protein_id gnl|my_center|LOCUS_05410 3576 2482 gene locus_tag LOCUS_05420 gene ugpC 3576 2482 CDS product sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037392167.1 protein_id gnl|my_center|LOCUS_05420 4431 3598 gene locus_tag LOCUS_05430 4431 3598 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064253348.1 protein_id gnl|my_center|LOCUS_05430 5270 4434 gene locus_tag LOCUS_05440 5270 4434 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064244087.1 protein_id gnl|my_center|LOCUS_05440 >Feature sequence096 189 392 gene locus_tag LOCUS_05450 189 392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05450 569 1642 gene locus_tag LOCUS_05460 569 1642 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583756.1 protein_id gnl|my_center|LOCUS_05460 2447 1704 gene locus_tag LOCUS_05470 2447 1704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05470 2944 2444 gene locus_tag LOCUS_05480 2944 2444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05480 2992 3216 gene locus_tag LOCUS_05490 2992 3216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05490 3272 4108 gene locus_tag LOCUS_05500 3272 4108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000672055.1 protein_id gnl|my_center|LOCUS_05500 4152 5219 gene locus_tag LOCUS_05510 gene dusB 4152 5219 CDS product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256119.1 protein_id gnl|my_center|LOCUS_05510 5234 5461 gene locus_tag LOCUS_05520 5234 5461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05520 >Feature sequence097 311 2119 gene locus_tag LOCUS_05530 gene dnaG 311 2119 CDS product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392160.1 protein_id gnl|my_center|LOCUS_05530 2180 3877 gene locus_tag LOCUS_05540 gene rpoD 2180 3877 CDS product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943710.1 protein_id gnl|my_center|LOCUS_05540 >Feature sequence098 3048 2755 gene locus_tag LOCUS_05550 3048 2755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05550 5429 3210 gene locus_tag LOCUS_05560 5429 3210 CDS product NHLP family bacteriocin export ABC transporter peptidase/permease/ATPase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814910.1 protein_id gnl|my_center|LOCUS_05560 >Feature sequence099 354 1127 gene locus_tag LOCUS_05570 354 1127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05570 1131 1316 gene locus_tag LOCUS_05580 1131 1316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05580 1326 2117 gene locus_tag LOCUS_05590 1326 2117 CDS product trans-aconitate 2-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887067.1 protein_id gnl|my_center|LOCUS_05590 3811 2051 gene locus_tag LOCUS_05600 3811 2051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05600 >Feature sequence100 720 2021 gene locus_tag LOCUS_05610 gene purD 720 2021 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545691.1 protein_id gnl|my_center|LOCUS_05610 2259 3038 gene locus_tag LOCUS_05620 gene pspA 2259 3038 CDS product phage shock protein PspA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010950768.1 protein_id gnl|my_center|LOCUS_05620 3117 3953 gene locus_tag LOCUS_05630 3117 3953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05630 4994 4044 gene locus_tag LOCUS_05640 gene hslO 4994 4044 CDS product Hsp33 family molecular chaperone HslO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296053.1 protein_id gnl|my_center|LOCUS_05640 >Feature sequence101 1594 158 gene locus_tag LOCUS_05650 gene aroE 1594 158 CDS product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327789.1 protein_id gnl|my_center|LOCUS_05650 2662 1721 gene locus_tag LOCUS_05660 gene cysK 2662 1721 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257225.1 protein_id gnl|my_center|LOCUS_05660 3317 2769 gene locus_tag LOCUS_05670 3317 2769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05670 4317 3451 gene locus_tag LOCUS_05680 gene rlmB 4317 3451 CDS product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399684.1 protein_id gnl|my_center|LOCUS_05680 5330 4314 gene locus_tag LOCUS_05690 5330 4314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05690 >Feature sequence102 2225 2653 gene locus_tag LOCUS_05700 2225 2653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05700 4585 2738 gene locus_tag LOCUS_05710 4585 2738 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889608.1 protein_id gnl|my_center|LOCUS_05710 >Feature sequence103 1194 2354 gene locus_tag LOCUS_05720 1194 2354 CDS product catalase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227457.1 protein_id gnl|my_center|LOCUS_05720 2395 3021 gene locus_tag LOCUS_05730 2395 3021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227454.1 protein_id gnl|my_center|LOCUS_05730 3065 3691 gene locus_tag LOCUS_05740 3065 3691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227454.1 protein_id gnl|my_center|LOCUS_05740 3728 5101 gene locus_tag LOCUS_05750 3728 5101 CDS product peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227456.1 protein_id gnl|my_center|LOCUS_05750 >Feature sequence104 1962 226 gene locus_tag LOCUS_05760 gene msbA 1962 226 CDS product lipid A export permease/ATP-binding protein MsbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942900.1 protein_id gnl|my_center|LOCUS_05760 2285 3034 gene locus_tag LOCUS_05770 2285 3034 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082164.1 protein_id gnl|my_center|LOCUS_05770 3137 4735 gene locus_tag LOCUS_05780 3137 4735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05780 4768 4914 gene locus_tag LOCUS_05790 4768 4914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05790 >Feature sequence105 183 809 gene locus_tag LOCUS_05800 183 809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05800 812 2695 gene locus_tag LOCUS_05810 gene mnmG 812 2695 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546402.1 protein_id gnl|my_center|LOCUS_05810 2885 3709 gene locus_tag LOCUS_05820 2885 3709 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940782.1 protein_id gnl|my_center|LOCUS_05820 3639 4523 gene locus_tag LOCUS_05830 3639 4523 CDS product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546849.1 protein_id gnl|my_center|LOCUS_05830 >Feature sequence106 305 1804 gene locus_tag LOCUS_05840 305 1804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05840 1809 2780 gene locus_tag LOCUS_05850 1809 2780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05850 2835 4238 gene locus_tag LOCUS_05860 gene xseA 2835 4238 CDS product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942411.1 protein_id gnl|my_center|LOCUS_05860 4238 5014 gene locus_tag LOCUS_05870 4238 5014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05870 5025 5315 gene locus_tag LOCUS_05880 gene xseB 5025 5315 CDS product exodeoxyribonuclease VII small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693923.1 protein_id gnl|my_center|LOCUS_05880 >Feature sequence107 640 158 gene locus_tag LOCUS_05890 640 158 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475488.1 protein_id gnl|my_center|LOCUS_05890 1516 653 gene locus_tag LOCUS_05900 1516 653 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140835.1 protein_id gnl|my_center|LOCUS_05900 1676 2845 gene locus_tag LOCUS_05910 1676 2845 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967232.1 protein_id gnl|my_center|LOCUS_05910 3051 4247 gene locus_tag LOCUS_05920 3051 4247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05920 4244 5533 gene locus_tag LOCUS_05930 4244 5533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05930 >Feature sequence108 756 52 gene locus_tag LOCUS_05940 756 52 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944002.1 protein_id gnl|my_center|LOCUS_05940 1677 814 gene locus_tag LOCUS_05950 1677 814 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025773590.1 protein_id gnl|my_center|LOCUS_05950 2795 1674 gene locus_tag LOCUS_05960 2795 1674 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583299.1 protein_id gnl|my_center|LOCUS_05960 3816 2899 gene locus_tag LOCUS_05970 3816 2899 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583298.1 protein_id gnl|my_center|LOCUS_05970 5153 3837 gene locus_tag LOCUS_05980 5153 3837 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583297.1 protein_id gnl|my_center|LOCUS_05980 >Feature sequence109 1231 38 gene locus_tag LOCUS_05990 1231 38 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255955.1 protein_id gnl|my_center|LOCUS_05990 1549 2418 gene locus_tag LOCUS_06000 1549 2418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06000 2662 3333 gene locus_tag LOCUS_06010 2662 3333 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057943.1 protein_id gnl|my_center|LOCUS_06010 3359 4171 gene locus_tag LOCUS_06020 3359 4171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06020 >Feature sequence110 3269 2862 gene locus_tag LOCUS_06030 3269 2862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06030 4183 3404 gene locus_tag LOCUS_06040 gene pyrH 4183 3404 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876512.1 protein_id gnl|my_center|LOCUS_06040 5084 4269 gene locus_tag LOCUS_06050 gene pyrH 5084 4269 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223864.1 protein_id gnl|my_center|LOCUS_06050 5443 5090 gene locus_tag LOCUS_06060 5443 5090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06060 >Feature sequence111 148 1632 gene locus_tag LOCUS_06070 148 1632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06070 1774 2265 gene locus_tag LOCUS_06080 1774 2265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06080 2318 2394 gene locus_tag LOCUS_t00040 2318 2394 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 2500 3057 gene locus_tag LOCUS_06090 2500 3057 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933341.1 protein_id gnl|my_center|LOCUS_06090 3061 5475 gene locus_tag LOCUS_06100 gene pcrA 3061 5475 CDS product DNA helicase PcrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011922262.1 protein_id gnl|my_center|LOCUS_06100 >Feature sequence112 258 767 gene locus_tag LOCUS_06110 258 767 CDS product adenylyltransferase/cytidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258042.1 protein_id gnl|my_center|LOCUS_06110 842 1918 gene locus_tag LOCUS_06120 gene waaC 842 1918 CDS product lipopolysaccharide heptosyltransferase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942882.1 protein_id gnl|my_center|LOCUS_06120 1932 2465 gene locus_tag LOCUS_06130 1932 2465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06130 2476 3336 gene locus_tag LOCUS_06140 2476 3336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06140 3555 4517 gene locus_tag LOCUS_06150 3555 4517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06150 >Feature sequence113 1083 2129 gene locus_tag LOCUS_06160 1083 2129 CDS product TerC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929529.1 protein_id gnl|my_center|LOCUS_06160 2136 2612 gene locus_tag LOCUS_06170 2136 2612 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090138.1 protein_id gnl|my_center|LOCUS_06170 2886 5222 gene locus_tag LOCUS_06180 2886 5222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06180 >Feature sequence114 893 1180 gene locus_tag LOCUS_06190 gene higB 893 1180 CDS product type II toxin-antitoxin system toxin HigB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000550189.1 protein_id gnl|my_center|LOCUS_06190 1184 1411 gene locus_tag LOCUS_06200 1184 1411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06200 1802 1590 gene locus_tag LOCUS_06210 1802 1590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06210 2541 3785 gene locus_tag LOCUS_06220 2541 3785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06220 >Feature sequence115 336 1088 gene locus_tag LOCUS_06230 336 1088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06230 1089 3089 gene locus_tag LOCUS_06240 1089 3089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06240 3329 3928 gene locus_tag LOCUS_06250 3329 3928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06250 >Feature sequence116 2 247 gene locus_tag LOCUS_06260 2 247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06260 259 924 gene locus_tag LOCUS_06270 259 924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06270 1247 3640 gene locus_tag LOCUS_06280 1247 3640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06280 3741 5363 gene locus_tag LOCUS_06290 3741 5363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06290 >Feature sequence117 332 1729 gene locus_tag LOCUS_06300 332 1729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06300 1768 3021 gene locus_tag LOCUS_06310 1768 3021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06310 3031 3801 gene locus_tag LOCUS_06320 3031 3801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06320 5357 3891 gene locus_tag LOCUS_06330 gene guaB 5357 3891 CDS product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942835.1 protein_id gnl|my_center|LOCUS_06330 >Feature sequence118 674 1684 gene locus_tag LOCUS_06340 674 1684 CDS product N-acetylornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037393.1 protein_id gnl|my_center|LOCUS_06340 1686 2573 gene locus_tag LOCUS_06350 gene argB 1686 2573 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869561.1 protein_id gnl|my_center|LOCUS_06350 2591 3937 gene locus_tag LOCUS_06360 gene trmFO 2591 3937 CDS product methylenetetrahydrofolate--tRNA-(uracil(54)-C(5))-methyltransferase (FADH(2)-oxidizing) TrmFO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392541.1 protein_id gnl|my_center|LOCUS_06360 3889 5037 gene locus_tag LOCUS_06370 3889 5037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06370 >Feature sequence119 1789 653 gene locus_tag LOCUS_06380 1789 653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06380 3101 2160 gene locus_tag LOCUS_06390 3101 2160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06390 <5357 3350 gene locus_tag LOCUS_06400 <5357 3350 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_118840085.1:dehydrogenase E1 component subunit alpha/beta >Feature sequence120 >Feature sequence121 1623 556 gene locus_tag LOCUS_06410 1623 556 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868467.1 protein_id gnl|my_center|LOCUS_06410 2069 1629 gene locus_tag LOCUS_06420 2069 1629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06420 3111 2089 gene locus_tag LOCUS_06430 3111 2089 CDS product M28 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797516.1 protein_id gnl|my_center|LOCUS_06430 3503 3126 gene locus_tag LOCUS_06440 3503 3126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06440 4084 3500 gene locus_tag LOCUS_06450 4084 3500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06450 4624 4124 gene locus_tag LOCUS_06460 4624 4124 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942028.1 protein_id gnl|my_center|LOCUS_06460 4749 4834 gene locus_tag LOCUS_t00050 4749 4834 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence122 1396 710 gene locus_tag LOCUS_06470 1396 710 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967335.1 protein_id gnl|my_center|LOCUS_06470 1674 2180 gene locus_tag LOCUS_06480 1674 2180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06480 2487 2275 gene locus_tag LOCUS_06490 2487 2275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06490 4615 2681 gene locus_tag LOCUS_06500 4615 2681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06500 >Feature sequence123 <1 902 gene locus_tag LOCUS_06510 <1 902 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257578.1:glycosyltransferase family 1 protein 910 1917 gene locus_tag LOCUS_06520 gene gmd 910 1917 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257005.1 protein_id gnl|my_center|LOCUS_06520 1914 3089 gene locus_tag LOCUS_06530 1914 3089 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256755.1 protein_id gnl|my_center|LOCUS_06530 3086 4678 gene locus_tag LOCUS_06540 3086 4678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06540 >Feature sequence124 3525 226 gene locus_tag LOCUS_06550 3525 226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06550 5188 3794 gene locus_tag LOCUS_06560 5188 3794 CDS product tetracycline resistance MFS efflux pump inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918931.1 protein_id gnl|my_center|LOCUS_06560 >Feature sequence125 1913 1371 gene locus_tag LOCUS_06570 1913 1371 CDS product O-acetyl-ADP-ribose deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391683.1 protein_id gnl|my_center|LOCUS_06570 2343 1990 gene locus_tag LOCUS_06580 2343 1990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06580 3293 2544 gene locus_tag LOCUS_06590 3293 2544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06590 3901 3491 gene locus_tag LOCUS_06600 3901 3491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06600 4039 5016 gene locus_tag LOCUS_06610 gene msrP 4039 5016 CDS product protein-methionine-sulfoxide reductase catalytic subunit MsrP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257868.1 protein_id gnl|my_center|LOCUS_06610 >Feature sequence126 1448 201 gene locus_tag LOCUS_06620 gene rlmD 1448 201 CDS product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546143.1 protein_id gnl|my_center|LOCUS_06620 2207 1467 gene locus_tag LOCUS_06630 2207 1467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06630 3049 2252 gene locus_tag LOCUS_06640 3049 2252 CDS product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886388.1 protein_id gnl|my_center|LOCUS_06640 4469 3180 gene locus_tag LOCUS_06650 4469 3180 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143746.1 protein_id gnl|my_center|LOCUS_06650 <5270 4594 gene locus_tag LOCUS_06660 <5270 4594 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942580.1:biotin--[acetyl-CoA-carboxylase] ligase >Feature sequence127 545 811 gene locus_tag LOCUS_06670 545 811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06670 1336 806 gene locus_tag LOCUS_06680 1336 806 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000721031.1 protein_id gnl|my_center|LOCUS_06680 1856 1392 gene locus_tag LOCUS_06690 1856 1392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06690 3651 1906 gene locus_tag LOCUS_06700 3651 1906 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140378.1 protein_id gnl|my_center|LOCUS_06700 3839 4510 gene locus_tag LOCUS_06710 3839 4510 CDS product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085274.1 protein_id gnl|my_center|LOCUS_06710 <5247 4514 gene locus_tag LOCUS_06720 <5247 4514 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941353.1:sugar kinase >Feature sequence128 1821 877 gene locus_tag LOCUS_06730 1821 877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06730 <5241 2121 gene locus_tag LOCUS_06740 <5241 2121 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010918809.1:TonB-dependent receptor >Feature sequence129 3 1424 gene locus_tag LOCUS_06750 3 1424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06750 1427 2281 gene locus_tag LOCUS_06760 gene nadC 1427 2281 CDS product carboxylating nicotinate-nucleotide diphosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_067615902.1 protein_id gnl|my_center|LOCUS_06760 2520 3356 gene locus_tag LOCUS_06770 2520 3356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06770 3390 3731 gene locus_tag LOCUS_06780 3390 3731 CDS product XdhC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393501.1 protein_id gnl|my_center|LOCUS_06780 3743 4078 gene locus_tag LOCUS_06790 3743 4078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06790 4075 4329 gene locus_tag LOCUS_06800 4075 4329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06800 4350 4664 gene locus_tag LOCUS_06810 4350 4664 CDS product DUF962 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003107722.1 protein_id gnl|my_center|LOCUS_06810 >Feature sequence130 1 1995 gene locus_tag LOCUS_06820 1 1995 CDS product putative baseplate assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258037.1 protein_id gnl|my_center|LOCUS_06820 1992 4865 gene locus_tag LOCUS_06830 1992 4865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06830 >Feature sequence131 348 1844 gene locus_tag LOCUS_06840 348 1844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06840 1841 3205 gene locus_tag LOCUS_06850 1841 3205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06850 3286 4755 gene locus_tag LOCUS_06860 3286 4755 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889218.1 protein_id gnl|my_center|LOCUS_06860 >Feature sequence132 <1 511 gene locus_tag LOCUS_06870 <1 511 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003549192.1:Holliday junction resolvase RuvX 527 1615 gene locus_tag LOCUS_06880 gene mltG 527 1615 CDS product endolytic transglycosylase MltG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941176.1 protein_id gnl|my_center|LOCUS_06880 1766 2413 gene locus_tag LOCUS_06890 1766 2413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06890 2496 3134 gene locus_tag LOCUS_06900 2496 3134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06900 3867 3199 gene locus_tag LOCUS_06910 3867 3199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06910 4141 4545 gene locus_tag LOCUS_06920 4141 4545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06920 >Feature sequence133 1057 236 gene locus_tag LOCUS_06930 1057 236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06930 2519 1104 gene locus_tag LOCUS_06940 gene gltA 2519 1104 CDS product NADPH-dependent glutamate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082125.1 protein_id gnl|my_center|LOCUS_06940 3494 2625 gene locus_tag LOCUS_06950 3494 2625 CDS product nitrilase-related carbon-nitrogen hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_084641929.1 protein_id gnl|my_center|LOCUS_06950 5022 3517 gene locus_tag LOCUS_06960 5022 3517 CDS product NCS1 family nucleobase:cation symporter-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228418.1 protein_id gnl|my_center|LOCUS_06960 >Feature sequence134 3893 2862 gene locus_tag LOCUS_06970 gene tssG 3893 2862 CDS product type VI secretion system baseplate subunit TssG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269329.1 protein_id gnl|my_center|LOCUS_06970 <5198 3857 gene locus_tag LOCUS_06980 <5198 3857 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003343627.1:type VI secretion system baseplate subunit TssF >Feature sequence135 541 3438 gene locus_tag LOCUS_06990 541 3438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06990 3580 4347 gene locus_tag LOCUS_07000 gene tsaB 3580 4347 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393646.1 protein_id gnl|my_center|LOCUS_07000 4397 4855 gene locus_tag LOCUS_07010 gene rimI 4397 4855 CDS product ribosomal protein S18-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056322.1 protein_id gnl|my_center|LOCUS_07010 >Feature sequence136 <1 695 gene locus_tag LOCUS_07020 <1 695 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003343647.1:type VI secretion system protein TssA 879 1430 gene locus_tag LOCUS_07030 gene tssB 879 1430 CDS product type VI secretion system contractile sheath small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003318241.1 protein_id gnl|my_center|LOCUS_07030 1423 2916 gene locus_tag LOCUS_07040 gene tssC 1423 2916 CDS product type VI secretion system contractile sheath large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003343625.1 protein_id gnl|my_center|LOCUS_07040 3304 3792 gene locus_tag LOCUS_07050 3304 3792 CDS product type VI secretion system tube protein Hcp inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004530039.1 protein_id gnl|my_center|LOCUS_07050 4029 4514 gene locus_tag LOCUS_07060 gene tssE 4029 4514 CDS product type VI secretion system baseplate subunit TssE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003318239.1 protein_id gnl|my_center|LOCUS_07060 >Feature sequence137 <1 788 gene locus_tag LOCUS_07070 <1 788 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000161236.1:type I glyceraldehyde-3-phosphate dehydrogenase 832 1710 gene locus_tag LOCUS_07080 832 1710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07080 1734 2936 gene locus_tag LOCUS_07090 1734 2936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07090 2949 3584 gene locus_tag LOCUS_07100 2949 3584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07100 3593 4351 gene locus_tag LOCUS_07110 gene tpiA 3593 4351 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942272.1 protein_id gnl|my_center|LOCUS_07110 4367 4822 gene locus_tag LOCUS_07120 4367 4822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07120 4856 4940 gene locus_tag LOCUS_t00060 4856 4940 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence138 1 615 gene locus_tag LOCUS_07130 gene rsmG 1 615 CDS product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921904.1 protein_id gnl|my_center|LOCUS_07130 2473 698 gene locus_tag LOCUS_07140 2473 698 CDS product SpoIVB peptidase S55 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869562.1 protein_id gnl|my_center|LOCUS_07140 2874 3470 gene locus_tag LOCUS_07150 2874 3470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07150 3580 4503 gene locus_tag LOCUS_07160 3580 4503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07160 >Feature sequence139 980 651 gene locus_tag LOCUS_07170 980 651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07170 1983 997 gene locus_tag LOCUS_07180 1983 997 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942246.1 protein_id gnl|my_center|LOCUS_07180 3128 2082 gene locus_tag LOCUS_07190 gene plsX 3128 2082 CDS product phosphate acyltransferase PlsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938504.1 protein_id gnl|my_center|LOCUS_07190 3424 3239 gene locus_tag LOCUS_07200 gene rpmF 3424 3239 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545520.1 protein_id gnl|my_center|LOCUS_07200 3987 3472 gene locus_tag LOCUS_07210 3987 3472 CDS product DUF177 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545391.1 protein_id gnl|my_center|LOCUS_07210 >Feature sequence140 3 1517 gene locus_tag LOCUS_07220 3 1517 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921438.1 protein_id gnl|my_center|LOCUS_07220 1514 2620 gene locus_tag LOCUS_07230 1514 2620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122840.1 protein_id gnl|my_center|LOCUS_07230 2636 4135 gene locus_tag LOCUS_07240 gene glpK 2636 4135 CDS product glycerol kinase GlpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888563.1 protein_id gnl|my_center|LOCUS_07240 >Feature sequence141 1874 2086 gene locus_tag LOCUS_07250 1874 2086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07250 3704 2151 gene locus_tag LOCUS_07260 3704 2151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07260 >Feature sequence142 2610 3503 gene locus_tag LOCUS_07270 2610 3503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07270 3507 4427 gene locus_tag LOCUS_07280 gene cyoE 3507 4427 CDS product heme o synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013062574.1 protein_id gnl|my_center|LOCUS_07280 >Feature sequence143 <1 1179 gene locus_tag LOCUS_07290 <1 1179 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_048061304.1:PQQ-binding-like beta-propeller repeat protein 1261 1470 gene locus_tag LOCUS_07300 1261 1470 CDS product type II toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532022.1 protein_id gnl|my_center|LOCUS_07300 1540 2160 gene locus_tag LOCUS_07310 1540 2160 CDS product GMP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249145.1 protein_id gnl|my_center|LOCUS_07310 2185 2355 gene locus_tag LOCUS_07320 2185 2355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07320 3026 2352 gene locus_tag LOCUS_07330 3026 2352 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228492.1 protein_id gnl|my_center|LOCUS_07330 3947 3051 gene locus_tag LOCUS_07340 3947 3051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197530101.1 protein_id gnl|my_center|LOCUS_07340 4172 3990 gene locus_tag LOCUS_07350 4172 3990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07350 4392 4934 gene locus_tag LOCUS_07360 4392 4934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07360 >Feature sequence144 541 266 gene locus_tag LOCUS_07370 541 266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07370 2730 538 gene locus_tag LOCUS_07380 2730 538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07380 3947 2727 gene locus_tag LOCUS_07390 3947 2727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07390 4468 3962 gene locus_tag LOCUS_07400 4468 3962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07400 >Feature sequence145 266 1198 gene locus_tag LOCUS_07410 266 1198 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531569.1 protein_id gnl|my_center|LOCUS_07410 2014 3255 gene locus_tag LOCUS_07420 2014 3255 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038780.1 protein_id gnl|my_center|LOCUS_07420 3308 4513 gene locus_tag LOCUS_07430 gene glf 3308 4513 CDS product UDP-galactopyranose mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017872005.1 protein_id gnl|my_center|LOCUS_07430 >Feature sequence146 244 1422 gene locus_tag LOCUS_07440 244 1422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07440 >Feature sequence147 1630 1298 gene locus_tag LOCUS_07450 gene groES 1630 1298 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970827.1 protein_id gnl|my_center|LOCUS_07450 1982 1815 gene locus_tag LOCUS_07460 1982 1815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07460 2504 2259 gene locus_tag LOCUS_07470 2504 2259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07470 3470 2562 gene locus_tag LOCUS_07480 3470 2562 CDS product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545457.1 protein_id gnl|my_center|LOCUS_07480 4198 3716 gene locus_tag LOCUS_07490 4198 3716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07490 >Feature sequence148 1 480 gene locus_tag LOCUS_07500 1 480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07500 579 905 gene locus_tag LOCUS_07510 579 905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07510 1425 2705 gene locus_tag LOCUS_07520 1425 2705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07520 2766 3884 gene locus_tag LOCUS_07530 2766 3884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07530 3913 4389 gene locus_tag LOCUS_07540 3913 4389 CDS product ester cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928468.1 protein_id gnl|my_center|LOCUS_07540 >Feature sequence149 3122 195 gene locus_tag LOCUS_07550 3122 195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07550 >Feature sequence150 448 212 gene locus_tag LOCUS_07560 448 212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07560 1605 457 gene locus_tag LOCUS_07570 1605 457 CDS product trypsin-like peptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142095.1 protein_id gnl|my_center|LOCUS_07570 2260 1796 gene locus_tag LOCUS_07580 2260 1796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07580 3062 2331 gene locus_tag LOCUS_07590 3062 2331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07590 3466 3101 gene locus_tag LOCUS_07600 3466 3101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07600 4457 3609 gene locus_tag LOCUS_07610 4457 3609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07610 4748 4485 gene locus_tag LOCUS_07620 4748 4485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07620 >Feature sequence151 654 31 gene locus_tag LOCUS_07630 gene ruvA 654 31 CDS product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072405.1 protein_id gnl|my_center|LOCUS_07630 841 1548 gene locus_tag LOCUS_07640 841 1548 CDS product redox-sensing transcriptional repressor Rex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_054936275.1 protein_id gnl|my_center|LOCUS_07640 1589 2098 gene locus_tag LOCUS_07650 1589 2098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07650 2113 2931 gene locus_tag LOCUS_07660 2113 2931 CDS product class II aldolase/adducin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256490.1 protein_id gnl|my_center|LOCUS_07660 2986 3765 gene locus_tag LOCUS_07670 2986 3765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07670 3765 4292 gene locus_tag LOCUS_07680 3765 4292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07680 4397 4660 gene locus_tag LOCUS_07690 gene eutM 4397 4660 CDS product ethanolamine utilization microcompartment protein EutM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005895463.1 protein_id gnl|my_center|LOCUS_07690 >Feature sequence152 <1 1289 gene locus_tag LOCUS_07700 <1 1289 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011120545.1:M1 family metallopeptidase 1286 1822 gene locus_tag LOCUS_07710 1286 1822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07710 1922 2857 gene locus_tag LOCUS_07720 1922 2857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07720 >Feature sequence153 2 439 gene locus_tag LOCUS_07730 2 439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07730 586 1626 gene locus_tag LOCUS_07740 586 1626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07740 1635 3101 gene locus_tag LOCUS_07750 gene glmU 1635 3101 CDS product bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391623.1 protein_id gnl|my_center|LOCUS_07750 >Feature sequence154 1318 893 gene locus_tag LOCUS_07760 1318 893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07760 2280 1327 gene locus_tag LOCUS_07770 2280 1327 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545286.1 protein_id gnl|my_center|LOCUS_07770 3211 4467 gene locus_tag LOCUS_07780 3211 4467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07780 >Feature sequence155 3113 1668 gene locus_tag LOCUS_07790 3113 1668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07790 3907 3149 gene locus_tag LOCUS_07800 gene larB 3907 3149 CDS product nickel pincer cofactor biosynthesis protein LarB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947959.1 protein_id gnl|my_center|LOCUS_07800 4025 4642 gene locus_tag LOCUS_07810 4025 4642 CDS product flavin prenyltransferase UbiX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140532.1 protein_id gnl|my_center|LOCUS_07810 >Feature sequence156 733 1185 gene locus_tag LOCUS_07820 733 1185 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001003313.1 protein_id gnl|my_center|LOCUS_07820 1531 3252 gene locus_tag LOCUS_07830 gene rpoD 1531 3252 CDS product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943710.1 protein_id gnl|my_center|LOCUS_07830 3521 4150 gene locus_tag LOCUS_07840 3521 4150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07840 4782 4243 gene locus_tag LOCUS_07850 4782 4243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07850 >Feature sequence157 86 985 gene locus_tag LOCUS_07860 86 985 CDS product WG repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358861.1 protein_id gnl|my_center|LOCUS_07860 1006 2142 gene locus_tag LOCUS_07870 gene speY 1006 2142 CDS product deoxyhypusine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141047.1 protein_id gnl|my_center|LOCUS_07870 2236 2709 gene locus_tag LOCUS_07880 2236 2709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07880 2805 3032 gene locus_tag LOCUS_07890 2805 3032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07890 3097 4647 gene locus_tag LOCUS_07900 3097 4647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07900 >Feature sequence158 598 1269 gene locus_tag LOCUS_07910 598 1269 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889002.1 protein_id gnl|my_center|LOCUS_07910 1426 2520 gene locus_tag LOCUS_07920 1426 2520 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583464.1 protein_id gnl|my_center|LOCUS_07920 2547 2777 gene locus_tag LOCUS_07930 2547 2777 CDS product type II toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022341.1 protein_id gnl|my_center|LOCUS_07930 3027 3857 gene locus_tag LOCUS_07940 3027 3857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07940 3967 4752 gene locus_tag LOCUS_07950 gene paaG 3967 4752 CDS product 2-(1,2-epoxy-1,2-dihydrophenyl)acetyl-CoA isomerase PaaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186957.1 protein_id gnl|my_center|LOCUS_07950 >Feature sequence159 <1 1000 gene locus_tag LOCUS_07960 <1 1000 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164927227.1:NADH-quinone oxidoreductase subunit L 1124 2821 gene locus_tag LOCUS_07970 1124 2821 CDS product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258760.1 protein_id gnl|my_center|LOCUS_07970 >Feature sequence160 3463 716 gene locus_tag LOCUS_07980 3463 716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07980 4797 3559 gene locus_tag LOCUS_07990 4797 3559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07990 >Feature sequence161 1212 172 gene locus_tag LOCUS_08000 gene gmd 1212 172 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056481.1 protein_id gnl|my_center|LOCUS_08000 1459 2409 gene locus_tag LOCUS_08010 1459 2409 CDS product GDP-L-fucose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257987.1 protein_id gnl|my_center|LOCUS_08010 2477 3151 gene locus_tag LOCUS_08020 2477 3151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08020 3158 4105 gene locus_tag LOCUS_08030 3158 4105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08030 >Feature sequence162 <1 1187 gene locus_tag LOCUS_08040 <1 1187 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011460675.1:aminomethyl-transferring glycine dehydrogenase subunit GcvPA 1191 2723 gene locus_tag LOCUS_08050 gene gcvPB 1191 2723 CDS product aminomethyl-transferring glycine dehydrogenase subunit GcvPB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460674.1 protein_id gnl|my_center|LOCUS_08050 3681 2704 gene locus_tag LOCUS_08060 3681 2704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08060 4401 3910 gene locus_tag LOCUS_08070 4401 3910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08070 >Feature sequence163 166 1089 gene locus_tag LOCUS_08080 166 1089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08080 1295 2329 gene locus_tag LOCUS_08090 1295 2329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08090 2472 3890 gene locus_tag LOCUS_08100 2472 3890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08100 >Feature sequence164 480 220 gene locus_tag LOCUS_08110 480 220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08110 1802 504 gene locus_tag LOCUS_08120 gene pepP 1802 504 CDS product Xaa-Pro aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114045.1 protein_id gnl|my_center|LOCUS_08120 1932 3512 gene locus_tag LOCUS_08130 1932 3512 CDS product succinic semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225959.1 protein_id gnl|my_center|LOCUS_08130 3534 4541 gene locus_tag LOCUS_08140 3534 4541 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011971076.1 protein_id gnl|my_center|LOCUS_08140 >Feature sequence165 432 1469 gene locus_tag LOCUS_08150 432 1469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08150 1487 2905 gene locus_tag LOCUS_08160 1487 2905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08160 2941 3234 gene locus_tag LOCUS_08170 2941 3234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08170 3367 4512 gene locus_tag LOCUS_08180 3367 4512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08180 >Feature sequence166 821 2296 gene locus_tag LOCUS_08190 821 2296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08190 2728 3780 gene locus_tag LOCUS_08200 2728 3780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08200 >Feature sequence167 2881 1931 gene locus_tag LOCUS_08210 2881 1931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08210 >Feature sequence168 <1 876 gene locus_tag LOCUS_08220 <1 876 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_203473432.1:type I DNA topoisomerase 1768 920 gene locus_tag LOCUS_08230 1768 920 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720501.1 protein_id gnl|my_center|LOCUS_08230 2746 1850 gene locus_tag LOCUS_08240 2746 1850 CDS product diacylglycerol kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338161.1 protein_id gnl|my_center|LOCUS_08240 >Feature sequence169 <1 2551 gene locus_tag LOCUS_08250 <1 2551 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012258514.1:FHA domain-containing protein 2561 3157 gene locus_tag LOCUS_08260 2561 3157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08260 3194 3889 gene locus_tag LOCUS_08270 3194 3889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08270 4217 4005 gene locus_tag LOCUS_08280 4217 4005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08280 >Feature sequence170 473 3091 gene locus_tag LOCUS_08290 473 3091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08290 3592 3140 gene locus_tag LOCUS_08300 3592 3140 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938185.1 protein_id gnl|my_center|LOCUS_08300 <4619 3637 gene locus_tag LOCUS_08310 <4619 3637 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011142299.1:VCBS repeat-containing protein >Feature sequence171 <1 1831 gene locus_tag LOCUS_08320 <1 1831 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011140254.1:tail fiber domain-containing protein 1846 2979 gene locus_tag LOCUS_08330 1846 2979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08330 >Feature sequence172 424 351 gene locus_tag LOCUS_t00070 424 351 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 1132 500 gene locus_tag LOCUS_08340 1132 500 CDS product XTP/dITP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545768.1 protein_id gnl|my_center|LOCUS_08340 1212 2597 gene locus_tag LOCUS_08350 1212 2597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08350 4358 2628 gene locus_tag LOCUS_08360 4358 2628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08360 >Feature sequence173 1264 3225 gene locus_tag LOCUS_08370 1264 3225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08370 4146 3292 gene locus_tag LOCUS_08380 4146 3292 CDS product branched chain amino acid--2-keto-4-methylthiobutyrate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393599.1 protein_id gnl|my_center|LOCUS_08380 >Feature sequence174 3065 846 gene locus_tag LOCUS_08390 3065 846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08390 >Feature sequence175 1266 271 gene locus_tag LOCUS_08400 gene holA 1266 271 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001279916.1 protein_id gnl|my_center|LOCUS_08400 1823 1269 gene locus_tag LOCUS_08410 1823 1269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08410 2822 1896 gene locus_tag LOCUS_08420 gene folP 2822 1896 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_039644433.1 protein_id gnl|my_center|LOCUS_08420 <4597 2872 gene locus_tag LOCUS_08430 <4597 2872 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_200858940.1:ATP-dependent zinc metalloprotease FtsH >Feature sequence176 368 2908 gene locus_tag LOCUS_08440 368 2908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08440 >Feature sequence177 1253 423 gene locus_tag LOCUS_08450 1253 423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08450 1691 1356 gene locus_tag LOCUS_08460 1691 1356 CDS product 2Fe-2S iron-sulfur cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001125388.1 protein_id gnl|my_center|LOCUS_08460 2233 1766 gene locus_tag LOCUS_08470 2233 1766 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140300.1 protein_id gnl|my_center|LOCUS_08470 2844 2230 gene locus_tag LOCUS_08480 2844 2230 CDS product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977382.1 protein_id gnl|my_center|LOCUS_08480 3512 2850 gene locus_tag LOCUS_08490 gene cmk 3512 2850 CDS product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943242.1 protein_id gnl|my_center|LOCUS_08490 <4583 3622 gene locus_tag LOCUS_08500 <4583 3622 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012258446.1:low-specificity L-threonine aldolase >Feature sequence178 3837 3169 gene locus_tag LOCUS_08510 3837 3169 CDS product cytochrome c3 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256517.1 protein_id gnl|my_center|LOCUS_08510 >Feature sequence179 640 2961 gene locus_tag LOCUS_08520 640 2961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08520 >Feature sequence180 374 1345 gene locus_tag LOCUS_08530 374 1345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08530 1391 2341 gene locus_tag LOCUS_08540 1391 2341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08540 2433 2891 gene locus_tag LOCUS_08550 2433 2891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08550 3844 2888 gene locus_tag LOCUS_08560 3844 2888 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545051.1 protein_id gnl|my_center|LOCUS_08560 4327 3998 gene locus_tag LOCUS_08570 4327 3998 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003701976.1 protein_id gnl|my_center|LOCUS_08570 >Feature sequence181 3373 1496 gene locus_tag LOCUS_08580 3373 1496 CDS product M1 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176994158.1 protein_id gnl|my_center|LOCUS_08580 4356 3445 gene locus_tag LOCUS_08590 4356 3445 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259448.1 protein_id gnl|my_center|LOCUS_08590 >Feature sequence182 552 1259 gene locus_tag LOCUS_08600 552 1259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08600 2333 1347 gene locus_tag LOCUS_08610 2333 1347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08610 3091 2405 gene locus_tag LOCUS_08620 3091 2405 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965007.1 protein_id gnl|my_center|LOCUS_08620 <4529 3088 gene locus_tag LOCUS_08630 <4529 3088 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_069810170.1:ATP-binding protein >Feature sequence183 3070 281 gene locus_tag LOCUS_08640 gene mutS 3070 281 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404353.1 protein_id gnl|my_center|LOCUS_08640 >Feature sequence184 220 987 gene locus_tag LOCUS_08650 220 987 CDS product SCO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118837921.1 protein_id gnl|my_center|LOCUS_08650 1223 984 gene locus_tag LOCUS_08660 1223 984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08660 1713 2090 gene locus_tag LOCUS_08670 1713 2090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08670 >Feature sequence185 565 275 gene locus_tag LOCUS_08680 565 275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08680 1433 585 gene locus_tag LOCUS_08690 1433 585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08690 2282 1563 gene locus_tag LOCUS_08700 2282 1563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08700 2950 2468 gene locus_tag LOCUS_08710 gene greA 2950 2468 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005485311.1 protein_id gnl|my_center|LOCUS_08710 3290 4348 gene locus_tag LOCUS_08720 3290 4348 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258942.1 protein_id gnl|my_center|LOCUS_08720 >Feature sequence186 1157 210 gene locus_tag LOCUS_08730 1157 210 CDS product cobalamin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258980.1 protein_id gnl|my_center|LOCUS_08730 1328 2011 gene locus_tag LOCUS_08740 gene nox 1328 2011 CDS product NADH dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227925.1 protein_id gnl|my_center|LOCUS_08740 2036 2398 gene locus_tag LOCUS_08750 2036 2398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08750 2910 2425 gene locus_tag LOCUS_08760 2910 2425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143103.1 protein_id gnl|my_center|LOCUS_08760 2974 3579 gene locus_tag LOCUS_08770 2974 3579 CDS product DNA-3-methyladenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966252.1 protein_id gnl|my_center|LOCUS_08770 3847 4494 gene locus_tag LOCUS_08780 3847 4494 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036499.1 protein_id gnl|my_center|LOCUS_08780 >Feature sequence187 1046 612 gene locus_tag LOCUS_08790 1046 612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08790 1139 1570 gene locus_tag LOCUS_08800 1139 1570 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939839.1 protein_id gnl|my_center|LOCUS_08800 2129 1641 gene locus_tag LOCUS_08810 2129 1641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08810 3031 2144 gene locus_tag LOCUS_08820 3031 2144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08820 3868 3158 gene locus_tag LOCUS_08830 3868 3158 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869727.1 protein_id gnl|my_center|LOCUS_08830 <4497 3846 gene locus_tag LOCUS_08840 <4497 3846 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011404813.1:N-acetyl-alpha-D-glucosaminyl L-malate synthase BshA >Feature sequence188 1208 438 gene locus_tag LOCUS_08850 1208 438 CDS product TIGR00282 family metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392597.1 protein_id gnl|my_center|LOCUS_08850 2014 1628 gene locus_tag LOCUS_08860 2014 1628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08860 2292 2011 gene locus_tag LOCUS_08870 2292 2011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08870 <4489 2391 gene locus_tag LOCUS_08880 <4489 2391 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942167.1:phenylalanine--tRNA ligase subunit beta >Feature sequence189 230 1219 gene locus_tag LOCUS_08890 230 1219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08890 1403 1828 gene locus_tag LOCUS_08900 1403 1828 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391491.1 protein_id gnl|my_center|LOCUS_08900 1952 3103 gene locus_tag LOCUS_08910 1952 3103 CDS product PQQ-dependent sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228032.1 protein_id gnl|my_center|LOCUS_08910 3823 3185 gene locus_tag LOCUS_08920 3823 3185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08920 >Feature sequence190 2748 235 gene locus_tag LOCUS_08930 2748 235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08930 2862 4421 gene locus_tag LOCUS_08940 2862 4421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08940 >Feature sequence191 298 768 gene locus_tag LOCUS_08950 298 768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08950 775 1467 gene locus_tag LOCUS_08960 775 1467 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072508.1 protein_id gnl|my_center|LOCUS_08960 3217 1583 gene locus_tag LOCUS_08970 3217 1583 CDS product ATP-dependent DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048053886.1 protein_id gnl|my_center|LOCUS_08970 >Feature sequence192 669 3206 gene locus_tag LOCUS_08980 669 3206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08980 3245 4285 gene locus_tag LOCUS_08990 3245 4285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08990 >Feature sequence193 2640 880 gene locus_tag LOCUS_09000 2640 880 CDS product DUF885 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141209.1 protein_id gnl|my_center|LOCUS_09000 4176 2698 gene locus_tag LOCUS_09010 4176 2698 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257638.1 protein_id gnl|my_center|LOCUS_09010 >Feature sequence194 <1 603 gene locus_tag LOCUS_09020 <1 603 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011460386.1:pitrilysin family protein 624 1841 gene locus_tag LOCUS_09030 624 1841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09030 1854 2678 gene locus_tag LOCUS_09040 1854 2678 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014551636.1 protein_id gnl|my_center|LOCUS_09040 2678 3118 gene locus_tag LOCUS_09050 2678 3118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09050 >Feature sequence195 1054 20 gene locus_tag LOCUS_09060 1054 20 CDS product alcohol dehydrogenase catalytic domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467337.1 protein_id gnl|my_center|LOCUS_09060 1378 2055 gene locus_tag LOCUS_09070 1378 2055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09070 2078 2956 gene locus_tag LOCUS_09080 2078 2956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09080 4284 2953 gene locus_tag LOCUS_09090 4284 2953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09090 >Feature sequence196 1579 1887 gene locus_tag LOCUS_09100 1579 1887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09100 1979 2890 gene locus_tag LOCUS_09110 1979 2890 CDS product DUF692 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265874.1 protein_id gnl|my_center|LOCUS_09110 2892 3488 gene locus_tag LOCUS_09120 2892 3488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09120 4078 3506 gene locus_tag LOCUS_09130 4078 3506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09130 >Feature sequence197 140 331 gene locus_tag LOCUS_09140 140 331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09140 334 621 gene locus_tag LOCUS_09150 334 621 CDS product EutN/CcmL family microcompartment protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388667.1 protein_id gnl|my_center|LOCUS_09150 618 914 gene locus_tag LOCUS_09160 618 914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09160 911 1345 gene locus_tag LOCUS_09170 911 1345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09170 1462 3309 gene locus_tag LOCUS_09180 1462 3309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09180 3373 4050 gene locus_tag LOCUS_09190 3373 4050 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878966.1 protein_id gnl|my_center|LOCUS_09190 >Feature sequence198 365 1009 gene locus_tag LOCUS_09200 365 1009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09200 1155 2177 gene locus_tag LOCUS_09210 1155 2177 CDS product glycine cleavage T C-terminal barrel domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258471.1 protein_id gnl|my_center|LOCUS_09210 2174 2464 gene locus_tag LOCUS_09220 2174 2464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09220 >Feature sequence199 556 1344 gene locus_tag LOCUS_09230 556 1344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09230 1516 1977 gene locus_tag LOCUS_09240 gene exbD 1516 1977 CDS product TonB system transport protein ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002551495.1 protein_id gnl|my_center|LOCUS_09240 2105 2578 gene locus_tag LOCUS_09250 gene tolR 2105 2578 CDS product protein TolR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932318.1 protein_id gnl|my_center|LOCUS_09250 2684 3541 gene locus_tag LOCUS_09260 2684 3541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09260 >Feature sequence200 188 1666 gene locus_tag LOCUS_09270 188 1666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09270 1772 4276 gene locus_tag LOCUS_09280 gene priA 1772 4276 CDS product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232079.1 protein_id gnl|my_center|LOCUS_09280 >Feature sequence201 3090 2725 gene locus_tag LOCUS_09290 3090 2725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09290 3483 3268 gene locus_tag LOCUS_09300 3483 3268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09300 >Feature sequence202 >Feature sequence203 2370 178 gene locus_tag LOCUS_09310 2370 178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09310 2994 2641 gene locus_tag LOCUS_09320 2994 2641 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969576.1 protein_id gnl|my_center|LOCUS_09320 3276 4076 gene locus_tag LOCUS_09330 3276 4076 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222374.1 protein_id gnl|my_center|LOCUS_09330 >Feature sequence204 796 1617 gene locus_tag LOCUS_09340 796 1617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09340 1717 2214 gene locus_tag LOCUS_09350 1717 2214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09350 2229 3320 gene locus_tag LOCUS_09360 2229 3320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09360 >Feature sequence205 239 2278 gene locus_tag LOCUS_09370 239 2278 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256059.1 protein_id gnl|my_center|LOCUS_09370 >Feature sequence206 2288 1218 gene locus_tag LOCUS_09380 2288 1218 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113413.1 protein_id gnl|my_center|LOCUS_09380 4081 2366 gene locus_tag LOCUS_09390 4081 2366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09390 >Feature sequence207 801 1400 gene locus_tag LOCUS_09400 801 1400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09400 1887 1411 gene locus_tag LOCUS_09410 1887 1411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09410 2865 1948 gene locus_tag LOCUS_09420 2865 1948 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015839.1 protein_id gnl|my_center|LOCUS_09420 3862 2855 gene locus_tag LOCUS_09430 3862 2855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09430 >Feature sequence208 1946 939 gene locus_tag LOCUS_09440 gene pta 1946 939 CDS product phosphate acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943344.1 protein_id gnl|my_center|LOCUS_09440 2160 2810 gene locus_tag LOCUS_09450 2160 2810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09450 3413 2871 gene locus_tag LOCUS_09460 3413 2871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09460 3611 4156 gene locus_tag LOCUS_09470 3611 4156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09470 >Feature sequence209 1538 834 gene locus_tag LOCUS_09480 1538 834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09480 1820 2065 gene locus_tag LOCUS_09490 1820 2065 CDS product glutaredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524616.1 protein_id gnl|my_center|LOCUS_09490 4214 2070 gene locus_tag LOCUS_09500 4214 2070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09500 >Feature sequence210 709 2256 gene locus_tag LOCUS_09510 709 2256 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964215.1 protein_id gnl|my_center|LOCUS_09510 2266 3036 gene locus_tag LOCUS_09520 2266 3036 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962745.1 protein_id gnl|my_center|LOCUS_09520 >Feature sequence211 3 1169 gene locus_tag LOCUS_09530 3 1169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09530 1219 2019 gene locus_tag LOCUS_09540 1219 2019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09540 2928 2113 gene locus_tag LOCUS_09550 2928 2113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09550 3050 3622 gene locus_tag LOCUS_09560 3050 3622 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144059.1 protein_id gnl|my_center|LOCUS_09560 >Feature sequence212 236 2002 gene locus_tag LOCUS_09570 236 2002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09570 2278 2910 gene locus_tag LOCUS_09580 2278 2910 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036499.1 protein_id gnl|my_center|LOCUS_09580 2983 3729 gene locus_tag LOCUS_09590 2983 3729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09590 >Feature sequence213 788 934 gene locus_tag LOCUS_09600 788 934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09600 1094 2281 gene locus_tag LOCUS_09610 gene kynU 1094 2281 CDS product kynureninase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003818477.1 protein_id gnl|my_center|LOCUS_09610 2373 3218 gene locus_tag LOCUS_09620 2373 3218 CDS product tryptophan 2,3-dioxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035685.1 protein_id gnl|my_center|LOCUS_09620 >Feature sequence214 <1 2358 gene locus_tag LOCUS_09630 <1 2358 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_208256196.1:exo-alpha-sialidase >Feature sequence215 2225 1308 gene locus_tag LOCUS_09640 2225 1308 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405383.1 protein_id gnl|my_center|LOCUS_09640 >Feature sequence216 64 432 gene locus_tag LOCUS_09650 gene rplN 64 432 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003014346.1 protein_id gnl|my_center|LOCUS_09650 435 773 gene locus_tag LOCUS_09660 gene rplX 435 773 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003427723.1 protein_id gnl|my_center|LOCUS_09660 818 1372 gene locus_tag LOCUS_09670 gene rplE 818 1372 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258243.1 protein_id gnl|my_center|LOCUS_09670 1389 1574 gene locus_tag LOCUS_09680 1389 1574 CDS product type Z 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258244.1 protein_id gnl|my_center|LOCUS_09680 1621 2013 gene locus_tag LOCUS_09690 gene rpsH 1621 2013 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925182.1 protein_id gnl|my_center|LOCUS_09690 2026 2586 gene locus_tag LOCUS_09700 gene rplF 2026 2586 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546082.1 protein_id gnl|my_center|LOCUS_09700 2731 3114 gene locus_tag LOCUS_09710 gene rplR 2731 3114 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925411.1 protein_id gnl|my_center|LOCUS_09710 3115 3621 gene locus_tag LOCUS_09720 gene rpsE 3115 3621 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003701326.1 protein_id gnl|my_center|LOCUS_09720 3710 3916 gene locus_tag LOCUS_09730 3710 3916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09730 >Feature sequence217 <1 849 gene locus_tag LOCUS_09740 <1 849 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004081330.1:3-isopropylmalate dehydratase large subunit 872 1063 gene locus_tag LOCUS_09750 872 1063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09750 1076 1639 gene locus_tag LOCUS_09760 1076 1639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09760 1759 2220 gene locus_tag LOCUS_09770 1759 2220 CDS product DUF488 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031813.1 protein_id gnl|my_center|LOCUS_09770 2252 3310 gene locus_tag LOCUS_09780 2252 3310 CDS product mechanosensitive ion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173510087.1 protein_id gnl|my_center|LOCUS_09780 3916 3398 gene locus_tag LOCUS_09790 3916 3398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09790 >Feature sequence218 319 1146 gene locus_tag LOCUS_09800 319 1146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09800 1134 2219 gene locus_tag LOCUS_09810 1134 2219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09810 2320 2775 gene locus_tag LOCUS_09820 2320 2775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09820 3150 2800 gene locus_tag LOCUS_09830 3150 2800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09830 >Feature sequence219 1651 527 gene locus_tag LOCUS_09840 gene trxB 1651 527 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932523.1 protein_id gnl|my_center|LOCUS_09840 1825 2613 gene locus_tag LOCUS_09850 1825 2613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09850 2950 3825 gene locus_tag LOCUS_09860 2950 3825 CDS product 3-hydroxybutyryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965995.1 protein_id gnl|my_center|LOCUS_09860 >Feature sequence220 1352 1005 gene locus_tag LOCUS_09870 1352 1005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09870 1857 1324 gene locus_tag LOCUS_09880 1857 1324 CDS product HNH endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143719.1 protein_id gnl|my_center|LOCUS_09880 2936 1983 gene locus_tag LOCUS_09890 gene pip 2936 1983 CDS product prolyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141435.1 protein_id gnl|my_center|LOCUS_09890 3702 2950 gene locus_tag LOCUS_09900 3702 2950 CDS product ComF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940800.1 protein_id gnl|my_center|LOCUS_09900 4160 3792 gene locus_tag LOCUS_09910 gene dksA 4160 3792 CDS product RNA polymerase-binding protein DksA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719804.1 protein_id gnl|my_center|LOCUS_09910 >Feature sequence221 1566 874 gene locus_tag LOCUS_09920 1566 874 CDS product aspartate/glutamate racemase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000848553.1 protein_id gnl|my_center|LOCUS_09920 2175 1585 gene locus_tag LOCUS_09930 2175 1585 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000767065.1 protein_id gnl|my_center|LOCUS_09930 2482 2183 gene locus_tag LOCUS_09940 2482 2183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09940 <4240 2649 gene locus_tag LOCUS_09950 <4240 2649 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011228793.1:protein kinase >Feature sequence222 2409 1396 gene locus_tag LOCUS_09960 2409 1396 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007335040.1 protein_id gnl|my_center|LOCUS_09960 3757 2549 gene locus_tag LOCUS_09970 3757 2549 CDS product PilT/PilU family type 4a pilus ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545245.1 protein_id gnl|my_center|LOCUS_09970 >Feature sequence223 881 1441 gene locus_tag LOCUS_09980 881 1441 CDS product NifU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004596187.1 protein_id gnl|my_center|LOCUS_09980 1596 3536 gene locus_tag LOCUS_09990 1596 3536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09990 <4229 3541 gene locus_tag LOCUS_10000 <4229 3541 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962816.1:bacillithiol biosynthesis deacetylase BshB1 >Feature sequence224 1490 720 gene locus_tag LOCUS_10010 1490 720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10010 2054 1503 gene locus_tag LOCUS_10020 2054 1503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10020 2473 2060 gene locus_tag LOCUS_10030 2473 2060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10030 3165 2476 gene locus_tag LOCUS_10040 3165 2476 CDS product 2OG-Fe(II) oxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073517.1 protein_id gnl|my_center|LOCUS_10040 4161 3184 gene locus_tag LOCUS_10050 4161 3184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10050 >Feature sequence225 3049 1109 gene locus_tag LOCUS_10060 3049 1109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10060 4001 3165 gene locus_tag LOCUS_10070 4001 3165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10070 >Feature sequence226 1952 420 gene locus_tag LOCUS_10080 1952 420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10080 3095 1977 gene locus_tag LOCUS_10090 3095 1977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10090 3164 4144 gene locus_tag LOCUS_10100 3164 4144 CDS product stage II sporulation protein M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256411.1 protein_id gnl|my_center|LOCUS_10100 >Feature sequence227 <1 1102 gene locus_tag LOCUS_10110 <1 1102 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_235044863.1:XrtA-associated ATPase 1110 2180 gene locus_tag LOCUS_10120 1110 2180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10120 2188 3576 gene locus_tag LOCUS_10130 2188 3576 CDS product TIGR03013 family PEP-CTERM/XrtA system glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942630.1 protein_id gnl|my_center|LOCUS_10130 >Feature sequence228 1749 355 gene locus_tag LOCUS_10140 1749 355 CDS product multifunctional CCA addition/repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038505.1 protein_id gnl|my_center|LOCUS_10140 2180 1830 gene locus_tag LOCUS_10150 2180 1830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10150 3716 2238 gene locus_tag LOCUS_10160 3716 2238 CDS product glycine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013399500.1 protein_id gnl|my_center|LOCUS_10160 >Feature sequence229 730 488 gene locus_tag LOCUS_10170 730 488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10170 1315 860 gene locus_tag LOCUS_10180 gene rnhA 1315 860 CDS product ribonuclease HI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000917883.1 protein_id gnl|my_center|LOCUS_10180 <4183 1338 gene locus_tag LOCUS_10190 <4183 1338 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011055983.1:SMC family ATPase >Feature sequence230 3 467 gene locus_tag LOCUS_10200 3 467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10200 620 2335 gene locus_tag LOCUS_10210 620 2335 CDS product GspE/PulE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942427.1 protein_id gnl|my_center|LOCUS_10210 >Feature sequence231 <1 1463 gene locus_tag LOCUS_10220 <1 1463 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011106392.1:DUF1800 domain-containing protein 1523 2908 gene locus_tag LOCUS_10230 1523 2908 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920272.1 protein_id gnl|my_center|LOCUS_10230 >Feature sequence232 928 515 gene locus_tag LOCUS_10240 928 515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10240 1425 1210 gene locus_tag LOCUS_10250 1425 1210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10250 3554 1632 gene locus_tag LOCUS_10260 gene selB 3554 1632 CDS product selenocysteine-specific translation elongation factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940778.1 protein_id gnl|my_center|LOCUS_10260 >Feature sequence233 418 573 gene locus_tag LOCUS_10270 418 573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10270 673 1638 gene locus_tag LOCUS_10280 673 1638 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962522.1 protein_id gnl|my_center|LOCUS_10280 <4162 1756 gene locus_tag LOCUS_10290 <4162 1756 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012583439.1:DNA mismatch repair protein MutS >Feature sequence234 2978 1572 gene locus_tag LOCUS_10300 gene mpl 2978 1572 CDS product UDP-N-acetylmuramate:L-alanyl-gamma-D-glutamyl-meso-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933145.1 protein_id gnl|my_center|LOCUS_10300 3614 2991 gene locus_tag LOCUS_10310 3614 2991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10310 <4154 3639 gene locus_tag LOCUS_10320 <4154 3639 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_226990901.1:MEDS domain-containing protein >Feature sequence235 1505 933 gene locus_tag LOCUS_10330 gene nuoE 1505 933 CDS product NADH-quinone oxidoreductase subunit NuoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000540773.1 protein_id gnl|my_center|LOCUS_10330 2722 1502 gene locus_tag LOCUS_10340 gene nuoD 2722 1502 CDS product NADH dehydrogenase (quinone) subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941009.1 protein_id gnl|my_center|LOCUS_10340 3288 2737 gene locus_tag LOCUS_10350 3288 2737 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142343.1 protein_id gnl|my_center|LOCUS_10350 3904 3359 gene locus_tag LOCUS_10360 3904 3359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10360 >Feature sequence236 659 1492 gene locus_tag LOCUS_10370 659 1492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10370 1748 2155 gene locus_tag LOCUS_10380 1748 2155 CDS product hotdog fold thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811741.1 protein_id gnl|my_center|LOCUS_10380 3088 2267 gene locus_tag LOCUS_10390 3088 2267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086844.1 protein_id gnl|my_center|LOCUS_10390 >Feature sequence237 <1 776 gene locus_tag LOCUS_10400 <1 776 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010906368.1:gluconokinase 901 2961 gene locus_tag LOCUS_10410 gene tkt 901 2961 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403054.1 protein_id gnl|my_center|LOCUS_10410 >Feature sequence238 687 1424 gene locus_tag LOCUS_10420 687 1424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10420 1532 2278 gene locus_tag LOCUS_10430 1532 2278 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258317.1 protein_id gnl|my_center|LOCUS_10430 3359 2370 gene locus_tag LOCUS_10440 3359 2370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10440 <4128 3512 gene locus_tag LOCUS_10450 <4128 3512 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011142299.1:VCBS repeat-containing protein >Feature sequence239 3674 3222 gene locus_tag LOCUS_10460 3674 3222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10460 >Feature sequence240 1753 704 gene locus_tag LOCUS_10470 1753 704 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943459.1 protein_id gnl|my_center|LOCUS_10470 2495 1854 gene locus_tag LOCUS_10480 gene rpsD 2495 1854 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393909.1 protein_id gnl|my_center|LOCUS_10480 3031 2630 gene locus_tag LOCUS_10490 gene rpsK 3031 2630 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943461.1 protein_id gnl|my_center|LOCUS_10490 3427 3044 gene locus_tag LOCUS_10500 gene rpsM 3427 3044 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258255.1 protein_id gnl|my_center|LOCUS_10500 3834 3613 gene locus_tag LOCUS_10510 gene infA 3834 3613 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006583256.1 protein_id gnl|my_center|LOCUS_10510 >Feature sequence241 3294 1774 gene locus_tag LOCUS_10520 3294 1774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10520 >Feature sequence242 223 657 gene locus_tag LOCUS_10530 223 657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10530 2845 731 gene locus_tag LOCUS_10540 2845 731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10540 3464 3003 gene locus_tag LOCUS_10550 3464 3003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10550 >Feature sequence243 456 3626 gene locus_tag LOCUS_10560 456 3626 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037353.1 protein_id gnl|my_center|LOCUS_10560 >Feature sequence244 1485 562 gene locus_tag LOCUS_10570 1485 562 CDS product Rossmann-like and DUF2520 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391687.1 protein_id gnl|my_center|LOCUS_10570 >Feature sequence245 77 892 gene locus_tag LOCUS_10580 gene cysT 77 892 CDS product sulfate ABC transporter permease subunit CysT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036155.1 protein_id gnl|my_center|LOCUS_10580 972 2237 gene locus_tag LOCUS_10590 972 2237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10590 2280 3809 gene locus_tag LOCUS_10600 gene nrfD 2280 3809 CDS product polysulfide reductase NrfD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259049.1 protein_id gnl|my_center|LOCUS_10600 >Feature sequence246 1260 976 gene locus_tag LOCUS_10610 1260 976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10610 1801 1415 gene locus_tag LOCUS_10620 1801 1415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10620 2204 1839 gene locus_tag LOCUS_10630 2204 1839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10630 2896 2231 gene locus_tag LOCUS_10640 2896 2231 CDS product GvpL/GvpF family gas vesicle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972477.1 protein_id gnl|my_center|LOCUS_10640 3215 2994 gene locus_tag LOCUS_10650 3215 2994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10650 4023 3208 gene locus_tag LOCUS_10660 4023 3208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10660 >Feature sequence247 <1 650 gene locus_tag LOCUS_10670 <1 650 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941361.1:SpoIIE family protein phosphatase 980 723 gene locus_tag LOCUS_10680 980 723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10680 1181 1933 gene locus_tag LOCUS_10690 1181 1933 CDS product DUF4159 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920665.1 protein_id gnl|my_center|LOCUS_10690 3940 2015 gene locus_tag LOCUS_10700 3940 2015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10700 >Feature sequence248 <1 1778 gene locus_tag LOCUS_10710 <1 1778 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_009871433.1:menaquinone biosynthesis decarboxylase 1765 2619 gene locus_tag LOCUS_10720 1765 2619 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529142.1 protein_id gnl|my_center|LOCUS_10720 <4065 2740 gene locus_tag LOCUS_10730 <4065 2740 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011074106.1:ATP-binding protein >Feature sequence249 319 957 gene locus_tag LOCUS_10740 319 957 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142702.1 protein_id gnl|my_center|LOCUS_10740 954 1565 gene locus_tag LOCUS_10750 954 1565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10750 3085 1682 gene locus_tag LOCUS_10760 3085 1682 CDS product DUF4139 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943931.1 protein_id gnl|my_center|LOCUS_10760 >Feature sequence250 2123 1887 gene locus_tag LOCUS_10770 2123 1887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10770 <4061 2880 gene locus_tag LOCUS_10780 <4061 2880 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011266458.1:bifunctional [glutamate--ammonia ligase]-adenylyl-L-tyrosine phosphorylase/[glutamate--ammonia-ligase] adenylyltransferase >Feature sequence251 487 2139 gene locus_tag LOCUS_10790 gene ettA 487 2139 CDS product energy-dependent translational throttle protein EttA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942289.1 protein_id gnl|my_center|LOCUS_10790 2698 3093 gene locus_tag LOCUS_10800 gene rpsL 2698 3093 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943491.1 protein_id gnl|my_center|LOCUS_10800 3132 3566 gene locus_tag LOCUS_10810 gene rpsG 3132 3566 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938594.1 protein_id gnl|my_center|LOCUS_10810 >Feature sequence252 1541 363 gene locus_tag LOCUS_10820 1541 363 CDS product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706990.1 protein_id gnl|my_center|LOCUS_10820 >Feature sequence253 3794 1170 gene locus_tag LOCUS_10830 3794 1170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10830 >Feature sequence254 4012 659 gene locus_tag LOCUS_10840 4012 659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10840 >Feature sequence255 3 1982 gene locus_tag LOCUS_10850 3 1982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10850 2355 2071 gene locus_tag LOCUS_10860 2355 2071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10860 >Feature sequence256 <1 1297 gene locus_tag LOCUS_10870 <1 1297 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010932252.1:FAD-binding oxidoreductase 1406 2575 gene locus_tag LOCUS_10880 gene aroC 1406 2575 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_196768335.1 protein_id gnl|my_center|LOCUS_10880 2695 3210 gene locus_tag LOCUS_10890 gene def 2695 3210 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948295.1 protein_id gnl|my_center|LOCUS_10890 >Feature sequence257 3303 220 gene locus_tag LOCUS_10900 3303 220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10900 >Feature sequence258 <1 637 gene locus_tag LOCUS_10910 <1 637 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011142299.1:VCBS repeat-containing protein 1900 677 gene locus_tag LOCUS_10920 1900 677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10920 3275 2049 gene locus_tag LOCUS_10930 3275 2049 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027385545.1 protein_id gnl|my_center|LOCUS_10930 >Feature sequence259 1 1410 gene locus_tag LOCUS_10940 1 1410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10940 1622 2002 gene locus_tag LOCUS_10950 1622 2002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10950 2208 1999 gene locus_tag LOCUS_10960 2208 1999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140805.1 protein_id gnl|my_center|LOCUS_10960 <4008 2300 gene locus_tag LOCUS_10970 <4008 2300 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010940771.1:DNA polymerase III subunit gamma/tau >Feature sequence260 <1 846 gene locus_tag LOCUS_10980 <1 846 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010939262.1:chaperonin GroEL 1125 3461 gene locus_tag LOCUS_10990 1125 3461 CDS product ATP-dependent Clp protease ATP-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141541.1 protein_id gnl|my_center|LOCUS_10990 >Feature sequence261 873 1352 gene locus_tag LOCUS_11000 873 1352 CDS product roadblock/LC7 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940775.1 protein_id gnl|my_center|LOCUS_11000 1444 2028 gene locus_tag LOCUS_11010 1444 2028 CDS product GTPase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940776.1 protein_id gnl|my_center|LOCUS_11010 2675 2121 gene locus_tag LOCUS_11020 2675 2121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11020 3802 2759 gene locus_tag LOCUS_11030 gene queA 3802 2759 CDS product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460358.1 protein_id gnl|my_center|LOCUS_11030 >Feature sequence262 2340 1321 gene locus_tag LOCUS_11040 gene rtcA 2340 1321 CDS product RNA 3'-terminal phosphate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005052686.1 protein_id gnl|my_center|LOCUS_11040 >Feature sequence263 1586 2752 gene locus_tag LOCUS_11050 1586 2752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11050 2772 3740 gene locus_tag LOCUS_11060 2772 3740 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232632.1 protein_id gnl|my_center|LOCUS_11060 >Feature sequence264 >Feature sequence265 2671 218 gene locus_tag LOCUS_11070 2671 218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11070 2867 3427 gene locus_tag LOCUS_11080 2867 3427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11080 3797 3513 gene locus_tag LOCUS_11090 3797 3513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11090 >Feature sequence266 1155 328 gene locus_tag LOCUS_11100 1155 328 CDS product RDD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256259.1 protein_id gnl|my_center|LOCUS_11100 2810 1239 gene locus_tag LOCUS_11110 2810 1239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11110 <3950 3007 gene locus_tag LOCUS_11120 <3950 3007 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011393211.1:tyrosine--tRNA ligase >Feature sequence267 548 1729 gene locus_tag LOCUS_11130 548 1729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11130 1733 2467 gene locus_tag LOCUS_11140 1733 2467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11140 2523 2804 gene locus_tag LOCUS_11150 2523 2804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11150 3121 3906 gene locus_tag LOCUS_11160 3121 3906 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965188.1 protein_id gnl|my_center|LOCUS_11160 >Feature sequence268 189 1244 gene locus_tag LOCUS_11170 189 1244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11170 2953 1241 gene locus_tag LOCUS_11180 2953 1241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11180 >Feature sequence269 1084 1767 gene locus_tag LOCUS_11190 1084 1767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11190 2458 1892 gene locus_tag LOCUS_11200 2458 1892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11200 3758 2541 gene locus_tag LOCUS_11210 3758 2541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11210 >Feature sequence270 1008 43 gene locus_tag LOCUS_11220 gene trxB 1008 43 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080734.1 protein_id gnl|my_center|LOCUS_11220 1598 1029 gene locus_tag LOCUS_11230 1598 1029 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941339.1 protein_id gnl|my_center|LOCUS_11230 2628 1606 gene locus_tag LOCUS_11240 2628 1606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11240 2727 3059 gene locus_tag LOCUS_11250 2727 3059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11250 3348 3680 gene locus_tag LOCUS_11260 3348 3680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11260 >Feature sequence271 2475 997 gene locus_tag LOCUS_11270 2475 997 CDS product amino acid ABC transporter substrate-binding protein/permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989593.1 protein_id gnl|my_center|LOCUS_11270 3333 2479 gene locus_tag LOCUS_11280 gene yecC 3333 2479 CDS product L-cystine ABC transporter ATP-binding protein YecC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705980.1 protein_id gnl|my_center|LOCUS_11280 >Feature sequence272 440 135 gene locus_tag LOCUS_11290 gene nuoK 440 135 CDS product NADH-quinone oxidoreductase subunit NuoK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941016.1 protein_id gnl|my_center|LOCUS_11290 1124 447 gene locus_tag LOCUS_11300 1124 447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11300 2294 1209 gene locus_tag LOCUS_11310 gene nuoH 2294 1209 CDS product NADH-quinone oxidoreductase subunit NuoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258755.1 protein_id gnl|my_center|LOCUS_11310 <3883 2351 gene locus_tag LOCUS_11320 <3883 2351 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012258754.1:NADH-quinone oxidoreductase subunit NuoG >Feature sequence273 925 1977 gene locus_tag LOCUS_11330 925 1977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11330 2064 3545 gene locus_tag LOCUS_11340 2064 3545 CDS product PD40 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_093950374.1 protein_id gnl|my_center|LOCUS_11340 >Feature sequence274 85 636 gene locus_tag LOCUS_11350 85 636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11350 734 2629 gene locus_tag LOCUS_11360 gene mrdA 734 2629 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942721.1 protein_id gnl|my_center|LOCUS_11360 2707 3828 gene locus_tag LOCUS_11370 gene rodA 2707 3828 CDS product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546334.1 protein_id gnl|my_center|LOCUS_11370 >Feature sequence275 3236 1098 gene locus_tag LOCUS_11380 3236 1098 CDS product bi-domain-containing oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164924817.1 protein_id gnl|my_center|LOCUS_11380 >Feature sequence276 1910 717 gene locus_tag LOCUS_11390 1910 717 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258369.1 protein_id gnl|my_center|LOCUS_11390 3006 1900 gene locus_tag LOCUS_11400 gene menC 3006 1900 CDS product o-succinylbenzoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256750.1 protein_id gnl|my_center|LOCUS_11400 3592 3143 gene locus_tag LOCUS_11410 3592 3143 CDS product SUF system NifU family Fe-S cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141374.1 protein_id gnl|my_center|LOCUS_11410 >Feature sequence277 1691 777 gene locus_tag LOCUS_11420 1691 777 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230883.1 protein_id gnl|my_center|LOCUS_11420 3000 3641 gene locus_tag LOCUS_11430 3000 3641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11430 >Feature sequence278 1210 2283 gene locus_tag LOCUS_11440 gene hppD 1210 2283 CDS product 4-hydroxyphenylpyruvate dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256700.1 protein_id gnl|my_center|LOCUS_11440 2311 3531 gene locus_tag LOCUS_11450 2311 3531 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194779.1 protein_id gnl|my_center|LOCUS_11450 >Feature sequence279 409 170 gene locus_tag LOCUS_11460 409 170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11460 730 1206 gene locus_tag LOCUS_11470 730 1206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11470 2273 1362 gene locus_tag LOCUS_11480 2273 1362 CDS product glutaminyl-peptide cyclotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920502.1 protein_id gnl|my_center|LOCUS_11480 3682 2270 gene locus_tag LOCUS_11490 3682 2270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11490 >Feature sequence280 <1 634 gene locus_tag LOCUS_11500 <1 634 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011068002.1:aminopeptidase P family protein 881 1603 gene locus_tag LOCUS_11510 881 1603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11510 1600 2850 gene locus_tag LOCUS_11520 1600 2850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11520 >Feature sequence281 1751 12 gene locus_tag LOCUS_11530 1751 12 CDS product putative porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112715.1 protein_id gnl|my_center|LOCUS_11530 2078 3733 gene locus_tag LOCUS_11540 2078 3733 CDS product adenylate/guanylate cyclase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257013.1 protein_id gnl|my_center|LOCUS_11540 >Feature sequence282 <1 510 gene locus_tag LOCUS_11550 <1 510 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003813700.1:phosphopyruvate hydratase 536 1018 gene locus_tag LOCUS_11560 536 1018 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704723.1 protein_id gnl|my_center|LOCUS_11560 1020 1244 gene locus_tag LOCUS_11570 1020 1244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11570 1261 2808 gene locus_tag LOCUS_11580 gene gpmI 1261 2808 CDS product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071541097.1 protein_id gnl|my_center|LOCUS_11580 >Feature sequence283 1638 856 gene locus_tag LOCUS_11590 1638 856 CDS product ZIP family metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_057504658.1 protein_id gnl|my_center|LOCUS_11590 2032 2472 gene locus_tag LOCUS_11600 gene mraZ 2032 2472 CDS product division/cell wall cluster transcriptional repressor MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095567.1 protein_id gnl|my_center|LOCUS_11600 2588 3553 gene locus_tag LOCUS_11610 gene rsmH 2588 3553 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943702.1 protein_id gnl|my_center|LOCUS_11610 >Feature sequence284 1920 658 gene locus_tag LOCUS_11620 gene ftsA 1920 658 CDS product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943689.1 protein_id gnl|my_center|LOCUS_11620 3074 1965 gene locus_tag LOCUS_11630 3074 1965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11630 <3833 3071 gene locus_tag LOCUS_11640 <3833 3071 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943692.1:UDP-N-acetylmuramate dehydrogenase >Feature sequence285 25 882 gene locus_tag LOCUS_11650 25 882 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228905.1 protein_id gnl|my_center|LOCUS_11650 1050 3251 gene locus_tag LOCUS_11660 1050 3251 CDS product S46 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_141815383.1 protein_id gnl|my_center|LOCUS_11660 >Feature sequence286 871 1794 gene locus_tag LOCUS_11670 871 1794 CDS product YCF48-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046237280.1 protein_id gnl|my_center|LOCUS_11670 3738 2026 gene locus_tag LOCUS_11680 3738 2026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11680 >Feature sequence287 2982 1804 gene locus_tag LOCUS_11690 2982 1804 CDS product phosphopentomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811028.1 protein_id gnl|my_center|LOCUS_11690 >Feature sequence288 478 1710 gene locus_tag LOCUS_11700 478 1710 CDS product DUF1015 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942916.1 protein_id gnl|my_center|LOCUS_11700 1712 2227 gene locus_tag LOCUS_11710 1712 2227 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_166172348.1 protein_id gnl|my_center|LOCUS_11710 2239 3441 gene locus_tag LOCUS_11720 2239 3441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11720 >Feature sequence289 953 423 gene locus_tag LOCUS_11730 953 423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11730 2637 961 gene locus_tag LOCUS_11740 2637 961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11740 3812 2826 gene locus_tag LOCUS_11750 3812 2826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11750 >Feature sequence290 401 2176 gene locus_tag LOCUS_11760 401 2176 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706430.1 protein_id gnl|my_center|LOCUS_11760 >Feature sequence291 1153 101 gene locus_tag LOCUS_11770 1153 101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11770 <3810 1322 gene locus_tag LOCUS_11780 <3810 1322 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001240970.1:outer membrane protein assembly factor BamA >Feature sequence292 559 1722 gene locus_tag LOCUS_11790 559 1722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11790 1777 2643 gene locus_tag LOCUS_11800 1777 2643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11800 >Feature sequence293 <1 877 gene locus_tag LOCUS_11810 <1 877 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010933683.1:DNA mismatch repair endonuclease MutL 1617 889 gene locus_tag LOCUS_11820 1617 889 CDS product HAD hydrolase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933371.1 protein_id gnl|my_center|LOCUS_11820 2126 1617 gene locus_tag LOCUS_11830 2126 1617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11830 3662 2142 gene locus_tag LOCUS_11840 gene accC 3662 2142 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761157.1 protein_id gnl|my_center|LOCUS_11840 >Feature sequence294 2273 336 gene locus_tag LOCUS_11850 2273 336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11850 3103 2348 gene locus_tag LOCUS_11860 gene pgl 3103 2348 CDS product 6-phosphogluconolactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143172.1 protein_id gnl|my_center|LOCUS_11860 <3803 3100 gene locus_tag LOCUS_11870 <3803 3100 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011141169.1:glucokinase >Feature sequence295 326 1144 gene locus_tag LOCUS_11880 326 1144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11880 1272 2039 gene locus_tag LOCUS_11890 1272 2039 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224130.1 protein_id gnl|my_center|LOCUS_11890 >Feature sequence296 <1 719 gene locus_tag LOCUS_11900 <1 719 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008762240.1:inositol-3-phosphate synthase 1161 2369 gene locus_tag LOCUS_11910 1161 2369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11910 3088 2450 gene locus_tag LOCUS_11920 3088 2450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11920 3586 3323 gene locus_tag LOCUS_11930 3586 3323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11930 >Feature sequence297 <3785 903 gene locus_tag LOCUS_11940 <3785 903 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000060812.1:autotransporter assembly complex protein TamB >Feature sequence298 <1 830 gene locus_tag LOCUS_11950 <1 830 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_153018271.1:ABC transporter ATP-binding protein 827 1303 gene locus_tag LOCUS_11960 827 1303 CDS product DUF402 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003223272.1 protein_id gnl|my_center|LOCUS_11960 1333 2154 gene locus_tag LOCUS_11970 1333 2154 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545091.1 protein_id gnl|my_center|LOCUS_11970 >Feature sequence299 281 916 gene locus_tag LOCUS_11980 281 916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11980 1272 1066 gene locus_tag LOCUS_11990 gene cspB 1272 1066 CDS product cold shock-like protein CspB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001161731.1 protein_id gnl|my_center|LOCUS_11990 >Feature sequence300 1129 236 gene locus_tag LOCUS_12000 1129 236 CDS product 3-hydroxybutyryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173325.1 protein_id gnl|my_center|LOCUS_12000 2381 1197 gene locus_tag LOCUS_12010 2381 1197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12010 >Feature sequence301 862 1242 gene locus_tag LOCUS_12020 862 1242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12020 1246 1527 gene locus_tag LOCUS_12030 1246 1527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12030 1555 2127 gene locus_tag LOCUS_12040 gene efp 1555 2127 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545338.1 protein_id gnl|my_center|LOCUS_12040 3163 2219 gene locus_tag LOCUS_12050 3163 2219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12050 >Feature sequence302 1094 1933 gene locus_tag LOCUS_12060 1094 1933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12060 >Feature sequence303 69 890 gene locus_tag LOCUS_12070 gene gvpL 69 890 CDS product gas vesicle protein GvpL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890528.1 protein_id gnl|my_center|LOCUS_12070 1494 1829 gene locus_tag LOCUS_12080 1494 1829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12080 >Feature sequence304 946 335 gene locus_tag LOCUS_12090 946 335 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583208.1 protein_id gnl|my_center|LOCUS_12090 2026 1076 gene locus_tag LOCUS_12100 2026 1076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12100 2572 2084 gene locus_tag LOCUS_12110 2572 2084 CDS product prepilin-type N-terminal cleavage/methylation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942420.1 protein_id gnl|my_center|LOCUS_12110 3332 2562 gene locus_tag LOCUS_12120 3332 2562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12120 >Feature sequence305 <1 963 gene locus_tag LOCUS_12130 <1 963 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010881258.1:hydantoinase B/oxoprolinase family protein 2208 1447 gene locus_tag LOCUS_12140 gene fabG 2208 1447 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000911782.1 protein_id gnl|my_center|LOCUS_12140 3097 2228 gene locus_tag LOCUS_12150 gene galU 3097 2228 CDS product UTP--glucose-1-phosphate uridylyltransferase GalU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941523.1 protein_id gnl|my_center|LOCUS_12150 >Feature sequence306 736 512 gene locus_tag LOCUS_12160 736 512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12160 2730 2035 gene locus_tag LOCUS_12170 2730 2035 CDS product FAD/NAD(P)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392335.1 protein_id gnl|my_center|LOCUS_12170 >Feature sequence307 1 1209 gene locus_tag LOCUS_12180 1 1209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12180 >Feature sequence308 628 1653 gene locus_tag LOCUS_12190 gene waaF 628 1653 CDS product lipopolysaccharide heptosyltransferase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942896.1 protein_id gnl|my_center|LOCUS_12190 1680 3317 gene locus_tag LOCUS_12200 gene dacB 1680 3317 CDS product D-alanyl-D-alanine carboxypeptidase/D-alanyl-D-alanine-endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839168.1 protein_id gnl|my_center|LOCUS_12200 >Feature sequence309 3223 1127 gene locus_tag LOCUS_12210 3223 1127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12210 >Feature sequence310 1414 2964 gene locus_tag LOCUS_12220 1414 2964 CDS product M28 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073369.1 protein_id gnl|my_center|LOCUS_12220 >Feature sequence311 473 1075 gene locus_tag LOCUS_12230 473 1075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12230 1191 2966 gene locus_tag LOCUS_12240 1191 2966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12240 3097 3594 gene locus_tag LOCUS_12250 3097 3594 CDS product Rab family GTPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257121.1 protein_id gnl|my_center|LOCUS_12250 >Feature sequence312 640 1281 gene locus_tag LOCUS_12260 640 1281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12260 2838 1285 gene locus_tag LOCUS_12270 2838 1285 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016360.1 protein_id gnl|my_center|LOCUS_12270 <3725 2838 gene locus_tag LOCUS_12280 <3725 2838 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011403151.1:glycoside hydrolase family 3 N-terminal domain-containing protein >Feature sequence313 1151 1336 gene locus_tag LOCUS_12290 1151 1336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12290 2282 1329 gene locus_tag LOCUS_12300 gene ribF 2282 1329 CDS product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102619.1 protein_id gnl|my_center|LOCUS_12300 3125 2358 gene locus_tag LOCUS_12310 3125 2358 CDS product GPMC system MBL fold metallohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943103.1 protein_id gnl|my_center|LOCUS_12310 <3723 3141 gene locus_tag LOCUS_12320 <3723 3141 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010937799.1:DUF1844 domain-containing protein >Feature sequence314 306 2099 gene locus_tag LOCUS_12330 306 2099 CDS product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963871.1 protein_id gnl|my_center|LOCUS_12330 >Feature sequence315 155 826 gene locus_tag LOCUS_12340 155 826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258031.1 protein_id gnl|my_center|LOCUS_12340 845 1147 gene locus_tag LOCUS_12350 845 1147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12350 1155 2318 gene locus_tag LOCUS_12360 1155 2318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12360 2318 2944 gene locus_tag LOCUS_12370 2318 2944 CDS product phage baseplate assembly protein V inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258034.1 protein_id gnl|my_center|LOCUS_12370 2948 3280 gene locus_tag LOCUS_12380 2948 3280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258035.1 protein_id gnl|my_center|LOCUS_12380 3297 3677 gene locus_tag LOCUS_12390 3297 3677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12390 >Feature sequence316 <1 1043 gene locus_tag LOCUS_12400 <1 1043 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011389862.1:ATP-dependent Clp protease ATP-binding subunit ClpA 1100 1753 gene locus_tag LOCUS_12410 gene aat 1100 1753 CDS product leucyl/phenylalanyl-tRNA--protein transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938894.1 protein_id gnl|my_center|LOCUS_12410 1768 2439 gene locus_tag LOCUS_12420 1768 2439 CDS product YceH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940907.1 protein_id gnl|my_center|LOCUS_12420 2497 2982 gene locus_tag LOCUS_12430 2497 2982 CDS product isoprenylcysteine carboxylmethyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197535734.1 protein_id gnl|my_center|LOCUS_12430 >Feature sequence317 325 1116 gene locus_tag LOCUS_12440 325 1116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12440 2913 1198 gene locus_tag LOCUS_12450 2913 1198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12450 >Feature sequence318 1894 314 gene locus_tag LOCUS_12460 gene atpA 1894 314 CDS product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940787.1 protein_id gnl|my_center|LOCUS_12460 2457 1912 gene locus_tag LOCUS_12470 gene atpH 2457 1912 CDS product ATP synthase F1 subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940786.1 protein_id gnl|my_center|LOCUS_12470 3014 2454 gene locus_tag LOCUS_12480 3014 2454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12480 3509 3024 gene locus_tag LOCUS_12490 3509 3024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12490 >Feature sequence319 <1 1251 gene locus_tag LOCUS_12500 <1 1251 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941018.1:NADH-quinone oxidoreductase subunit M 1277 1849 gene locus_tag LOCUS_12510 1277 1849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12510 1855 3429 gene locus_tag LOCUS_12520 1855 3429 CDS product NADH-quinone oxidoreductase subunit N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941019.1 protein_id gnl|my_center|LOCUS_12520 >Feature sequence320 1005 697 gene locus_tag LOCUS_12530 1005 697 CDS product ferritin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080895.1 protein_id gnl|my_center|LOCUS_12530 1192 2001 gene locus_tag LOCUS_12540 1192 2001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12540 3298 2075 gene locus_tag LOCUS_12550 gene alr 3298 2075 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941268.1 protein_id gnl|my_center|LOCUS_12550 >Feature sequence321 <1 1603 gene locus_tag LOCUS_12560 <1 1603 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011404654.1:TonB-dependent receptor 1770 2597 gene locus_tag LOCUS_12570 1770 2597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12570 2707 3666 gene locus_tag LOCUS_12580 2707 3666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12580 >Feature sequence322 1443 64 gene locus_tag LOCUS_12590 1443 64 CDS product D-alanyl-D-alanine carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057931.1 protein_id gnl|my_center|LOCUS_12590 1669 2346 gene locus_tag LOCUS_12600 1669 2346 CDS product N-glycosylase/DNA lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016533.1 protein_id gnl|my_center|LOCUS_12600 >Feature sequence323 513 872 gene locus_tag LOCUS_12610 513 872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12610 1269 1730 gene locus_tag LOCUS_12620 1269 1730 CDS product DUF1697 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002666760.1 protein_id gnl|my_center|LOCUS_12620 1830 2501 gene locus_tag LOCUS_12630 1830 2501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12630 2511 2888 gene locus_tag LOCUS_12640 2511 2888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12640 3559 2918 gene locus_tag LOCUS_12650 3559 2918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12650 >Feature sequence324 222 830 gene locus_tag LOCUS_12660 222 830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12660 2341 905 gene locus_tag LOCUS_12670 2341 905 CDS product mechanosensitive ion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704452.1 protein_id gnl|my_center|LOCUS_12670 <3663 2535 gene locus_tag LOCUS_12680 <3663 2535 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010966601.1:Nramp family divalent metal transporter >Feature sequence325 1321 446 gene locus_tag LOCUS_12690 1321 446 CDS product S-methyl-5'-thioadenosine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142419.1 protein_id gnl|my_center|LOCUS_12690 2180 1329 gene locus_tag LOCUS_12700 2180 1329 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479789.1 protein_id gnl|my_center|LOCUS_12700 <3660 2190 gene locus_tag LOCUS_12710 <3660 2190 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_009892066.1:peptidylprolyl isomerase >Feature sequence326 >Feature sequence327 221 2131 gene locus_tag LOCUS_12720 221 2131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12720 >Feature sequence328 <1 584 gene locus_tag LOCUS_12730 <1 584 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943812.1:thiamine-phosphate kinase 663 2069 gene locus_tag LOCUS_12740 gene cysS 663 2069 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869759.1 protein_id gnl|my_center|LOCUS_12740 >Feature sequence329 275 1525 gene locus_tag LOCUS_12750 275 1525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12750 1522 2910 gene locus_tag LOCUS_12760 1522 2910 CDS product Nramp family divalent metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966601.1 protein_id gnl|my_center|LOCUS_12760 <3621 2806 gene locus_tag LOCUS_12770 <3621 2806 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015944761.1:ribonuclease HII >Feature sequence330 <1 1936 gene locus_tag LOCUS_12780 <1 1936 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011393458.1:xanthine dehydrogenase molybdenum-binding subunit XdhA 1989 2450 gene locus_tag LOCUS_12790 1989 2450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12790 2474 3463 gene locus_tag LOCUS_12800 2474 3463 CDS product xanthine dehydrogenase family protein subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268938.1 protein_id gnl|my_center|LOCUS_12800 >Feature sequence331 1191 337 gene locus_tag LOCUS_12810 1191 337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12810 1359 2783 gene locus_tag LOCUS_12820 1359 2783 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000716439.1 protein_id gnl|my_center|LOCUS_12820 >Feature sequence332 622 194 gene locus_tag LOCUS_12830 622 194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12830 1348 827 gene locus_tag LOCUS_12840 1348 827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143103.1 protein_id gnl|my_center|LOCUS_12840 2684 1446 gene locus_tag LOCUS_12850 2684 1446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12850 2913 2710 gene locus_tag LOCUS_12860 2913 2710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12860 3115 3528 gene locus_tag LOCUS_12870 3115 3528 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224021.1 protein_id gnl|my_center|LOCUS_12870 >Feature sequence333 1033 533 gene locus_tag LOCUS_12880 1033 533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12880 1955 1023 gene locus_tag LOCUS_12890 1955 1023 CDS product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972240.1 protein_id gnl|my_center|LOCUS_12890 2156 3568 gene locus_tag LOCUS_12900 2156 3568 CDS product RNB domain-containing ribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932680.1 protein_id gnl|my_center|LOCUS_12900 >Feature sequence334 569 1993 gene locus_tag LOCUS_12910 gene selA 569 1993 CDS product L-seryl-tRNA(Sec) selenium transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897684.1 protein_id gnl|my_center|LOCUS_12910 3019 2102 gene locus_tag LOCUS_12920 3019 2102 CDS product sucrase ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030485.1 protein_id gnl|my_center|LOCUS_12920 >Feature sequence335 938 423 gene locus_tag LOCUS_12930 938 423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12930 1353 940 gene locus_tag LOCUS_12940 1353 940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12940 1571 1359 gene locus_tag LOCUS_12950 1571 1359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12950 2798 1581 gene locus_tag LOCUS_12960 2798 1581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12960 3271 2813 gene locus_tag LOCUS_12970 3271 2813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12970 >Feature sequence336 2715 1288 gene locus_tag LOCUS_12980 2715 1288 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197530044.1 protein_id gnl|my_center|LOCUS_12980 >Feature sequence337 1515 856 gene locus_tag LOCUS_12990 1515 856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12990 1993 2325 gene locus_tag LOCUS_13000 1993 2325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13000 2421 3269 gene locus_tag LOCUS_13010 2421 3269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13010 3466 3281 gene locus_tag LOCUS_13020 3466 3281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13020 >Feature sequence338 898 113 gene locus_tag LOCUS_13030 gene sdhB 898 113 CDS product succinate dehydrogenase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000139712.1 protein_id gnl|my_center|LOCUS_13030 2916 895 gene locus_tag LOCUS_13040 gene sdhA 2916 895 CDS product succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000676737.1 protein_id gnl|my_center|LOCUS_13040 <3573 2916 gene locus_tag LOCUS_13050 <3573 2916 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000678351.1:succinate dehydrogenase cytochrome B558 >Feature sequence339 <1 1228 gene locus_tag LOCUS_13060 <1 1228 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012256201.1:CSLREA domain-containing protein 2675 1320 gene locus_tag LOCUS_13070 2675 1320 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546604.1 protein_id gnl|my_center|LOCUS_13070 <3572 2668 gene locus_tag LOCUS_13080 <3572 2668 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941478.1:ATP-binding protein >Feature sequence340 1585 2598 gene locus_tag LOCUS_13090 1585 2598 CDS product chemotaxis protein CheB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970589.1 protein_id gnl|my_center|LOCUS_13090 >Feature sequence341 527 129 gene locus_tag LOCUS_13100 527 129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13100 886 587 gene locus_tag LOCUS_13110 886 587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13110 1555 1013 gene locus_tag LOCUS_13120 1555 1013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13120 2296 1703 gene locus_tag LOCUS_13130 2296 1703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13130 2673 2293 gene locus_tag LOCUS_13140 2673 2293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13140 3481 2726 gene locus_tag LOCUS_13150 3481 2726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13150 >Feature sequence342 1339 359 gene locus_tag LOCUS_13160 1339 359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13160 1905 1336 gene locus_tag LOCUS_13170 1905 1336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13170 3126 1927 gene locus_tag LOCUS_13180 3126 1927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256522.1 protein_id gnl|my_center|LOCUS_13180 >Feature sequence343 <1 1756 gene locus_tag LOCUS_13190 <1 1756 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941262.1:ATP-binding protein 1756 2220 gene locus_tag LOCUS_13200 1756 2220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13200 >Feature sequence344 <1 1638 gene locus_tag LOCUS_13210 <1 1638 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_118827098.1:ABC transporter ATP-binding protein 1644 2336 gene locus_tag LOCUS_13220 1644 2336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964282.1 protein_id gnl|my_center|LOCUS_13220 3464 2421 gene locus_tag LOCUS_13230 3464 2421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13230 >Feature sequence345 1107 322 gene locus_tag LOCUS_13240 gene rfbF 1107 322 CDS product glucose-1-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261038.1 protein_id gnl|my_center|LOCUS_13240 2828 1293 gene locus_tag LOCUS_13250 2828 1293 CDS product oligosaccharide flippase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143842.1 protein_id gnl|my_center|LOCUS_13250 <3541 2835 gene locus_tag LOCUS_13260 <3541 2835 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012546515.1:glycosyltransferase family 4 protein >Feature sequence346 1375 824 gene locus_tag LOCUS_13270 1375 824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13270 2058 1372 gene locus_tag LOCUS_13280 2058 1372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13280 2633 2055 gene locus_tag LOCUS_13290 2633 2055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13290 <3540 2673 gene locus_tag LOCUS_13300 <3540 2673 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012583296.1:asparagine--tRNA ligase >Feature sequence347 464 1144 gene locus_tag LOCUS_13310 464 1144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13310 1650 1228 gene locus_tag LOCUS_13320 1650 1228 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140146.1 protein_id gnl|my_center|LOCUS_13320 2820 1798 gene locus_tag LOCUS_13330 2820 1798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13330 >Feature sequence348 <1 517 gene locus_tag LOCUS_13340 <1 517 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011086368.1:type VI secretion system ATPase TssH 541 1827 gene locus_tag LOCUS_13350 541 1827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13350 >Feature sequence349 220 1194 gene locus_tag LOCUS_13360 220 1194 CDS product DUF1702 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_086861803.1 protein_id gnl|my_center|LOCUS_13360 1191 3194 gene locus_tag LOCUS_13370 1191 3194 CDS product CRTAC1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228637.1 protein_id gnl|my_center|LOCUS_13370 >Feature sequence350 562 1332 gene locus_tag LOCUS_13380 562 1332 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941592.1 protein_id gnl|my_center|LOCUS_13380 1365 2282 gene locus_tag LOCUS_13390 1365 2282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13390 >Feature sequence351 1230 277 gene locus_tag LOCUS_13400 1230 277 CDS product phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083752.1 protein_id gnl|my_center|LOCUS_13400 1514 2056 gene locus_tag LOCUS_13410 1514 2056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13410 2929 2147 gene locus_tag LOCUS_13420 2929 2147 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119176.1 protein_id gnl|my_center|LOCUS_13420 >Feature sequence352 35 1429 gene locus_tag LOCUS_13430 35 1429 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037400962.1 protein_id gnl|my_center|LOCUS_13430 3247 1703 gene locus_tag LOCUS_13440 3247 1703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13440 >Feature sequence353 1218 1823 gene locus_tag LOCUS_13450 1218 1823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13450 1869 2270 gene locus_tag LOCUS_13460 1869 2270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13460 >Feature sequence354 736 482 gene locus_tag LOCUS_13470 736 482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13470 942 2081 gene locus_tag LOCUS_13480 942 2081 CDS product bifunctional cystathionine gamma-lyase/homocysteine desulfhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001201906.1 protein_id gnl|my_center|LOCUS_13480 >Feature sequence355 >Feature sequence356 <1 1785 gene locus_tag LOCUS_13490 <1 1785 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003810664.1:alanine--tRNA ligase 2293 1937 gene locus_tag LOCUS_13500 2293 1937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13500 2564 3385 gene locus_tag LOCUS_13510 2564 3385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13510 >Feature sequence357 <1 671 gene locus_tag LOCUS_13520 <1 671 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000056892.1:D-2-hydroxyacid dehydrogenase 793 1629 gene locus_tag LOCUS_13530 793 1629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13530 1989 1720 gene locus_tag LOCUS_13540 1989 1720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13540 <3477 2099 gene locus_tag LOCUS_13550 <3477 2099 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012048419.1:S8 family serine peptidase >Feature sequence358 1087 584 gene locus_tag LOCUS_13560 1087 584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13560 3183 1129 gene locus_tag LOCUS_13570 gene uvrC 3183 1129 CDS product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963830.1 protein_id gnl|my_center|LOCUS_13570 >Feature sequence359 <1 1362 gene locus_tag LOCUS_13580 <1 1362 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942302.1:diguanylate cyclase 1523 2569 gene locus_tag LOCUS_13590 1523 2569 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942731.1 protein_id gnl|my_center|LOCUS_13590 >Feature sequence360 1932 178 gene locus_tag LOCUS_13600 1932 178 CDS product lytic transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941675.1 protein_id gnl|my_center|LOCUS_13600 <3468 2343 gene locus_tag LOCUS_13610 <3468 2343 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012545466.1:endopeptidase La >Feature sequence361 >Feature sequence362 180 1538 gene locus_tag LOCUS_13620 180 1538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13620 1551 2420 gene locus_tag LOCUS_13630 1551 2420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13630 >Feature sequence363 364 930 gene locus_tag LOCUS_13640 364 930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13640 1719 1015 gene locus_tag LOCUS_13650 1719 1015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13650 2183 1734 gene locus_tag LOCUS_13660 gene dtd 2183 1734 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460350.1 protein_id gnl|my_center|LOCUS_13660 3240 2188 gene locus_tag LOCUS_13670 3240 2188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13670 >Feature sequence364 919 140 gene locus_tag LOCUS_13680 gene ygiD 919 140 CDS product 4,5-DOPA dioxygenase extradiol inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174107.1 protein_id gnl|my_center|LOCUS_13680 1084 1461 gene locus_tag LOCUS_13690 1084 1461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13690 1544 1942 gene locus_tag LOCUS_13700 1544 1942 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969399.1 protein_id gnl|my_center|LOCUS_13700 2965 1946 gene locus_tag LOCUS_13710 2965 1946 CDS product PA0069 family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035273.1 protein_id gnl|my_center|LOCUS_13710 3274 3089 gene locus_tag LOCUS_13720 3274 3089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13720 >Feature sequence365 496 1179 gene locus_tag LOCUS_13730 496 1179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13730 1294 2037 gene locus_tag LOCUS_13740 1294 2037 CDS product TlyA family rRNA (cytidine-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942068.1 protein_id gnl|my_center|LOCUS_13740 2519 3127 gene locus_tag LOCUS_13750 2519 3127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13750 >Feature sequence366 1439 189 gene locus_tag LOCUS_13760 1439 189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13760 >Feature sequence367 1701 25 gene locus_tag LOCUS_13770 1701 25 CDS product M28 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265906.1 protein_id gnl|my_center|LOCUS_13770 2321 1716 gene locus_tag LOCUS_13780 gene folE 2321 1716 CDS product GTP cyclohydrolase I FolE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003225516.1 protein_id gnl|my_center|LOCUS_13780 <3436 2433 gene locus_tag LOCUS_13790 <3436 2433 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012583893.1:nickel pincer cofactor biosynthesis protein LarC >Feature sequence368 44 448 gene locus_tag LOCUS_13800 44 448 CDS product PIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142424.1 protein_id gnl|my_center|LOCUS_13800 473 688 gene locus_tag LOCUS_13810 473 688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13810 788 1186 gene locus_tag LOCUS_13820 788 1186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13820 1190 2089 gene locus_tag LOCUS_13830 1190 2089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13830 2397 2729 gene locus_tag LOCUS_13840 2397 2729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13840 <3425 2825 gene locus_tag LOCUS_13850 <3425 2825 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012259421.1:FAD-dependent oxidoreductase >Feature sequence369 767 2407 gene locus_tag LOCUS_13860 767 2407 CDS product PDZ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259046.1 protein_id gnl|my_center|LOCUS_13860 <3407 2596 gene locus_tag LOCUS_13870 <3407 2596 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012545034.1:diacylglycerol kinase family lipid kinase >Feature sequence370 459 70 gene locus_tag LOCUS_13880 gene rplL 459 70 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393946.1 protein_id gnl|my_center|LOCUS_13880 1228 689 gene locus_tag LOCUS_13890 gene rplJ 1228 689 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001832306.1 protein_id gnl|my_center|LOCUS_13890 1942 1247 gene locus_tag LOCUS_13900 gene rplA 1942 1247 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870242.1 protein_id gnl|my_center|LOCUS_13900 2462 2037 gene locus_tag LOCUS_13910 gene rplK 2462 2037 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003806886.1 protein_id gnl|my_center|LOCUS_13910 3122 2562 gene locus_tag LOCUS_13920 gene nusG 3122 2562 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525645.1 protein_id gnl|my_center|LOCUS_13920 >Feature sequence371 1526 396 gene locus_tag LOCUS_13930 gene pdhA 1526 396 CDS product pyruvate dehydrogenase (acetyl-transferring) E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943082.1 protein_id gnl|my_center|LOCUS_13930 <3404 1725 gene locus_tag LOCUS_13940 <3404 1725 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012256431.1:PAS domain-containing protein >Feature sequence372 1022 1747 gene locus_tag LOCUS_13950 1022 1747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13950 >Feature sequence373 152 640 gene locus_tag LOCUS_13960 152 640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13960 2104 731 gene locus_tag LOCUS_13970 gene zraR 2104 731 CDS product sigma-54-dependent response regulator transcription factor ZraR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000148535.1 protein_id gnl|my_center|LOCUS_13970 <3393 2141 gene locus_tag LOCUS_13980 <3393 2141 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941439.1:cache domain-containing protein >Feature sequence374 1 3345 gene locus_tag LOCUS_13990 1 3345 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388324.1 protein_id gnl|my_center|LOCUS_13990 >Feature sequence375 >Feature sequence376 >Feature sequence377 1951 908 gene locus_tag LOCUS_14000 1951 908 CDS product YVTN family beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532045.1 protein_id gnl|my_center|LOCUS_14000 2273 1941 gene locus_tag LOCUS_14010 2273 1941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533179.1 protein_id gnl|my_center|LOCUS_14010 2644 2279 gene locus_tag LOCUS_14020 2644 2279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533180.1 protein_id gnl|my_center|LOCUS_14020 <3372 2641 gene locus_tag LOCUS_14030 <3372 2641 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013533181.1:Nramp family divalent metal transporter >Feature sequence378 <1 2350 gene locus_tag LOCUS_14040 <1 2350 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011143725.1:PAS domain-containing protein >Feature sequence379 137 1711 gene locus_tag LOCUS_14050 137 1711 CDS product glycine betaine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986277.1 protein_id gnl|my_center|LOCUS_14050 2201 1803 gene locus_tag LOCUS_14060 2201 1803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14060 >Feature sequence380 <1 1812 gene locus_tag LOCUS_14070 <1 1812 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_081361214.1:sigma 54-interacting transcriptional regulator >Feature sequence381 1841 1140 gene locus_tag LOCUS_14080 1841 1140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14080 3203 1932 gene locus_tag LOCUS_14090 3203 1932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14090 >Feature sequence382 <1 774 gene locus_tag LOCUS_14100 <1 774 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257128.1:thioredoxin domain-containing protein 1654 785 gene locus_tag LOCUS_14110 1654 785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14110 2078 1734 gene locus_tag LOCUS_14120 2078 1734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14120 >Feature sequence383 1116 799 gene locus_tag LOCUS_14130 1116 799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14130 2914 1142 gene locus_tag LOCUS_14140 2914 1142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14140 >Feature sequence384 1974 415 gene locus_tag LOCUS_14150 1974 415 CDS product pyridoxal-dependent decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532193.1 protein_id gnl|my_center|LOCUS_14150 2138 3259 gene locus_tag LOCUS_14160 2138 3259 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880158.1 protein_id gnl|my_center|LOCUS_14160 >Feature sequence385 838 2244 gene locus_tag LOCUS_14170 838 2244 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941790.1 protein_id gnl|my_center|LOCUS_14170 >Feature sequence386 361 603 gene locus_tag LOCUS_14180 361 603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14180 2297 771 gene locus_tag LOCUS_14190 2297 771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14190 3351 2380 gene locus_tag LOCUS_14200 3351 2380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14200 >Feature sequence387 166 1941 gene locus_tag LOCUS_14210 166 1941 CDS product chloride channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_111158892.1 protein_id gnl|my_center|LOCUS_14210 3057 1954 gene locus_tag LOCUS_14220 3057 1954 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021256.1 protein_id gnl|my_center|LOCUS_14220 >Feature sequence388 695 120 gene locus_tag LOCUS_14230 695 120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14230 2027 732 gene locus_tag LOCUS_14240 2027 732 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140123.1 protein_id gnl|my_center|LOCUS_14240 2866 2024 gene locus_tag LOCUS_14250 2866 2024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14250 >Feature sequence389 682 215 gene locus_tag LOCUS_14260 682 215 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050984093.1 protein_id gnl|my_center|LOCUS_14260 978 902 gene locus_tag LOCUS_t00080 978 902 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 2073 1090 gene locus_tag LOCUS_14270 2073 1090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14270 2991 2365 gene locus_tag LOCUS_14280 2991 2365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14280 >Feature sequence390 1605 1084 gene locus_tag LOCUS_14290 1605 1084 CDS product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426450.1 protein_id gnl|my_center|LOCUS_14290 1983 1708 gene locus_tag LOCUS_14300 1983 1708 CDS product acylphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259430.1 protein_id gnl|my_center|LOCUS_14300 2268 2026 gene locus_tag LOCUS_14310 2268 2026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14310 3063 2293 gene locus_tag LOCUS_14320 3063 2293 CDS product chlorite dismutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017869292.1 protein_id gnl|my_center|LOCUS_14320 >Feature sequence391 104 409 gene locus_tag LOCUS_14330 104 409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14330 446 2044 gene locus_tag LOCUS_14340 446 2044 CDS product chemotaxis protein CheA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942862.1 protein_id gnl|my_center|LOCUS_14340 2146 2787 gene locus_tag LOCUS_14350 2146 2787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14350 >Feature sequence392 681 289 gene locus_tag LOCUS_14360 gene gcvH 681 289 CDS product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964219.1 protein_id gnl|my_center|LOCUS_14360 1868 813 gene locus_tag LOCUS_14370 gene gcvT 1868 813 CDS product glycine cleavage system aminomethyltransferase GcvT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460676.1 protein_id gnl|my_center|LOCUS_14370 2934 2143 gene locus_tag LOCUS_14380 2934 2143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14380 >Feature sequence393 474 1097 gene locus_tag LOCUS_14390 gene lexA 474 1097 CDS product transcriptional repressor LexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080401.1 protein_id gnl|my_center|LOCUS_14390 1368 2459 gene locus_tag LOCUS_14400 1368 2459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14400 2810 3064 gene locus_tag LOCUS_14410 2810 3064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14410 3192 3117 gene locus_tag LOCUS_t00090 3192 3117 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence394 <1 2791 gene locus_tag LOCUS_14420 <1 2791 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_118838180.1:hybrid sensor histidine kinase/response regulator >Feature sequence395 1642 227 gene locus_tag LOCUS_14430 1642 227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14430 2191 1679 gene locus_tag LOCUS_14440 2191 1679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14440 <3305 2296 gene locus_tag LOCUS_14450 <3305 2296 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012256639.1:protein kinase >Feature sequence396 2585 1083 gene locus_tag LOCUS_14460 2585 1083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14460 <3303 2610 gene locus_tag LOCUS_14470 <3303 2610 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011123819.1:polysaccharide deacetylase family protein >Feature sequence397 <1 2319 gene locus_tag LOCUS_14480 <1 2319 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015154897.1:TonB-dependent siderophore receptor >Feature sequence398 <1 572 gene locus_tag LOCUS_14490 <1 572 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011461367.1:amidohydrolase 701 1366 gene locus_tag LOCUS_14500 701 1366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14500 1732 1403 gene locus_tag LOCUS_14510 1732 1403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14510 >Feature sequence399 <1 684 gene locus_tag LOCUS_14520 <1 684 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010965265.1:bifunctional metallophosphatase/5'-nucleotidase 1265 807 gene locus_tag LOCUS_14530 1265 807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14530 >Feature sequence400 1147 1791 gene locus_tag LOCUS_14540 1147 1791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14540 1788 2546 gene locus_tag LOCUS_14550 1788 2546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14550 >Feature sequence401 248 868 gene locus_tag LOCUS_14560 248 868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14560 964 1638 gene locus_tag LOCUS_14570 964 1638 CDS product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812028.1 protein_id gnl|my_center|LOCUS_14570 1761 2168 gene locus_tag LOCUS_14580 1761 2168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14580 2174 2249 gene locus_tag LOCUS_t00100 2174 2249 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 2669 3232 gene locus_tag LOCUS_14590 2669 3232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14590 >Feature sequence402 >Feature sequence403 1899 2765 gene locus_tag LOCUS_14600 1899 2765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14600 >Feature sequence404 283 1302 gene locus_tag LOCUS_14610 gene aroF 283 1302 CDS product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943946.1 protein_id gnl|my_center|LOCUS_14610 1406 2395 gene locus_tag LOCUS_14620 1406 2395 CDS product NDP-sugar synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143692.1 protein_id gnl|my_center|LOCUS_14620 >Feature sequence405 2867 1794 gene locus_tag LOCUS_14630 2867 1794 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103036621.1 protein_id gnl|my_center|LOCUS_14630 >Feature sequence406 1125 244 gene locus_tag LOCUS_14640 1125 244 CDS product phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001224475.1 protein_id gnl|my_center|LOCUS_14640 1845 1162 gene locus_tag LOCUS_14650 1845 1162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14650 1963 2307 gene locus_tag LOCUS_14660 gene trxA 1963 2307 CDS product thioredoxin TrxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070766.1 protein_id gnl|my_center|LOCUS_14660 >Feature sequence407 522 115 gene locus_tag LOCUS_14670 522 115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14670 2618 759 gene locus_tag LOCUS_14680 2618 759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14680 >Feature sequence408 924 160 gene locus_tag LOCUS_14690 924 160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14690 1181 1393 gene locus_tag LOCUS_14700 1181 1393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14700 2147 1713 gene locus_tag LOCUS_14710 2147 1713 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118829160.1 protein_id gnl|my_center|LOCUS_14710 2923 2144 gene locus_tag LOCUS_14720 2923 2144 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256896.1 protein_id gnl|my_center|LOCUS_14720 >Feature sequence409 707 9 gene locus_tag LOCUS_14730 707 9 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14730 2634 793 gene locus_tag LOCUS_14740 2634 793 CDS product multicopper oxidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011971066.1 protein_id gnl|my_center|LOCUS_14740 >Feature sequence410 1661 225 gene locus_tag LOCUS_14750 1661 225 CDS product FAD-linked oxidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943908.1 protein_id gnl|my_center|LOCUS_14750 <3232 1821 gene locus_tag LOCUS_14760 <3232 1821 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011013341.1:serine/threonine-protein kinase >Feature sequence411 519 2384 gene locus_tag LOCUS_14770 519 2384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14770 2422 3141 gene locus_tag LOCUS_14780 2422 3141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14780 >Feature sequence412 2521 95 gene locus_tag LOCUS_14790 gene ppsA 2521 95 CDS product phosphoenolpyruvate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056610.1 protein_id gnl|my_center|LOCUS_14790 <3230 2537 gene locus_tag LOCUS_14800 <3230 2537 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_118839369.1:M1 family metallopeptidase >Feature sequence413 128 1273 gene locus_tag LOCUS_14810 128 1273 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887898.1 protein_id gnl|my_center|LOCUS_14810 1355 1933 gene locus_tag LOCUS_14820 1355 1933 CDS product HDIG domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228920.1 protein_id gnl|my_center|LOCUS_14820 2330 1926 gene locus_tag LOCUS_14830 2330 1926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14830 >Feature sequence414 2706 241 gene locus_tag LOCUS_14840 2706 241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14840 3058 2822 gene locus_tag LOCUS_14850 3058 2822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14850 >Feature sequence415 1664 240 gene locus_tag LOCUS_14860 1664 240 CDS product NAD-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142799.1 protein_id gnl|my_center|LOCUS_14860 2949 1822 gene locus_tag LOCUS_14870 2949 1822 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948743.1 protein_id gnl|my_center|LOCUS_14870 >Feature sequence416 192 560 gene locus_tag LOCUS_14880 192 560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14880 679 1899 gene locus_tag LOCUS_14890 679 1899 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142321.1 protein_id gnl|my_center|LOCUS_14890 2413 2811 gene locus_tag LOCUS_14900 2413 2811 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259427.1 protein_id gnl|my_center|LOCUS_14900 3108 2908 gene locus_tag LOCUS_14910 3108 2908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969369.1 protein_id gnl|my_center|LOCUS_14910 >Feature sequence417 1079 1570 gene locus_tag LOCUS_14920 gene def 1079 1570 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694639.1 protein_id gnl|my_center|LOCUS_14920 1585 2067 gene locus_tag LOCUS_14930 1585 2067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14930 2292 2077 gene locus_tag LOCUS_14940 2292 2077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14940 >Feature sequence418 1731 460 gene locus_tag LOCUS_14950 1731 460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14950 2794 2027 gene locus_tag LOCUS_14960 2794 2027 CDS product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976314.1 protein_id gnl|my_center|LOCUS_14960 >Feature sequence419 1321 623 gene locus_tag LOCUS_14970 1321 623 CDS product pirin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141821.1 protein_id gnl|my_center|LOCUS_14970 2668 1370 gene locus_tag LOCUS_14980 2668 1370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14980 >Feature sequence420 >Feature sequence421 <1 1666 gene locus_tag LOCUS_14990 <1 1666 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942526.1:phosphoenolpyruvate--protein phosphotransferase >Feature sequence422 73 1245 gene locus_tag LOCUS_15000 73 1245 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256328.1 protein_id gnl|my_center|LOCUS_15000 >Feature sequence423 1198 242 gene locus_tag LOCUS_15010 1198 242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15010 2066 1245 gene locus_tag LOCUS_15020 2066 1245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15020 2722 2063 gene locus_tag LOCUS_15030 2722 2063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15030 >Feature sequence424 626 48 gene locus_tag LOCUS_15040 626 48 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15040 961 650 gene locus_tag LOCUS_15050 961 650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15050 1427 990 gene locus_tag LOCUS_15060 1427 990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15060 2132 1557 gene locus_tag LOCUS_15070 gene pth 2132 1557 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009892068.1 protein_id gnl|my_center|LOCUS_15070 2837 2196 gene locus_tag LOCUS_15080 2837 2196 CDS product 50S ribosomal protein L25 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546254.1 protein_id gnl|my_center|LOCUS_15080 >Feature sequence425 871 434 gene locus_tag LOCUS_15090 871 434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011971067.1 protein_id gnl|my_center|LOCUS_15090 2988 901 gene locus_tag LOCUS_15100 2988 901 CDS product LodA/GoxA family CTQ-dependent oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119822.1 protein_id gnl|my_center|LOCUS_15100 >Feature sequence426 <3147 800 gene locus_tag LOCUS_15110 <3147 800 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010918869.1:M14 family metallopeptidase >Feature sequence427 1954 257 gene locus_tag LOCUS_15120 1954 257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15120 >Feature sequence428 16 1032 gene locus_tag LOCUS_15130 16 1032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15130 1835 1125 gene locus_tag LOCUS_15140 1835 1125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15140 2293 1919 gene locus_tag LOCUS_15150 2293 1919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15150 <3143 2408 gene locus_tag LOCUS_15160 <3143 2408 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011142299.1:VCBS repeat-containing protein >Feature sequence429 >Feature sequence430 1568 558 gene locus_tag LOCUS_15170 1568 558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15170 2951 1815 gene locus_tag LOCUS_15180 2951 1815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15180 >Feature sequence431 54 422 gene locus_tag LOCUS_15190 54 422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15190 2591 525 gene locus_tag LOCUS_15200 2591 525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15200 >Feature sequence432 2006 495 gene locus_tag LOCUS_15210 2006 495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15210 >Feature sequence433 662 225 gene locus_tag LOCUS_15220 662 225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15220 1054 770 gene locus_tag LOCUS_15230 1054 770 CDS product oxidative damage protection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_044233591.1 protein_id gnl|my_center|LOCUS_15230 1596 1102 gene locus_tag LOCUS_15240 1596 1102 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933657.1 protein_id gnl|my_center|LOCUS_15240 2735 1674 gene locus_tag LOCUS_15250 2735 1674 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930636.1 protein_id gnl|my_center|LOCUS_15250 >Feature sequence434 1365 334 gene locus_tag LOCUS_15260 1365 334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15260 <3125 1773 gene locus_tag LOCUS_15270 <3125 1773 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011142299.1:VCBS repeat-containing protein >Feature sequence435 <1 1625 gene locus_tag LOCUS_15280 <1 1625 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000486377.1:3-hydroxyacyl-CoA dehydrogenase/enoyl-CoA hydratase family protein 1656 2228 gene locus_tag LOCUS_15290 1656 2228 CDS product DinB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962189.1 protein_id gnl|my_center|LOCUS_15290 2245 2745 gene locus_tag LOCUS_15300 2245 2745 CDS product DUF4442 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810105.1 protein_id gnl|my_center|LOCUS_15300 >Feature sequence436 <1 1154 gene locus_tag LOCUS_15310 <1 1154 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010865052.1:ABC transporter ATP-binding protein 1254 2327 gene locus_tag LOCUS_15320 1254 2327 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583515.1 protein_id gnl|my_center|LOCUS_15320 >Feature sequence437 789 145 gene locus_tag LOCUS_15330 789 145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15330 936 1946 gene locus_tag LOCUS_15340 936 1946 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099262600.1 protein_id gnl|my_center|LOCUS_15340 2085 2564 gene locus_tag LOCUS_15350 2085 2564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15350 2565 2966 gene locus_tag LOCUS_15360 2565 2966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15360 >Feature sequence438 <1 592 gene locus_tag LOCUS_15370 <1 592 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011142299.1:VCBS repeat-containing protein 1852 617 gene locus_tag LOCUS_15380 1852 617 CDS product competence/damage-inducible protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071541328.1 protein_id gnl|my_center|LOCUS_15380 <3104 1869 gene locus_tag LOCUS_15390 <3104 1869 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011460521.1:Stk1 family PASTA domain-containing Ser/Thr kinase >Feature sequence439 1248 214 gene locus_tag LOCUS_15400 1248 214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15400 1841 1266 gene locus_tag LOCUS_15410 1841 1266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15410 <3082 2339 gene locus_tag LOCUS_15420 <3082 2339 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_041914012.1:polyribonucleotide nucleotidyltransferase >Feature sequence440 <1 1677 gene locus_tag LOCUS_15430 <1 1677 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_172992225.1:lamin tail domain-containing protein 1923 2543 gene locus_tag LOCUS_15440 1923 2543 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072508.1 protein_id gnl|my_center|LOCUS_15440 >Feature sequence441 <1 1413 gene locus_tag LOCUS_15450 <1 1413 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010940703.1:Tol-Pal system beta propeller repeat protein TolB >Feature sequence442 1803 2255 gene locus_tag LOCUS_15460 gene rpiB 1803 2255 CDS product ribose 5-phosphate isomerase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932728.1 protein_id gnl|my_center|LOCUS_15460 2268 2507 gene locus_tag LOCUS_15470 2268 2507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15470 2497 2937 gene locus_tag LOCUS_15480 2497 2937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15480 >Feature sequence443 550 2619 gene locus_tag LOCUS_15490 550 2619 CDS product S46 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142622.1 protein_id gnl|my_center|LOCUS_15490 >Feature sequence444 463 3021 gene locus_tag LOCUS_15500 gene leuS 463 3021 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942849.1 protein_id gnl|my_center|LOCUS_15500 >Feature sequence445 503 366 gene locus_tag LOCUS_15510 503 366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15510 846 1757 gene locus_tag LOCUS_15520 846 1757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15520 1906 2193 gene locus_tag LOCUS_15530 1906 2193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15530 >Feature sequence446 1088 603 gene locus_tag LOCUS_15540 1088 603 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528705.1 protein_id gnl|my_center|LOCUS_15540 2358 1222 gene locus_tag LOCUS_15550 2358 1222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15550 <3053 2532 gene locus_tag LOCUS_15560 <3053 2532 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257772.1:amidohydrolase family protein >Feature sequence447 <1 1061 gene locus_tag LOCUS_15570 <1 1061 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011144112.1:peptide ABC transporter substrate-binding protein 1759 1055 gene locus_tag LOCUS_15580 1759 1055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15580 1863 2894 gene locus_tag LOCUS_15590 1863 2894 CDS product ligase-associated DNA damage response exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970281.1 protein_id gnl|my_center|LOCUS_15590 >Feature sequence448 <1 562 gene locus_tag LOCUS_15600 <1 562 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963830.1:AMP-dependent synthetase/ligase 753 1871 gene locus_tag LOCUS_15610 753 1871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15610 >Feature sequence449 >Feature sequence450 329 997 gene locus_tag LOCUS_15620 329 997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15620 1241 1372 gene locus_tag LOCUS_15630 1241 1372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15630 1543 2013 gene locus_tag LOCUS_15640 1543 2013 CDS product tRNA (cytidine(34)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941854.1 protein_id gnl|my_center|LOCUS_15640 >Feature sequence451 367 1971 gene locus_tag LOCUS_15650 367 1971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15650 >Feature sequence452 1148 1732 gene locus_tag LOCUS_15660 1148 1732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15660 1772 2236 gene locus_tag LOCUS_15670 1772 2236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15670 2302 2700 gene locus_tag LOCUS_15680 2302 2700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15680 >Feature sequence453 1146 73 gene locus_tag LOCUS_15690 gene amrS 1146 73 CDS product AmmeMemoRadiSam system radical SAM enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228858.1 protein_id gnl|my_center|LOCUS_15690 1208 1873 gene locus_tag LOCUS_15700 1208 1873 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389275.1 protein_id gnl|my_center|LOCUS_15700 2173 1958 gene locus_tag LOCUS_15710 2173 1958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15710 2764 2303 gene locus_tag LOCUS_15720 2764 2303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15720 >Feature sequence454 1614 721 gene locus_tag LOCUS_15730 1614 721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15730 1836 2459 gene locus_tag LOCUS_15740 1836 2459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15740 >Feature sequence455 >Feature sequence456 1538 717 gene locus_tag LOCUS_15750 1538 717 CDS product menaquinone biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922781.1 protein_id gnl|my_center|LOCUS_15750 1713 2318 gene locus_tag LOCUS_15760 1713 2318 CDS product cyclase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943961.1 protein_id gnl|my_center|LOCUS_15760 2343 2780 gene locus_tag LOCUS_15770 2343 2780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15770 >Feature sequence457 403 1422 gene locus_tag LOCUS_15780 403 1422 CDS product zinc metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023149.1 protein_id gnl|my_center|LOCUS_15780 1457 1774 gene locus_tag LOCUS_15790 1457 1774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065638.1 protein_id gnl|my_center|LOCUS_15790 1901 2362 gene locus_tag LOCUS_15800 1901 2362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15800 >Feature sequence458 1346 612 gene locus_tag LOCUS_15810 1346 612 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143646.1 protein_id gnl|my_center|LOCUS_15810 1432 1668 gene locus_tag LOCUS_15820 1432 1668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15820 2832 1813 gene locus_tag LOCUS_15830 2832 1813 CDS product deoxyhypusine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022952.1 protein_id gnl|my_center|LOCUS_15830 >Feature sequence459 <2998 743 gene locus_tag LOCUS_15840 <2998 743 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011142299.1:VCBS repeat-containing protein >Feature sequence460 1571 1200 gene locus_tag LOCUS_15850 1571 1200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15850 <2996 1633 gene locus_tag LOCUS_15860 <2996 1633 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000262844.1:glycosyltransferase family 2 protein >Feature sequence461 1538 948 gene locus_tag LOCUS_15870 1538 948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15870 2896 1541 gene locus_tag LOCUS_15880 2896 1541 CDS product DUF512 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942640.1 protein_id gnl|my_center|LOCUS_15880 >Feature sequence462 226 585 gene locus_tag LOCUS_15890 226 585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15890 710 1987 gene locus_tag LOCUS_15900 gene fabF 710 1987 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392466.1 protein_id gnl|my_center|LOCUS_15900 1984 2748 gene locus_tag LOCUS_15910 1984 2748 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889586.1 protein_id gnl|my_center|LOCUS_15910 >Feature sequence463 204 1205 gene locus_tag LOCUS_15920 204 1205 CDS product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940684.1 protein_id gnl|my_center|LOCUS_15920 1328 1801 gene locus_tag LOCUS_15930 gene smpB 1328 1801 CDS product SsrA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001123905.1 protein_id gnl|my_center|LOCUS_15930 >Feature sequence464 <1 1462 gene locus_tag LOCUS_15940 <1 1462 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943252.1:single-stranded-DNA-specific exonuclease RecJ >Feature sequence465 <1 694 gene locus_tag LOCUS_15950 <1 694 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014207474.1:2-oxoglutarate dehydrogenase E1 component 835 1461 gene locus_tag LOCUS_15960 835 1461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15960 1454 1870 gene locus_tag LOCUS_15970 1454 1870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15970 >Feature sequence466 1652 663 gene locus_tag LOCUS_15980 1652 663 CDS product NAD(P)H-quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529235.1 protein_id gnl|my_center|LOCUS_15980 1755 2735 gene locus_tag LOCUS_15990 1755 2735 CDS product diacylglycerol kinase family lipid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808357.1 protein_id gnl|my_center|LOCUS_15990 >Feature sequence467 >Feature sequence468 <1 1499 gene locus_tag LOCUS_16000 <1 1499 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012258680.1:formylglycine-generating enzyme family protein >Feature sequence469 <1 1454 gene locus_tag LOCUS_16010 <1 1454 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942130.1:tetratricopeptide repeat protein 1621 2409 gene locus_tag LOCUS_16020 1621 2409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16020 >Feature sequence470 <1 2188 gene locus_tag LOCUS_16030 <1 2188 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013227744.1:TOMM precursor leader peptide-binding protein >Feature sequence471 276 1094 gene locus_tag LOCUS_16040 276 1094 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810029.1 protein_id gnl|my_center|LOCUS_16040 1154 2029 gene locus_tag LOCUS_16050 1154 2029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16050 >Feature sequence472 54 1082 gene locus_tag LOCUS_16060 54 1082 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258124.1 protein_id gnl|my_center|LOCUS_16060 1079 2170 gene locus_tag LOCUS_16070 1079 2170 CDS product dipeptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172559.1 protein_id gnl|my_center|LOCUS_16070 >Feature sequence473 1491 643 gene locus_tag LOCUS_16080 1491 643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16080 1870 1499 gene locus_tag LOCUS_16090 1870 1499 CDS product STAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000406877.1 protein_id gnl|my_center|LOCUS_16090 2144 2581 gene locus_tag LOCUS_16100 2144 2581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16100 >Feature sequence474 369 845 gene locus_tag LOCUS_16110 369 845 CDS product dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941234.1 protein_id gnl|my_center|LOCUS_16110 2335 956 gene locus_tag LOCUS_16120 2335 956 CDS product cystathionine beta-synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028755.1 protein_id gnl|my_center|LOCUS_16120 2538 2750 gene locus_tag LOCUS_16130 2538 2750 CDS product DUF2283 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546825.1 protein_id gnl|my_center|LOCUS_16130 >Feature sequence475 <2942 141 gene locus_tag LOCUS_16140 <2942 141 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003400356.1:Stk1 family PASTA domain-containing Ser/Thr kinase >Feature sequence476 <1 538 gene locus_tag LOCUS_16150 <1 538 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003113227.1:NAD(P)/FAD-dependent oxidoreductase 746 1420 gene locus_tag LOCUS_16160 746 1420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16160 1577 1834 gene locus_tag LOCUS_16170 1577 1834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16170 >Feature sequence477 >Feature sequence478 333 1655 gene locus_tag LOCUS_16180 gene deoA 333 1655 CDS product thymidine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968373.1 protein_id gnl|my_center|LOCUS_16180 1652 2677 gene locus_tag LOCUS_16190 1652 2677 CDS product BMP family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583513.1 protein_id gnl|my_center|LOCUS_16190 >Feature sequence479 2358 916 gene locus_tag LOCUS_16200 gene engA 2358 916 CDS product ribosome-associated GTPase EngA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230565.1 protein_id gnl|my_center|LOCUS_16200 >Feature sequence480 >Feature sequence481 1372 632 gene locus_tag LOCUS_16210 1372 632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257044.1 protein_id gnl|my_center|LOCUS_16210 1704 2528 gene locus_tag LOCUS_16220 1704 2528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16220 >Feature sequence482 1674 1351 gene locus_tag LOCUS_16230 1674 1351 CDS product 4a-hydroxytetrahydrobiopterin dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947715.1 protein_id gnl|my_center|LOCUS_16230 1781 2719 gene locus_tag LOCUS_16240 1781 2719 CDS product threonine/serine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227827.1 protein_id gnl|my_center|LOCUS_16240 >Feature sequence483 <1 740 gene locus_tag LOCUS_16250 <1 740 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011261596.1:Holliday junction branch migration DNA helicase RuvB 1670 930 gene locus_tag LOCUS_16260 1670 930 CDS product pyridoxine 5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942449.1 protein_id gnl|my_center|LOCUS_16260 2570 1755 gene locus_tag LOCUS_16270 2570 1755 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256313.1 protein_id gnl|my_center|LOCUS_16270 >Feature sequence484 1128 484 gene locus_tag LOCUS_16280 1128 484 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546790.1 protein_id gnl|my_center|LOCUS_16280 2651 1233 gene locus_tag LOCUS_16290 gene secY 2651 1233 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943466.1 protein_id gnl|my_center|LOCUS_16290 >Feature sequence485 >Feature sequence486 1239 283 gene locus_tag LOCUS_16300 1239 283 CDS product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258910.1 protein_id gnl|my_center|LOCUS_16300 <2908 1334 gene locus_tag LOCUS_16310 <2908 1334 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014400094.1:HAMP domain-containing protein >Feature sequence487 <1 1948 gene locus_tag LOCUS_16320 <1 1948 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012256976.1:C25 family cysteine peptidase 2025 2100 gene locus_tag LOCUS_t00110 2025 2100 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 <2907 2350 gene locus_tag LOCUS_16330 <2907 2350 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011261811.1:di-heme oxidoredictase family protein >Feature sequence488 <1 1001 gene locus_tag LOCUS_16340 <1 1001 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012544993.1:DUF3488 and transglutaminase-like domain-containing protein 1022 2437 gene locus_tag LOCUS_16350 gene rimO 1022 2437 CDS product 30S ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943823.1 protein_id gnl|my_center|LOCUS_16350 >Feature sequence489 2 325 gene locus_tag LOCUS_16360 2 325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16360 1343 342 gene locus_tag LOCUS_16370 1343 342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16370 1547 2638 gene locus_tag LOCUS_16380 1547 2638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16380 >Feature sequence490 33 947 gene locus_tag LOCUS_16390 33 947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16390 1198 1977 gene locus_tag LOCUS_16400 1198 1977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16400 >Feature sequence491 <2894 11 gene locus_tag LOCUS_16410 <2894 11 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011090068.1:UPF0182 family protein >Feature sequence492 <1 1339 gene locus_tag LOCUS_16420 <1 1339 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011140163.1:acetate--CoA ligase 1449 1874 gene locus_tag LOCUS_16430 1449 1874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16430 1919 2281 gene locus_tag LOCUS_16440 1919 2281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16440 >Feature sequence493 1038 259 gene locus_tag LOCUS_16450 1038 259 CDS product cobalamin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192829.1 protein_id gnl|my_center|LOCUS_16450 1654 2700 gene locus_tag LOCUS_16460 gene mtnA 1654 2700 CDS product S-methyl-5-thioribose-1-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080652.1 protein_id gnl|my_center|LOCUS_16460 >Feature sequence494 302 1144 gene locus_tag LOCUS_16470 gene pstA 302 1144 CDS product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582861.1 protein_id gnl|my_center|LOCUS_16470 1278 2087 gene locus_tag LOCUS_16480 gene pstB 1278 2087 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938383.1 protein_id gnl|my_center|LOCUS_16480 2251 2859 gene locus_tag LOCUS_16490 gene phoU 2251 2859 CDS product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986850.1 protein_id gnl|my_center|LOCUS_16490 >Feature sequence495 622 212 gene locus_tag LOCUS_16500 622 212 CDS product SET domain-containing protein-lysine N-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004551114.1 protein_id gnl|my_center|LOCUS_16500 1157 633 gene locus_tag LOCUS_16510 1157 633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16510 2061 1330 gene locus_tag LOCUS_16520 gene rph 2061 1330 CDS product ribonuclease PH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942439.1 protein_id gnl|my_center|LOCUS_16520 <2874 2042 gene locus_tag LOCUS_16530 <2874 2042 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943554.1:glutamate racemase >Feature sequence496 1672 311 gene locus_tag LOCUS_16540 1672 311 CDS product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937466.1 protein_id gnl|my_center|LOCUS_16540 <2873 1672 gene locus_tag LOCUS_16550 <2873 1672 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942363.1:GTP-binding protein >Feature sequence497 553 128 gene locus_tag LOCUS_16560 553 128 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228629.1 protein_id gnl|my_center|LOCUS_16560 <2870 540 gene locus_tag LOCUS_16570 <2870 540 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_071831510.1:type I polyketide synthase >Feature sequence498 181 1230 gene locus_tag LOCUS_16580 181 1230 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_218916593.1 protein_id gnl|my_center|LOCUS_16580 1331 1819 gene locus_tag LOCUS_16590 1331 1819 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205378591.1 protein_id gnl|my_center|LOCUS_16590 >Feature sequence499 1 474 gene locus_tag LOCUS_16600 1 474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16600 <2868 562 gene locus_tag LOCUS_16610 <2868 562 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_162015845.1:M1 family metallopeptidase >Feature sequence500 507 334 gene locus_tag LOCUS_16620 507 334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16620 909 682 gene locus_tag LOCUS_16630 909 682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16630 1504 2358 gene locus_tag LOCUS_16640 1504 2358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16640 >Feature sequence501 1201 731 gene locus_tag LOCUS_16650 1201 731 CDS product VanZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986971.1 protein_id gnl|my_center|LOCUS_16650 <2857 1298 gene locus_tag LOCUS_16660 <2857 1298 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011142299.1:VCBS repeat-containing protein >Feature sequence502 766 479 gene locus_tag LOCUS_16670 766 479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_16670 1045 767 gene locus_tag LOCUS_16680 1045 767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16680 1499 1032 gene locus_tag LOCUS_16690 1499 1032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16690 2856 1621 gene locus_tag LOCUS_16700 2856 1621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16700 >Feature sequence503 559 1215 gene locus_tag LOCUS_16710 559 1215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16710 1344 2276 gene locus_tag LOCUS_16720 1344 2276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16720 >Feature sequence504 1687 1343 gene locus_tag LOCUS_16730 gene clpS 1687 1343 CDS product ATP-dependent Clp protease adapter ClpS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545154.1 protein_id gnl|my_center|LOCUS_16730 >Feature sequence505 926 1333 gene locus_tag LOCUS_16740 926 1333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16740 1529 2557 gene locus_tag LOCUS_16750 1529 2557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16750 >Feature sequence506 >Feature sequence507 1813 575 gene locus_tag LOCUS_16760 1813 575 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809406.1 protein_id gnl|my_center|LOCUS_16760 <2845 1942 gene locus_tag LOCUS_16770 <2845 1942 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011405554.1:ABC transporter permease >Feature sequence508 160 990 gene locus_tag LOCUS_16780 160 990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16780 1084 1791 gene locus_tag LOCUS_16790 1084 1791 CDS product arylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528820.1 protein_id gnl|my_center|LOCUS_16790 1812 2333 gene locus_tag LOCUS_16800 1812 2333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16800 >Feature sequence509 >Feature sequence510 466 897 gene locus_tag LOCUS_16810 466 897 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970383.1 protein_id gnl|my_center|LOCUS_16810 953 1591 gene locus_tag LOCUS_16820 953 1591 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970398.1 protein_id gnl|my_center|LOCUS_16820 >Feature sequence511 <1 717 gene locus_tag LOCUS_16830 <1 717 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011074140.1:ligand-gated channel protein 1207 791 gene locus_tag LOCUS_16840 1207 791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16840 1395 2567 gene locus_tag LOCUS_16850 1395 2567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16850 >Feature sequence512 2100 1159 gene locus_tag LOCUS_16860 2100 1159 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002917329.1 protein_id gnl|my_center|LOCUS_16860 2833 2102 gene locus_tag LOCUS_16870 gene lgt 2833 2102 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880125.1 protein_id gnl|my_center|LOCUS_16870 >Feature sequence513 1425 1129 gene locus_tag LOCUS_16880 1425 1129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_16880 1836 1432 gene locus_tag LOCUS_16890 1836 1432 CDS product glycine/sarcosine/betaine reductase selenoprotein B family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255959.1 protein_id gnl|my_center|LOCUS_16890 2075 1878 gene locus_tag LOCUS_16900 2075 1878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16900 2505 2191 gene locus_tag LOCUS_16910 2505 2191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_16910 2655 2515 gene locus_tag LOCUS_16920 2655 2515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_16920 >Feature sequence514 1919 495 gene locus_tag LOCUS_16930 1919 495 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729439.1 protein_id gnl|my_center|LOCUS_16930 <2830 1939 gene locus_tag LOCUS_16940 <2830 1939 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007329773.1:LysR family transcriptional regulator >Feature sequence515 524 174 gene locus_tag LOCUS_16950 524 174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16950 <2827 679 gene locus_tag LOCUS_16960 <2827 679 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013529030.1:DNA translocase FtsK >Feature sequence516 <1 983 gene locus_tag LOCUS_16970 <1 983 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_193484340.1:alginate lyase family protein >Feature sequence517 1082 141 gene locus_tag LOCUS_16980 1082 141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16980 1867 1100 gene locus_tag LOCUS_16990 1867 1100 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000445567.1 protein_id gnl|my_center|LOCUS_16990 2701 1958 gene locus_tag LOCUS_17000 gene fabG 2701 1958 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082240.1 protein_id gnl|my_center|LOCUS_17000 >Feature sequence518 764 75 gene locus_tag LOCUS_17010 gene lolA 764 75 CDS product outer membrane lipoprotein chaperone LolA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000976047.1 protein_id gnl|my_center|LOCUS_17010 1725 769 gene locus_tag LOCUS_17020 1725 769 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057738.1 protein_id gnl|my_center|LOCUS_17020 2694 1744 gene locus_tag LOCUS_17030 2694 1744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17030 >Feature sequence519 1822 698 gene locus_tag LOCUS_17040 1822 698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17040 2654 1896 gene locus_tag LOCUS_17050 gene fabG 2654 1896 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000911782.1 protein_id gnl|my_center|LOCUS_17050 2818 2666 gene locus_tag LOCUS_17060 2818 2666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17060 >Feature sequence520 419 763 gene locus_tag LOCUS_17070 419 763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17070 877 1098 gene locus_tag LOCUS_17080 gene infA 877 1098 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004105485.1 protein_id gnl|my_center|LOCUS_17080 1135 1485 gene locus_tag LOCUS_17090 1135 1485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17090 1478 1705 gene locus_tag LOCUS_17100 1478 1705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17100 >Feature sequence521 267 37 gene locus_tag LOCUS_17110 267 37 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17110 1481 369 gene locus_tag LOCUS_17120 gene nadA 1481 369 CDS product quinolinate synthase NadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010080872.1 protein_id gnl|my_center|LOCUS_17120 <2815 1724 gene locus_tag LOCUS_17130 <2815 1724 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000857390.1:class II fumarate hydratase >Feature sequence522 142 552 gene locus_tag LOCUS_17140 142 552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17140 695 1501 gene locus_tag LOCUS_17150 695 1501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17150 1634 2098 gene locus_tag LOCUS_17160 1634 2098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17160 <2813 2187 gene locus_tag LOCUS_17170 <2813 2187 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011393971.1:ATP-binding protein >Feature sequence523 137 661 gene locus_tag LOCUS_17180 gene rimM 137 661 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392484.1 protein_id gnl|my_center|LOCUS_17180 671 1366 gene locus_tag LOCUS_17190 gene trmD 671 1366 CDS product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000686892.1 protein_id gnl|my_center|LOCUS_17190 1393 1776 gene locus_tag LOCUS_17200 gene rplS 1393 1776 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414717.1 protein_id gnl|my_center|LOCUS_17200 2238 1876 gene locus_tag LOCUS_17210 gene erpA 2238 1876 CDS product iron-sulfur cluster insertion protein ErpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881213.1 protein_id gnl|my_center|LOCUS_17210 2810 2367 gene locus_tag LOCUS_17220 2810 2367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17220 >Feature sequence524 1823 1512 gene locus_tag LOCUS_17230 gene yajC 1823 1512 CDS product preprotein translocase subunit YajC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402802.1 protein_id gnl|my_center|LOCUS_17230 <2811 1887 gene locus_tag LOCUS_17240 <2811 1887 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943257.1:tRNA guanosine(34) transglycosylase Tgt >Feature sequence525 <1 609 gene locus_tag LOCUS_17250 <1 609 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000444381.1:TylF/MycF family methyltransferase 606 1421 gene locus_tag LOCUS_17260 606 1421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17260 1542 2783 gene locus_tag LOCUS_17270 1542 2783 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202923.1 protein_id gnl|my_center|LOCUS_17270 >Feature sequence526 <1 1181 gene locus_tag LOCUS_17280 <1 1181 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012256326.1:magnesium chelatase ATPase subunit D >Feature sequence527 <1 1184 gene locus_tag LOCUS_17290 <1 1184 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011037381.1:CocE/NonD family hydrolase 1274 1975 gene locus_tag LOCUS_17300 1274 1975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17300 2135 2530 gene locus_tag LOCUS_17310 2135 2530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17310 >Feature sequence528 2346 415 gene locus_tag LOCUS_17320 2346 415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17320 2699 2626 gene locus_tag LOCUS_t00120 2699 2626 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence529 <1 1073 gene locus_tag LOCUS_17330 <1 1073 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943758.1:isoleucine--tRNA ligase 1070 1597 gene locus_tag LOCUS_17340 gene lspA 1070 1597 CDS product signal peptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073364.1 protein_id gnl|my_center|LOCUS_17340 <2791 1693 gene locus_tag LOCUS_17350 <2791 1693 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010948307.1:M13 family metallopeptidase >Feature sequence530 963 19 gene locus_tag LOCUS_17360 963 19 CDS product aspartate carbamoyltransferase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941926.1 protein_id gnl|my_center|LOCUS_17360 1651 1112 gene locus_tag LOCUS_17370 gene pyrR 1651 1112 CDS product bifunctional pyr operon transcriptional regulator/uracil phosphoribosyltransferase PyrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_196768320.1 protein_id gnl|my_center|LOCUS_17370 >Feature sequence531 >Feature sequence532 604 248 gene locus_tag LOCUS_17380 604 248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17380 1426 686 gene locus_tag LOCUS_17390 1426 686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17390 2440 1457 gene locus_tag LOCUS_17400 2440 1457 CDS product KpsF/GutQ family sugar-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037924.1 protein_id gnl|my_center|LOCUS_17400 >Feature sequence533 864 947 gene locus_tag LOCUS_t00130 864 947 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 1036 2457 gene locus_tag LOCUS_17410 gene tig 1036 2457 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723884.1 protein_id gnl|my_center|LOCUS_17410 >Feature sequence534 367 1989 gene locus_tag LOCUS_17420 367 1989 CDS product di-heme oxidoredictase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968504.1 protein_id gnl|my_center|LOCUS_17420 2314 2186 gene locus_tag LOCUS_17430 2314 2186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17430 >Feature sequence535 247 1257 gene locus_tag LOCUS_17440 247 1257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267860.1 protein_id gnl|my_center|LOCUS_17440 >Feature sequence536 395 1273 gene locus_tag LOCUS_17450 395 1273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17450 1300 1848 gene locus_tag LOCUS_17460 gene ruvC 1300 1848 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256932.1 protein_id gnl|my_center|LOCUS_17460 1919 2671 gene locus_tag LOCUS_17470 1919 2671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17470 >Feature sequence537 2466 643 gene locus_tag LOCUS_17480 gene pilB 2466 643 CDS product type IV-A pilus assembly ATPase PilB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942137.1 protein_id gnl|my_center|LOCUS_17480 >Feature sequence538 2 280 gene locus_tag LOCUS_17490 2 280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17490 702 295 gene locus_tag LOCUS_17500 702 295 CDS product PIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142424.1 protein_id gnl|my_center|LOCUS_17500 905 699 gene locus_tag LOCUS_17510 905 699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17510 2419 962 gene locus_tag LOCUS_17520 gene gatA 2419 962 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257583.1 protein_id gnl|my_center|LOCUS_17520 >Feature sequence539 812 1909 gene locus_tag LOCUS_17530 812 1909 CDS product lysylphosphatidylglycerol synthase transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942134.1 protein_id gnl|my_center|LOCUS_17530 2006 2488 gene locus_tag LOCUS_17540 gene nrdR 2006 2488 CDS product transcriptional regulator NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003399430.1 protein_id gnl|my_center|LOCUS_17540 >Feature sequence540 44 343 gene locus_tag LOCUS_17550 44 343 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921693.1 protein_id gnl|my_center|LOCUS_17550 1119 346 gene locus_tag LOCUS_17560 1119 346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17560 1513 1163 gene locus_tag LOCUS_17570 1513 1163 CDS product histidine triad nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880034.1 protein_id gnl|my_center|LOCUS_17570 <2746 1603 gene locus_tag LOCUS_17580 <2746 1603 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003094332.1:UDP-N-acetylglucosamine 1-carboxyvinyltransferase >Feature sequence541 <1 1435 gene locus_tag LOCUS_17590 <1 1435 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005814533.1:M13 family metallopeptidase >Feature sequence542 <1 650 gene locus_tag LOCUS_17600 <1 650 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011389868.1:tetratricopeptide repeat-containing sulfotransferase family protein 795 1106 gene locus_tag LOCUS_17610 795 1106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17610 1157 1495 gene locus_tag LOCUS_17620 1157 1495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17620 >Feature sequence543 1259 1738 gene locus_tag LOCUS_17630 1259 1738 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973276.1 protein_id gnl|my_center|LOCUS_17630 1728 2180 gene locus_tag LOCUS_17640 1728 2180 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000623963.1 protein_id gnl|my_center|LOCUS_17640 2177 2323 gene locus_tag LOCUS_17650 2177 2323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17650 >Feature sequence544 1408 83 gene locus_tag LOCUS_17660 1408 83 CDS product folylpolyglutamate synthase/dihydrofolate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272524.1 protein_id gnl|my_center|LOCUS_17660 2407 1505 gene locus_tag LOCUS_17670 gene accD 2407 1505 CDS product acetyl-CoA carboxylase, carboxyltransferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545653.1 protein_id gnl|my_center|LOCUS_17670 >Feature sequence545 345 13 gene locus_tag LOCUS_17680 345 13 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17680 <2731 500 gene locus_tag LOCUS_17690 <2731 500 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942342.1:tetratricopeptide repeat protein >Feature sequence546 55 975 gene locus_tag LOCUS_17700 55 975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17700 2072 1056 gene locus_tag LOCUS_17710 2072 1056 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004523318.1 protein_id gnl|my_center|LOCUS_17710 2607 2098 gene locus_tag LOCUS_17720 2607 2098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17720 >Feature sequence547 <1 1753 gene locus_tag LOCUS_17730 <1 1753 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012545943.1:CHAT domain-containing protein 1772 2413 gene locus_tag LOCUS_17740 1772 2413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17740 >Feature sequence548 2162 225 gene locus_tag LOCUS_17750 2162 225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17750 >Feature sequence549 2249 879 gene locus_tag LOCUS_17760 gene glmM 2249 879 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222643.1 protein_id gnl|my_center|LOCUS_17760 >Feature sequence550 <1 1276 gene locus_tag LOCUS_17770 <1 1276 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011390869.1:amidotransferase 1, exosortase A system-associated 1276 2472 gene locus_tag LOCUS_17780 1276 2472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17780 >Feature sequence551 349 1710 gene locus_tag LOCUS_17790 349 1710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17790 >Feature sequence552 585 1598 gene locus_tag LOCUS_17800 585 1598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17800 1595 1810 gene locus_tag LOCUS_17810 1595 1810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17810 >Feature sequence553 <1 1161 gene locus_tag LOCUS_17820 <1 1161 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001052446.1:di-heme oxidoredictase family protein 1409 1969 gene locus_tag LOCUS_17830 1409 1969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17830 >Feature sequence554 2294 2440 gene locus_tag LOCUS_17840 2294 2440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17840 >Feature sequence555 465 1004 gene locus_tag LOCUS_17850 465 1004 CDS product DinB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000941979.1 protein_id gnl|my_center|LOCUS_17850 1082 1549 gene locus_tag LOCUS_17860 1082 1549 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263483.1 protein_id gnl|my_center|LOCUS_17860 1589 1918 gene locus_tag LOCUS_17870 1589 1918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039267.1 protein_id gnl|my_center|LOCUS_17870 1911 2420 gene locus_tag LOCUS_17880 1911 2420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17880 >Feature sequence556 <1 2088 gene locus_tag LOCUS_17890 <1 2088 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012048130.1:endonuclease MutS2 >Feature sequence557 23 973 gene locus_tag LOCUS_17900 23 973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17900 1034 1492 gene locus_tag LOCUS_17910 1034 1492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17910 >Feature sequence558 1108 329 gene locus_tag LOCUS_17920 gene sufC 1108 329 CDS product Fe-S cluster assembly ATPase SufC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057741.1 protein_id gnl|my_center|LOCUS_17920 1461 1123 gene locus_tag LOCUS_17930 1461 1123 CDS product DUF86 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020812.1 protein_id gnl|my_center|LOCUS_17930 1741 1451 gene locus_tag LOCUS_17940 1741 1451 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066199.1 protein_id gnl|my_center|LOCUS_17940 <2705 1766 gene locus_tag LOCUS_17950 <2705 1766 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011056341.1:Fe-S cluster assembly protein SufB >Feature sequence559 317 1303 gene locus_tag LOCUS_17960 317 1303 CDS product thiamine pyrophosphate-dependent dehydrogenase E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258973.1 protein_id gnl|my_center|LOCUS_17960 1411 1830 gene locus_tag LOCUS_17970 1411 1830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17970 >Feature sequence560 1203 1670 gene locus_tag LOCUS_17980 1203 1670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17980 1724 2527 gene locus_tag LOCUS_17990 1724 2527 CDS product PhzF family phenazine biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_095645285.1 protein_id gnl|my_center|LOCUS_17990 >Feature sequence561 <1 1359 gene locus_tag LOCUS_18000 <1 1359 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_037395926.1:adenylate/guanylate cyclase domain-containing protein 1395 2186 gene locus_tag LOCUS_18010 1395 2186 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000821952.1 protein_id gnl|my_center|LOCUS_18010 2214 2630 gene locus_tag LOCUS_18020 2214 2630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18020 >Feature sequence562 <2687 1425 gene locus_tag LOCUS_18030 <2687 1425 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_009967303.1:serine protease AprX >Feature sequence563 <1 719 gene locus_tag LOCUS_18040 <1 719 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943120.1:sensor histidine kinase KdpD 716 2590 gene locus_tag LOCUS_18050 716 2590 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963797.1 protein_id gnl|my_center|LOCUS_18050 >Feature sequence564 977 126 gene locus_tag LOCUS_18060 977 126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18060 1599 1039 gene locus_tag LOCUS_18070 1599 1039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18070 2338 1718 gene locus_tag LOCUS_18080 2338 1718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18080 >Feature sequence565 <2679 1041 gene locus_tag LOCUS_18090 <2679 1041 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941762.1:phosphate regulon sensor histidine kinase PhoR >Feature sequence566 >Feature sequence567 <1 1645 gene locus_tag LOCUS_18100 <1 1645 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164928427.1:ATP-binding protein >Feature sequence568 >Feature sequence569 >Feature sequence570 1067 2203 gene locus_tag LOCUS_18110 gene aroB 1067 2203 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545319.1 protein_id gnl|my_center|LOCUS_18110 2315 2638 gene locus_tag LOCUS_18120 2315 2638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18120 >Feature sequence571 <1 1285 gene locus_tag LOCUS_18130 <1 1285 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000454344.1:penicillin acylase family protein 1297 1893 gene locus_tag LOCUS_18140 gene thpR 1297 1893 CDS product RNA 2',3'-cyclic phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007332599.1 protein_id gnl|my_center|LOCUS_18140 <2658 1956 gene locus_tag LOCUS_18150 <2658 1956 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002208576.1:SPFH domain-containing protein >Feature sequence572 30 1001 gene locus_tag LOCUS_18160 30 1001 CDS product tyrosine recombinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583874.1 protein_id gnl|my_center|LOCUS_18160 1953 1081 gene locus_tag LOCUS_18170 1953 1081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18170 <2657 2115 gene locus_tag LOCUS_18180 <2657 2115 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011140636.1:response regulator >Feature sequence573 <1 1535 gene locus_tag LOCUS_18190 <1 1535 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_038967728.1:methyltransferase regulatory domain-containing protein 2138 1539 gene locus_tag LOCUS_18200 2138 1539 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000680361.1 protein_id gnl|my_center|LOCUS_18200 2437 2156 gene locus_tag LOCUS_18210 2437 2156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18210 >Feature sequence574 >Feature sequence575 667 1617 gene locus_tag LOCUS_18220 667 1617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18220 >Feature sequence576 1841 636 gene locus_tag LOCUS_18230 1841 636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18230 >Feature sequence577 <1 1192 gene locus_tag LOCUS_18240 <1 1192 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011392987.1:ATP-binding protein 1312 1686 gene locus_tag LOCUS_18250 1312 1686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18250 >Feature sequence578 3 200 gene locus_tag LOCUS_18260 3 200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18260 345 2411 gene locus_tag LOCUS_18270 345 2411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18270 >Feature sequence579 98 1729 gene locus_tag LOCUS_18280 gene boxC 98 1729 CDS product 2,3-epoxybenzoyl-CoA dihydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063921378.1 protein_id gnl|my_center|LOCUS_18280 >Feature sequence580 <1 2180 gene locus_tag LOCUS_18290 <1 2180 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010918869.1:M14 family metallopeptidase >Feature sequence581 1685 279 gene locus_tag LOCUS_18300 1685 279 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921284.1 protein_id gnl|my_center|LOCUS_18300 2324 1689 gene locus_tag LOCUS_18310 2324 1689 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868278.1 protein_id gnl|my_center|LOCUS_18310 >Feature sequence582 1006 131 gene locus_tag LOCUS_18320 gene panC 1006 131 CDS product pantoate--beta-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258070.1 protein_id gnl|my_center|LOCUS_18320 1886 1017 gene locus_tag LOCUS_18330 gene panB 1886 1017 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439367.1 protein_id gnl|my_center|LOCUS_18330 >Feature sequence583 418 948 gene locus_tag LOCUS_18340 418 948 CDS product tail fiber protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528766.1 protein_id gnl|my_center|LOCUS_18340 >Feature sequence584 647 1816 gene locus_tag LOCUS_18350 647 1816 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193484168.1 protein_id gnl|my_center|LOCUS_18350 >Feature sequence585 2059 845 gene locus_tag LOCUS_18360 2059 845 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392515.1 protein_id gnl|my_center|LOCUS_18360 >Feature sequence586 2355 820 gene locus_tag LOCUS_18370 2355 820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18370 >Feature sequence587 1129 284 gene locus_tag LOCUS_18380 1129 284 CDS product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001078448.1 protein_id gnl|my_center|LOCUS_18380 <2618 1134 gene locus_tag LOCUS_18390 <2618 1134 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011035657.1:AarF/UbiB family protein >Feature sequence588 <1 1402 gene locus_tag LOCUS_18400 <1 1402 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011029141.1:MFS transporter 1716 2567 gene locus_tag LOCUS_18410 1716 2567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18410 >Feature sequence589 <1 1100 gene locus_tag LOCUS_18420 <1 1100 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011142299.1:VCBS repeat-containing protein 2339 1134 gene locus_tag LOCUS_18430 2339 1134 CDS product aminotransferase class III-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404943.1 protein_id gnl|my_center|LOCUS_18430 >Feature sequence590 1434 625 gene locus_tag LOCUS_18440 1434 625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18440 <2611 1460 gene locus_tag LOCUS_18450 <2611 1460 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012545108.1:preprotein translocase subunit SecA >Feature sequence591 <2610 504 gene locus_tag LOCUS_18460 <2610 504 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_103068426.1:M12 family metallo-peptidase >Feature sequence592 3 785 gene locus_tag LOCUS_18470 3 785 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144243.1 protein_id gnl|my_center|LOCUS_18470 793 1560 gene locus_tag LOCUS_18480 793 1560 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404226.1 protein_id gnl|my_center|LOCUS_18480 2301 1564 gene locus_tag LOCUS_18490 2301 1564 CDS product DUF2071 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399111.1 protein_id gnl|my_center|LOCUS_18490 >Feature sequence593 <2608 950 gene locus_tag LOCUS_18500 <2608 950 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012640602.1:DUF4175 family protein >Feature sequence594 444 1196 gene locus_tag LOCUS_18510 444 1196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18510 <2606 1285 gene locus_tag LOCUS_18520 <2606 1285 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004193963.1:phosphomethylpyrimidine synthase ThiC >Feature sequence595 1629 1093 gene locus_tag LOCUS_18530 gene raiA 1629 1093 CDS product ribosome-associated translation inhibitor RaiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966132.1 protein_id gnl|my_center|LOCUS_18530 <2604 1731 gene locus_tag LOCUS_18540 <2604 1731 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942532.1:RNA polymerase factor sigma-54 >Feature sequence596 <1 851 gene locus_tag LOCUS_18550 <1 851 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943874.1:excinuclease ABC subunit UvrB 881 2356 gene locus_tag LOCUS_18560 881 2356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18560 >Feature sequence597 1 285 gene locus_tag LOCUS_18570 1 285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18570 704 351 gene locus_tag LOCUS_18580 704 351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18580 1823 714 gene locus_tag LOCUS_18590 1823 714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18590 2358 1828 gene locus_tag LOCUS_18600 2358 1828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18600 >Feature sequence598 527 180 gene locus_tag LOCUS_18610 527 180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389227.1 protein_id gnl|my_center|LOCUS_18610 1081 524 gene locus_tag LOCUS_18620 1081 524 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000808789.1 protein_id gnl|my_center|LOCUS_18620 2445 1078 gene locus_tag LOCUS_18630 2445 1078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18630 >Feature sequence599 <1 1312 gene locus_tag LOCUS_18640 <1 1312 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011036622.1:asparagine synthase (glutamine-hydrolyzing) 1348 1746 gene locus_tag LOCUS_18650 1348 1746 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071181.1 protein_id gnl|my_center|LOCUS_18650 >Feature sequence600 352 1404 gene locus_tag LOCUS_18660 352 1404 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975112.1 protein_id gnl|my_center|LOCUS_18660 1469 2080 gene locus_tag LOCUS_18670 1469 2080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18670 >Feature sequence601 1309 920 gene locus_tag LOCUS_18680 gene nuoK 1309 920 CDS product NADH-quinone oxidoreductase subunit NuoK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813222.1 protein_id gnl|my_center|LOCUS_18680 2537 1395 gene locus_tag LOCUS_18690 2537 1395 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816051.1 protein_id gnl|my_center|LOCUS_18690 >Feature sequence602 <1 1033 gene locus_tag LOCUS_18700 <1 1033 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011250239.1:MATE family efflux transporter 1508 1122 gene locus_tag LOCUS_18710 1508 1122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18710 >Feature sequence603 1263 955 gene locus_tag LOCUS_18720 1263 955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18720 2340 1300 gene locus_tag LOCUS_18730 2340 1300 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090392.1 protein_id gnl|my_center|LOCUS_18730 >Feature sequence604 1824 376 gene locus_tag LOCUS_18740 1824 376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18740 <2575 1880 gene locus_tag LOCUS_18750 <2575 1880 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_235044988.1:SCO family protein >Feature sequence605 449 1813 gene locus_tag LOCUS_18760 449 1813 CDS product TRZ/ATZ family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113433.1 protein_id gnl|my_center|LOCUS_18760 2330 1857 gene locus_tag LOCUS_18770 2330 1857 CDS product MOSC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088276.1 protein_id gnl|my_center|LOCUS_18770 >Feature sequence606 42 1703 gene locus_tag LOCUS_18780 42 1703 CDS product ribonuclease J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392583.1 protein_id gnl|my_center|LOCUS_18780 1796 2242 gene locus_tag LOCUS_18790 1796 2242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18790 >Feature sequence607 544 158 gene locus_tag LOCUS_18800 544 158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18800 778 566 gene locus_tag LOCUS_18810 778 566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18810 1209 781 gene locus_tag LOCUS_18820 gene rplP 1209 781 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810150.1 protein_id gnl|my_center|LOCUS_18820 2102 1308 gene locus_tag LOCUS_18830 gene rpsC 2102 1308 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393931.1 protein_id gnl|my_center|LOCUS_18830 >Feature sequence608 828 1071 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq acgccgtcgctcaagaggacgccgt >Feature sequence609 1021 632 gene locus_tag LOCUS_18840 1021 632 CDS product BlaI/MecI/CopY family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008664252.1 protein_id gnl|my_center|LOCUS_18840 1220 1669 gene locus_tag LOCUS_18850 1220 1669 CDS product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940812.1 protein_id gnl|my_center|LOCUS_18850 >Feature sequence610 230 709 gene locus_tag LOCUS_18860 230 709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18860 >Feature sequence611 402 1058 gene locus_tag LOCUS_18870 402 1058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18870 >Feature sequence612 2162 606 gene locus_tag LOCUS_18880 2162 606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18880 >Feature sequence613 1123 2103 gene locus_tag LOCUS_18890 1123 2103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18890 >Feature sequence614 <1 1900 gene locus_tag LOCUS_18900 <1 1900 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011021139.1:radical SAM protein >Feature sequence615 <1 1068 gene locus_tag LOCUS_18910 <1 1068 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012256405.1:glucose-6-phosphate dehydrogenase 1093 2256 gene locus_tag LOCUS_18920 1093 2256 CDS product glucose-6-phosphate dehydrogenase assembly protein OpcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143171.1 protein_id gnl|my_center|LOCUS_18920 >Feature sequence616 675 1031 gene locus_tag LOCUS_18930 675 1031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18930 1061 2320 gene locus_tag LOCUS_18940 1061 2320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18940 >Feature sequence617 2015 411 gene locus_tag LOCUS_18950 gene serA 2015 411 CDS product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546680.1 protein_id gnl|my_center|LOCUS_18950 >Feature sequence618 >Feature sequence619 <1 1684 gene locus_tag LOCUS_18960 <1 1684 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011038616.1:pitrilysin family protein >Feature sequence620 <1 1320 gene locus_tag LOCUS_18970 <1 1320 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164925700.1:S9 family peptidase <2534 1415 gene locus_tag LOCUS_18980 <2534 1415 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011020305.1:VWA domain-containing protein >Feature sequence621 327 1886 gene locus_tag LOCUS_18990 327 1886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18990 >Feature sequence622 1977 94 gene locus_tag LOCUS_19000 1977 94 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19000 >Feature sequence623 563 489 gene locus_tag LOCUS_t00140 563 489 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 1201 659 gene locus_tag LOCUS_19010 1201 659 CDS product HAD hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942537.1 protein_id gnl|my_center|LOCUS_19010 2520 1210 gene locus_tag LOCUS_19020 2520 1210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19020 >Feature sequence624 1402 1070 gene locus_tag LOCUS_19030 1402 1070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19030 >Feature sequence625 782 252 gene locus_tag LOCUS_19040 gene efp 782 252 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082309.1 protein_id gnl|my_center|LOCUS_19040 1823 1089 gene locus_tag LOCUS_19050 1823 1089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19050 2169 1864 gene locus_tag LOCUS_19060 2169 1864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19060 >Feature sequence626 2515 1028 gene locus_tag LOCUS_19070 2515 1028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19070 >Feature sequence627 2213 111 gene locus_tag LOCUS_19080 2213 111 CDS product molybdopterin oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527789.1 protein_id gnl|my_center|LOCUS_19080 >Feature sequence628 201 1070 gene locus_tag LOCUS_19090 gene era 201 1070 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288753.1 protein_id gnl|my_center|LOCUS_19090 1063 1917 gene locus_tag LOCUS_19100 gene prmA 1063 1917 CDS product 50S ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816472.1 protein_id gnl|my_center|LOCUS_19100 >Feature sequence629 1680 304 gene locus_tag LOCUS_19110 1680 304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19110 2171 1857 gene locus_tag LOCUS_19120 2171 1857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19120 >Feature sequence630 1334 861 gene locus_tag LOCUS_19130 1334 861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19130 1954 1331 gene locus_tag LOCUS_19140 1954 1331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19140 >Feature sequence631 416 1948 gene locus_tag LOCUS_19150 416 1948 CDS product cytochrome c biogenesis protein ResB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941275.1 protein_id gnl|my_center|LOCUS_19150 >Feature sequence632 1096 74 gene locus_tag LOCUS_19160 gene trpD 1096 74 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025774851.1 protein_id gnl|my_center|LOCUS_19160 1673 1107 gene locus_tag LOCUS_19170 gene pabA 1673 1107 CDS product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243797.1 protein_id gnl|my_center|LOCUS_19170 <2499 1763 gene locus_tag LOCUS_19180 <2499 1763 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943526.1:ankyrin repeat domain-containing protein >Feature sequence633 1660 26 gene locus_tag LOCUS_19190 1660 26 CDS product carboxyl transferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963147.1 protein_id gnl|my_center|LOCUS_19190 >Feature sequence634 1896 298 gene locus_tag LOCUS_19200 1896 298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19200 <2494 1917 gene locus_tag LOCUS_19210 <2494 1917 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011013545.1:HAD family hydrolase >Feature sequence635 <1 1220 gene locus_tag LOCUS_19220 <1 1220 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164928419.1:alpha/beta fold hydrolase 1284 1937 gene locus_tag LOCUS_19230 1284 1937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19230 >Feature sequence636 <1 657 gene locus_tag LOCUS_19240 <1 657 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011461043.1:nucleotide sugar dehydrogenase 661 1779 gene locus_tag LOCUS_19250 gene wecB 661 1779 CDS product UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060909.1 protein_id gnl|my_center|LOCUS_19250 >Feature sequence637 <1 1017 gene locus_tag LOCUS_19260 <1 1017 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011123665.1:SDR family oxidoreductase 1046 1633 gene locus_tag LOCUS_19270 1046 1633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19270 1630 2436 gene locus_tag LOCUS_19280 1630 2436 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036275.1 protein_id gnl|my_center|LOCUS_19280 >Feature sequence638 >Feature sequence639 <1 1206 gene locus_tag LOCUS_19290 <1 1206 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011393778.1:AmmeMemoRadiSam system protein A 1196 1435 gene locus_tag LOCUS_19300 1196 1435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19300 <2482 1589 gene locus_tag LOCUS_19310 <2482 1589 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013385569.1:DNA topoisomerase (ATP-hydrolyzing) subunit B >Feature sequence640 141 1265 gene locus_tag LOCUS_19320 141 1265 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256548.1 protein_id gnl|my_center|LOCUS_19320 1940 1311 gene locus_tag LOCUS_19330 1940 1311 CDS product DUF2238 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003816581.1 protein_id gnl|my_center|LOCUS_19330 >Feature sequence641 <2468 1551 gene locus_tag LOCUS_19340 <2468 1551 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011142299.1:VCBS repeat-containing protein >Feature sequence642 >Feature sequence643 61 2052 gene locus_tag LOCUS_19350 61 2052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19350 >Feature sequence644 >Feature sequence645 <2448 508 gene locus_tag LOCUS_19360 <2448 508 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011141097.1:serine/threonine-protein kinase >Feature sequence646 2237 483 gene locus_tag LOCUS_19370 2237 483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19370 >Feature sequence647 755 961 gene locus_tag LOCUS_19380 755 961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19380 1087 1707 gene locus_tag LOCUS_19390 1087 1707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19390 <2441 1800 gene locus_tag LOCUS_19400 <2441 1800 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011142299.1:VCBS repeat-containing protein >Feature sequence648 <1 1356 gene locus_tag LOCUS_19410 <1 1356 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011403955.1:sigma-54 dependent transcriptional regulator 1423 2079 gene locus_tag LOCUS_19420 1423 2079 CDS product O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964993.1 protein_id gnl|my_center|LOCUS_19420 >Feature sequence649 312 127 gene locus_tag LOCUS_19430 312 127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19430 <2431 394 gene locus_tag LOCUS_19440 <2431 394 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257457.1:GAF domain-containing protein >Feature sequence650 574 98 gene locus_tag LOCUS_19450 574 98 CDS product DUF721 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941300.1 protein_id gnl|my_center|LOCUS_19450 619 1248 gene locus_tag LOCUS_19460 619 1248 CDS product Maf family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001226275.1 protein_id gnl|my_center|LOCUS_19460 1874 1341 gene locus_tag LOCUS_19470 1874 1341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19470 >Feature sequence651 2206 1136 gene locus_tag LOCUS_19480 2206 1136 CDS product WG repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358861.1 protein_id gnl|my_center|LOCUS_19480 >Feature sequence652 1 1401 gene locus_tag LOCUS_19490 1 1401 CDS product ATP-dependent DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_202320246.1 protein_id gnl|my_center|LOCUS_19490 1825 1598 gene locus_tag LOCUS_19500 1825 1598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19500 >Feature sequence653 1964 1353 gene locus_tag LOCUS_19510 1964 1353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19510 >Feature sequence654 >Feature sequence655 2360 225 gene locus_tag LOCUS_19520 gene metG 2360 225 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391596.1 protein_id gnl|my_center|LOCUS_19520 >Feature sequence656 <1 933 gene locus_tag LOCUS_19530 <1 933 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011392878.1:glycosyltransferase family 4 protein >Feature sequence657 2044 347 gene locus_tag LOCUS_19540 2044 347 CDS product DUF87 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056105.1 protein_id gnl|my_center|LOCUS_19540 >Feature sequence658 428 793 gene locus_tag LOCUS_19550 428 793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19550 1141 1719 gene locus_tag LOCUS_19560 1141 1719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19560 1726 2274 gene locus_tag LOCUS_19570 1726 2274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19570 >Feature sequence659 1540 1070 gene locus_tag LOCUS_19580 1540 1070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19580 2171 1755 gene locus_tag LOCUS_19590 2171 1755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19590 >Feature sequence660 1372 521 gene locus_tag LOCUS_19600 1372 521 CDS product DUF72 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928572.1 protein_id gnl|my_center|LOCUS_19600 1785 1393 gene locus_tag LOCUS_19610 1785 1393 CDS product secondary thiamine-phosphate synthase enzyme YjbQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545896.1 protein_id gnl|my_center|LOCUS_19610 2395 1880 gene locus_tag LOCUS_19620 2395 1880 CDS product biotin transporter BioY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041443401.1 protein_id gnl|my_center|LOCUS_19620 >Feature sequence661 1334 66 gene locus_tag LOCUS_19630 1334 66 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141373.1 protein_id gnl|my_center|LOCUS_19630 <2383 1352 gene locus_tag LOCUS_19640 <2383 1352 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010946340.1:Fe-S cluster assembly protein SufD >Feature sequence662 >Feature sequence663 55 429 gene locus_tag LOCUS_19650 55 429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19650 426 1316 gene locus_tag LOCUS_19660 426 1316 CDS product cytochrome c oxidase assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011971120.1 protein_id gnl|my_center|LOCUS_19660 1313 1825 gene locus_tag LOCUS_19670 1313 1825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19670 1863 2318 gene locus_tag LOCUS_19680 1863 2318 CDS product DUF421 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003317797.1 protein_id gnl|my_center|LOCUS_19680 >Feature sequence664 1712 954 gene locus_tag LOCUS_19690 1712 954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19690 2318 1728 gene locus_tag LOCUS_19700 2318 1728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19700 >Feature sequence665 1967 834 gene locus_tag LOCUS_19710 gene argE 1967 834 CDS product acetylornithine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201419049.1 protein_id gnl|my_center|LOCUS_19710 >Feature sequence666 <2358 381 gene locus_tag LOCUS_19720 <2358 381 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011140222.1:NAD(P)H-quinone oxidoreductase subunit 5 >Feature sequence667 1426 1785 gene locus_tag LOCUS_19730 1426 1785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19730 >Feature sequence668 <1 1346 gene locus_tag LOCUS_19740 <1 1346 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942140.1:ATP-binding protein >Feature sequence669 440 937 gene locus_tag LOCUS_19750 440 937 CDS product YajQ family cyclic di-GMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944407.1 protein_id gnl|my_center|LOCUS_19750 1042 2061 gene locus_tag LOCUS_19760 gene ispB 1042 2061 CDS product octaprenyl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807467.1 protein_id gnl|my_center|LOCUS_19760 >Feature sequence670 >Feature sequence671 1340 339 gene locus_tag LOCUS_19770 gene prfB 1340 339 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942918.1 protein_id gnl|my_center|LOCUS_19770 <2343 1483 gene locus_tag LOCUS_19780 <2343 1483 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012545206.1:apolipoprotein N-acyltransferase >Feature sequence672 <1 786 gene locus_tag LOCUS_19790 <1 786 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010940715.1:serine--tRNA ligase 790 1311 gene locus_tag LOCUS_19800 790 1311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19800 <2339 1373 gene locus_tag LOCUS_19810 <2339 1373 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_103020423.1:signal peptide peptidase SppA >Feature sequence673 1498 2 gene locus_tag LOCUS_19820 1498 2 CDS product pyridoxal-dependent decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258696.1 protein_id gnl|my_center|LOCUS_19820 2165 1617 gene locus_tag LOCUS_19830 2165 1617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19830 >Feature sequence674 >Feature sequence675 >Feature sequence676 1294 713 gene locus_tag LOCUS_19840 gene gmhB 1294 713 CDS product D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942726.1 protein_id gnl|my_center|LOCUS_19840 <2325 1291 gene locus_tag LOCUS_19850 <2325 1291 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942896.1:lipopolysaccharide heptosyltransferase II >Feature sequence677 1 648 gene locus_tag LOCUS_19860 1 648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19860 652 1131 gene locus_tag LOCUS_19870 652 1131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19870 1250 1834 gene locus_tag LOCUS_19880 1250 1834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19880 >Feature sequence678 820 374 gene locus_tag LOCUS_19890 820 374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19890 <2321 939 gene locus_tag LOCUS_19900 <2321 939 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942684.1:sigma-54 dependent transcriptional regulator >Feature sequence679 551 2044 gene locus_tag LOCUS_19910 551 2044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19910 >Feature sequence680 79 2079 gene locus_tag LOCUS_19920 79 2079 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256956.1 protein_id gnl|my_center|LOCUS_19920 >Feature sequence681 1644 259 gene locus_tag LOCUS_19930 1644 259 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930426.1 protein_id gnl|my_center|LOCUS_19930 >Feature sequence682 >Feature sequence683 >Feature sequence684 94 549 gene locus_tag LOCUS_19940 94 549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19940 649 1104 gene locus_tag LOCUS_19950 649 1104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19950 1083 2249 gene locus_tag LOCUS_19960 1083 2249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19960 >Feature sequence685 462 1328 gene locus_tag LOCUS_19970 gene kdsA 462 1328 CDS product 3-deoxy-8-phosphooctulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870024.1 protein_id gnl|my_center|LOCUS_19970 >Feature sequence686 1063 554 gene locus_tag LOCUS_19980 1063 554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19980 1459 1085 gene locus_tag LOCUS_19990 1459 1085 CDS product tRNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948308.1 protein_id gnl|my_center|LOCUS_19990 1773 1459 gene locus_tag LOCUS_20000 1773 1459 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727879.1 protein_id gnl|my_center|LOCUS_20000 >Feature sequence687 <1 2201 gene locus_tag LOCUS_20010 <1 2201 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010876334.1:ABC transporter permease >Feature sequence688 >Feature sequence689 317 817 gene locus_tag LOCUS_20020 317 817 CDS product NfeD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971919.1 protein_id gnl|my_center|LOCUS_20020 <2281 822 gene locus_tag LOCUS_20030 <2281 822 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011141063.1:CHAT domain-containing protein >Feature sequence690 2 529 gene locus_tag LOCUS_20040 2 529 CDS product metal-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143393.1 protein_id gnl|my_center|LOCUS_20040 897 619 gene locus_tag LOCUS_20050 897 619 CDS product GlsB/YeaQ/YmgE family stress response membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000511323.1 protein_id gnl|my_center|LOCUS_20050 2256 1045 gene locus_tag LOCUS_20060 2256 1045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20060 >Feature sequence691 <1 536 gene locus_tag LOCUS_20070 <1 536 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011986681.1:PhzF family phenazine biosynthesis protein 547 1542 gene locus_tag LOCUS_20080 547 1542 CDS product YpdA family putative bacillithiol disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399008.1 protein_id gnl|my_center|LOCUS_20080 >Feature sequence692 499 83 gene locus_tag LOCUS_20090 499 83 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20090 1143 496 gene locus_tag LOCUS_20100 1143 496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20100 1863 1144 gene locus_tag LOCUS_20110 1863 1144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20110 >Feature sequence693 >Feature sequence694 1643 348 gene locus_tag LOCUS_20120 1643 348 CDS product glucose-1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144244.1 protein_id gnl|my_center|LOCUS_20120 >Feature sequence695 >Feature sequence696 <1 1981 gene locus_tag LOCUS_20130 <1 1981 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012545243.1:threonine--tRNA ligase >Feature sequence697 1148 546 gene locus_tag LOCUS_20140 1148 546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20140 >Feature sequence698 1309 515 gene locus_tag LOCUS_20150 gene modA 1309 515 CDS product molybdate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089689.1 protein_id gnl|my_center|LOCUS_20150 1427 2095 gene locus_tag LOCUS_20160 gene modB 1427 2095 CDS product molybdate ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144266.1 protein_id gnl|my_center|LOCUS_20160 >Feature sequence699 <1 909 gene locus_tag LOCUS_20170 <1 909 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003974985.1:ABC transporter ATP-binding protein 906 1793 gene locus_tag LOCUS_20180 906 1793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20180 >Feature sequence700 <1 1002 gene locus_tag LOCUS_20190 <1 1002 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011110443.1:glycogen synthase GlgA 1029 1373 gene locus_tag LOCUS_20200 gene trxA 1029 1373 CDS product thioredoxin TrxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096336.1 protein_id gnl|my_center|LOCUS_20200 1469 1873 gene locus_tag LOCUS_20210 1469 1873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20210 >Feature sequence701 1219 551 gene locus_tag LOCUS_20220 1219 551 CDS product cyclase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933918.1 protein_id gnl|my_center|LOCUS_20220 1394 1212 gene locus_tag LOCUS_20230 1394 1212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20230 <2244 1519 gene locus_tag LOCUS_20240 <2244 1519 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011143410.1:ABC transporter ATP-binding protein >Feature sequence702 2090 1197 gene locus_tag LOCUS_20250 2090 1197 CDS product metalloenzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015942637.1 protein_id gnl|my_center|LOCUS_20250 >Feature sequence703 746 1318 gene locus_tag LOCUS_20260 746 1318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20260 >Feature sequence704 2 544 gene locus_tag LOCUS_20270 2 544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20270 740 1114 gene locus_tag LOCUS_20280 740 1114 CDS product TraR/DksA C4-type zinc finger protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164924922.1 protein_id gnl|my_center|LOCUS_20280 1861 1139 gene locus_tag LOCUS_20290 1861 1139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20290 >Feature sequence705 <2227 736 gene locus_tag LOCUS_20300 <2227 736 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164924817.1:bi-domain-containing oxidoreductase >Feature sequence706 491 1930 gene locus_tag LOCUS_20310 gene hslU 491 1930 CDS product ATP-dependent protease ATPase subunit HslU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_181406033.1 protein_id gnl|my_center|LOCUS_20310 >Feature sequence707 511 35 gene locus_tag LOCUS_20320 511 35 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20320 900 691 gene locus_tag LOCUS_20330 900 691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20330 >Feature sequence708 >Feature sequence709 340 35 gene locus_tag LOCUS_20340 340 35 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20340 1847 384 gene locus_tag LOCUS_20350 1847 384 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142346.1 protein_id gnl|my_center|LOCUS_20350 >Feature sequence710 >Feature sequence711 1869 91 gene locus_tag LOCUS_20360 1869 91 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000416279.1 protein_id gnl|my_center|LOCUS_20360 >Feature sequence712 589 1740 gene locus_tag LOCUS_20370 589 1740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20370 >Feature sequence713 <1 1572 gene locus_tag LOCUS_20380 <1 1572 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011144201.1:DUF1800 domain-containing protein >Feature sequence714 1162 353 gene locus_tag LOCUS_20390 1162 353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20390 1459 2118 gene locus_tag LOCUS_20400 gene rpoE 1459 2118 CDS product RNA polymerase sigma factor RpoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036461.1 protein_id gnl|my_center|LOCUS_20400 >Feature sequence715 >Feature sequence716 575 2074 gene locus_tag LOCUS_20410 gene hutH 575 2074 CDS product histidine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000631874.1 protein_id gnl|my_center|LOCUS_20410 >Feature sequence717 1877 960 gene locus_tag LOCUS_20420 1877 960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20420 >Feature sequence718 <1 518 gene locus_tag LOCUS_20430 <1 518 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012258908.1:MFS transporter 536 1375 gene locus_tag LOCUS_20440 gene legD1 536 1375 CDS product Dot/Icm type IV secretion system effector LegD1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948394.1 protein_id gnl|my_center|LOCUS_20440 1385 1861 gene locus_tag LOCUS_20450 1385 1861 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071200.1 protein_id gnl|my_center|LOCUS_20450 >Feature sequence719 342 2183 gene locus_tag LOCUS_20460 342 2183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20460 >Feature sequence720 1075 716 gene locus_tag LOCUS_20470 1075 716 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462150.1 protein_id gnl|my_center|LOCUS_20470 1696 1085 gene locus_tag LOCUS_20480 gene purN 1696 1085 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393541.1 protein_id gnl|my_center|LOCUS_20480 >Feature sequence721 667 404 gene locus_tag LOCUS_20490 667 404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20490 >Feature sequence722 158 1969 gene locus_tag LOCUS_20500 158 1969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20500 >Feature sequence723 383 1840 gene locus_tag LOCUS_20510 383 1840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20510 >Feature sequence724 191 1186 gene locus_tag LOCUS_20520 191 1186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20520 <2180 1183 gene locus_tag LOCUS_20530 <2180 1183 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011039084.1:NAD(P)/FAD-dependent oxidoreductase >Feature sequence725 161 946 gene locus_tag LOCUS_20540 161 946 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877942.1 protein_id gnl|my_center|LOCUS_20540 986 1201 gene locus_tag LOCUS_20550 986 1201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20550 1252 1327 gene locus_tag LOCUS_t00150 1252 1327 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence726 >Feature sequence727 72 893 gene locus_tag LOCUS_20560 gene ccsB 72 893 CDS product c-type cytochrome biogenesis protein CcsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943894.1 protein_id gnl|my_center|LOCUS_20560 >Feature sequence728 1203 604 gene locus_tag LOCUS_20570 1203 604 CDS product CDP-alcohol phosphatidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532444.1 protein_id gnl|my_center|LOCUS_20570 <2166 1286 gene locus_tag LOCUS_20580 <2166 1286 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003898036.1:metallophosphoesterase >Feature sequence729 237 653 gene locus_tag LOCUS_20590 237 653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20590 >Feature sequence730 1513 911 gene locus_tag LOCUS_20600 1513 911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20600 >Feature sequence731 1208 1981 gene locus_tag LOCUS_20610 1208 1981 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405200.1 protein_id gnl|my_center|LOCUS_20610 >Feature sequence732 >Feature sequence733 1514 858 gene locus_tag LOCUS_20620 1514 858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20620 >Feature sequence734 437 799 gene locus_tag LOCUS_20630 gene nifU 437 799 CDS product Fe-S cluster assembly scaffold protein NifU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393153.1 protein_id gnl|my_center|LOCUS_20630 >Feature sequence735 232 1206 gene locus_tag LOCUS_20640 232 1206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20640 1944 1147 gene locus_tag LOCUS_20650 1944 1147 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403708.1 protein_id gnl|my_center|LOCUS_20650 >Feature sequence736 2071 611 gene locus_tag LOCUS_20660 2071 611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20660 >Feature sequence737 728 336 gene locus_tag LOCUS_20670 728 336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20670 <2136 848 gene locus_tag LOCUS_20680 <2136 848 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943934.1:phosphoglucomutase/phosphomannomutase family protein >Feature sequence738 <1 634 gene locus_tag LOCUS_20690 <1 634 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010940709.1:heat-inducible transcriptional repressor HrcA 655 1512 gene locus_tag LOCUS_20700 655 1512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20700 >Feature sequence739 1 1095 gene locus_tag LOCUS_20710 1 1095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20710 1121 1825 gene locus_tag LOCUS_20720 1121 1825 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943121.1 protein_id gnl|my_center|LOCUS_20720 >Feature sequence740 >Feature sequence741 209 1816 gene locus_tag LOCUS_20730 209 1816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_20730 >Feature sequence742 483 947 gene locus_tag LOCUS_20740 483 947 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546571.1 protein_id gnl|my_center|LOCUS_20740 1019 1765 gene locus_tag LOCUS_20750 1019 1765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20750 >Feature sequence743 304 1074 gene locus_tag LOCUS_20760 304 1074 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118840046.1 protein_id gnl|my_center|LOCUS_20760 >Feature sequence744 <1 649 gene locus_tag LOCUS_20770 <1 649 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011969633.1:xanthine dehydrogenase family protein molybdopterin-binding subunit 642 1166 gene locus_tag LOCUS_20780 642 1166 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062284418.1 protein_id gnl|my_center|LOCUS_20780 1435 1316 gene locus_tag LOCUS_20790 1435 1316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20790 >Feature sequence745 861 454 gene locus_tag LOCUS_20800 861 454 CDS product CoA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393898.1 protein_id gnl|my_center|LOCUS_20800 <2097 873 gene locus_tag LOCUS_20810 <2097 873 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257643.1:carbamoyl-phosphate synthase large subunit >Feature sequence746 >Feature sequence747 >Feature sequence748 1330 530 gene locus_tag LOCUS_20820 gene lpxA 1330 530 CDS product acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771657.1 protein_id gnl|my_center|LOCUS_20820 >Feature sequence749 >Feature sequence750 1363 29 gene locus_tag LOCUS_20830 1363 29 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942689.1 protein_id gnl|my_center|LOCUS_20830 >Feature sequence751 >Feature sequence752 856 56 gene locus_tag LOCUS_20840 gene lpxI 856 56 CDS product UDP-2,3-diacylglucosamine diphosphatase LpxI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011791912.1 protein_id gnl|my_center|LOCUS_20840 1747 974 gene locus_tag LOCUS_20850 gene lpxA 1747 974 CDS product acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546244.1 protein_id gnl|my_center|LOCUS_20850 >Feature sequence753 1277 357 gene locus_tag LOCUS_20860 1277 357 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144111.1 protein_id gnl|my_center|LOCUS_20860 <2073 1380 gene locus_tag LOCUS_20870 <2073 1380 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011144112.1:peptide ABC transporter substrate-binding protein >Feature sequence754 306 1658 gene locus_tag LOCUS_20880 306 1658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255956.1 protein_id gnl|my_center|LOCUS_20880 >Feature sequence755 503 1306 gene locus_tag LOCUS_20890 503 1306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20890 1322 1651 gene locus_tag LOCUS_20900 1322 1651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20900 >Feature sequence756 >Feature sequence757 <1 1168 gene locus_tag LOCUS_20910 <1 1168 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942076.1:SpoIIE family protein phosphatase <2063 1253 gene locus_tag LOCUS_20920 <2063 1253 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011142299.1:VCBS repeat-containing protein >Feature sequence758 185 1705 gene locus_tag LOCUS_20930 185 1705 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964225.1 protein_id gnl|my_center|LOCUS_20930 >Feature sequence759 1194 1715 gene locus_tag LOCUS_20940 gene folK 1194 1715 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943608.1 protein_id gnl|my_center|LOCUS_20940 >Feature sequence760 <2049 611 gene locus_tag LOCUS_20950 <2049 611 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011792662.1:pyridoxal-dependent decarboxylase >Feature sequence761 450 1403 gene locus_tag LOCUS_20960 450 1403 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099798653.1 protein_id gnl|my_center|LOCUS_20960 >Feature sequence762 <1 612 gene locus_tag LOCUS_20970 <1 612 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257569.1:Glu/Leu/Phe/Val dehydrogenase 724 1086 gene locus_tag LOCUS_20980 gene arsC 724 1086 CDS product arsenate reductase (glutaredoxin) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072786.1 protein_id gnl|my_center|LOCUS_20980 >Feature sequence763 <1 1005 gene locus_tag LOCUS_20990 <1 1005 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011021201.1:ABC transporter ATP-binding protein 1028 1939 gene locus_tag LOCUS_21000 1028 1939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21000 >Feature sequence764 <1 883 gene locus_tag LOCUS_21010 <1 883 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012546788.1:glycosyltransferase family 4 protein 870 1379 gene locus_tag LOCUS_21020 870 1379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21020 2000 1497 gene locus_tag LOCUS_21030 gene purE 2000 1497 CDS product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172593.1 protein_id gnl|my_center|LOCUS_21030 >Feature sequence765 <2037 820 gene locus_tag LOCUS_21040 <2037 820 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003357329.1:acetyl-CoA C-acetyltransferase >Feature sequence766 713 108 gene locus_tag LOCUS_21050 713 108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21050 <2033 774 gene locus_tag LOCUS_21060 <2033 774 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010921413.1:pitrilysin family protein >Feature sequence767 800 513 gene locus_tag LOCUS_21070 800 513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_21070 1061 819 gene locus_tag LOCUS_21080 1061 819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21080 >Feature sequence768 1069 89 gene locus_tag LOCUS_21090 gene folD 1069 89 CDS product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393025.1 protein_id gnl|my_center|LOCUS_21090 >Feature sequence769 459 1400 gene locus_tag LOCUS_21100 459 1400 CDS product histone deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003891503.1 protein_id gnl|my_center|LOCUS_21100 1617 1910 gene locus_tag LOCUS_21110 1617 1910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21110 >Feature sequence770 >Feature sequence771 <1 1401 gene locus_tag LOCUS_21120 <1 1401 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164928421.1:S41 family peptidase >Feature sequence772 <2012 825 gene locus_tag LOCUS_21130 <2012 825 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008766268.1:arylsulfatase >Feature sequence773 <1 710 gene locus_tag LOCUS_21140 <1 710 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010940695.1:transcription-repair coupling factor 849 1982 gene locus_tag LOCUS_21150 849 1982 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943066.1 protein_id gnl|my_center|LOCUS_21150 >Feature sequence774