>Feature sequence001 2788 2609 gene locus_tag LOCUS_00010 2788 2609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_00010 3669 2797 gene locus_tag LOCUS_00020 3669 2797 CDS product CoB--CoM heterodisulfide reductase iron-sulfur subunit B family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391978.1 protein_id gnl|my_center|LOCUS_00020 5489 3741 gene locus_tag LOCUS_00030 5489 3741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00030 6516 7457 gene locus_tag LOCUS_00040 6516 7457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00040 8014 7463 gene locus_tag LOCUS_00050 8014 7463 CDS product archaemetzincin family Zn-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250129.1 protein_id gnl|my_center|LOCUS_00050 9386 8028 gene locus_tag LOCUS_00060 9386 8028 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941261.1 protein_id gnl|my_center|LOCUS_00060 10951 9416 gene locus_tag LOCUS_00070 10951 9416 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011369225.1 protein_id gnl|my_center|LOCUS_00070 11430 11564 gene locus_tag LOCUS_00080 11430 11564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00080 11527 12543 gene locus_tag LOCUS_00090 11527 12543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00090 12967 16359 gene locus_tag LOCUS_00100 12967 16359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00100 16464 16886 gene locus_tag LOCUS_00110 16464 16886 CDS product hydrogenase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876760.1 protein_id gnl|my_center|LOCUS_00110 17106 18251 gene locus_tag LOCUS_00120 17106 18251 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392333.1 protein_id gnl|my_center|LOCUS_00120 18440 21871 gene locus_tag LOCUS_00130 18440 21871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00130 23448 21868 gene locus_tag LOCUS_00140 23448 21868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00140 24478 24086 gene locus_tag LOCUS_00150 24478 24086 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937569.1 protein_id gnl|my_center|LOCUS_00150 25015 24518 gene locus_tag LOCUS_00160 25015 24518 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023986.1 protein_id gnl|my_center|LOCUS_00160 26183 25008 gene locus_tag LOCUS_00170 26183 25008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00170 27691 26183 gene locus_tag LOCUS_00180 27691 26183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00180 29034 27709 gene locus_tag LOCUS_00190 29034 27709 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937837.1 protein_id gnl|my_center|LOCUS_00190 29696 29031 gene locus_tag LOCUS_00200 29696 29031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546704.1 protein_id gnl|my_center|LOCUS_00200 30160 29912 gene locus_tag LOCUS_00210 30160 29912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00210 30463 30284 gene locus_tag LOCUS_00220 30463 30284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00220 >Feature sequence002 913 443 gene locus_tag LOCUS_00230 913 443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00230 6125 933 gene locus_tag LOCUS_00240 6125 933 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883981.1 protein_id gnl|my_center|LOCUS_00240 6883 7116 gene locus_tag LOCUS_00250 6883 7116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00250 10574 7713 gene locus_tag LOCUS_00260 10574 7713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00260 11590 10592 gene locus_tag LOCUS_00270 11590 10592 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001201234.1 protein_id gnl|my_center|LOCUS_00270 13230 11656 gene locus_tag LOCUS_00280 13230 11656 CDS product NAD(P)H-hydrate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164924808.1 protein_id gnl|my_center|LOCUS_00280 13606 14226 gene locus_tag LOCUS_00290 13606 14226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00290 14273 15601 gene locus_tag LOCUS_00300 14273 15601 CDS product COG3014 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000930348.1 protein_id gnl|my_center|LOCUS_00300 15747 16700 gene locus_tag LOCUS_00310 15747 16700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00310 18204 17149 gene locus_tag LOCUS_00320 gene mltC 18204 17149 CDS product membrane-bound lytic murein transglycosylase MltC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693158.1 protein_id gnl|my_center|LOCUS_00320 18925 18368 gene locus_tag LOCUS_00330 18925 18368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00330 19354 19082 gene locus_tag LOCUS_00340 19354 19082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00340 22077 19495 gene locus_tag LOCUS_00350 22077 19495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00350 24045 22381 gene locus_tag LOCUS_00360 24045 22381 CDS product bifunctional UDP-sugar hydrolase/5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082429.1 protein_id gnl|my_center|LOCUS_00360 24916 24113 gene locus_tag LOCUS_00370 24916 24113 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_144685205.1 protein_id gnl|my_center|LOCUS_00370 25659 25021 gene locus_tag LOCUS_00380 25659 25021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00380 >Feature sequence003 54 521 gene locus_tag LOCUS_00390 54 521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00390 1319 552 gene locus_tag LOCUS_00400 1319 552 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038759.1 protein_id gnl|my_center|LOCUS_00400 2352 1288 gene locus_tag LOCUS_00410 2352 1288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00410 4003 2618 gene locus_tag LOCUS_00420 4003 2618 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948760.1 protein_id gnl|my_center|LOCUS_00420 4904 4182 gene locus_tag LOCUS_00430 4904 4182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00430 5211 4948 gene locus_tag LOCUS_00440 5211 4948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00440 5622 5257 gene locus_tag LOCUS_00450 5622 5257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00450 7677 5881 gene locus_tag LOCUS_00460 7677 5881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00460 7802 8230 gene locus_tag LOCUS_00470 7802 8230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00470 8154 8675 gene locus_tag LOCUS_00480 8154 8675 CDS product PIN domain nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393507.1 protein_id gnl|my_center|LOCUS_00480 8742 9572 gene locus_tag LOCUS_00490 gene larE 8742 9572 CDS product ATP-dependent sacrificial sulfur transferase LarE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461498.1 protein_id gnl|my_center|LOCUS_00490 9776 11515 gene locus_tag LOCUS_00500 9776 11515 CDS product YcaO-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939485.1 protein_id gnl|my_center|LOCUS_00500 11990 13087 gene locus_tag LOCUS_00510 11990 13087 CDS product inositol-3-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065345.1 protein_id gnl|my_center|LOCUS_00510 13098 14420 gene locus_tag LOCUS_00520 13098 14420 CDS product bifunctional L-myo-inositol-1-phosphate cytidylyltransferase/CDP-L-myo-inositol myo-inositolphosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880881.1 protein_id gnl|my_center|LOCUS_00520 14563 15885 gene locus_tag LOCUS_00530 14563 15885 CDS product bifunctional L-myo-inositol-1-phosphate cytidylyltransferase/CDP-L-myo-inositol myo-inositolphosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880881.1 protein_id gnl|my_center|LOCUS_00530 15878 16465 gene locus_tag LOCUS_00540 15878 16465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00540 16526 16753 gene locus_tag LOCUS_00550 16526 16753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00550 16741 17235 gene locus_tag LOCUS_00560 16741 17235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00560 17248 17682 gene locus_tag LOCUS_00570 gene rfaE2 17248 17682 CDS product D-glycero-beta-D-manno-heptose 1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000364507.1 protein_id gnl|my_center|LOCUS_00570 18022 18984 gene locus_tag LOCUS_00580 18022 18984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00580 19120 19407 gene locus_tag LOCUS_00590 gene groES 19120 19407 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028171493.1 protein_id gnl|my_center|LOCUS_00590 19550 21172 gene locus_tag LOCUS_00600 gene groL 19550 21172 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939262.1 protein_id gnl|my_center|LOCUS_00600 21546 22388 gene locus_tag LOCUS_00610 21546 22388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00610 22826 24235 gene locus_tag LOCUS_00620 22826 24235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00620 24275 26023 gene locus_tag LOCUS_00630 24275 26023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00630 26034 26273 gene locus_tag LOCUS_00640 26034 26273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00640 >Feature sequence004 168 425 gene locus_tag LOCUS_00650 168 425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00650 964 407 gene locus_tag LOCUS_00660 964 407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00660 4089 961 gene locus_tag LOCUS_00670 4089 961 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705254.1 protein_id gnl|my_center|LOCUS_00670 5220 4102 gene locus_tag LOCUS_00680 5220 4102 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880852.1 protein_id gnl|my_center|LOCUS_00680 6917 5331 gene locus_tag LOCUS_00690 gene pyrG 6917 5331 CDS product CTP synthase (glutamine hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002657046.1 protein_id gnl|my_center|LOCUS_00690 7166 8491 gene locus_tag LOCUS_00700 gene der 7166 8491 CDS product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942865.1 protein_id gnl|my_center|LOCUS_00700 8512 9189 gene locus_tag LOCUS_00710 8512 9189 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006311306.1 protein_id gnl|my_center|LOCUS_00710 9176 10591 gene locus_tag LOCUS_00720 9176 10591 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939857.1 protein_id gnl|my_center|LOCUS_00720 10854 12269 gene locus_tag LOCUS_00730 10854 12269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00730 12492 12247 gene locus_tag LOCUS_00740 12492 12247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00740 12492 13421 gene locus_tag LOCUS_00750 12492 13421 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226734.1 protein_id gnl|my_center|LOCUS_00750 15491 13461 gene locus_tag LOCUS_00760 gene fusA 15491 13461 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393940.1 protein_id gnl|my_center|LOCUS_00760 16279 16923 gene locus_tag LOCUS_00770 16279 16923 CDS product endonuclease III domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870952.1 protein_id gnl|my_center|LOCUS_00770 17419 18315 gene locus_tag LOCUS_00780 gene menA 17419 18315 CDS product 1,4-dihydroxy-2-naphthoate octaprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391135.1 protein_id gnl|my_center|LOCUS_00780 18355 19647 gene locus_tag LOCUS_00790 gene purB 18355 19647 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942277.1 protein_id gnl|my_center|LOCUS_00790 19727 19918 gene locus_tag LOCUS_00800 19727 19918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00800 20018 21355 gene locus_tag LOCUS_00810 20018 21355 CDS product L,D-transpeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940204.1 protein_id gnl|my_center|LOCUS_00810 21301 22125 gene locus_tag LOCUS_00820 21301 22125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00820 22115 23896 gene locus_tag LOCUS_00830 22115 23896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00830 25907 23922 gene locus_tag LOCUS_00840 25907 23922 CDS product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056499.1 protein_id gnl|my_center|LOCUS_00840 >Feature sequence005 932 2221 gene locus_tag LOCUS_00850 932 2221 CDS product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940462.1 protein_id gnl|my_center|LOCUS_00850 2268 2489 gene locus_tag LOCUS_00860 2268 2489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00860 2597 3601 gene locus_tag LOCUS_00870 2597 3601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00870 3562 3792 gene locus_tag LOCUS_00880 3562 3792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00880 3866 4057 gene locus_tag LOCUS_00890 3866 4057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00890 4054 4290 gene locus_tag LOCUS_00900 4054 4290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00900 5560 4631 gene locus_tag LOCUS_00910 5560 4631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00910 5974 6714 gene locus_tag LOCUS_00920 5974 6714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870951.1 protein_id gnl|my_center|LOCUS_00920 7645 6797 gene locus_tag LOCUS_00930 7645 6797 CDS product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020084.1 protein_id gnl|my_center|LOCUS_00930 8393 7638 gene locus_tag LOCUS_00940 8393 7638 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933759.1 protein_id gnl|my_center|LOCUS_00940 9338 8469 gene locus_tag LOCUS_00950 9338 8469 CDS product zinc ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_165439262.1 protein_id gnl|my_center|LOCUS_00950 9638 9384 gene locus_tag LOCUS_00960 9638 9384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00960 9813 11072 gene locus_tag LOCUS_00970 9813 11072 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140777.1 protein_id gnl|my_center|LOCUS_00970 11273 14488 gene locus_tag LOCUS_00980 11273 14488 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000838383.1 protein_id gnl|my_center|LOCUS_00980 14564 14857 gene locus_tag LOCUS_00990 14564 14857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00990 15366 16007 gene locus_tag LOCUS_01000 15366 16007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000345920.1 protein_id gnl|my_center|LOCUS_01000 16019 17932 gene locus_tag LOCUS_01010 16019 17932 CDS product fumarate reductase/succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000050920.1 protein_id gnl|my_center|LOCUS_01010 17929 18702 gene locus_tag LOCUS_01020 17929 18702 CDS product succinate dehydrogenase/fumarate reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761731.1 protein_id gnl|my_center|LOCUS_01020 19005 19538 gene locus_tag LOCUS_01030 19005 19538 CDS product RsbRD N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393113.1 protein_id gnl|my_center|LOCUS_01030 19569 20645 gene locus_tag LOCUS_01040 gene dsrM 19569 20645 CDS product sulfate reduction electron transfer complex DsrMKJOP subunit DsrM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393108.1 protein_id gnl|my_center|LOCUS_01040 20648 22276 gene locus_tag LOCUS_01050 20648 22276 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393112.1 protein_id gnl|my_center|LOCUS_01050 22269 22655 gene locus_tag LOCUS_01060 gene dsrJ 22269 22655 CDS product sulfate reduction electron transfer complex DsrMKJOP subunit DsrJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393111.1 protein_id gnl|my_center|LOCUS_01060 22655 23470 gene locus_tag LOCUS_01070 22655 23470 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459005.1 protein_id gnl|my_center|LOCUS_01070 23481 24641 gene locus_tag LOCUS_01080 gene nrfD 23481 24641 CDS product polysulfide reductase NrfD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071541886.1 protein_id gnl|my_center|LOCUS_01080 24916 25104 gene locus_tag LOCUS_01090 24916 25104 CDS product ferredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940534.1 protein_id gnl|my_center|LOCUS_01090 25721 25269 gene locus_tag LOCUS_01100 25721 25269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01100 >Feature sequence006 520 266 gene locus_tag LOCUS_01110 520 266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01110 652 574 gene locus_tag LOCUS_t00010 652 574 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 3471 1000 gene locus_tag LOCUS_01120 gene lon 3471 1000 CDS product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942434.1 protein_id gnl|my_center|LOCUS_01120 4714 3464 gene locus_tag LOCUS_01130 gene clpX 4714 3464 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942435.1 protein_id gnl|my_center|LOCUS_01130 5365 4757 gene locus_tag LOCUS_01140 gene clpP 5365 4757 CDS product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545892.1 protein_id gnl|my_center|LOCUS_01140 6675 5371 gene locus_tag LOCUS_01150 gene tig 6675 5371 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942437.1 protein_id gnl|my_center|LOCUS_01150 6985 6901 gene locus_tag LOCUS_t00020 6985 6901 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 7788 7027 gene locus_tag LOCUS_01160 gene radC 7788 7027 CDS product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971736.1 protein_id gnl|my_center|LOCUS_01160 7963 8502 gene locus_tag LOCUS_01170 7963 8502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01170 8690 9691 gene locus_tag LOCUS_01180 gene plsX 8690 9691 CDS product phosphate acyltransferase PlsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942245.1 protein_id gnl|my_center|LOCUS_01180 9744 10493 gene locus_tag LOCUS_01190 gene fabG 9744 10493 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583308.1 protein_id gnl|my_center|LOCUS_01190 10584 10823 gene locus_tag LOCUS_01200 gene acpP 10584 10823 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005544465.1 protein_id gnl|my_center|LOCUS_01200 10975 12219 gene locus_tag LOCUS_01210 gene fabF 10975 12219 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544941.1 protein_id gnl|my_center|LOCUS_01210 12534 13793 gene locus_tag LOCUS_01220 12534 13793 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583175.1 protein_id gnl|my_center|LOCUS_01220 13794 14240 gene locus_tag LOCUS_01230 13794 14240 CDS product cytidine/deoxycytidylate deaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942329.1 protein_id gnl|my_center|LOCUS_01230 14237 14710 gene locus_tag LOCUS_01240 gene nrdR 14237 14710 CDS product transcriptional regulator NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942330.1 protein_id gnl|my_center|LOCUS_01240 14896 16011 gene locus_tag LOCUS_01250 gene ribD 14896 16011 CDS product bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942331.1 protein_id gnl|my_center|LOCUS_01250 16201 16863 gene locus_tag LOCUS_01260 16201 16863 CDS product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942332.1 protein_id gnl|my_center|LOCUS_01260 16856 18073 gene locus_tag LOCUS_01270 16856 18073 CDS product bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942333.1 protein_id gnl|my_center|LOCUS_01270 18150 18617 gene locus_tag LOCUS_01280 gene ribE 18150 18617 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942334.1 protein_id gnl|my_center|LOCUS_01280 18745 19185 gene locus_tag LOCUS_01290 gene nusB 18745 19185 CDS product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942335.1 protein_id gnl|my_center|LOCUS_01290 19340 21916 gene locus_tag LOCUS_01300 gene leuS 19340 21916 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942849.1 protein_id gnl|my_center|LOCUS_01300 22332 22790 gene locus_tag LOCUS_01310 22332 22790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01310 22790 23839 gene locus_tag LOCUS_01320 gene holA 22790 23839 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002362655.1 protein_id gnl|my_center|LOCUS_01320 24155 23883 gene locus_tag LOCUS_01330 gene rpsT 24155 23883 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942846.1 protein_id gnl|my_center|LOCUS_01330 24402 24217 gene locus_tag LOCUS_01340 24402 24217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01340 24344 25843 gene locus_tag LOCUS_01350 gene murJ 24344 25843 CDS product murein biosynthesis integral membrane protein MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941832.1 protein_id gnl|my_center|LOCUS_01350 >Feature sequence007 301 1164 gene locus_tag LOCUS_01360 301 1164 CDS product MEMO1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867663.1 protein_id gnl|my_center|LOCUS_01360 1275 2021 gene locus_tag LOCUS_01370 1275 2021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01370 2782 2258 gene locus_tag LOCUS_01380 2782 2258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01380 3221 3421 gene locus_tag LOCUS_01390 3221 3421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01390 3470 3658 gene locus_tag LOCUS_01400 3470 3658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01400 3745 4236 gene locus_tag LOCUS_01410 3745 4236 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546148.1 protein_id gnl|my_center|LOCUS_01410 4379 5146 gene locus_tag LOCUS_01420 gene cobB 4379 5146 CDS product NAD-dependent protein deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762545.1 protein_id gnl|my_center|LOCUS_01420 6103 5165 gene locus_tag LOCUS_01430 6103 5165 CDS product PAC2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775659.1 protein_id gnl|my_center|LOCUS_01430 6157 7566 gene locus_tag LOCUS_01440 6157 7566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01440 7594 7670 gene locus_tag LOCUS_t00030 7594 7670 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 8004 9449 gene locus_tag LOCUS_01450 8004 9449 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546582.1 protein_id gnl|my_center|LOCUS_01450 9418 10773 gene locus_tag LOCUS_01460 9418 10773 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164924829.1 protein_id gnl|my_center|LOCUS_01460 10990 11409 gene locus_tag LOCUS_01470 10990 11409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01470 11481 12410 gene locus_tag LOCUS_01480 11481 12410 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006313297.1 protein_id gnl|my_center|LOCUS_01480 12415 13200 gene locus_tag LOCUS_01490 12415 13200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01490 13247 15826 gene locus_tag LOCUS_01500 13247 15826 CDS product PEP/pyruvate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545874.1 protein_id gnl|my_center|LOCUS_01500 15841 16236 gene locus_tag LOCUS_01510 15841 16236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01510 16289 17125 gene locus_tag LOCUS_01520 16289 17125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01520 17154 18047 gene locus_tag LOCUS_01530 17154 18047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01530 19808 18033 gene locus_tag LOCUS_01540 19808 18033 CDS product aldehyde ferredoxin oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941578.1 protein_id gnl|my_center|LOCUS_01540 21181 19880 gene locus_tag LOCUS_01550 gene gabT 21181 19880 CDS product 4-aminobutyrate--2-oxoglutarate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964736.1 protein_id gnl|my_center|LOCUS_01550 22450 21248 gene locus_tag LOCUS_01560 22450 21248 CDS product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878528.1 protein_id gnl|my_center|LOCUS_01560 23928 22654 gene locus_tag LOCUS_01570 23928 22654 CDS product ArgE/DapE family deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063173608.1 protein_id gnl|my_center|LOCUS_01570 24593 23943 gene locus_tag LOCUS_01580 24593 23943 CDS product CoA transferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000525293.1 protein_id gnl|my_center|LOCUS_01580 25278 24583 gene locus_tag LOCUS_01590 25278 24583 CDS product CoA transferase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889327.1 protein_id gnl|my_center|LOCUS_01590 >Feature sequence008 31 1776 gene locus_tag LOCUS_01600 31 1776 CDS product aldehyde ferredoxin oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986475.1 protein_id gnl|my_center|LOCUS_01600 2142 2633 gene locus_tag LOCUS_01610 2142 2633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01610 3034 3630 gene locus_tag LOCUS_01620 3034 3630 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943910.1 protein_id gnl|my_center|LOCUS_01620 3696 4589 gene locus_tag LOCUS_01630 3696 4589 CDS product isocitrate lyase/PEP mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_225665727.1 protein_id gnl|my_center|LOCUS_01630 4691 5752 gene locus_tag LOCUS_01640 4691 5752 CDS product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266701.1 protein_id gnl|my_center|LOCUS_01640 5760 6245 gene locus_tag LOCUS_01650 5760 6245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01650 6253 7563 gene locus_tag LOCUS_01660 6253 7563 CDS product TRAP transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090565.1 protein_id gnl|my_center|LOCUS_01660 7628 8740 gene locus_tag LOCUS_01670 7628 8740 CDS product 2-methylaconitate cis-trans isomerase PrpF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967865.1 protein_id gnl|my_center|LOCUS_01670 8787 10052 gene locus_tag LOCUS_01680 gene leuC 8787 10052 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393737.1 protein_id gnl|my_center|LOCUS_01680 10046 10543 gene locus_tag LOCUS_01690 gene leuD 10046 10543 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868466.1 protein_id gnl|my_center|LOCUS_01690 11843 10851 gene locus_tag LOCUS_01700 11843 10851 CDS product GlxA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162840014.1 protein_id gnl|my_center|LOCUS_01700 12126 12581 gene locus_tag LOCUS_01710 12126 12581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01710 12669 12836 gene locus_tag LOCUS_01720 12669 12836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01720 14217 13087 gene locus_tag LOCUS_01730 14217 13087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01730 15601 14219 gene locus_tag LOCUS_01740 15601 14219 CDS product FAD-linked oxidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943908.1 protein_id gnl|my_center|LOCUS_01740 16652 15603 gene locus_tag LOCUS_01750 16652 15603 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879345.1 protein_id gnl|my_center|LOCUS_01750 18635 16686 gene locus_tag LOCUS_01760 18635 16686 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763545.1 protein_id gnl|my_center|LOCUS_01760 19018 18665 gene locus_tag LOCUS_01770 19018 18665 CDS product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932629.1 protein_id gnl|my_center|LOCUS_01770 19905 19180 gene locus_tag LOCUS_01780 19905 19180 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922324.1 protein_id gnl|my_center|LOCUS_01780 20313 20083 gene locus_tag LOCUS_01790 20313 20083 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422320.1 protein_id gnl|my_center|LOCUS_01790 21138 20776 gene locus_tag LOCUS_01800 21138 20776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01800 21579 22157 gene locus_tag LOCUS_01810 21579 22157 CDS product HDIG domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943410.1 protein_id gnl|my_center|LOCUS_01810 22778 22434 gene locus_tag LOCUS_01820 22778 22434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01820 23949 23440 gene locus_tag LOCUS_01830 23949 23440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01830 >Feature sequence009 1077 55 gene locus_tag LOCUS_01840 1077 55 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01840 2394 1132 gene locus_tag LOCUS_01850 2394 1132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01850 2986 6288 gene locus_tag LOCUS_01860 gene recC 2986 6288 CDS product exodeoxyribonuclease V subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942180.1 protein_id gnl|my_center|LOCUS_01860 6306 9932 gene locus_tag LOCUS_01870 gene recB 6306 9932 CDS product exodeoxyribonuclease V subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942181.1 protein_id gnl|my_center|LOCUS_01870 9934 11805 gene locus_tag LOCUS_01880 gene recD 9934 11805 CDS product exodeoxyribonuclease V subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942182.1 protein_id gnl|my_center|LOCUS_01880 11865 12827 gene locus_tag LOCUS_01890 11865 12827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01890 12943 13329 gene locus_tag LOCUS_01900 12943 13329 CDS product bacteriohemerythrin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083774559.1 protein_id gnl|my_center|LOCUS_01900 16244 13611 gene locus_tag LOCUS_01910 16244 13611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01910 18253 16511 gene locus_tag LOCUS_01920 18253 16511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01920 20332 18254 gene locus_tag LOCUS_01930 20332 18254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01930 21882 20392 gene locus_tag LOCUS_01940 21882 20392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01940 23767 21872 gene locus_tag LOCUS_01950 23767 21872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01950 >Feature sequence010 977 390 gene locus_tag LOCUS_01960 977 390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01960 2568 1474 gene locus_tag LOCUS_01970 2568 1474 CDS product ImmA/IrrE family metallo-endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387767.1 protein_id gnl|my_center|LOCUS_01970 2810 2580 gene locus_tag LOCUS_01980 2810 2580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01980 3719 3393 gene locus_tag LOCUS_01990 3719 3393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01990 3949 3719 gene locus_tag LOCUS_02000 3949 3719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02000 4836 4078 gene locus_tag LOCUS_02010 4836 4078 CDS product NAD-dependent protein deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967135.1 protein_id gnl|my_center|LOCUS_02010 5452 4889 gene locus_tag LOCUS_02020 5452 4889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02020 6027 5530 gene locus_tag LOCUS_02030 gene purE 6027 5530 CDS product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172593.1 protein_id gnl|my_center|LOCUS_02030 6778 6146 gene locus_tag LOCUS_02040 6778 6146 CDS product DUF3786 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_196768312.1 protein_id gnl|my_center|LOCUS_02040 6994 7716 gene locus_tag LOCUS_02050 6994 7716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02050 7938 8984 gene locus_tag LOCUS_02060 gene ychF 7938 8984 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256516.1 protein_id gnl|my_center|LOCUS_02060 9036 10097 gene locus_tag LOCUS_02070 gene argC 9036 10097 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000861219.1 protein_id gnl|my_center|LOCUS_02070 12472 10154 gene locus_tag LOCUS_02080 12472 10154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02080 12694 13461 gene locus_tag LOCUS_02090 12694 13461 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435866.1 protein_id gnl|my_center|LOCUS_02090 13470 14081 gene locus_tag LOCUS_02100 13470 14081 CDS product Maf family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869234.1 protein_id gnl|my_center|LOCUS_02100 16082 14121 gene locus_tag LOCUS_02110 16082 14121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02110 17345 16086 gene locus_tag LOCUS_02120 gene urtA 17345 16086 CDS product urea ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056962.1 protein_id gnl|my_center|LOCUS_02120 18975 17518 gene locus_tag LOCUS_02130 18975 17518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02130 20697 19285 gene locus_tag LOCUS_02140 20697 19285 CDS product SH3 domain-containing C40 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001268661.1 protein_id gnl|my_center|LOCUS_02140 21922 21101 gene locus_tag LOCUS_02150 gene proC 21922 21101 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023994.1 protein_id gnl|my_center|LOCUS_02150 22768 21989 gene locus_tag LOCUS_02160 22768 21989 CDS product EcsC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118012.1 protein_id gnl|my_center|LOCUS_02160 >Feature sequence011 902 36 gene locus_tag LOCUS_02170 902 36 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392921.1 protein_id gnl|my_center|LOCUS_02170 1754 918 gene locus_tag LOCUS_02180 1754 918 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392922.1 protein_id gnl|my_center|LOCUS_02180 2306 1863 gene locus_tag LOCUS_02190 gene nifU 2306 1863 CDS product Fe-S cluster assembly scaffold protein NifU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_124796962.1 protein_id gnl|my_center|LOCUS_02190 2619 2419 gene locus_tag LOCUS_02200 2619 2419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02200 3989 2736 gene locus_tag LOCUS_02210 3989 2736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02210 4420 4037 gene locus_tag LOCUS_02220 4420 4037 CDS product NifB/NifX family molybdenum-iron cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869146.1 protein_id gnl|my_center|LOCUS_02220 5105 4443 gene locus_tag LOCUS_02230 5105 4443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02230 6745 5396 gene locus_tag LOCUS_02240 gene orpR 6745 5396 CDS product sigma 54-interacting transcriptional regulator OrpR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939383.1 protein_id gnl|my_center|LOCUS_02240 7369 7707 gene locus_tag LOCUS_02250 7369 7707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02250 7953 10340 gene locus_tag LOCUS_02260 7953 10340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02260 10405 11325 gene locus_tag LOCUS_02270 10405 11325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02270 11389 12540 gene locus_tag LOCUS_02280 11389 12540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02280 12573 13559 gene locus_tag LOCUS_02290 12573 13559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02290 13563 15677 gene locus_tag LOCUS_02300 13563 15677 CDS product adenylate/guanylate cyclase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028841931.1 protein_id gnl|my_center|LOCUS_02300 15711 16535 gene locus_tag LOCUS_02310 15711 16535 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_044233703.1 protein_id gnl|my_center|LOCUS_02310 16551 17810 gene locus_tag LOCUS_02320 16551 17810 CDS product aconitase X inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870830.1 protein_id gnl|my_center|LOCUS_02320 17801 18205 gene locus_tag LOCUS_02330 17801 18205 CDS product DUF126 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877139.1 protein_id gnl|my_center|LOCUS_02330 19134 19481 gene locus_tag LOCUS_02340 19134 19481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02340 19733 20197 gene locus_tag LOCUS_02350 19733 20197 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258189.1 protein_id gnl|my_center|LOCUS_02350 20601 21224 gene locus_tag LOCUS_02360 20601 21224 CDS product DUF6088 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974802.1 protein_id gnl|my_center|LOCUS_02360 21226 22263 gene locus_tag LOCUS_02370 21226 22263 CDS product nucleotidyl transferase AbiEii/AbiGii toxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013448020.1 protein_id gnl|my_center|LOCUS_02370 >Feature sequence012 2082 439 gene locus_tag LOCUS_02380 2082 439 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763167.1 protein_id gnl|my_center|LOCUS_02380 3307 2561 gene locus_tag LOCUS_02390 3307 2561 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004523163.1 protein_id gnl|my_center|LOCUS_02390 4345 3587 gene locus_tag LOCUS_02400 4345 3587 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878326.1 protein_id gnl|my_center|LOCUS_02400 5343 4342 gene locus_tag LOCUS_02410 5343 4342 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938015.1 protein_id gnl|my_center|LOCUS_02410 6547 5675 gene locus_tag LOCUS_02420 6547 5675 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004435248.1 protein_id gnl|my_center|LOCUS_02420 8055 6646 gene locus_tag LOCUS_02430 8055 6646 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089186.1 protein_id gnl|my_center|LOCUS_02430 9261 8113 gene locus_tag LOCUS_02440 9261 8113 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902861.1 protein_id gnl|my_center|LOCUS_02440 9444 10175 gene locus_tag LOCUS_02450 9444 10175 CDS product NAD-dependent deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881424.1 protein_id gnl|my_center|LOCUS_02450 10172 10978 gene locus_tag LOCUS_02460 10172 10978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02460 11283 10975 gene locus_tag LOCUS_02470 11283 10975 CDS product HNH endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942712.1 protein_id gnl|my_center|LOCUS_02470 12051 11317 gene locus_tag LOCUS_02480 12051 11317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02480 12184 12011 gene locus_tag LOCUS_02490 12184 12011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02490 12235 12699 gene locus_tag LOCUS_02500 gene tadA 12235 12699 CDS product tRNA adenosine(34) deaminase TadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545402.1 protein_id gnl|my_center|LOCUS_02500 12709 12804 gene locus_tag LOCUS_t00040 12709 12804 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 12885 12978 gene locus_tag LOCUS_t00050 12885 12978 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 13139 14830 gene locus_tag LOCUS_02510 gene dnaX 13139 14830 CDS product DNA polymerase III subunit gamma/tau inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940771.1 protein_id gnl|my_center|LOCUS_02510 14827 15156 gene locus_tag LOCUS_02520 14827 15156 CDS product YbaB/EbfC family nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001996460.1 protein_id gnl|my_center|LOCUS_02520 15179 15790 gene locus_tag LOCUS_02530 gene recR 15179 15790 CDS product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421618.1 protein_id gnl|my_center|LOCUS_02530 15787 17163 gene locus_tag LOCUS_02540 15787 17163 CDS product FAD-linked oxidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943908.1 protein_id gnl|my_center|LOCUS_02540 18263 17160 gene locus_tag LOCUS_02550 18263 17160 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942347.1 protein_id gnl|my_center|LOCUS_02550 18475 19308 gene locus_tag LOCUS_02560 18475 19308 CDS product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869232.1 protein_id gnl|my_center|LOCUS_02560 19859 20716 gene locus_tag LOCUS_02570 19859 20716 CDS product DUF368 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263632.1 protein_id gnl|my_center|LOCUS_02570 <22445 20703 gene locus_tag LOCUS_02580 <22445 20703 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011792614.1:LPS assembly protein LptD >Feature sequence013 1429 332 gene locus_tag LOCUS_02590 1429 332 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249414.1 protein_id gnl|my_center|LOCUS_02590 2836 1634 gene locus_tag LOCUS_02600 2836 1634 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107381.1 protein_id gnl|my_center|LOCUS_02600 3467 3081 gene locus_tag LOCUS_02610 3467 3081 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141769.1 protein_id gnl|my_center|LOCUS_02610 3688 3464 gene locus_tag LOCUS_02620 3688 3464 CDS product type II toxin-antitoxin system prevent-host-death family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227972.1 protein_id gnl|my_center|LOCUS_02620 3937 3755 gene locus_tag LOCUS_02630 3937 3755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02630 4290 4571 gene locus_tag LOCUS_02640 4290 4571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02640 4575 4919 gene locus_tag LOCUS_02650 4575 4919 CDS product type II toxin-antitoxin system PemK/MazF family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001829891.1 protein_id gnl|my_center|LOCUS_02650 5301 6485 gene locus_tag LOCUS_02660 5301 6485 CDS product molybdopterin molybdotransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938250.1 protein_id gnl|my_center|LOCUS_02660 6482 8437 gene locus_tag LOCUS_02670 6482 8437 CDS product molybdopterin biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940249.1 protein_id gnl|my_center|LOCUS_02670 8418 8765 gene locus_tag LOCUS_02680 8418 8765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02680 8803 9351 gene locus_tag LOCUS_02690 gene mobB 8803 9351 CDS product molybdopterin-guanine dinucleotide biosynthesis protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393319.1 protein_id gnl|my_center|LOCUS_02690 9435 10235 gene locus_tag LOCUS_02700 gene tolQ 9435 10235 CDS product protein TolQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940706.1 protein_id gnl|my_center|LOCUS_02700 10243 10647 gene locus_tag LOCUS_02710 gene tolR 10243 10647 CDS product protein TolR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940705.1 protein_id gnl|my_center|LOCUS_02710 10652 11491 gene locus_tag LOCUS_02720 10652 11491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02720 11514 12851 gene locus_tag LOCUS_02730 gene tolB 11514 12851 CDS product Tol-Pal system beta propeller repeat protein TolB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940703.1 protein_id gnl|my_center|LOCUS_02730 13118 13657 gene locus_tag LOCUS_02740 gene pal 13118 13657 CDS product peptidoglycan-associated lipoprotein Pal inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940363.1 protein_id gnl|my_center|LOCUS_02740 13773 14627 gene locus_tag LOCUS_02750 gene ybgF 13773 14627 CDS product tol-pal system protein YbgF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545231.1 protein_id gnl|my_center|LOCUS_02750 14760 16451 gene locus_tag LOCUS_02760 14760 16451 CDS product chloride channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189745032.1 protein_id gnl|my_center|LOCUS_02760 17119 16499 gene locus_tag LOCUS_02770 17119 16499 CDS product thermonuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792219.1 protein_id gnl|my_center|LOCUS_02770 17332 17502 gene locus_tag LOCUS_02780 17332 17502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02780 17506 17721 gene locus_tag LOCUS_02790 17506 17721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02790 19090 17891 gene locus_tag LOCUS_02800 19090 17891 CDS product DUF1343 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545899.1 protein_id gnl|my_center|LOCUS_02800 19341 20252 gene locus_tag LOCUS_02810 19341 20252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02810 >Feature sequence014 1566 217 gene locus_tag LOCUS_02820 1566 217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02820 2579 1488 gene locus_tag LOCUS_02830 2579 1488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02830 2992 2576 gene locus_tag LOCUS_02840 2992 2576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02840 4827 3178 gene locus_tag LOCUS_02850 4827 3178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02850 7314 5074 gene locus_tag LOCUS_02860 7314 5074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02860 8437 9540 gene locus_tag LOCUS_02870 8437 9540 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878191.1 protein_id gnl|my_center|LOCUS_02870 9944 10387 gene locus_tag LOCUS_02880 9944 10387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02880 11101 10382 gene locus_tag LOCUS_02890 gene pyrF 11101 10382 CDS product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942107.1 protein_id gnl|my_center|LOCUS_02890 11215 11290 gene locus_tag LOCUS_t00060 11215 11290 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 11709 11936 gene locus_tag LOCUS_02900 11709 11936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02900 12667 11939 gene locus_tag LOCUS_02910 12667 11939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02910 13614 12742 gene locus_tag LOCUS_02920 13614 12742 CDS product Stp1/IreP family PP2C-type Ser/Thr phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002354922.1 protein_id gnl|my_center|LOCUS_02920 15171 13627 gene locus_tag LOCUS_02930 gene rng 15171 13627 CDS product ribonuclease G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943853.1 protein_id gnl|my_center|LOCUS_02930 17733 15223 gene locus_tag LOCUS_02940 17733 15223 CDS product TIGR03960 family B12-binding radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943854.1 protein_id gnl|my_center|LOCUS_02940 19343 18030 gene locus_tag LOCUS_02950 19343 18030 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942140.1 protein_id gnl|my_center|LOCUS_02950 19272 19469 gene locus_tag LOCUS_02960 19272 19469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02960 19503 19631 gene locus_tag LOCUS_02970 19503 19631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02970 20946 19735 gene locus_tag LOCUS_02980 20946 19735 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942139.1 protein_id gnl|my_center|LOCUS_02980 21369 21581 gene locus_tag LOCUS_02990 21369 21581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02990 >Feature sequence015 1427 780 gene locus_tag LOCUS_03000 1427 780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03000 1978 1616 gene locus_tag LOCUS_03010 1978 1616 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019079176.1 protein_id gnl|my_center|LOCUS_03010 2736 2053 gene locus_tag LOCUS_03020 2736 2053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03020 3308 3132 gene locus_tag LOCUS_03030 3308 3132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03030 3589 5106 gene locus_tag LOCUS_03040 3589 5106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03040 5527 5120 gene locus_tag LOCUS_03050 5527 5120 CDS product Zn-ribbon domain-containing OB-fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878788.1 protein_id gnl|my_center|LOCUS_03050 6696 5530 gene locus_tag LOCUS_03060 6696 5530 CDS product beta-ketoacyl synthase N-terminal-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878787.1 protein_id gnl|my_center|LOCUS_03060 7917 6772 gene locus_tag LOCUS_03070 7917 6772 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245114.1 protein_id gnl|my_center|LOCUS_03070 9055 8288 gene locus_tag LOCUS_03080 9055 8288 CDS product 3-hydroxyacyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102518.1 protein_id gnl|my_center|LOCUS_03080 10938 9415 gene locus_tag LOCUS_03090 10938 9415 CDS product fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085732.1 protein_id gnl|my_center|LOCUS_03090 11848 11054 gene locus_tag LOCUS_03100 11848 11054 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256968.1 protein_id gnl|my_center|LOCUS_03100 12351 11851 gene locus_tag LOCUS_03110 12351 11851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03110 13590 12376 gene locus_tag LOCUS_03120 13590 12376 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256969.1 protein_id gnl|my_center|LOCUS_03120 14759 13713 gene locus_tag LOCUS_03130 14759 13713 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391254.1 protein_id gnl|my_center|LOCUS_03130 15647 14763 gene locus_tag LOCUS_03140 15647 14763 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391255.1 protein_id gnl|my_center|LOCUS_03140 17554 15656 gene locus_tag LOCUS_03150 17554 15656 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256972.1 protein_id gnl|my_center|LOCUS_03150 18359 17580 gene locus_tag LOCUS_03160 18359 17580 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256973.1 protein_id gnl|my_center|LOCUS_03160 18649 18374 gene locus_tag LOCUS_03170 18649 18374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03170 19486 18842 gene locus_tag LOCUS_03180 19486 18842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03180 19784 20557 gene locus_tag LOCUS_03190 19784 20557 CDS product crotonase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091874.1 protein_id gnl|my_center|LOCUS_03190 >Feature sequence016 1274 993 gene locus_tag LOCUS_03200 1274 993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03200 3576 1741 gene locus_tag LOCUS_03210 3576 1741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03210 6184 3581 gene locus_tag LOCUS_03220 6184 3581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03220 6598 7899 gene locus_tag LOCUS_03230 6598 7899 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392350.1 protein_id gnl|my_center|LOCUS_03230 8053 9252 gene locus_tag LOCUS_03240 8053 9252 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093049.1 protein_id gnl|my_center|LOCUS_03240 10069 9410 gene locus_tag LOCUS_03250 10069 9410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03250 12425 10197 gene locus_tag LOCUS_03260 12425 10197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03260 13774 12425 gene locus_tag LOCUS_03270 gene fslC 13774 12425 CDS product rhizoferrin biosystnesis N-citrylornithine decarboxylase FslC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003022882.1 protein_id gnl|my_center|LOCUS_03270 15036 13969 gene locus_tag LOCUS_03280 15036 13969 CDS product ATP-grasp domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582961.1 protein_id gnl|my_center|LOCUS_03280 15306 15037 gene locus_tag LOCUS_03290 15306 15037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03290 17031 15400 gene locus_tag LOCUS_03300 17031 15400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03300 17464 18117 gene locus_tag LOCUS_03310 17464 18117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03310 18267 21296 gene locus_tag LOCUS_03320 18267 21296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03320 >Feature sequence017 <1 951 gene locus_tag LOCUS_03330 <1 951 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011393625.1:GTP 3',8-cyclase MoaA 2138 1293 gene locus_tag LOCUS_03340 2138 1293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03340 2650 2138 gene locus_tag LOCUS_03350 2650 2138 CDS product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164931087.1 protein_id gnl|my_center|LOCUS_03350 2959 3906 gene locus_tag LOCUS_03360 gene amrB 2959 3906 CDS product AmmeMemoRadiSam system protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875685.1 protein_id gnl|my_center|LOCUS_03360 6322 3872 gene locus_tag LOCUS_03370 gene priA 6322 3872 CDS product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989822.1 protein_id gnl|my_center|LOCUS_03370 7181 6354 gene locus_tag LOCUS_03380 7181 6354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03380 7952 7254 gene locus_tag LOCUS_03390 7952 7254 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943737.1 protein_id gnl|my_center|LOCUS_03390 8067 8252 gene locus_tag LOCUS_03400 8067 8252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03400 8991 8290 gene locus_tag LOCUS_03410 gene mtgA 8991 8290 CDS product monofunctional biosynthetic peptidoglycan transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107650.1 protein_id gnl|my_center|LOCUS_03410 9837 8998 gene locus_tag LOCUS_03420 gene mazG 9837 8998 CDS product nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975271.1 protein_id gnl|my_center|LOCUS_03420 10276 9797 gene locus_tag LOCUS_03430 10276 9797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03430 10635 11867 gene locus_tag LOCUS_03440 10635 11867 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002673537.1 protein_id gnl|my_center|LOCUS_03440 12109 12621 gene locus_tag LOCUS_03450 12109 12621 CDS product DUF992 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006311346.1 protein_id gnl|my_center|LOCUS_03450 13552 12842 gene locus_tag LOCUS_03460 13552 12842 CDS product queuosine precursor transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011174123.1 protein_id gnl|my_center|LOCUS_03460 15183 13609 gene locus_tag LOCUS_03470 15183 13609 CDS product DUF4301 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787470.1 protein_id gnl|my_center|LOCUS_03470 15502 17322 gene locus_tag LOCUS_03480 gene ftsH 15502 17322 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_200858940.1 protein_id gnl|my_center|LOCUS_03480 17340 18188 gene locus_tag LOCUS_03490 gene folP 17340 18188 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545277.1 protein_id gnl|my_center|LOCUS_03490 18458 19225 gene locus_tag LOCUS_03500 18458 19225 CDS product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942579.1 protein_id gnl|my_center|LOCUS_03500 20070 19258 gene locus_tag LOCUS_03510 20070 19258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03510 <21029 20391 gene locus_tag LOCUS_03520 <21029 20391 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010932971.1:DNA alkylation repair protein >Feature sequence018 1467 1096 gene locus_tag LOCUS_03530 1467 1096 CDS product DUF1992 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028842486.1 protein_id gnl|my_center|LOCUS_03530 1654 2118 gene locus_tag LOCUS_03540 1654 2118 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393684.1 protein_id gnl|my_center|LOCUS_03540 2361 3656 gene locus_tag LOCUS_03550 gene hemL 2361 3656 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460175.1 protein_id gnl|my_center|LOCUS_03550 3731 3949 gene locus_tag LOCUS_03560 3731 3949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03560 4060 4350 gene locus_tag LOCUS_03570 4060 4350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03570 4353 5042 gene locus_tag LOCUS_03580 4353 5042 CDS product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941002.1 protein_id gnl|my_center|LOCUS_03580 5143 5520 gene locus_tag LOCUS_03590 5143 5520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03590 5650 6285 gene locus_tag LOCUS_03600 5650 6285 CDS product redox-sensing transcriptional repressor Rex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938215.1 protein_id gnl|my_center|LOCUS_03600 9149 6324 gene locus_tag LOCUS_03610 gene uvrA 9149 6324 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943938.1 protein_id gnl|my_center|LOCUS_03610 9462 9638 gene locus_tag LOCUS_03620 9462 9638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03620 9847 10467 gene locus_tag LOCUS_03630 gene lexA 9847 10467 CDS product transcriptional repressor LexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894124.1 protein_id gnl|my_center|LOCUS_03630 10475 11242 gene locus_tag LOCUS_03640 10475 11242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03640 11310 14195 gene locus_tag LOCUS_03650 11310 14195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03650 14188 15006 gene locus_tag LOCUS_03660 14188 15006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03660 15847 16449 gene locus_tag LOCUS_03670 15847 16449 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056199.1 protein_id gnl|my_center|LOCUS_03670 16856 17206 gene locus_tag LOCUS_03680 16856 17206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03680 17225 18280 gene locus_tag LOCUS_03690 17225 18280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03690 19762 18515 gene locus_tag LOCUS_03700 19762 18515 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006313130.1 protein_id gnl|my_center|LOCUS_03700 20421 19759 gene locus_tag LOCUS_03710 20421 19759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03710 >Feature sequence019 1616 1008 gene locus_tag LOCUS_03720 1616 1008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03720 2044 1619 gene locus_tag LOCUS_03730 2044 1619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03730 2315 2067 gene locus_tag LOCUS_03740 2315 2067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03740 3323 2352 gene locus_tag LOCUS_03750 3323 2352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_03750 4002 3328 gene locus_tag LOCUS_03760 gene atpB 4002 3328 CDS product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_196768272.1 protein_id gnl|my_center|LOCUS_03760 4404 4027 gene locus_tag LOCUS_03770 4404 4027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03770 4730 4401 gene locus_tag LOCUS_03780 4730 4401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03780 5296 4838 gene locus_tag LOCUS_03790 5296 4838 CDS product YbhB/YbcL family Raf kinase inhibitor-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875912.1 protein_id gnl|my_center|LOCUS_03790 6236 5499 gene locus_tag LOCUS_03800 6236 5499 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_165443456.1 protein_id gnl|my_center|LOCUS_03800 7026 6229 gene locus_tag LOCUS_03810 7026 6229 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041213497.1 protein_id gnl|my_center|LOCUS_03810 7936 7094 gene locus_tag LOCUS_03820 7936 7094 CDS product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938265.1 protein_id gnl|my_center|LOCUS_03820 8230 8412 gene locus_tag LOCUS_03830 8230 8412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03830 9685 8441 gene locus_tag LOCUS_03840 9685 8441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03840 10741 9749 gene locus_tag LOCUS_03850 10741 9749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03850 11672 10710 gene locus_tag LOCUS_03860 11672 10710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03860 13588 11939 gene locus_tag LOCUS_03870 13588 11939 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814052.1 protein_id gnl|my_center|LOCUS_03870 15281 13626 gene locus_tag LOCUS_03880 15281 13626 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459443.1 protein_id gnl|my_center|LOCUS_03880 17177 15288 gene locus_tag LOCUS_03890 17177 15288 CDS product TRAP transporter fused permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041271912.1 protein_id gnl|my_center|LOCUS_03890 18164 17187 gene locus_tag LOCUS_03900 18164 17187 CDS product TAXI family TRAP transporter solute-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878139.1 protein_id gnl|my_center|LOCUS_03900 19346 18333 gene locus_tag LOCUS_03910 19346 18333 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989600.1 protein_id gnl|my_center|LOCUS_03910 20152 19373 gene locus_tag LOCUS_03920 20152 19373 CDS product FadR/GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811089.1 protein_id gnl|my_center|LOCUS_03920 >Feature sequence020 376 744 gene locus_tag LOCUS_03930 gene rbfA 376 744 CDS product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001829509.1 protein_id gnl|my_center|LOCUS_03930 745 1701 gene locus_tag LOCUS_03940 745 1701 CDS product bifunctional oligoribonuclease/PAP phosphatase NrnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942235.1 protein_id gnl|my_center|LOCUS_03940 1784 2716 gene locus_tag LOCUS_03950 gene truB 1784 2716 CDS product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942236.1 protein_id gnl|my_center|LOCUS_03950 2816 3085 gene locus_tag LOCUS_03960 gene rpsO 2816 3085 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942237.1 protein_id gnl|my_center|LOCUS_03960 3194 5290 gene locus_tag LOCUS_03970 gene pnp 3194 5290 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041914012.1 protein_id gnl|my_center|LOCUS_03970 5283 6542 gene locus_tag LOCUS_03980 5283 6542 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942239.1 protein_id gnl|my_center|LOCUS_03980 6619 7071 gene locus_tag LOCUS_03990 gene dut 6619 7071 CDS product dUTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942240.1 protein_id gnl|my_center|LOCUS_03990 7068 7874 gene locus_tag LOCUS_04000 7068 7874 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014551636.1 protein_id gnl|my_center|LOCUS_04000 8472 9284 gene locus_tag LOCUS_04010 8472 9284 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963826.1 protein_id gnl|my_center|LOCUS_04010 9634 10131 gene locus_tag LOCUS_04020 9634 10131 CDS product tRNA (cytidine(34)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941854.1 protein_id gnl|my_center|LOCUS_04020 11208 10162 gene locus_tag LOCUS_04030 11208 10162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546406.1 protein_id gnl|my_center|LOCUS_04030 11935 11201 gene locus_tag LOCUS_04040 11935 11201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04040 12314 11919 gene locus_tag LOCUS_04050 12314 11919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04050 12744 12316 gene locus_tag LOCUS_04060 12744 12316 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021779456.1 protein_id gnl|my_center|LOCUS_04060 13355 12729 gene locus_tag LOCUS_04070 13355 12729 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091163.1 protein_id gnl|my_center|LOCUS_04070 13665 15398 gene locus_tag LOCUS_04080 13665 15398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04080 15573 15367 gene locus_tag LOCUS_04090 15573 15367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04090 16812 15853 gene locus_tag LOCUS_04100 16812 15853 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761587.1 protein_id gnl|my_center|LOCUS_04100 17567 16815 gene locus_tag LOCUS_04110 17567 16815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04110 18792 17569 gene locus_tag LOCUS_04120 18792 17569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04120 19451 19074 gene locus_tag LOCUS_04130 19451 19074 CDS product zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545694.1 protein_id gnl|my_center|LOCUS_04130 >Feature sequence021 217 2271 gene locus_tag LOCUS_04140 217 2271 CDS product xanthine dehydrogenase family protein molybdopterin-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975050.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04140 2348 2476 gene locus_tag LOCUS_04150 2348 2476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04150 2473 2679 gene locus_tag LOCUS_04160 2473 2679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04160 2816 3340 gene locus_tag LOCUS_04170 2816 3340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04170 3340 3819 gene locus_tag LOCUS_04180 3340 3819 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062284418.1 protein_id gnl|my_center|LOCUS_04180 4233 5375 gene locus_tag LOCUS_04190 4233 5375 CDS product saccharopine dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879085.1 protein_id gnl|my_center|LOCUS_04190 5396 6646 gene locus_tag LOCUS_04200 gene hemL 5396 6646 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878736.1 protein_id gnl|my_center|LOCUS_04200 9158 6777 gene locus_tag LOCUS_04210 9158 6777 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861444.1 protein_id gnl|my_center|LOCUS_04210 9930 9457 gene locus_tag LOCUS_04220 9930 9457 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062284418.1 protein_id gnl|my_center|LOCUS_04220 10981 10112 gene locus_tag LOCUS_04230 10981 10112 CDS product xanthine dehydrogenase family protein subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969635.1 protein_id gnl|my_center|LOCUS_04230 12648 11350 gene locus_tag LOCUS_04240 12648 11350 CDS product phenylacetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942694.1 protein_id gnl|my_center|LOCUS_04240 14218 12914 gene locus_tag LOCUS_04250 14218 12914 CDS product TRAP transporter large permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942699.1 protein_id gnl|my_center|LOCUS_04250 14706 14215 gene locus_tag LOCUS_04260 14706 14215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04260 15908 14883 gene locus_tag LOCUS_04270 15908 14883 CDS product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942697.1 protein_id gnl|my_center|LOCUS_04270 16431 16237 gene locus_tag LOCUS_04280 16431 16237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04280 18144 16516 gene locus_tag LOCUS_04290 18144 16516 CDS product methylmalonyl-CoA mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879704.1 protein_id gnl|my_center|LOCUS_04290 18666 18268 gene locus_tag LOCUS_04300 18666 18268 CDS product cobalamin B12-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888664.1 protein_id gnl|my_center|LOCUS_04300 19443 18712 gene locus_tag LOCUS_04310 19443 18712 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391621.1 protein_id gnl|my_center|LOCUS_04310 <20366 19545 gene locus_tag LOCUS_04320 <20366 19545 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_037391689.1:CaiB/BaiF CoA-transferase family protein >Feature sequence022 1339 395 gene locus_tag LOCUS_04330 1339 395 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943691.1 protein_id gnl|my_center|LOCUS_04330 2017 3363 gene locus_tag LOCUS_04340 gene dnaA 2017 3363 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947895.1 protein_id gnl|my_center|LOCUS_04340 3828 3646 gene locus_tag LOCUS_04350 3828 3646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04350 4818 3847 gene locus_tag LOCUS_04360 4818 3847 CDS product D-glycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393452.1 protein_id gnl|my_center|LOCUS_04360 5677 4832 gene locus_tag LOCUS_04370 5677 4832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04370 6737 5715 gene locus_tag LOCUS_04380 6737 5715 CDS product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940684.1 protein_id gnl|my_center|LOCUS_04380 9339 6919 gene locus_tag LOCUS_04390 gene gyrA 9339 6919 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940682.1 protein_id gnl|my_center|LOCUS_04390 11763 9373 gene locus_tag LOCUS_04400 gene gyrB 11763 9373 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937314.1 protein_id gnl|my_center|LOCUS_04400 12880 11765 gene locus_tag LOCUS_04410 gene dnaN 12880 11765 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940679.1 protein_id gnl|my_center|LOCUS_04410 14478 13162 gene locus_tag LOCUS_04420 gene dnaA 14478 13162 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003727573.1 protein_id gnl|my_center|LOCUS_04420 14581 15330 gene locus_tag LOCUS_04430 14581 15330 CDS product carbon monoxide dehydrogenase accessory protein CooC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418348.1 protein_id gnl|my_center|LOCUS_04430 15662 16984 gene locus_tag LOCUS_04440 15662 16984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04440 16984 17403 gene locus_tag LOCUS_04450 16984 17403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04450 17440 17568 gene locus_tag LOCUS_04460 17440 17568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04460 17607 19037 gene locus_tag LOCUS_04470 17607 19037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_04470 19242 19646 gene locus_tag LOCUS_04480 19242 19646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_04480 >Feature sequence023 5560 1844 gene locus_tag LOCUS_04490 gene recB 5560 1844 CDS product exodeoxyribonuclease V subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942181.1 protein_id gnl|my_center|LOCUS_04490 8823 5563 gene locus_tag LOCUS_04500 gene recC 8823 5563 CDS product exodeoxyribonuclease V subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942180.1 protein_id gnl|my_center|LOCUS_04500 10070 8949 gene locus_tag LOCUS_04510 gene dpaL 10070 8949 CDS product diaminopropionate ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047950.1 protein_id gnl|my_center|LOCUS_04510 11105 10425 gene locus_tag LOCUS_04520 11105 10425 CDS product glycerophosphodiester phosphodiesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978652.1 protein_id gnl|my_center|LOCUS_04520 11857 11144 gene locus_tag LOCUS_04530 11857 11144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04530 14869 13556 gene locus_tag LOCUS_04540 14869 13556 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089286.1 protein_id gnl|my_center|LOCUS_04540 15889 15284 gene locus_tag LOCUS_04550 gene recR 15889 15284 CDS product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421618.1 protein_id gnl|my_center|LOCUS_04550 16294 15971 gene locus_tag LOCUS_04560 16294 15971 CDS product YbaB/EbfC family nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391577.1 protein_id gnl|my_center|LOCUS_04560 17305 16343 gene locus_tag LOCUS_04570 17305 16343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04570 17682 17380 gene locus_tag LOCUS_04580 17682 17380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04580 19014 17821 gene locus_tag LOCUS_04590 19014 17821 CDS product acetylornithine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393770.1 protein_id gnl|my_center|LOCUS_04590 20033 19134 gene locus_tag LOCUS_04600 gene argB 20033 19134 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938759.1 protein_id gnl|my_center|LOCUS_04600 >Feature sequence024 1056 277 gene locus_tag LOCUS_04610 1056 277 CDS product ribonuclease H-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938290.1 protein_id gnl|my_center|LOCUS_04610 1506 2495 gene locus_tag LOCUS_04620 1506 2495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04620 2492 3559 gene locus_tag LOCUS_04630 2492 3559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04630 3598 4290 gene locus_tag LOCUS_04640 3598 4290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04640 4205 5392 gene locus_tag LOCUS_04650 4205 5392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04650 6574 9252 gene locus_tag LOCUS_04660 6574 9252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04660 9249 9695 gene locus_tag LOCUS_04670 gene csm2 9249 9695 CDS product type III-A CRISPR-associated protein Csm2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256464.1 protein_id gnl|my_center|LOCUS_04670 9698 10546 gene locus_tag LOCUS_04680 gene csm3 9698 10546 CDS product type III-A CRISPR-associated RAMP protein Csm3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082356.1 protein_id gnl|my_center|LOCUS_04680 10556 11563 gene locus_tag LOCUS_04690 gene csm4 10556 11563 CDS product type III-A CRISPR-associated RAMP protein Csm4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546537.1 protein_id gnl|my_center|LOCUS_04690 11560 13143 gene locus_tag LOCUS_04700 11560 13143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04700 13169 13714 gene locus_tag LOCUS_04710 13169 13714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04710 13743 13892 gene locus_tag LOCUS_04720 13743 13892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04720 13901 14293 gene locus_tag LOCUS_04730 gene csx20 13901 14293 CDS product CRISPR-associated protein Csx20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010871197.1 protein_id gnl|my_center|LOCUS_04730 14365 15681 gene locus_tag LOCUS_04740 14365 15681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04740 16009 17429 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtttgaagcattgccccgatttgaggggattgagac 17790 18014 gene locus_tag LOCUS_04750 17790 18014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04750 >Feature sequence025 2140 3147 gene locus_tag LOCUS_04760 2140 3147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04760 3349 5163 gene locus_tag LOCUS_04770 3349 5163 CDS product carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976109.1 protein_id gnl|my_center|LOCUS_04770 5313 5717 gene locus_tag LOCUS_04780 5313 5717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04780 5728 5886 gene locus_tag LOCUS_04790 5728 5886 CDS product DUF5989 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975331.1 protein_id gnl|my_center|LOCUS_04790 5940 7232 gene locus_tag LOCUS_04800 5940 7232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04800 7337 8689 gene locus_tag LOCUS_04810 7337 8689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04810 8907 9803 gene locus_tag LOCUS_04820 8907 9803 CDS product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942733.1 protein_id gnl|my_center|LOCUS_04820 9831 10457 gene locus_tag LOCUS_04830 9831 10457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04830 10678 11307 gene locus_tag LOCUS_04840 gene grpE 10678 11307 CDS product nucleotide exchange factor GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816478.1 protein_id gnl|my_center|LOCUS_04840 11351 13258 gene locus_tag LOCUS_04850 gene dnaK 11351 13258 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940711.1 protein_id gnl|my_center|LOCUS_04850 13255 15105 gene locus_tag LOCUS_04860 13255 15105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04860 15782 15153 gene locus_tag LOCUS_04870 15782 15153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04870 16023 17066 gene locus_tag LOCUS_04880 gene pdxA 16023 17066 CDS product 4-hydroxythreonine-4-phosphate dehydrogenase PdxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940791.1 protein_id gnl|my_center|LOCUS_04880 17180 17395 gene locus_tag LOCUS_04890 17180 17395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04890 17817 17566 gene locus_tag LOCUS_04900 17817 17566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04900 18205 18396 gene locus_tag LOCUS_04910 18205 18396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04910 18446 18760 gene locus_tag LOCUS_04920 18446 18760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04920 19299 18943 gene locus_tag LOCUS_04930 19299 18943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04930 >Feature sequence026 1201 611 gene locus_tag LOCUS_04940 1201 611 CDS product pyruvate kinase alpha/beta domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080707.1 protein_id gnl|my_center|LOCUS_04940 2428 1244 gene locus_tag LOCUS_04950 2428 1244 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393775.1 protein_id gnl|my_center|LOCUS_04950 3195 2665 gene locus_tag LOCUS_04960 3195 2665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04960 3941 3288 gene locus_tag LOCUS_04970 3941 3288 CDS product carboxylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001165959.1 protein_id gnl|my_center|LOCUS_04970 5372 4119 gene locus_tag LOCUS_04980 5372 4119 CDS product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809685.1 protein_id gnl|my_center|LOCUS_04980 6158 5496 gene locus_tag LOCUS_04990 6158 5496 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459138.1 protein_id gnl|my_center|LOCUS_04990 8662 6164 gene locus_tag LOCUS_05000 8662 6164 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011761921.1 protein_id gnl|my_center|LOCUS_05000 9448 8723 gene locus_tag LOCUS_05010 9448 8723 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583300.1 protein_id gnl|my_center|LOCUS_05010 10066 9614 gene locus_tag LOCUS_05020 10066 9614 CDS product Zn-ribbon domain-containing OB-fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877533.1 protein_id gnl|my_center|LOCUS_05020 11238 10069 gene locus_tag LOCUS_05030 11238 10069 CDS product thiolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_211204333.1 protein_id gnl|my_center|LOCUS_05030 11835 11323 gene locus_tag LOCUS_05040 11835 11323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05040 13105 12299 gene locus_tag LOCUS_05050 13105 12299 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942649.1 protein_id gnl|my_center|LOCUS_05050 14522 13281 gene locus_tag LOCUS_05060 14522 13281 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965775.1 protein_id gnl|my_center|LOCUS_05060 15364 14660 gene locus_tag LOCUS_05070 15364 14660 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000062202.1 protein_id gnl|my_center|LOCUS_05070 15790 15383 gene locus_tag LOCUS_05080 15790 15383 CDS product cobalamin B12-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974171.1 protein_id gnl|my_center|LOCUS_05080 17494 15803 gene locus_tag LOCUS_05090 17494 15803 CDS product methylmalonyl-CoA mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867965.1 protein_id gnl|my_center|LOCUS_05090 19168 17540 gene locus_tag LOCUS_05100 19168 17540 CDS product ATP-dependent acyl-CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000892286.1 protein_id gnl|my_center|LOCUS_05100 >Feature sequence027 421 840 gene locus_tag LOCUS_05110 421 840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05110 786 1022 gene locus_tag LOCUS_05120 786 1022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05120 1003 1320 gene locus_tag LOCUS_05130 1003 1320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05130 2116 2862 gene locus_tag LOCUS_05140 2116 2862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05140 2887 3054 gene locus_tag LOCUS_05150 2887 3054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05150 3104 3271 gene locus_tag LOCUS_05160 3104 3271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05160 3329 4345 gene locus_tag LOCUS_05170 3329 4345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05170 4705 5664 gene locus_tag LOCUS_05180 gene ilvA 4705 5664 CDS product threonine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083156.1 protein_id gnl|my_center|LOCUS_05180 5678 6910 gene locus_tag LOCUS_05190 5678 6910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05190 7183 6914 gene locus_tag LOCUS_05200 7183 6914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05200 8842 7244 gene locus_tag LOCUS_05210 8842 7244 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867265.1 protein_id gnl|my_center|LOCUS_05210 8911 10419 gene locus_tag LOCUS_05220 8911 10419 CDS product M81 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040461.1 protein_id gnl|my_center|LOCUS_05220 12156 10534 gene locus_tag LOCUS_05230 12156 10534 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867265.1 protein_id gnl|my_center|LOCUS_05230 13390 12182 gene locus_tag LOCUS_05240 13390 12182 CDS product M81 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808661.1 protein_id gnl|my_center|LOCUS_05240 14095 14865 gene locus_tag LOCUS_05250 14095 14865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05250 14876 15505 gene locus_tag LOCUS_05260 14876 15505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05260 15520 16344 gene locus_tag LOCUS_05270 15520 16344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05270 16347 17012 gene locus_tag LOCUS_05280 16347 17012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05280 18702 17041 gene locus_tag LOCUS_05290 18702 17041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05290 19191 18949 gene locus_tag LOCUS_05300 19191 18949 CDS product Lrp/AsnC ligand binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978266.1 protein_id gnl|my_center|LOCUS_05300 >Feature sequence028 1412 126 gene locus_tag LOCUS_05310 gene hemA 1412 126 CDS product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943895.1 protein_id gnl|my_center|LOCUS_05310 2248 1418 gene locus_tag LOCUS_05320 gene ccsB 2248 1418 CDS product c-type cytochrome biogenesis protein CcsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943894.1 protein_id gnl|my_center|LOCUS_05320 2925 2245 gene locus_tag LOCUS_05330 2925 2245 CDS product bifunctional precorrin-2 dehydrogenase/sirohydrochlorin ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392765.1 protein_id gnl|my_center|LOCUS_05330 4181 3021 gene locus_tag LOCUS_05340 4181 3021 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016357.1 protein_id gnl|my_center|LOCUS_05340 4665 4321 gene locus_tag LOCUS_05350 4665 4321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05350 7084 4670 gene locus_tag LOCUS_05360 gene pheT 7084 4670 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942167.1 protein_id gnl|my_center|LOCUS_05360 8126 7110 gene locus_tag LOCUS_05370 gene pheS 8126 7110 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942166.1 protein_id gnl|my_center|LOCUS_05370 8804 8460 gene locus_tag LOCUS_05380 gene rplT 8804 8460 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942165.1 protein_id gnl|my_center|LOCUS_05380 9089 8892 gene locus_tag LOCUS_05390 gene rpmI 9089 8892 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942164.1 protein_id gnl|my_center|LOCUS_05390 9655 9254 gene locus_tag LOCUS_05400 gene infC 9655 9254 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391235.1 protein_id gnl|my_center|LOCUS_05400 11604 9778 gene locus_tag LOCUS_05410 gene thrS 11604 9778 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193360261.1 protein_id gnl|my_center|LOCUS_05410 12100 12026 gene locus_tag LOCUS_t00070 12100 12026 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 12581 12393 gene locus_tag LOCUS_05420 12581 12393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05420 13558 12581 gene locus_tag LOCUS_05430 13558 12581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05430 14609 13656 gene locus_tag LOCUS_05440 gene miaA 14609 13656 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942643.1 protein_id gnl|my_center|LOCUS_05440 16379 14658 gene locus_tag LOCUS_05450 gene mutL 16379 14658 CDS product DNA mismatch repair endonuclease MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942644.1 protein_id gnl|my_center|LOCUS_05450 16776 17831 gene locus_tag LOCUS_05460 16776 17831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05460 18102 17803 gene locus_tag LOCUS_05470 18102 17803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05470 >Feature sequence029 503 369 gene locus_tag LOCUS_05480 503 369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05480 799 500 gene locus_tag LOCUS_05490 799 500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_05490 2066 777 gene locus_tag LOCUS_05500 2066 777 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941927.1 protein_id gnl|my_center|LOCUS_05500 2992 2063 gene locus_tag LOCUS_05510 2992 2063 CDS product aspartate carbamoyltransferase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583924.1 protein_id gnl|my_center|LOCUS_05510 3809 3318 gene locus_tag LOCUS_05520 3809 3318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05520 4840 3806 gene locus_tag LOCUS_05530 4840 3806 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943459.1 protein_id gnl|my_center|LOCUS_05530 5547 4918 gene locus_tag LOCUS_05540 gene rpsD 5547 4918 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943460.1 protein_id gnl|my_center|LOCUS_05540 6251 5856 gene locus_tag LOCUS_05550 gene rpsK 6251 5856 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943461.1 protein_id gnl|my_center|LOCUS_05550 6641 6270 gene locus_tag LOCUS_05560 gene rpsM 6641 6270 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869905.1 protein_id gnl|my_center|LOCUS_05560 7112 6888 gene locus_tag LOCUS_05570 gene infA 7112 6888 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942395.1 protein_id gnl|my_center|LOCUS_05570 8468 7155 gene locus_tag LOCUS_05580 gene secY 8468 7155 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943466.1 protein_id gnl|my_center|LOCUS_05580 8958 8518 gene locus_tag LOCUS_05590 gene rplO 8958 8518 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966393.1 protein_id gnl|my_center|LOCUS_05590 9153 8977 gene locus_tag LOCUS_05600 gene rpmD 9153 8977 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000201159.1 protein_id gnl|my_center|LOCUS_05600 9659 9156 gene locus_tag LOCUS_05610 gene rpsE 9659 9156 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938615.1 protein_id gnl|my_center|LOCUS_05610 10101 9733 gene locus_tag LOCUS_05620 gene rplR 10101 9733 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943470.1 protein_id gnl|my_center|LOCUS_05620 10715 10176 gene locus_tag LOCUS_05630 gene rplF 10715 10176 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943471.1 protein_id gnl|my_center|LOCUS_05630 11185 10787 gene locus_tag LOCUS_05640 gene rpsH 11185 10787 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943472.1 protein_id gnl|my_center|LOCUS_05640 12095 11556 gene locus_tag LOCUS_05650 gene rplE 12095 11556 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943474.1 protein_id gnl|my_center|LOCUS_05650 12510 12181 gene locus_tag LOCUS_05660 gene rplX 12510 12181 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938609.1 protein_id gnl|my_center|LOCUS_05660 13039 12671 gene locus_tag LOCUS_05670 gene rplN 13039 12671 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938608.1 protein_id gnl|my_center|LOCUS_05670 13346 13080 gene locus_tag LOCUS_05680 gene rpsQ 13346 13080 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943477.1 protein_id gnl|my_center|LOCUS_05680 13562 13359 gene locus_tag LOCUS_05690 gene rpmC 13562 13359 CDS product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003567550.1 protein_id gnl|my_center|LOCUS_05690 13977 13567 gene locus_tag LOCUS_05700 gene rplP 13977 13567 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943479.1 protein_id gnl|my_center|LOCUS_05700 14631 13987 gene locus_tag LOCUS_05710 gene rpsC 14631 13987 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943480.1 protein_id gnl|my_center|LOCUS_05710 14983 14651 gene locus_tag LOCUS_05720 gene rplV 14983 14651 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001148025.1 protein_id gnl|my_center|LOCUS_05720 15326 15036 gene locus_tag LOCUS_05730 gene rpsS 15326 15036 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938602.1 protein_id gnl|my_center|LOCUS_05730 16169 15480 gene locus_tag LOCUS_05740 gene rplB 16169 15480 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943483.1 protein_id gnl|my_center|LOCUS_05740 16658 16371 gene locus_tag LOCUS_05750 16658 16371 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943484.1 protein_id gnl|my_center|LOCUS_05750 17281 16658 gene locus_tag LOCUS_05760 gene rplD 17281 16658 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810159.1 protein_id gnl|my_center|LOCUS_05760 17977 17357 gene locus_tag LOCUS_05770 gene rplC 17977 17357 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943486.1 protein_id gnl|my_center|LOCUS_05770 18420 18109 gene locus_tag LOCUS_05780 gene rpsJ 18420 18109 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943487.1 protein_id gnl|my_center|LOCUS_05780 >Feature sequence030 93 953 gene locus_tag LOCUS_05790 93 953 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048395.1 protein_id gnl|my_center|LOCUS_05790 1374 2543 gene locus_tag LOCUS_05800 gene larC 1374 2543 CDS product nickel pincer cofactor biosynthesis protein LarC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583893.1 protein_id gnl|my_center|LOCUS_05800 2697 3137 gene locus_tag LOCUS_05810 2697 3137 CDS product phosphatidylglycerophosphatase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940818.1 protein_id gnl|my_center|LOCUS_05810 3234 4490 gene locus_tag LOCUS_05820 3234 4490 CDS product competence/damage-inducible protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582488.1 protein_id gnl|my_center|LOCUS_05820 4462 5037 gene locus_tag LOCUS_05830 gene thpR 4462 5037 CDS product RNA 2',3'-cyclic phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876222.1 protein_id gnl|my_center|LOCUS_05830 5097 6128 gene locus_tag LOCUS_05840 gene recA 5097 6128 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940821.1 protein_id gnl|my_center|LOCUS_05840 6188 8860 gene locus_tag LOCUS_05850 gene alaS 6188 8860 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940824.1 protein_id gnl|my_center|LOCUS_05850 9655 8840 gene locus_tag LOCUS_05860 9655 8840 CDS product outer membrane protein assembly factor BamD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941169.1 protein_id gnl|my_center|LOCUS_05860 10582 9665 gene locus_tag LOCUS_05870 gene trxB 10582 9665 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393897.1 protein_id gnl|my_center|LOCUS_05870 10985 10662 gene locus_tag LOCUS_05880 gene trxA 10985 10662 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056655.1 protein_id gnl|my_center|LOCUS_05880 11823 11200 gene locus_tag LOCUS_05890 11823 11200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05890 12290 13321 gene locus_tag LOCUS_05900 12290 13321 CDS product DUF362 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941750.1 protein_id gnl|my_center|LOCUS_05900 13939 15012 gene locus_tag LOCUS_05910 13939 15012 CDS product branched-chain amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244231.1 protein_id gnl|my_center|LOCUS_05910 15489 16451 gene locus_tag LOCUS_05920 gene mtnA 15489 16451 CDS product S-methyl-5-thioribose-1-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943990.1 protein_id gnl|my_center|LOCUS_05920 18204 16861 gene locus_tag LOCUS_05930 gene tilS 18204 16861 CDS product tRNA lysidine(34) synthetase TilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546068.1 protein_id gnl|my_center|LOCUS_05930 >Feature sequence031 216 938 gene locus_tag LOCUS_05940 216 938 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090590.1 protein_id gnl|my_center|LOCUS_05940 1163 2230 gene locus_tag LOCUS_05950 1163 2230 CDS product phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267697.1 protein_id gnl|my_center|LOCUS_05950 4111 2291 gene locus_tag LOCUS_05960 4111 2291 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_072773675.1 protein_id gnl|my_center|LOCUS_05960 5400 4198 gene locus_tag LOCUS_05970 5400 4198 CDS product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878528.1 protein_id gnl|my_center|LOCUS_05970 6337 5465 gene locus_tag LOCUS_05980 6337 5465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05980 7719 6397 gene locus_tag LOCUS_05990 7719 6397 CDS product DUF362 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272661.1 protein_id gnl|my_center|LOCUS_05990 8441 7731 gene locus_tag LOCUS_06000 8441 7731 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112791.1 protein_id gnl|my_center|LOCUS_06000 10727 8598 gene locus_tag LOCUS_06010 10727 8598 CDS product 3-hydroxyacyl-CoA dehydrogenase NAD-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480226.1 protein_id gnl|my_center|LOCUS_06010 11388 12704 gene locus_tag LOCUS_06020 11388 12704 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089186.1 protein_id gnl|my_center|LOCUS_06020 12778 13647 gene locus_tag LOCUS_06030 12778 13647 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877735.1 protein_id gnl|my_center|LOCUS_06030 13650 14690 gene locus_tag LOCUS_06040 13650 14690 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948215.1 protein_id gnl|my_center|LOCUS_06040 14867 16576 gene locus_tag LOCUS_06050 14867 16576 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064321.1 protein_id gnl|my_center|LOCUS_06050 16578 17348 gene locus_tag LOCUS_06060 16578 17348 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944003.1 protein_id gnl|my_center|LOCUS_06060 >Feature sequence032 1097 1609 gene locus_tag LOCUS_06070 1097 1609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06070 2365 2934 gene locus_tag LOCUS_06080 2365 2934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06080 2931 3215 gene locus_tag LOCUS_06090 2931 3215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06090 3226 3414 gene locus_tag LOCUS_06100 3226 3414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06100 3438 4073 gene locus_tag LOCUS_06110 3438 4073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06110 4487 4660 gene locus_tag LOCUS_06120 4487 4660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06120 4682 5113 gene locus_tag LOCUS_06130 4682 5113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06130 5071 5238 gene locus_tag LOCUS_06140 5071 5238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06140 5250 5483 gene locus_tag LOCUS_06150 5250 5483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06150 5536 5811 gene locus_tag LOCUS_06160 5536 5811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06160 5798 6121 gene locus_tag LOCUS_06170 5798 6121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06170 6191 6376 gene locus_tag LOCUS_06180 6191 6376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06180 6373 6639 gene locus_tag LOCUS_06190 6373 6639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06190 6636 6863 gene locus_tag LOCUS_06200 6636 6863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06200 6860 8314 gene locus_tag LOCUS_06210 6860 8314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06210 9148 9903 gene locus_tag LOCUS_06220 9148 9903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06220 10056 10892 gene locus_tag LOCUS_06230 10056 10892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06230 11264 11647 gene locus_tag LOCUS_06240 11264 11647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06240 11655 11882 gene locus_tag LOCUS_06250 11655 11882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06250 12585 12854 gene locus_tag LOCUS_06260 12585 12854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06260 13136 13612 gene locus_tag LOCUS_06270 13136 13612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06270 13630 13857 gene locus_tag LOCUS_06280 13630 13857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06280 13867 14094 gene locus_tag LOCUS_06290 13867 14094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06290 14124 14297 gene locus_tag LOCUS_06300 14124 14297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06300 14548 15564 gene locus_tag LOCUS_06310 14548 15564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06310 15579 15863 gene locus_tag LOCUS_06320 15579 15863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06320 15866 16852 gene locus_tag LOCUS_06330 15866 16852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06330 16872 17759 gene locus_tag LOCUS_06340 16872 17759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06340 >Feature sequence033 120 467 gene locus_tag LOCUS_06350 120 467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06350 611 814 gene locus_tag LOCUS_06360 611 814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06360 867 1067 gene locus_tag LOCUS_06370 867 1067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06370 1296 1165 gene locus_tag LOCUS_06380 1296 1165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06380 2707 1838 gene locus_tag LOCUS_06390 2707 1838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06390 4076 2823 gene locus_tag LOCUS_06400 4076 2823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06400 4402 5172 gene locus_tag LOCUS_06410 gene surE 4402 5172 CDS product 5'/3'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404579.1 protein_id gnl|my_center|LOCUS_06410 6624 5218 gene locus_tag LOCUS_06420 6624 5218 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879446.1 protein_id gnl|my_center|LOCUS_06420 8107 6713 gene locus_tag LOCUS_06430 8107 6713 CDS product short-chain fatty acid transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015878.1 protein_id gnl|my_center|LOCUS_06430 9143 8466 gene locus_tag LOCUS_06440 gene lepB 9143 8466 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941922.1 protein_id gnl|my_center|LOCUS_06440 9480 9680 gene locus_tag LOCUS_06450 9480 9680 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942676.1 protein_id gnl|my_center|LOCUS_06450 9691 10779 gene locus_tag LOCUS_06460 gene pilM 9691 10779 CDS product type IV pilus assembly protein PilM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942675.1 protein_id gnl|my_center|LOCUS_06460 10776 11372 gene locus_tag LOCUS_06470 10776 11372 CDS product PilN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545919.1 protein_id gnl|my_center|LOCUS_06470 11410 11976 gene locus_tag LOCUS_06480 11410 11976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06480 11979 12599 gene locus_tag LOCUS_06490 11979 12599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06490 12652 13938 gene locus_tag LOCUS_06500 12652 13938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06500 13982 14128 gene locus_tag LOCUS_06510 13982 14128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06510 14106 15464 gene locus_tag LOCUS_06520 14106 15464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06520 15466 17019 gene locus_tag LOCUS_06530 gene mshL 15466 17019 CDS product pilus (MSHA type) biogenesis protein MshL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545709.1 protein_id gnl|my_center|LOCUS_06530 17637 16996 gene locus_tag LOCUS_06540 17637 16996 CDS product HAD-IA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193360256.1 protein_id gnl|my_center|LOCUS_06540 >Feature sequence034 1213 929 gene locus_tag LOCUS_06550 1213 929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06550 2434 1391 gene locus_tag LOCUS_06560 2434 1391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06560 2827 2618 gene locus_tag LOCUS_06570 2827 2618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06570 3617 2712 gene locus_tag LOCUS_06580 3617 2712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06580 4629 5153 gene locus_tag LOCUS_06590 4629 5153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06590 5385 6446 gene locus_tag LOCUS_06600 5385 6446 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001290820.1 protein_id gnl|my_center|LOCUS_06600 6548 7036 gene locus_tag LOCUS_06610 6548 7036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06610 7071 8105 gene locus_tag LOCUS_06620 gene fbp 7071 8105 CDS product class 1 fructose-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939127.1 protein_id gnl|my_center|LOCUS_06620 8757 8110 gene locus_tag LOCUS_06630 8757 8110 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005772758.1 protein_id gnl|my_center|LOCUS_06630 9689 8757 gene locus_tag LOCUS_06640 9689 8757 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545758.1 protein_id gnl|my_center|LOCUS_06640 10493 9789 gene locus_tag LOCUS_06650 10493 9789 CDS product Bax inhibitor-1/YccA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939740.1 protein_id gnl|my_center|LOCUS_06650 11940 10681 gene locus_tag LOCUS_06660 11940 10681 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582595.1 protein_id gnl|my_center|LOCUS_06660 12391 12167 gene locus_tag LOCUS_06670 12391 12167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06670 12464 13675 gene locus_tag LOCUS_06680 12464 13675 CDS product 6-phosphofructo-2-kinase/fructose-2,6-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011791484.1 protein_id gnl|my_center|LOCUS_06680 14008 13682 gene locus_tag LOCUS_06690 14008 13682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06690 14259 14183 gene locus_tag LOCUS_t00080 14259 14183 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 15725 14340 gene locus_tag LOCUS_06700 15725 14340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06700 15846 16712 gene locus_tag LOCUS_06710 15846 16712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06710 17473 16718 gene locus_tag LOCUS_06720 gene cobB 17473 16718 CDS product NAD-dependent protein deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762545.1 protein_id gnl|my_center|LOCUS_06720 >Feature sequence035 369 1946 gene locus_tag LOCUS_06730 gene nuoF 369 1946 CDS product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066666688.1 protein_id gnl|my_center|LOCUS_06730 2210 3700 gene locus_tag LOCUS_06740 2210 3700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06740 3812 4687 gene locus_tag LOCUS_06750 3812 4687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06750 5671 4700 gene locus_tag LOCUS_06760 5671 4700 CDS product DUF814 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583848.1 protein_id gnl|my_center|LOCUS_06760 6623 5673 gene locus_tag LOCUS_06770 6623 5673 CDS product DnaJ C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940692.1 protein_id gnl|my_center|LOCUS_06770 7519 8364 gene locus_tag LOCUS_06780 7519 8364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06780 8393 8734 gene locus_tag LOCUS_06790 8393 8734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06790 8846 9712 gene locus_tag LOCUS_06800 8846 9712 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004435248.1 protein_id gnl|my_center|LOCUS_06800 9716 10582 gene locus_tag LOCUS_06810 9716 10582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06810 10640 11428 gene locus_tag LOCUS_06820 10640 11428 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870136.1 protein_id gnl|my_center|LOCUS_06820 11421 12167 gene locus_tag LOCUS_06830 11421 12167 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037394372.1 protein_id gnl|my_center|LOCUS_06830 12318 13910 gene locus_tag LOCUS_06840 12318 13910 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763167.1 protein_id gnl|my_center|LOCUS_06840 14244 14816 gene locus_tag LOCUS_06850 14244 14816 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393334.1 protein_id gnl|my_center|LOCUS_06850 14958 15380 gene locus_tag LOCUS_06860 14958 15380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06860 16183 15458 gene locus_tag LOCUS_06870 16183 15458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06870 16715 16413 gene locus_tag LOCUS_06880 16715 16413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06880 16972 16715 gene locus_tag LOCUS_06890 16972 16715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06890 >Feature sequence036 164 616 gene locus_tag LOCUS_06900 164 616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06900 995 681 gene locus_tag LOCUS_06910 995 681 CDS product HigA family addiction module antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626089.1 protein_id gnl|my_center|LOCUS_06910 1540 1812 gene locus_tag LOCUS_06920 1540 1812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06920 1805 2356 gene locus_tag LOCUS_06930 1805 2356 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000118351.1 protein_id gnl|my_center|LOCUS_06930 2328 2708 gene locus_tag LOCUS_06940 2328 2708 CDS product MmcQ/YjbR family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706385.1 protein_id gnl|my_center|LOCUS_06940 2989 3267 gene locus_tag LOCUS_06950 2989 3267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06950 3312 4247 gene locus_tag LOCUS_06960 3312 4247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06960 6432 4264 gene locus_tag LOCUS_06970 6432 4264 CDS product ATP-dependent helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937467.1 protein_id gnl|my_center|LOCUS_06970 6891 7055 gene locus_tag LOCUS_06980 6891 7055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06980 7059 7178 gene locus_tag LOCUS_06990 7059 7178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06990 7876 7604 gene locus_tag LOCUS_07000 7876 7604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07000 8484 9086 gene locus_tag LOCUS_07010 gene cobC 8484 9086 CDS product alpha-ribazole phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041914029.1 protein_id gnl|my_center|LOCUS_07010 9144 9704 gene locus_tag LOCUS_07020 9144 9704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07020 10933 9713 gene locus_tag LOCUS_07030 10933 9713 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089288.1 protein_id gnl|my_center|LOCUS_07030 11666 12358 gene locus_tag LOCUS_07040 11666 12358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07040 12411 12803 gene locus_tag LOCUS_07050 12411 12803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07050 12870 13490 gene locus_tag LOCUS_07060 12870 13490 CDS product ADP-ribosylation factor-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228461.1 protein_id gnl|my_center|LOCUS_07060 13502 14251 gene locus_tag LOCUS_07070 13502 14251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07070 14293 14763 gene locus_tag LOCUS_07080 14293 14763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07080 14832 15965 gene locus_tag LOCUS_07090 14832 15965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07090 16090 17073 gene locus_tag LOCUS_07100 16090 17073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07100 >Feature sequence037 1064 309 gene locus_tag LOCUS_07110 1064 309 CDS product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941114.1 protein_id gnl|my_center|LOCUS_07110 1627 1190 gene locus_tag LOCUS_07120 1627 1190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07120 2797 1631 gene locus_tag LOCUS_07130 2797 1631 CDS product thiolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763169.1 protein_id gnl|my_center|LOCUS_07130 3350 4057 gene locus_tag LOCUS_07140 3350 4057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07140 4226 4573 gene locus_tag LOCUS_07150 4226 4573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07150 4621 5043 gene locus_tag LOCUS_07160 4621 5043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07160 5143 5874 gene locus_tag LOCUS_07170 5143 5874 CDS product NRDE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941457.1 protein_id gnl|my_center|LOCUS_07170 7371 5953 gene locus_tag LOCUS_07180 7371 5953 CDS product sodium:solute symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000879805.1 protein_id gnl|my_center|LOCUS_07180 8506 7439 gene locus_tag LOCUS_07190 8506 7439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07190 9201 8878 gene locus_tag LOCUS_07200 9201 8878 CDS product type II toxin-antitoxin system PemK/MazF family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680107.1 protein_id gnl|my_center|LOCUS_07200 9449 9195 gene locus_tag LOCUS_07210 9449 9195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07210 9971 9594 gene locus_tag LOCUS_07220 9971 9594 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770889.1 protein_id gnl|my_center|LOCUS_07220 10203 9961 gene locus_tag LOCUS_07230 10203 9961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07230 11046 10276 gene locus_tag LOCUS_07240 11046 10276 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921271.1 protein_id gnl|my_center|LOCUS_07240 11959 11093 gene locus_tag LOCUS_07250 11959 11093 CDS product 2-dehydropantoate 2-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963695.1 protein_id gnl|my_center|LOCUS_07250 12407 11982 gene locus_tag LOCUS_07260 12407 11982 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258683.1 protein_id gnl|my_center|LOCUS_07260 12833 13291 gene locus_tag LOCUS_07270 12833 13291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07270 13335 13769 gene locus_tag LOCUS_07280 13335 13769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07280 14645 13758 gene locus_tag LOCUS_07290 14645 13758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256555.1 protein_id gnl|my_center|LOCUS_07290 15599 14814 gene locus_tag LOCUS_07300 15599 14814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07300 16585 16163 gene locus_tag LOCUS_07310 16585 16163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07310 >Feature sequence038 951 1724 gene locus_tag LOCUS_07320 951 1724 CDS product motility protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937361.1 protein_id gnl|my_center|LOCUS_07320 1734 2498 gene locus_tag LOCUS_07330 1734 2498 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392303.1 protein_id gnl|my_center|LOCUS_07330 2495 3229 gene locus_tag LOCUS_07340 2495 3229 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392303.1 protein_id gnl|my_center|LOCUS_07340 3231 3707 gene locus_tag LOCUS_07350 gene fliL 3231 3707 CDS product flagellar basal body-associated protein FliL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002780442.1 protein_id gnl|my_center|LOCUS_07350 3721 4686 gene locus_tag LOCUS_07360 gene fliM 3721 4686 CDS product flagellar motor switch protein FliM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026183958.1 protein_id gnl|my_center|LOCUS_07360 4707 5177 gene locus_tag LOCUS_07370 gene fliN 4707 5177 CDS product flagellar motor switch protein FliN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937357.1 protein_id gnl|my_center|LOCUS_07370 5174 5554 gene locus_tag LOCUS_07380 5174 5554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07380 5544 6341 gene locus_tag LOCUS_07390 gene fliP 5544 6341 CDS product flagellar type III secretion system pore protein FliP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941092.1 protein_id gnl|my_center|LOCUS_07390 6334 6615 gene locus_tag LOCUS_07400 gene fliQ 6334 6615 CDS product flagellar biosynthesis protein FliQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005160414.1 protein_id gnl|my_center|LOCUS_07400 6716 7417 gene locus_tag LOCUS_07410 gene fliR 6716 7417 CDS product flagellar biosynthetic protein FliR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392309.1 protein_id gnl|my_center|LOCUS_07410 7433 8506 gene locus_tag LOCUS_07420 gene flhB 7433 8506 CDS product flagellar biosynthesis protein FlhB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545442.1 protein_id gnl|my_center|LOCUS_07420 8900 10690 gene locus_tag LOCUS_07430 gene flhA 8900 10690 CDS product flagellar biosynthesis protein FlhA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943681.1 protein_id gnl|my_center|LOCUS_07430 10680 12170 gene locus_tag LOCUS_07440 10680 12170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07440 12320 13228 gene locus_tag LOCUS_07450 12320 13228 CDS product MinD/ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943679.1 protein_id gnl|my_center|LOCUS_07450 13313 14056 gene locus_tag LOCUS_07460 13313 14056 CDS product FliA/WhiG family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943678.1 protein_id gnl|my_center|LOCUS_07460 14133 14432 gene locus_tag LOCUS_07470 14133 14432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07470 14468 14908 gene locus_tag LOCUS_07480 14468 14908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07480 16026 16355 gene locus_tag LOCUS_07490 16026 16355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07490 >Feature sequence039 1617 1850 gene locus_tag LOCUS_07500 1617 1850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07500 3485 1974 gene locus_tag LOCUS_07510 3485 1974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07510 4939 3572 gene locus_tag LOCUS_07520 4939 3572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07520 8264 5157 gene locus_tag LOCUS_07530 8264 5157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07530 9298 8354 gene locus_tag LOCUS_07540 9298 8354 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015868484.1 protein_id gnl|my_center|LOCUS_07540 12265 9584 gene locus_tag LOCUS_07550 gene polA 12265 9584 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941209.1 protein_id gnl|my_center|LOCUS_07550 13369 12404 gene locus_tag LOCUS_07560 13369 12404 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941622.1 protein_id gnl|my_center|LOCUS_07560 16376 13449 gene locus_tag LOCUS_07570 16376 13449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07570 >Feature sequence040 <1 810 gene locus_tag LOCUS_07580 <1 810 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941766.1:Xaa-Pro peptidase family protein 884 1597 gene locus_tag LOCUS_07590 gene recO 884 1597 CDS product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140088.1 protein_id gnl|my_center|LOCUS_07590 2934 1681 gene locus_tag LOCUS_07600 2934 1681 CDS product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888868.1 protein_id gnl|my_center|LOCUS_07600 3379 3239 gene locus_tag LOCUS_07610 3379 3239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07610 3907 4497 gene locus_tag LOCUS_07620 3907 4497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07620 4512 4916 gene locus_tag LOCUS_07630 4512 4916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07630 4954 6897 gene locus_tag LOCUS_07640 4954 6897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07640 6952 7167 gene locus_tag LOCUS_07650 6952 7167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07650 7149 7361 gene locus_tag LOCUS_07660 7149 7361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07660 7555 10041 gene locus_tag LOCUS_07670 7555 10041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_07670 10110 11009 gene locus_tag LOCUS_07680 10110 11009 CDS product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942950.1 protein_id gnl|my_center|LOCUS_07680 11088 13310 gene locus_tag LOCUS_07690 11088 13310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07690 13498 14076 gene locus_tag LOCUS_07700 13498 14076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07700 14073 14858 gene locus_tag LOCUS_07710 14073 14858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07710 14888 15973 gene locus_tag LOCUS_07720 14888 15973 CDS product mannose-1-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006523900.1 protein_id gnl|my_center|LOCUS_07720 >Feature sequence041 1520 171 gene locus_tag LOCUS_07730 gene gdhA 1520 171 CDS product NADP-specific glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962445.1 protein_id gnl|my_center|LOCUS_07730 4588 1601 gene locus_tag LOCUS_07740 4588 1601 CDS product PEP/pyruvate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790471.1 protein_id gnl|my_center|LOCUS_07740 5351 4620 gene locus_tag LOCUS_07750 5351 4620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07750 6151 5477 gene locus_tag LOCUS_07760 6151 5477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07760 6444 7292 gene locus_tag LOCUS_07770 6444 7292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07770 7354 9204 gene locus_tag LOCUS_07780 gene nuoF 7354 9204 CDS product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082447.1 protein_id gnl|my_center|LOCUS_07780 9239 9916 gene locus_tag LOCUS_07790 9239 9916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07790 9937 11523 gene locus_tag LOCUS_07800 9937 11523 CDS product FMN-binding glutamate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582712.1 protein_id gnl|my_center|LOCUS_07800 12221 11595 gene locus_tag LOCUS_07810 12221 11595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07810 14661 12265 gene locus_tag LOCUS_07820 14661 12265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07820 15361 14798 gene locus_tag LOCUS_07830 15361 14798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07830 >Feature sequence042 345 872 gene locus_tag LOCUS_07840 gene yihA 345 872 CDS product ribosome biogenesis GTP-binding protein YihA/YsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943641.1 protein_id gnl|my_center|LOCUS_07840 2310 943 gene locus_tag LOCUS_07850 2310 943 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546604.1 protein_id gnl|my_center|LOCUS_07850 3663 2374 gene locus_tag LOCUS_07860 gene lpxB 3663 2374 CDS product lipid-A-disaccharide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942901.1 protein_id gnl|my_center|LOCUS_07860 3781 3599 gene locus_tag LOCUS_07870 3781 3599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07870 5009 4038 gene locus_tag LOCUS_07880 5009 4038 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942903.1 protein_id gnl|my_center|LOCUS_07880 5800 5042 gene locus_tag LOCUS_07890 gene lpxI 5800 5042 CDS product UDP-2,3-diacylglucosamine diphosphatase LpxI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546653.1 protein_id gnl|my_center|LOCUS_07890 6719 5946 gene locus_tag LOCUS_07900 gene lpxA 6719 5946 CDS product acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546244.1 protein_id gnl|my_center|LOCUS_07900 7466 7014 gene locus_tag LOCUS_07910 gene fabZ 7466 7014 CDS product 3-hydroxyacyl-ACP dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942905.1 protein_id gnl|my_center|LOCUS_07910 8266 7475 gene locus_tag LOCUS_07920 8266 7475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07920 8459 8286 gene locus_tag LOCUS_07930 8459 8286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07930 8991 8467 gene locus_tag LOCUS_07940 8991 8467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07940 9287 9030 gene locus_tag LOCUS_07950 9287 9030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07950 11628 9292 gene locus_tag LOCUS_07960 gene bamA 11628 9292 CDS product outer membrane protein assembly factor BamA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942908.1 protein_id gnl|my_center|LOCUS_07960 12382 11702 gene locus_tag LOCUS_07970 12382 11702 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942909.1 protein_id gnl|my_center|LOCUS_07970 13605 12379 gene locus_tag LOCUS_07980 13605 12379 CDS product lipoprotein-releasing ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942910.1 protein_id gnl|my_center|LOCUS_07980 14349 13615 gene locus_tag LOCUS_07990 14349 13615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07990 15064 14339 gene locus_tag LOCUS_08000 15064 14339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08000 >Feature sequence043 2152 95 gene locus_tag LOCUS_08010 2152 95 CDS product TRAP transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228476.1 protein_id gnl|my_center|LOCUS_08010 3282 2290 gene locus_tag LOCUS_08020 3282 2290 CDS product TAXI family TRAP transporter solute-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261092.1 protein_id gnl|my_center|LOCUS_08020 4178 3543 gene locus_tag LOCUS_08030 4178 3543 CDS product DUF1638 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392826.1 protein_id gnl|my_center|LOCUS_08030 5366 4293 gene locus_tag LOCUS_08040 5366 4293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08040 6307 5666 gene locus_tag LOCUS_08050 6307 5666 CDS product corrinoid protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393606.1 protein_id gnl|my_center|LOCUS_08050 7418 6330 gene locus_tag LOCUS_08060 7418 6330 CDS product uroporphyrinogen decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064979.1 protein_id gnl|my_center|LOCUS_08060 8165 7458 gene locus_tag LOCUS_08070 8165 7458 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809848.1 protein_id gnl|my_center|LOCUS_08070 8972 8172 gene locus_tag LOCUS_08080 8972 8172 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385621.1 protein_id gnl|my_center|LOCUS_08080 9952 8969 gene locus_tag LOCUS_08090 9952 8969 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085969.1 protein_id gnl|my_center|LOCUS_08090 10895 10011 gene locus_tag LOCUS_08100 10895 10011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_08100 12266 10965 gene locus_tag LOCUS_08110 12266 10965 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085967.1 protein_id gnl|my_center|LOCUS_08110 13141 12347 gene locus_tag LOCUS_08120 13141 12347 CDS product methyltetrahydrofolate cobalamin methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393605.1 protein_id gnl|my_center|LOCUS_08120 15026 13569 gene locus_tag LOCUS_08130 15026 13569 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937982.1 protein_id gnl|my_center|LOCUS_08130 15550 15029 gene locus_tag LOCUS_08140 15550 15029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08140 >Feature sequence044 1413 451 gene locus_tag LOCUS_08150 1413 451 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876013.1 protein_id gnl|my_center|LOCUS_08150 2676 1534 gene locus_tag LOCUS_08160 gene wecB 2676 1534 CDS product UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817161.1 protein_id gnl|my_center|LOCUS_08160 3827 2673 gene locus_tag LOCUS_08170 3827 2673 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963418.1 protein_id gnl|my_center|LOCUS_08170 4896 3838 gene locus_tag LOCUS_08180 4896 3838 CDS product polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202260.1 protein_id gnl|my_center|LOCUS_08180 5438 6646 gene locus_tag LOCUS_08190 5438 6646 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461038.1 protein_id gnl|my_center|LOCUS_08190 6643 7779 gene locus_tag LOCUS_08200 6643 7779 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868715.1 protein_id gnl|my_center|LOCUS_08200 7796 8929 gene locus_tag LOCUS_08210 7796 8929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08210 10162 10013 gene locus_tag LOCUS_08220 10162 10013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08220 10677 12218 gene locus_tag LOCUS_08230 10677 12218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08230 13784 15154 gene locus_tag LOCUS_08240 13784 15154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08240 >Feature sequence045 983 294 gene locus_tag LOCUS_08250 983 294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08250 1227 961 gene locus_tag LOCUS_08260 1227 961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08260 1440 2030 gene locus_tag LOCUS_08270 1440 2030 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229253.1 protein_id gnl|my_center|LOCUS_08270 2030 3295 gene locus_tag LOCUS_08280 2030 3295 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943303.1 protein_id gnl|my_center|LOCUS_08280 3328 6438 gene locus_tag LOCUS_08290 3328 6438 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393846.1 protein_id gnl|my_center|LOCUS_08290 6563 7150 gene locus_tag LOCUS_08300 6563 7150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08300 8212 9552 gene locus_tag LOCUS_08310 8212 9552 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392350.1 protein_id gnl|my_center|LOCUS_08310 9571 9840 gene locus_tag LOCUS_08320 9571 9840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08320 9764 10906 gene locus_tag LOCUS_08330 9764 10906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08330 10907 11350 gene locus_tag LOCUS_08340 10907 11350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08340 11537 11839 gene locus_tag LOCUS_08350 11537 11839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08350 11854 13548 gene locus_tag LOCUS_08360 11854 13548 CDS product AarF/UbiB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941749.1 protein_id gnl|my_center|LOCUS_08360 13829 14743 gene locus_tag LOCUS_08370 13829 14743 CDS product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011791673.1 protein_id gnl|my_center|LOCUS_08370 14919 15089 gene locus_tag LOCUS_08380 14919 15089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08380 >Feature sequence046 1518 988 gene locus_tag LOCUS_08390 1518 988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08390 2374 1571 gene locus_tag LOCUS_08400 2374 1571 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227947.1 protein_id gnl|my_center|LOCUS_08400 2872 2438 gene locus_tag LOCUS_08410 2872 2438 CDS product four helix bundle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962274.1 protein_id gnl|my_center|LOCUS_08410 3964 2894 gene locus_tag LOCUS_08420 3964 2894 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005463596.1 protein_id gnl|my_center|LOCUS_08420 4962 4051 gene locus_tag LOCUS_08430 4962 4051 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227944.1 protein_id gnl|my_center|LOCUS_08430 7163 5211 gene locus_tag LOCUS_08440 7163 5211 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227943.1 protein_id gnl|my_center|LOCUS_08440 8033 7203 gene locus_tag LOCUS_08450 8033 7203 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227942.1 protein_id gnl|my_center|LOCUS_08450 9238 8030 gene locus_tag LOCUS_08460 9238 8030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08460 9487 10077 gene locus_tag LOCUS_08470 9487 10077 CDS product TetR/AcrR family transcriptional regulator C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000742222.1 protein_id gnl|my_center|LOCUS_08470 10152 10946 gene locus_tag LOCUS_08480 10152 10946 CDS product electron transfer flavoprotein subunit beta/FixA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817158.1 protein_id gnl|my_center|LOCUS_08480 11037 12020 gene locus_tag LOCUS_08490 11037 12020 CDS product electron transfer flavoprotein subunit alpha/FixB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817156.1 protein_id gnl|my_center|LOCUS_08490 12954 12286 gene locus_tag LOCUS_08500 12954 12286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08500 13135 13211 gene locus_tag LOCUS_t00090 13135 13211 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 13297 13827 gene locus_tag LOCUS_08510 13297 13827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08510 14236 14781 gene locus_tag LOCUS_08520 14236 14781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08520 >Feature sequence047 707 528 gene locus_tag LOCUS_08530 707 528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08530 924 2105 gene locus_tag LOCUS_08540 924 2105 CDS product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000552081.1 protein_id gnl|my_center|LOCUS_08540 2152 2931 gene locus_tag LOCUS_08550 2152 2931 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229549.1 protein_id gnl|my_center|LOCUS_08550 2949 3701 gene locus_tag LOCUS_08560 gene fabG 2949 3701 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942248.1 protein_id gnl|my_center|LOCUS_08560 3881 5029 gene locus_tag LOCUS_08570 3881 5029 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064757.1 protein_id gnl|my_center|LOCUS_08570 5231 6469 gene locus_tag LOCUS_08580 5231 6469 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040626.1 protein_id gnl|my_center|LOCUS_08580 7083 7412 gene locus_tag LOCUS_08590 7083 7412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08590 7428 8435 gene locus_tag LOCUS_08600 7428 8435 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965773.1 protein_id gnl|my_center|LOCUS_08600 8416 9168 gene locus_tag LOCUS_08610 8416 9168 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942651.1 protein_id gnl|my_center|LOCUS_08610 9170 10516 gene locus_tag LOCUS_08620 9170 10516 CDS product MmgE/PrpD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083638.1 protein_id gnl|my_center|LOCUS_08620 10517 11230 gene locus_tag LOCUS_08630 10517 11230 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944002.1 protein_id gnl|my_center|LOCUS_08630 11313 12857 gene locus_tag LOCUS_08640 gene caiC 11313 12857 CDS product crotonobetaine/carnitine-CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000355790.1 protein_id gnl|my_center|LOCUS_08640 13460 14167 gene locus_tag LOCUS_08650 13460 14167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08650 14455 14201 gene locus_tag LOCUS_08660 14455 14201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08660 >Feature sequence048 939 442 gene locus_tag LOCUS_08670 939 442 CDS product bifunctional nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880135.1 protein_id gnl|my_center|LOCUS_08670 1654 2337 gene locus_tag LOCUS_08680 1654 2337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08680 2352 3167 gene locus_tag LOCUS_08690 2352 3167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08690 3453 4025 gene locus_tag LOCUS_08700 3453 4025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08700 7336 4541 gene locus_tag LOCUS_08710 gene ppdK 7336 4541 CDS product pyruvate, phosphate dikinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392144.1 protein_id gnl|my_center|LOCUS_08710 7671 7492 gene locus_tag LOCUS_08720 7671 7492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08720 8012 7674 gene locus_tag LOCUS_08730 8012 7674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08730 8138 8305 gene locus_tag LOCUS_08740 8138 8305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08740 8748 8407 gene locus_tag LOCUS_08750 8748 8407 CDS product zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256377.1 protein_id gnl|my_center|LOCUS_08750 9049 8834 gene locus_tag LOCUS_08760 9049 8834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08760 9366 13766 gene locus_tag LOCUS_08770 9366 13766 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392708.1 protein_id gnl|my_center|LOCUS_08770 14002 14346 gene locus_tag LOCUS_08780 14002 14346 CDS product hydrogenase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392707.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_08780 >Feature sequence049 <1 2276 gene locus_tag LOCUS_08790 <1 2276 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942922.1:HDIG domain-containing protein 2176 2616 gene locus_tag LOCUS_08800 gene ybeY 2176 2616 CDS product rRNA maturation RNase YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942921.1 protein_id gnl|my_center|LOCUS_08800 2620 3339 gene locus_tag LOCUS_08810 2620 3339 CDS product pyridoxine 5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942449.1 protein_id gnl|my_center|LOCUS_08810 3341 3739 gene locus_tag LOCUS_08820 3341 3739 CDS product holo-[acyl-carrier-protein] synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942448.1 protein_id gnl|my_center|LOCUS_08820 3746 4195 gene locus_tag LOCUS_08830 3746 4195 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942446.1 protein_id gnl|my_center|LOCUS_08830 4335 4817 gene locus_tag LOCUS_08840 gene tsaE 4335 4817 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235044854.1 protein_id gnl|my_center|LOCUS_08840 4827 6059 gene locus_tag LOCUS_08850 4827 6059 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942444.1 protein_id gnl|my_center|LOCUS_08850 6034 6594 gene locus_tag LOCUS_08860 6034 6594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08860 6624 9215 gene locus_tag LOCUS_08870 6624 9215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08870 9511 10542 gene locus_tag LOCUS_08880 gene tsaD 9511 10542 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860650.1 protein_id gnl|my_center|LOCUS_08880 10664 11182 gene locus_tag LOCUS_08890 10664 11182 CDS product DUF2062 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055993.1 protein_id gnl|my_center|LOCUS_08890 11161 12066 gene locus_tag LOCUS_08900 gene rsmA 11161 12066 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391600.1 protein_id gnl|my_center|LOCUS_08900 12167 13015 gene locus_tag LOCUS_08910 gene panC 12167 13015 CDS product pantoate--beta-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942350.1 protein_id gnl|my_center|LOCUS_08910 13187 14353 gene locus_tag LOCUS_08920 gene metK 13187 14353 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942525.1 protein_id gnl|my_center|LOCUS_08920 >Feature sequence050 281 808 gene locus_tag LOCUS_08930 281 808 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546210.1 protein_id gnl|my_center|LOCUS_08930 813 1913 gene locus_tag LOCUS_08940 gene aroC 813 1913 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938193.1 protein_id gnl|my_center|LOCUS_08940 1907 2266 gene locus_tag LOCUS_08950 1907 2266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08950 2260 2730 gene locus_tag LOCUS_08960 2260 2730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08960 3034 3879 gene locus_tag LOCUS_08970 3034 3879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08970 3885 4913 gene locus_tag LOCUS_08980 gene aroB 3885 4913 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393064.1 protein_id gnl|my_center|LOCUS_08980 5008 6063 gene locus_tag LOCUS_08990 gene pheA 5008 6063 CDS product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583989.1 protein_id gnl|my_center|LOCUS_08990 6060 6833 gene locus_tag LOCUS_09000 6060 6833 CDS product prephenate dehydrogenase/arogenate dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791104.1 protein_id gnl|my_center|LOCUS_09000 6849 7523 gene locus_tag LOCUS_09010 gene aroD 6849 7523 CDS product type I 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083186615.1 protein_id gnl|my_center|LOCUS_09010 7520 8350 gene locus_tag LOCUS_09020 7520 8350 CDS product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024467.1 protein_id gnl|my_center|LOCUS_09020 8337 9602 gene locus_tag LOCUS_09030 gene aroA 8337 9602 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262299.1 protein_id gnl|my_center|LOCUS_09030 9822 11714 gene locus_tag LOCUS_09040 9822 11714 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938364.1 protein_id gnl|my_center|LOCUS_09040 11985 11722 gene locus_tag LOCUS_09050 11985 11722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09050 12439 11978 gene locus_tag LOCUS_09060 12439 11978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09060 13799 12570 gene locus_tag LOCUS_09070 13799 12570 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958440.1 protein_id gnl|my_center|LOCUS_09070 <14450 13907 gene locus_tag LOCUS_09080 <14450 13907 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011403984.1:aminotransferase class V-fold PLP-dependent enzyme >Feature sequence051 <1 2027 gene locus_tag LOCUS_09090 <1 2027 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010940695.1:transcription-repair coupling factor 2148 3095 gene locus_tag LOCUS_09100 2148 3095 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009892066.1 protein_id gnl|my_center|LOCUS_09100 3096 4067 gene locus_tag LOCUS_09110 3096 4067 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940693.1 protein_id gnl|my_center|LOCUS_09110 4080 5135 gene locus_tag LOCUS_09120 4080 5135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09120 5137 6366 gene locus_tag LOCUS_09130 gene tyrS 5137 6366 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048264.1 protein_id gnl|my_center|LOCUS_09130 6652 7458 gene locus_tag LOCUS_09140 6652 7458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09140 7641 9296 gene locus_tag LOCUS_09150 7641 9296 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942079.1 protein_id gnl|my_center|LOCUS_09150 9481 10230 gene locus_tag LOCUS_09160 9481 10230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09160 10430 11218 gene locus_tag LOCUS_09170 10430 11218 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459679.1 protein_id gnl|my_center|LOCUS_09170 11644 12369 gene locus_tag LOCUS_09180 11644 12369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09180 12438 13220 gene locus_tag LOCUS_09190 12438 13220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09190 >Feature sequence052 218 544 gene locus_tag LOCUS_09200 218 544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09200 741 1034 gene locus_tag LOCUS_09210 741 1034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09210 1155 1496 gene locus_tag LOCUS_09220 1155 1496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09220 1811 2347 gene locus_tag LOCUS_09230 1811 2347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09230 2520 2831 gene locus_tag LOCUS_09240 2520 2831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09240 4453 2828 gene locus_tag LOCUS_09250 4453 2828 CDS product glycerol-3-phosphate dehydrogenase/oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113972.1 protein_id gnl|my_center|LOCUS_09250 4632 4456 gene locus_tag LOCUS_09260 4632 4456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09260 5077 4625 gene locus_tag LOCUS_09270 5077 4625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09270 5606 7180 gene locus_tag LOCUS_09280 5606 7180 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681003.1 protein_id gnl|my_center|LOCUS_09280 8755 7418 gene locus_tag LOCUS_09290 8755 7418 CDS product M20/M25/M40 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226490.1 protein_id gnl|my_center|LOCUS_09290 9234 10262 gene locus_tag LOCUS_09300 9234 10262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878828.1 protein_id gnl|my_center|LOCUS_09300 11556 10291 gene locus_tag LOCUS_09310 11556 10291 CDS product Tm-1-like ATP-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949085.1 protein_id gnl|my_center|LOCUS_09310 12070 11606 gene locus_tag LOCUS_09320 12070 11606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09320 <14073 12082 gene locus_tag LOCUS_09330 <14073 12082 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_048064349.1:molybdopterin-dependent oxidoreductase >Feature sequence053 183 4349 gene locus_tag LOCUS_09340 183 4349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09340 4862 5926 gene locus_tag LOCUS_09350 4862 5926 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958440.1 protein_id gnl|my_center|LOCUS_09350 5930 6133 gene locus_tag LOCUS_09360 5930 6133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09360 6757 6350 gene locus_tag LOCUS_09370 6757 6350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09370 7182 6793 gene locus_tag LOCUS_09380 7182 6793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09380 8261 7191 gene locus_tag LOCUS_09390 8261 7191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09390 8582 8382 gene locus_tag LOCUS_09400 8582 8382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09400 9696 8632 gene locus_tag LOCUS_09410 9696 8632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09410 10740 9892 gene locus_tag LOCUS_09420 10740 9892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09420 11489 10875 gene locus_tag LOCUS_09430 11489 10875 CDS product arylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003021108.1 protein_id gnl|my_center|LOCUS_09430 11732 12256 gene locus_tag LOCUS_09440 11732 12256 CDS product HNH endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583256.1 protein_id gnl|my_center|LOCUS_09440 12709 12290 gene locus_tag LOCUS_09450 12709 12290 CDS product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723834.1 protein_id gnl|my_center|LOCUS_09450 13038 12736 gene locus_tag LOCUS_09460 13038 12736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09460 <14005 13049 gene locus_tag LOCUS_09470 <14005 13049 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011107905.1:RNase adapter RapZ >Feature sequence054 263 850 gene locus_tag LOCUS_09480 263 850 CDS product CDP-alcohol phosphatidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762243.1 protein_id gnl|my_center|LOCUS_09480 2633 867 gene locus_tag LOCUS_09490 2633 867 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943687.1 protein_id gnl|my_center|LOCUS_09490 4056 2815 gene locus_tag LOCUS_09500 4056 2815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09500 5345 4122 gene locus_tag LOCUS_09510 gene ftsA 5345 4122 CDS product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943689.1 protein_id gnl|my_center|LOCUS_09510 6135 5389 gene locus_tag LOCUS_09520 6135 5389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09520 7131 6217 gene locus_tag LOCUS_09530 gene murB 7131 6217 CDS product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963832.1 protein_id gnl|my_center|LOCUS_09530 8542 7154 gene locus_tag LOCUS_09540 gene murC 8542 7154 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943693.1 protein_id gnl|my_center|LOCUS_09540 9666 8539 gene locus_tag LOCUS_09550 gene murG 9666 8539 CDS product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545433.1 protein_id gnl|my_center|LOCUS_09550 10769 9666 gene locus_tag LOCUS_09560 gene ftsW 10769 9666 CDS product putative lipid II flippase FtsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943695.1 protein_id gnl|my_center|LOCUS_09560 12138 10762 gene locus_tag LOCUS_09570 gene murD 12138 10762 CDS product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943696.1 protein_id gnl|my_center|LOCUS_09570 13269 12190 gene locus_tag LOCUS_09580 gene mraY 13269 12190 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943697.1 protein_id gnl|my_center|LOCUS_09580 13702 13283 gene locus_tag LOCUS_09590 13702 13283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09590 >Feature sequence055 64 1002 gene locus_tag LOCUS_09600 64 1002 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091085.1 protein_id gnl|my_center|LOCUS_09600 1060 1266 gene locus_tag LOCUS_09610 1060 1266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09610 2463 1267 gene locus_tag LOCUS_09620 2463 1267 CDS product homocysteine biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940198.1 protein_id gnl|my_center|LOCUS_09620 2861 3682 gene locus_tag LOCUS_09630 gene kdsA 2861 3682 CDS product 3-deoxy-8-phosphooctulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545456.1 protein_id gnl|my_center|LOCUS_09630 3893 4417 gene locus_tag LOCUS_09640 gene kdsC 3893 4417 CDS product 3-deoxy-manno-octulosonate-8-phosphatase KdsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369496.1 protein_id gnl|my_center|LOCUS_09640 4606 5118 gene locus_tag LOCUS_09650 4606 5118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09650 5118 5663 gene locus_tag LOCUS_09660 5118 5663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09660 5669 6403 gene locus_tag LOCUS_09670 gene lptB 5669 6403 CDS product LPS export ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942533.1 protein_id gnl|my_center|LOCUS_09670 6502 7941 gene locus_tag LOCUS_09680 gene rpoN 6502 7941 CDS product RNA polymerase factor sigma-54 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942532.1 protein_id gnl|my_center|LOCUS_09680 8004 8543 gene locus_tag LOCUS_09690 gene raiA 8004 8543 CDS product ribosome-associated translation inhibitor RaiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546709.1 protein_id gnl|my_center|LOCUS_09690 8798 9268 gene locus_tag LOCUS_09700 8798 9268 CDS product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938921.1 protein_id gnl|my_center|LOCUS_09700 9287 9688 gene locus_tag LOCUS_09710 9287 9688 CDS product PTS sugar transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942528.1 protein_id gnl|my_center|LOCUS_09710 9685 10230 gene locus_tag LOCUS_09720 gene rimI 9685 10230 CDS product ribosomal protein S18-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393645.1 protein_id gnl|my_center|LOCUS_09720 10285 11283 gene locus_tag LOCUS_09730 gene gap 10285 11283 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391806.1 protein_id gnl|my_center|LOCUS_09730 11395 12165 gene locus_tag LOCUS_09740 gene tpiA 11395 12165 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942272.1 protein_id gnl|my_center|LOCUS_09740 12483 12659 gene locus_tag LOCUS_09750 12483 12659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09750 12652 12831 gene locus_tag LOCUS_09760 12652 12831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09760 12848 12934 gene locus_tag LOCUS_t00100 12848 12934 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence056 61 1221 gene locus_tag LOCUS_09770 61 1221 CDS product double-cubane-cluster-containing anaerobic reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359361.1 protein_id gnl|my_center|LOCUS_09770 1261 2658 gene locus_tag LOCUS_09780 1261 2658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09780 2658 3494 gene locus_tag LOCUS_09790 2658 3494 CDS product acyl-CoA dehydratase activase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392520.1 protein_id gnl|my_center|LOCUS_09790 4097 3495 gene locus_tag LOCUS_09800 4097 3495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09800 4840 4175 gene locus_tag LOCUS_09810 4840 4175 CDS product TIGR00153 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005647270.1 protein_id gnl|my_center|LOCUS_09810 6088 4865 gene locus_tag LOCUS_09820 6088 4865 CDS product inorganic phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073547.1 protein_id gnl|my_center|LOCUS_09820 7504 6308 gene locus_tag LOCUS_09830 7504 6308 CDS product thiolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460369.1 protein_id gnl|my_center|LOCUS_09830 9269 7689 gene locus_tag LOCUS_09840 gene fadD5 9269 7689 CDS product fatty-acid--CoA ligase FadD5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726688.1 protein_id gnl|my_center|LOCUS_09840 11895 9301 gene locus_tag LOCUS_09850 11895 9301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09850 12158 12385 gene locus_tag LOCUS_09860 12158 12385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09860 12500 13438 gene locus_tag LOCUS_09870 12500 13438 CDS product hydroxymethylglutaryl-CoA lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810801.1 protein_id gnl|my_center|LOCUS_09870 >Feature sequence057 <1 720 gene locus_tag LOCUS_09880 <1 720 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014876665.1:SDR family oxidoreductase 1044 1496 gene locus_tag LOCUS_09890 1044 1496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09890 1411 1821 gene locus_tag LOCUS_09900 1411 1821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_09900 1818 2156 gene locus_tag LOCUS_09910 1818 2156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_09910 2737 3342 gene locus_tag LOCUS_09920 2737 3342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09920 3358 5250 gene locus_tag LOCUS_09930 3358 5250 CDS product AMP-dependent synthetase/ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039705.1 protein_id gnl|my_center|LOCUS_09930 5297 6472 gene locus_tag LOCUS_09940 5297 6472 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007055677.1 protein_id gnl|my_center|LOCUS_09940 6698 7570 gene locus_tag LOCUS_09950 6698 7570 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391255.1 protein_id gnl|my_center|LOCUS_09950 7571 8635 gene locus_tag LOCUS_09960 7571 8635 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256970.1 protein_id gnl|my_center|LOCUS_09960 8636 9454 gene locus_tag LOCUS_09970 8636 9454 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227947.1 protein_id gnl|my_center|LOCUS_09970 9447 10232 gene locus_tag LOCUS_09980 9447 10232 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256973.1 protein_id gnl|my_center|LOCUS_09980 10236 11333 gene locus_tag LOCUS_09990 10236 11333 CDS product uroporphyrinogen decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393601.1 protein_id gnl|my_center|LOCUS_09990 11334 11708 gene locus_tag LOCUS_10000 11334 11708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10000 11680 11970 gene locus_tag LOCUS_10010 11680 11970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10010 12046 12951 gene locus_tag LOCUS_10020 12046 12951 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004551371.1 protein_id gnl|my_center|LOCUS_10020 >Feature sequence058 324 479 gene locus_tag LOCUS_10030 324 479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10030 483 686 gene locus_tag LOCUS_10040 483 686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10040 604 3447 gene locus_tag LOCUS_10050 604 3447 CDS product UPF0182 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392653.1 protein_id gnl|my_center|LOCUS_10050 3517 5220 gene locus_tag LOCUS_10060 3517 5220 CDS product glutamine--tRNA ligase/YqeY domain fusion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940210.1 protein_id gnl|my_center|LOCUS_10060 5303 5638 gene locus_tag LOCUS_10070 5303 5638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10070 5689 5985 gene locus_tag LOCUS_10080 5689 5985 CDS product integration host factor subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942168.1 protein_id gnl|my_center|LOCUS_10080 6161 6571 gene locus_tag LOCUS_10090 6161 6571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10090 8400 6574 gene locus_tag LOCUS_10100 8400 6574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_10100 9051 8416 gene locus_tag LOCUS_10110 9051 8416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_10110 10638 9055 gene locus_tag LOCUS_10120 10638 9055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10120 12623 10635 gene locus_tag LOCUS_10130 12623 10635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_10130 <13568 12620 gene locus_tag LOCUS_10140 <13568 12620 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_048053741.1:NAD(P)-binding protein note possible pseudo, frameshifted >Feature sequence059 727 1614 gene locus_tag LOCUS_10150 gene rfbD 727 1614 CDS product dTDP-4-dehydrorhamnose reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877394.1 protein_id gnl|my_center|LOCUS_10150 1636 2043 gene locus_tag LOCUS_10160 1636 2043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10160 3844 2036 gene locus_tag LOCUS_10170 3844 2036 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878757.1 protein_id gnl|my_center|LOCUS_10170 4241 4579 gene locus_tag LOCUS_10180 4241 4579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10180 4725 5885 gene locus_tag LOCUS_10190 4725 5885 CDS product nucleoside transporter C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088367.1 protein_id gnl|my_center|LOCUS_10190 6610 5903 gene locus_tag LOCUS_10200 6610 5903 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763250.1 protein_id gnl|my_center|LOCUS_10200 7353 6613 gene locus_tag LOCUS_10210 7353 6613 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763251.1 protein_id gnl|my_center|LOCUS_10210 8363 7362 gene locus_tag LOCUS_10220 8363 7362 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763252.1 protein_id gnl|my_center|LOCUS_10220 9247 8360 gene locus_tag LOCUS_10230 9247 8360 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763253.1 protein_id gnl|my_center|LOCUS_10230 10581 9295 gene locus_tag LOCUS_10240 10581 9295 CDS product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053240446.1 protein_id gnl|my_center|LOCUS_10240 11964 10780 gene locus_tag LOCUS_10250 11964 10780 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089637.1 protein_id gnl|my_center|LOCUS_10250 12486 13475 gene locus_tag LOCUS_10260 12486 13475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10260 >Feature sequence060 790 188 gene locus_tag LOCUS_10270 790 188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10270 2028 790 gene locus_tag LOCUS_10280 2028 790 CDS product Tm-1-like ATP-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949085.1 protein_id gnl|my_center|LOCUS_10280 4025 2370 gene locus_tag LOCUS_10290 4025 2370 CDS product (2,3-dihydroxybenzoyl)adenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000960113.1 protein_id gnl|my_center|LOCUS_10290 4585 4055 gene locus_tag LOCUS_10300 4585 4055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10300 6142 4736 gene locus_tag LOCUS_10310 6142 4736 CDS product UbiD family decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010977989.1 protein_id gnl|my_center|LOCUS_10310 7555 6473 gene locus_tag LOCUS_10320 7555 6473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10320 7977 7588 gene locus_tag LOCUS_10330 7977 7588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10330 8763 8059 gene locus_tag LOCUS_10340 8763 8059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10340 9511 8822 gene locus_tag LOCUS_10350 9511 8822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_10350 9583 9795 gene locus_tag LOCUS_10360 9583 9795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10360 9792 10013 gene locus_tag LOCUS_10370 9792 10013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10370 10202 11161 gene locus_tag LOCUS_10380 10202 11161 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015909376.1 protein_id gnl|my_center|LOCUS_10380 12419 11163 gene locus_tag LOCUS_10390 12419 11163 CDS product Tm-1-like ATP-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122999.1 protein_id gnl|my_center|LOCUS_10390 <13345 12423 gene locus_tag LOCUS_10400 <13345 12423 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004082811.1:DUF89 domain-containing protein >Feature sequence061 576 1064 gene locus_tag LOCUS_10410 576 1064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10410 1752 1099 gene locus_tag LOCUS_10420 1752 1099 CDS product protein-L-isoaspartate(D-aspartate) O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942171.1 protein_id gnl|my_center|LOCUS_10420 1982 2854 gene locus_tag LOCUS_10430 gene glyQ 1982 2854 CDS product glycine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941241.1 protein_id gnl|my_center|LOCUS_10430 2865 5009 gene locus_tag LOCUS_10440 gene glyS 2865 5009 CDS product glycine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941242.1 protein_id gnl|my_center|LOCUS_10440 6350 5142 gene locus_tag LOCUS_10450 6350 5142 CDS product murein transglycosylase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938186.1 protein_id gnl|my_center|LOCUS_10450 6895 7824 gene locus_tag LOCUS_10460 gene lpxC 6895 7824 CDS product UDP-3-O-acyl-N-acetylglucosamine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957401.1 protein_id gnl|my_center|LOCUS_10460 8239 8823 gene locus_tag LOCUS_10470 8239 8823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10470 8836 11067 gene locus_tag LOCUS_10480 8836 11067 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941478.1 protein_id gnl|my_center|LOCUS_10480 11081 12340 gene locus_tag LOCUS_10490 11081 12340 CDS product 3-deoxy-D-manno-octulosonic acid transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942899.1 protein_id gnl|my_center|LOCUS_10490 12412 12843 gene locus_tag LOCUS_10500 12412 12843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10500 >Feature sequence062 2837 2052 gene locus_tag LOCUS_10510 2837 2052 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000409725.1 protein_id gnl|my_center|LOCUS_10510 3651 2968 gene locus_tag LOCUS_10520 3651 2968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10520 4351 3665 gene locus_tag LOCUS_10530 4351 3665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10530 4568 4365 gene locus_tag LOCUS_10540 4568 4365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10540 5556 4693 gene locus_tag LOCUS_10550 5556 4693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10550 5939 5715 gene locus_tag LOCUS_10560 5939 5715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10560 6579 6016 gene locus_tag LOCUS_10570 6579 6016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10570 6695 6907 gene locus_tag LOCUS_10580 6695 6907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10580 8155 7082 gene locus_tag LOCUS_10590 8155 7082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10590 8717 8334 gene locus_tag LOCUS_10600 8717 8334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10600 9996 9019 gene locus_tag LOCUS_10610 9996 9019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10610 10218 10535 gene locus_tag LOCUS_10620 10218 10535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10620 10724 11083 gene locus_tag LOCUS_10630 10724 11083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10630 11032 11460 gene locus_tag LOCUS_10640 11032 11460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10640 11457 12386 gene locus_tag LOCUS_10650 11457 12386 CDS product MinD/ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002657813.1 protein_id gnl|my_center|LOCUS_10650 >Feature sequence063 735 1742 gene locus_tag LOCUS_10660 735 1742 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989600.1 protein_id gnl|my_center|LOCUS_10660 1830 3335 gene locus_tag LOCUS_10670 1830 3335 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948739.1 protein_id gnl|my_center|LOCUS_10670 3349 4623 gene locus_tag LOCUS_10680 3349 4623 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964633.1 protein_id gnl|my_center|LOCUS_10680 4616 5002 gene locus_tag LOCUS_10690 4616 5002 CDS product DUF1667 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925454.1 protein_id gnl|my_center|LOCUS_10690 5075 6079 gene locus_tag LOCUS_10700 5075 6079 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254327.1 protein_id gnl|my_center|LOCUS_10700 6118 7227 gene locus_tag LOCUS_10710 6118 7227 CDS product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090563.1 protein_id gnl|my_center|LOCUS_10710 7425 7928 gene locus_tag LOCUS_10720 7425 7928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10720 7918 9222 gene locus_tag LOCUS_10730 7918 9222 CDS product TRAP transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090565.1 protein_id gnl|my_center|LOCUS_10730 9284 11095 gene locus_tag LOCUS_10740 9284 11095 CDS product aldehyde ferredoxin oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941578.1 protein_id gnl|my_center|LOCUS_10740 11758 12513 gene locus_tag LOCUS_10750 11758 12513 CDS product 3-oxoacyl-ACP reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728415.1 protein_id gnl|my_center|LOCUS_10750 >Feature sequence064 1245 1 gene locus_tag LOCUS_10760 1245 1 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391253.1 protein_id gnl|my_center|LOCUS_10760 2945 1419 gene locus_tag LOCUS_10770 2945 1419 CDS product fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085732.1 protein_id gnl|my_center|LOCUS_10770 3781 3185 gene locus_tag LOCUS_10780 3781 3185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10780 4629 3820 gene locus_tag LOCUS_10790 4629 3820 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256968.1 protein_id gnl|my_center|LOCUS_10790 5995 4712 gene locus_tag LOCUS_10800 5995 4712 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391253.1 protein_id gnl|my_center|LOCUS_10800 7302 6205 gene locus_tag LOCUS_10810 7302 6205 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256970.1 protein_id gnl|my_center|LOCUS_10810 7742 7365 gene locus_tag LOCUS_10820 7742 7365 CDS product four helix bundle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405056.1 protein_id gnl|my_center|LOCUS_10820 8690 7806 gene locus_tag LOCUS_10830 8690 7806 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256971.1 protein_id gnl|my_center|LOCUS_10830 9150 8758 gene locus_tag LOCUS_10840 9150 8758 CDS product four helix bundle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530241.1 protein_id gnl|my_center|LOCUS_10840 11112 9184 gene locus_tag LOCUS_10850 11112 9184 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256972.1 protein_id gnl|my_center|LOCUS_10850 11935 11114 gene locus_tag LOCUS_10860 11935 11114 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256973.1 protein_id gnl|my_center|LOCUS_10860 >Feature sequence065 1087 386 gene locus_tag LOCUS_10870 1087 386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10870 2004 1129 gene locus_tag LOCUS_10880 2004 1129 CDS product F0F1 ATP synthase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938077.1 protein_id gnl|my_center|LOCUS_10880 3671 2157 gene locus_tag LOCUS_10890 gene atpA 3671 2157 CDS product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938078.1 protein_id gnl|my_center|LOCUS_10890 4222 3671 gene locus_tag LOCUS_10900 gene atpH 4222 3671 CDS product ATP synthase F1 subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940786.1 protein_id gnl|my_center|LOCUS_10900 4830 4219 gene locus_tag LOCUS_10910 4830 4219 CDS product ATP synthase F0 subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940785.1 protein_id gnl|my_center|LOCUS_10910 5255 4827 gene locus_tag LOCUS_10920 5255 4827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10920 5820 5380 gene locus_tag LOCUS_10930 5820 5380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10930 6032 6652 gene locus_tag LOCUS_10940 6032 6652 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035214699.1 protein_id gnl|my_center|LOCUS_10940 6699 7841 gene locus_tag LOCUS_10950 gene acdA 6699 7841 CDS product acyl-CoA dehydrogenase AcdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000545544.1 protein_id gnl|my_center|LOCUS_10950 8128 9258 gene locus_tag LOCUS_10960 8128 9258 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228882.1 protein_id gnl|my_center|LOCUS_10960 9290 10906 gene locus_tag LOCUS_10970 9290 10906 CDS product propionyl-CoA carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257900.1 protein_id gnl|my_center|LOCUS_10970 11140 12624 gene locus_tag LOCUS_10980 gene accC 11140 12624 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944627.1 protein_id gnl|my_center|LOCUS_10980 >Feature sequence066 131 376 gene locus_tag LOCUS_10990 131 376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10990 387 1454 gene locus_tag LOCUS_11000 387 1454 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065074.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11000 3075 1447 gene locus_tag LOCUS_11010 3075 1447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11010 3310 4122 gene locus_tag LOCUS_11020 3310 4122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11020 4115 7363 gene locus_tag LOCUS_11030 4115 7363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11030 7802 9166 gene locus_tag LOCUS_11040 7802 9166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11040 9180 10109 gene locus_tag LOCUS_11050 9180 10109 CDS product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941353.1 protein_id gnl|my_center|LOCUS_11050 10153 11565 gene locus_tag LOCUS_11060 10153 11565 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877924.1 protein_id gnl|my_center|LOCUS_11060 12308 11562 gene locus_tag LOCUS_11070 12308 11562 CDS product ribonuclease H-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020864.1 protein_id gnl|my_center|LOCUS_11070 >Feature sequence067 2997 163 gene locus_tag LOCUS_11080 2997 163 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792370.1 protein_id gnl|my_center|LOCUS_11080 3498 3046 gene locus_tag LOCUS_11090 3498 3046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11090 4387 3842 gene locus_tag LOCUS_11100 4387 3842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11100 4751 4338 gene locus_tag LOCUS_11110 4751 4338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11110 5101 8028 gene locus_tag LOCUS_11120 5101 8028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11120 8179 8427 gene locus_tag LOCUS_11130 8179 8427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11130 8566 10527 gene locus_tag LOCUS_11140 8566 10527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11140 10580 12268 gene locus_tag LOCUS_11150 10580 12268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11150 >Feature sequence068 2933 423 gene locus_tag LOCUS_11160 gene infB 2933 423 CDS product translation initiation factor IF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942233.1 protein_id gnl|my_center|LOCUS_11160 3309 3028 gene locus_tag LOCUS_11170 3309 3028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11170 4618 3269 gene locus_tag LOCUS_11180 gene nusA 4618 3269 CDS product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942231.1 protein_id gnl|my_center|LOCUS_11180 5183 4650 gene locus_tag LOCUS_11190 gene rimP 5183 4650 CDS product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460396.1 protein_id gnl|my_center|LOCUS_11190 5644 5569 gene locus_tag LOCUS_t00110 5644 5569 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 5856 6731 gene locus_tag LOCUS_11200 5856 6731 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942919.1 protein_id gnl|my_center|LOCUS_11200 7192 6971 gene locus_tag LOCUS_11210 7192 6971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11210 7463 7182 gene locus_tag LOCUS_11220 7463 7182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11220 7695 8564 gene locus_tag LOCUS_11230 7695 8564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11230 8966 10021 gene locus_tag LOCUS_11240 gene prfB 8966 10021 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942918.1 protein_id gnl|my_center|LOCUS_11240 12214 10022 gene locus_tag LOCUS_11250 12214 10022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11250 >Feature sequence069 307 1887 gene locus_tag LOCUS_11260 307 1887 CDS product DASS family sodium-coupled anion symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879947.1 protein_id gnl|my_center|LOCUS_11260 2143 3333 gene locus_tag LOCUS_11270 2143 3333 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940226.1 protein_id gnl|my_center|LOCUS_11270 3377 3817 gene locus_tag LOCUS_11280 3377 3817 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940496.1 protein_id gnl|my_center|LOCUS_11280 3858 5519 gene locus_tag LOCUS_11290 3858 5519 CDS product PAS domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940474.1 protein_id gnl|my_center|LOCUS_11290 5687 6127 gene locus_tag LOCUS_11300 5687 6127 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940473.1 protein_id gnl|my_center|LOCUS_11300 6616 7992 gene locus_tag LOCUS_11310 6616 7992 CDS product DASS family sodium-coupled anion symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040605.1 protein_id gnl|my_center|LOCUS_11310 8405 10066 gene locus_tag LOCUS_11320 8405 10066 CDS product PAS domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940474.1 protein_id gnl|my_center|LOCUS_11320 10280 10741 gene locus_tag LOCUS_11330 10280 10741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11330 >Feature sequence070 712 209 gene locus_tag LOCUS_11340 712 209 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083008.1 protein_id gnl|my_center|LOCUS_11340 1972 713 gene locus_tag LOCUS_11350 gene hacA 1972 713 CDS product homoaconitase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876998.1 protein_id gnl|my_center|LOCUS_11350 2303 1977 gene locus_tag LOCUS_11360 2303 1977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11360 3943 2306 gene locus_tag LOCUS_11370 3943 2306 CDS product fumarate reductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869524.1 protein_id gnl|my_center|LOCUS_11370 5134 3983 gene locus_tag LOCUS_11380 5134 3983 CDS product Xaa-Pro peptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339317.1 protein_id gnl|my_center|LOCUS_11380 6256 5138 gene locus_tag LOCUS_11390 6256 5138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11390 6784 6269 gene locus_tag LOCUS_11400 6784 6269 CDS product Isopropylmalate/citramalate isomerase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870790.1 protein_id gnl|my_center|LOCUS_11400 8074 6818 gene locus_tag LOCUS_11410 gene hacA 8074 6818 CDS product homoaconitase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066440.1 protein_id gnl|my_center|LOCUS_11410 9977 8142 gene locus_tag LOCUS_11420 9977 8142 CDS product TRAP transporter large permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459065.1 protein_id gnl|my_center|LOCUS_11420 11058 10039 gene locus_tag LOCUS_11430 11058 10039 CDS product DctP family TRAP transporter solute-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085534.1 protein_id gnl|my_center|LOCUS_11430 12010 11258 gene locus_tag LOCUS_11440 12010 11258 CDS product FadR/GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393787.1 protein_id gnl|my_center|LOCUS_11440 >Feature sequence071 238 924 gene locus_tag LOCUS_11450 238 924 CDS product DUF1847 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435816.1 protein_id gnl|my_center|LOCUS_11450 1671 1994 gene locus_tag LOCUS_11460 1671 1994 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546786.1 protein_id gnl|my_center|LOCUS_11460 1991 2170 gene locus_tag LOCUS_11470 1991 2170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11470 2215 2334 gene locus_tag LOCUS_11480 2215 2334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11480 2647 3291 gene locus_tag LOCUS_11490 2647 3291 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391621.1 protein_id gnl|my_center|LOCUS_11490 3599 4660 gene locus_tag LOCUS_11500 3599 4660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11500 4678 5184 gene locus_tag LOCUS_11510 4678 5184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11510 5181 6485 gene locus_tag LOCUS_11520 5181 6485 CDS product TRAP transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090565.1 protein_id gnl|my_center|LOCUS_11520 6482 7918 gene locus_tag LOCUS_11530 6482 7918 CDS product MmgE/PrpD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039289.1 protein_id gnl|my_center|LOCUS_11530 8038 9447 gene locus_tag LOCUS_11540 8038 9447 CDS product FAD-linked oxidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393791.1 protein_id gnl|my_center|LOCUS_11540 9543 10730 gene locus_tag LOCUS_11550 9543 10730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11550 10857 11312 gene locus_tag LOCUS_11560 10857 11312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11560 11300 11902 gene locus_tag LOCUS_11570 11300 11902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11570 >Feature sequence072 613 392 gene locus_tag LOCUS_11580 613 392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11580 1257 637 gene locus_tag LOCUS_11590 1257 637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11590 1693 1406 gene locus_tag LOCUS_11600 1693 1406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11600 2276 1863 gene locus_tag LOCUS_11610 2276 1863 CDS product PIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404325.1 protein_id gnl|my_center|LOCUS_11610 2512 2273 gene locus_tag LOCUS_11620 2512 2273 CDS product DUF6364 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404326.1 protein_id gnl|my_center|LOCUS_11620 2943 3305 gene locus_tag LOCUS_11630 2943 3305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11630 3277 3591 gene locus_tag LOCUS_11640 3277 3591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11640 3620 4177 gene locus_tag LOCUS_11650 3620 4177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11650 4848 6161 gene locus_tag LOCUS_11660 4848 6161 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965775.1 protein_id gnl|my_center|LOCUS_11660 6262 7176 gene locus_tag LOCUS_11670 6262 7176 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028172393.1 protein_id gnl|my_center|LOCUS_11670 7164 8171 gene locus_tag LOCUS_11680 7164 8171 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965773.1 protein_id gnl|my_center|LOCUS_11680 8171 8914 gene locus_tag LOCUS_11690 8171 8914 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942651.1 protein_id gnl|my_center|LOCUS_11690 8965 9681 gene locus_tag LOCUS_11700 8965 9681 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080267.1 protein_id gnl|my_center|LOCUS_11700 10656 9694 gene locus_tag LOCUS_11710 10656 9694 CDS product biotin-dependent carboxyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016387.1 protein_id gnl|my_center|LOCUS_11710 11330 10644 gene locus_tag LOCUS_11720 gene pxpB 11330 10644 CDS product 5-oxoprolinase subunit PxpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249288.1 protein_id gnl|my_center|LOCUS_11720 >Feature sequence073 79 1419 gene locus_tag LOCUS_11730 79 1419 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259421.1 protein_id gnl|my_center|LOCUS_11730 1429 2280 gene locus_tag LOCUS_11740 1429 2280 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402848.1 protein_id gnl|my_center|LOCUS_11740 2835 2260 gene locus_tag LOCUS_11750 2835 2260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11750 3657 3079 gene locus_tag LOCUS_11760 3657 3079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11760 4443 4009 gene locus_tag LOCUS_11770 4443 4009 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899644.1 protein_id gnl|my_center|LOCUS_11770 4601 4440 gene locus_tag LOCUS_11780 4601 4440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11780 5363 4746 gene locus_tag LOCUS_11790 gene gmk 5363 4746 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942878.1 protein_id gnl|my_center|LOCUS_11790 5638 5366 gene locus_tag LOCUS_11800 5638 5366 CDS product DUF370 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938198.1 protein_id gnl|my_center|LOCUS_11800 6534 5653 gene locus_tag LOCUS_11810 6534 5653 CDS product YicC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942879.1 protein_id gnl|my_center|LOCUS_11810 7066 6527 gene locus_tag LOCUS_11820 7066 6527 CDS product DUF4416 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544933.1 protein_id gnl|my_center|LOCUS_11820 8313 7342 gene locus_tag LOCUS_11830 gene rfaE1 8313 7342 CDS product D-glycero-beta-D-manno-heptose-7-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546729.1 protein_id gnl|my_center|LOCUS_11830 8823 10181 gene locus_tag LOCUS_11840 gene trkA 8823 10181 CDS product Trk system potassium transporter TrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545959.1 protein_id gnl|my_center|LOCUS_11840 10181 11629 gene locus_tag LOCUS_11850 10181 11629 CDS product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545413.1 protein_id gnl|my_center|LOCUS_11850 >Feature sequence074 1375 638 gene locus_tag LOCUS_11860 1375 638 CDS product tRNA1(Val) (adenine(37)-N6)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_087456344.1 protein_id gnl|my_center|LOCUS_11860 2708 1353 gene locus_tag LOCUS_11870 2708 1353 CDS product DUF1015 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931831.1 protein_id gnl|my_center|LOCUS_11870 2908 3324 gene locus_tag LOCUS_11880 2908 3324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11880 3372 4181 gene locus_tag LOCUS_11890 3372 4181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11890 4542 4258 gene locus_tag LOCUS_11900 4542 4258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11900 4637 4446 gene locus_tag LOCUS_11910 4637 4446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11910 4874 6214 gene locus_tag LOCUS_11920 4874 6214 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939137.1 protein_id gnl|my_center|LOCUS_11920 6644 7591 gene locus_tag LOCUS_11930 6644 7591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11930 8204 8965 gene locus_tag LOCUS_11940 8204 8965 CDS product cobalamin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073501.1 protein_id gnl|my_center|LOCUS_11940 9107 9919 gene locus_tag LOCUS_11950 9107 9919 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228313.1 protein_id gnl|my_center|LOCUS_11950 9916 10935 gene locus_tag LOCUS_11960 9916 10935 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897464.1 protein_id gnl|my_center|LOCUS_11960 >Feature sequence075 746 1081 gene locus_tag LOCUS_11970 746 1081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11970 2378 1368 gene locus_tag LOCUS_11980 gene hypE 2378 1368 CDS product hydrogenase expression/formation protein HypE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964127.1 protein_id gnl|my_center|LOCUS_11980 3325 2375 gene locus_tag LOCUS_11990 gene hypD 3325 2375 CDS product hydrogenase formation protein HypD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810717.1 protein_id gnl|my_center|LOCUS_11990 3640 3398 gene locus_tag LOCUS_12000 3640 3398 CDS product HypC/HybG/HupF family hydrogenase formation chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250951.1 protein_id gnl|my_center|LOCUS_12000 6171 3910 gene locus_tag LOCUS_12010 gene hypF 6171 3910 CDS product carbamoyltransferase HypF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940975.1 protein_id gnl|my_center|LOCUS_12010 6549 6226 gene locus_tag LOCUS_12020 6549 6226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12020 7590 6742 gene locus_tag LOCUS_12030 7590 6742 CDS product methylenetetrahydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436920.1 protein_id gnl|my_center|LOCUS_12030 8261 7590 gene locus_tag LOCUS_12040 8261 7590 CDS product methylenetetrahydrofolate reductase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436912.1 protein_id gnl|my_center|LOCUS_12040 9825 8275 gene locus_tag LOCUS_12050 9825 8275 CDS product nickel-dependent hydrogenase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811612.1 protein_id gnl|my_center|LOCUS_12050 10723 9818 gene locus_tag LOCUS_12060 10723 9818 CDS product hydrogenase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939203.1 protein_id gnl|my_center|LOCUS_12060 <11539 10797 gene locus_tag LOCUS_12070 <11539 10797 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010937880.1:formate dehydrogenase accessory protein FdhE >Feature sequence076 2903 2076 gene locus_tag LOCUS_12080 2903 2076 CDS product KilA-N domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004804477.1 protein_id gnl|my_center|LOCUS_12080 5224 2900 gene locus_tag LOCUS_12090 5224 2900 CDS product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970307.1 protein_id gnl|my_center|LOCUS_12090 6137 5598 gene locus_tag LOCUS_12100 6137 5598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12100 6833 6231 gene locus_tag LOCUS_12110 6833 6231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12110 7875 6826 gene locus_tag LOCUS_12120 7875 6826 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035321.1 protein_id gnl|my_center|LOCUS_12120 9233 8016 gene locus_tag LOCUS_12130 9233 8016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12130 10174 9608 gene locus_tag LOCUS_12140 10174 9608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12140 11408 10902 gene locus_tag LOCUS_12150 11408 10902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12150 >Feature sequence077 541 20 gene locus_tag LOCUS_12160 541 20 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12160 1029 538 gene locus_tag LOCUS_12170 1029 538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12170 1931 1041 gene locus_tag LOCUS_12180 1931 1041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12180 2899 1928 gene locus_tag LOCUS_12190 gene gspK 2899 1928 CDS product type II secretion system minor pseudopilin GspK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121457.1 protein_id gnl|my_center|LOCUS_12190 3572 2919 gene locus_tag LOCUS_12200 3572 2919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12200 3961 3569 gene locus_tag LOCUS_12210 3961 3569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12210 4454 3930 gene locus_tag LOCUS_12220 4454 3930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12220 4890 4417 gene locus_tag LOCUS_12230 gene gspG 4890 4417 CDS product type II secretion system major pseudopilin GspG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196811.1 protein_id gnl|my_center|LOCUS_12230 6213 4984 gene locus_tag LOCUS_12240 gene gspF 6213 4984 CDS product type II secretion system inner membrane protein GspF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000718700.1 protein_id gnl|my_center|LOCUS_12240 7852 6689 gene locus_tag LOCUS_12250 7852 6689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12250 8252 7983 gene locus_tag LOCUS_12260 8252 7983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12260 10318 8339 gene locus_tag LOCUS_12270 gene gspD 10318 8339 CDS product type II secretion system secretin GspD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940997.1 protein_id gnl|my_center|LOCUS_12270 10761 10336 gene locus_tag LOCUS_12280 10761 10336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12280 11329 10994 gene locus_tag LOCUS_12290 11329 10994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12290 >Feature sequence078 902 4375 gene locus_tag LOCUS_12300 gene dnaE 902 4375 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942050.1 protein_id gnl|my_center|LOCUS_12300 4693 4502 gene locus_tag LOCUS_12310 4693 4502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12310 4856 7210 gene locus_tag LOCUS_12320 4856 7210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12320 7276 8058 gene locus_tag LOCUS_12330 7276 8058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12330 8108 8338 gene locus_tag LOCUS_12340 8108 8338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12340 8984 8361 gene locus_tag LOCUS_12350 8984 8361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12350 9563 8997 gene locus_tag LOCUS_12360 9563 8997 CDS product indolepyruvate oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028841930.1 protein_id gnl|my_center|LOCUS_12360 <11173 9821 gene locus_tag LOCUS_12370 <11173 9821 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942696.1:thiamine pyrophosphate-dependent enzyme >Feature sequence079 891 391 gene locus_tag LOCUS_12380 891 391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12380 1485 958 gene locus_tag LOCUS_12390 1485 958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12390 2045 1563 gene locus_tag LOCUS_12400 2045 1563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12400 2273 2055 gene locus_tag LOCUS_12410 2273 2055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12410 3532 2270 gene locus_tag LOCUS_12420 gene arsB 3532 2270 CDS product ACR3 family arsenite efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118066.1 protein_id gnl|my_center|LOCUS_12420 4410 3697 gene locus_tag LOCUS_12430 4410 3697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12430 5381 4491 gene locus_tag LOCUS_12440 5381 4491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12440 5858 5433 gene locus_tag LOCUS_12450 5858 5433 CDS product putative zinc-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065848.1 protein_id gnl|my_center|LOCUS_12450 6120 5881 gene locus_tag LOCUS_12460 6120 5881 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065850.1 protein_id gnl|my_center|LOCUS_12460 7378 6206 gene locus_tag LOCUS_12470 7378 6206 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870216.1 protein_id gnl|my_center|LOCUS_12470 7822 7478 gene locus_tag LOCUS_12480 7822 7478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12480 8229 8507 gene locus_tag LOCUS_12490 8229 8507 CDS product TMEM165/GDT1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140124.1 protein_id gnl|my_center|LOCUS_12490 8508 9185 gene locus_tag LOCUS_12500 8508 9185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12500 9837 9322 gene locus_tag LOCUS_12510 9837 9322 CDS product O-acetyl-ADP-ribose deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065167.1 protein_id gnl|my_center|LOCUS_12510 10406 9834 gene locus_tag LOCUS_12520 gene hypB 10406 9834 CDS product hydrogenase nickel incorporation protein HypB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545559.1 protein_id gnl|my_center|LOCUS_12520 10819 10499 gene locus_tag LOCUS_12530 gene hypA 10819 10499 CDS product hydrogenase maturation nickel metallochaperone HypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388923.1 protein_id gnl|my_center|LOCUS_12530 >Feature sequence080 <1 698 gene locus_tag LOCUS_12540 <1 698 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000431263.1:metallophosphoesterase 1488 739 gene locus_tag LOCUS_12550 1488 739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12550 2319 2023 gene locus_tag LOCUS_12560 2319 2023 CDS product MTH1187 family thiamine-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938514.1 protein_id gnl|my_center|LOCUS_12560 2653 2811 gene locus_tag LOCUS_12570 2653 2811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12570 2962 4116 gene locus_tag LOCUS_12580 2962 4116 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267357.1 protein_id gnl|my_center|LOCUS_12580 4113 4790 gene locus_tag LOCUS_12590 4113 4790 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962745.1 protein_id gnl|my_center|LOCUS_12590 4795 6000 gene locus_tag LOCUS_12600 4795 6000 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057223.1 protein_id gnl|my_center|LOCUS_12600 5969 7216 gene locus_tag LOCUS_12610 5969 7216 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057223.1 protein_id gnl|my_center|LOCUS_12610 7597 7334 gene locus_tag LOCUS_12620 gene hupB 7597 7334 CDS product DNA-binding protein HU-beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006081127.1 protein_id gnl|my_center|LOCUS_12620 8110 9768 gene locus_tag LOCUS_12630 gene cdr 8110 9768 CDS product CoA-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000087584.1 protein_id gnl|my_center|LOCUS_12630 9886 10833 gene locus_tag LOCUS_12640 9886 10833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12640 >Feature sequence081 142 855 gene locus_tag LOCUS_12650 142 855 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582866.1 protein_id gnl|my_center|LOCUS_12650 1018 2652 gene locus_tag LOCUS_12660 1018 2652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12660 2860 3678 gene locus_tag LOCUS_12670 2860 3678 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385788.1 protein_id gnl|my_center|LOCUS_12670 3681 4730 gene locus_tag LOCUS_12680 3681 4730 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014538195.1 protein_id gnl|my_center|LOCUS_12680 4730 5719 gene locus_tag LOCUS_12690 4730 5719 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868866.1 protein_id gnl|my_center|LOCUS_12690 5722 6693 gene locus_tag LOCUS_12700 5722 6693 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385787.1 protein_id gnl|my_center|LOCUS_12700 6740 7924 gene locus_tag LOCUS_12710 6740 7924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12710 8055 9467 gene locus_tag LOCUS_12720 8055 9467 CDS product 5'-deoxyadenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902871.1 protein_id gnl|my_center|LOCUS_12720 9651 9379 gene locus_tag LOCUS_12730 9651 9379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12730 9726 10802 gene locus_tag LOCUS_12740 gene larA 9726 10802 CDS product nickel-dependent lactate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393426.1 protein_id gnl|my_center|LOCUS_12740 >Feature sequence082 1620 823 gene locus_tag LOCUS_12750 1620 823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12750 2031 2444 gene locus_tag LOCUS_12760 2031 2444 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263922.1 protein_id gnl|my_center|LOCUS_12760 2507 3733 gene locus_tag LOCUS_12770 2507 3733 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878191.1 protein_id gnl|my_center|LOCUS_12770 3875 4474 gene locus_tag LOCUS_12780 3875 4474 CDS product epoxyqueuosine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009127818.1 protein_id gnl|my_center|LOCUS_12780 4621 5661 gene locus_tag LOCUS_12790 4621 5661 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878758.1 protein_id gnl|my_center|LOCUS_12790 5743 6840 gene locus_tag LOCUS_12800 5743 6840 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878758.1 protein_id gnl|my_center|LOCUS_12800 6872 7660 gene locus_tag LOCUS_12810 6872 7660 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729714.1 protein_id gnl|my_center|LOCUS_12810 7723 8619 gene locus_tag LOCUS_12820 7723 8619 CDS product nitronate monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005088843.1 protein_id gnl|my_center|LOCUS_12820 8772 9128 gene locus_tag LOCUS_12830 8772 9128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12830 9231 9926 gene locus_tag LOCUS_12840 9231 9926 CDS product crotonase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403259.1 protein_id gnl|my_center|LOCUS_12840 10547 10825 gene locus_tag LOCUS_12850 10547 10825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12850 >Feature sequence083 244 525 gene locus_tag LOCUS_12860 244 525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12860 931 581 gene locus_tag LOCUS_12870 931 581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12870 2497 1337 gene locus_tag LOCUS_12880 2497 1337 CDS product LL-diaminopimelate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392408.1 protein_id gnl|my_center|LOCUS_12880 2829 3260 gene locus_tag LOCUS_12890 2829 3260 CDS product MarR family winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918284.1 protein_id gnl|my_center|LOCUS_12890 3333 4277 gene locus_tag LOCUS_12900 3333 4277 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088879.1 protein_id gnl|my_center|LOCUS_12900 4288 4791 gene locus_tag LOCUS_12910 4288 4791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12910 4763 5611 gene locus_tag LOCUS_12920 4763 5611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12920 6655 5687 gene locus_tag LOCUS_12930 6655 5687 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943684.1 protein_id gnl|my_center|LOCUS_12930 7076 7543 gene locus_tag LOCUS_12940 7076 7543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12940 7652 8518 gene locus_tag LOCUS_12950 7652 8518 CDS product YegS/Rv2252/BmrU family lipid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003356507.1 protein_id gnl|my_center|LOCUS_12950 8641 8961 gene locus_tag LOCUS_12960 8641 8961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12960 8958 9248 gene locus_tag LOCUS_12970 8958 9248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12970 10395 10601 gene locus_tag LOCUS_12980 10395 10601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12980 >Feature sequence084 543 292 gene locus_tag LOCUS_12990 543 292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12990 1073 540 gene locus_tag LOCUS_13000 1073 540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13000 3484 1010 gene locus_tag LOCUS_13010 3484 1010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13010 4622 3477 gene locus_tag LOCUS_13020 gene carA 4622 3477 CDS product glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941928.1 protein_id gnl|my_center|LOCUS_13020 7514 4854 gene locus_tag LOCUS_13030 7514 4854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13030 9267 7717 gene locus_tag LOCUS_13040 9267 7717 CDS product glutamate synthase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392806.1 protein_id gnl|my_center|LOCUS_13040 >Feature sequence085 24 671 gene locus_tag LOCUS_13050 24 671 CDS product cyclase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933918.1 protein_id gnl|my_center|LOCUS_13050 721 1857 gene locus_tag LOCUS_13060 721 1857 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938728.1 protein_id gnl|my_center|LOCUS_13060 1967 2629 gene locus_tag LOCUS_13070 1967 2629 CDS product nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003022654.1 protein_id gnl|my_center|LOCUS_13070 2773 3669 gene locus_tag LOCUS_13080 2773 3669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13080 3808 4905 gene locus_tag LOCUS_13090 3808 4905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13090 4871 5125 gene locus_tag LOCUS_13100 4871 5125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13100 5521 6270 gene locus_tag LOCUS_13110 5521 6270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13110 6682 6389 gene locus_tag LOCUS_13120 6682 6389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13120 7178 6783 gene locus_tag LOCUS_13130 7178 6783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13130 7681 7298 gene locus_tag LOCUS_13140 7681 7298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13140 8677 7700 gene locus_tag LOCUS_13150 8677 7700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13150 9418 8681 gene locus_tag LOCUS_13160 9418 8681 CDS product DUF1847 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272550.1 protein_id gnl|my_center|LOCUS_13160 10460 9411 gene locus_tag LOCUS_13170 10460 9411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13170 >Feature sequence086 <1 579 gene locus_tag LOCUS_13180 <1 579 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011393617.1:dihydroorotate dehydrogenase 1835 888 gene locus_tag LOCUS_13190 1835 888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_13190 2238 2038 gene locus_tag LOCUS_13200 2238 2038 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294067.1 protein_id gnl|my_center|LOCUS_13200 3049 2489 gene locus_tag LOCUS_13210 3049 2489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13210 3438 5066 gene locus_tag LOCUS_13220 3438 5066 CDS product GMC family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222688.1 protein_id gnl|my_center|LOCUS_13220 5063 5305 gene locus_tag LOCUS_13230 5063 5305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13230 5430 6002 gene locus_tag LOCUS_13240 5430 6002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13240 6089 7960 gene locus_tag LOCUS_13250 gene aor 6089 7960 CDS product aldehyde ferredoxin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868080.1 protein_id gnl|my_center|LOCUS_13250 7960 9651 gene locus_tag LOCUS_13260 7960 9651 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879268.1 protein_id gnl|my_center|LOCUS_13260 10049 9759 gene locus_tag LOCUS_13270 10049 9759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13270 >Feature sequence087 377 1135 gene locus_tag LOCUS_13280 377 1135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13280 1286 1714 gene locus_tag LOCUS_13290 1286 1714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13290 1974 4664 gene locus_tag LOCUS_13300 gene fdhF 1974 4664 CDS product formate dehydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_080510933.1 protein_id gnl|my_center|LOCUS_13300 5079 5426 gene locus_tag LOCUS_13310 5079 5426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13310 5437 8553 gene locus_tag LOCUS_13320 5437 8553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13320 10355 8946 gene locus_tag LOCUS_13330 gene gltA 10355 8946 CDS product NADPH-dependent glutamate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393026.1 protein_id gnl|my_center|LOCUS_13330 >Feature sequence088 604 1020 gene locus_tag LOCUS_13340 604 1020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13340 1725 1117 gene locus_tag LOCUS_13350 1725 1117 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939817.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13350 1942 2172 gene locus_tag LOCUS_13360 1942 2172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13360 2232 2600 gene locus_tag LOCUS_13370 2232 2600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13370 2802 3551 gene locus_tag LOCUS_13380 2802 3551 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047978.1 protein_id gnl|my_center|LOCUS_13380 4216 3959 gene locus_tag LOCUS_13390 4216 3959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13390 5276 4317 gene locus_tag LOCUS_13400 gene dacZ 5276 4317 CDS product diadenylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870515.1 protein_id gnl|my_center|LOCUS_13400 6053 5574 gene locus_tag LOCUS_13410 6053 5574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_13410 7015 6071 gene locus_tag LOCUS_13420 7015 6071 CDS product glycoside hydrolase family 130 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080062.1 protein_id gnl|my_center|LOCUS_13420 8354 7002 gene locus_tag LOCUS_13430 8354 7002 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022352.1 protein_id gnl|my_center|LOCUS_13430 9325 8357 gene locus_tag LOCUS_13440 9325 8357 CDS product glycosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022353.1 protein_id gnl|my_center|LOCUS_13440 >Feature sequence089 253 660 gene locus_tag LOCUS_13450 253 660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13450 1252 758 gene locus_tag LOCUS_13460 1252 758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_13460 1825 1280 gene locus_tag LOCUS_13470 1825 1280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_13470 3961 2081 gene locus_tag LOCUS_13480 3961 2081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13480 5049 4009 gene locus_tag LOCUS_13490 5049 4009 CDS product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812137.1 protein_id gnl|my_center|LOCUS_13490 6223 5216 gene locus_tag LOCUS_13500 6223 5216 CDS product aryl-sulfate sulfotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000940824.1 protein_id gnl|my_center|LOCUS_13500 7868 6405 gene locus_tag LOCUS_13510 7868 6405 CDS product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902151.1 protein_id gnl|my_center|LOCUS_13510 8741 7899 gene locus_tag LOCUS_13520 8741 7899 CDS product phosphoadenosine phosphosulfate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902295.1 protein_id gnl|my_center|LOCUS_13520 10014 8785 gene locus_tag LOCUS_13530 10014 8785 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902969.1 protein_id gnl|my_center|LOCUS_13530 >Feature sequence090 <1 2355 gene locus_tag LOCUS_13540 <1 2355 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000081335.1:DEAD/DEAH box helicase family protein 2439 2579 gene locus_tag LOCUS_13550 2439 2579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13550 2603 5086 gene locus_tag LOCUS_13560 2603 5086 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202769.1 protein_id gnl|my_center|LOCUS_13560 5263 6393 gene locus_tag LOCUS_13570 5263 6393 CDS product exonuclease SbcCD subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005090007.1 protein_id gnl|my_center|LOCUS_13570 6390 9023 gene locus_tag LOCUS_13580 6390 9023 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110116.1 protein_id gnl|my_center|LOCUS_13580 10171 9419 gene locus_tag LOCUS_13590 10171 9419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13590 >Feature sequence091 507 2198 gene locus_tag LOCUS_13600 gene panP 507 2198 CDS product putative pyridoxal-dependent aspartate 1-decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483514.1 protein_id gnl|my_center|LOCUS_13600 2300 3025 gene locus_tag LOCUS_13610 2300 3025 CDS product DUF72 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546323.1 protein_id gnl|my_center|LOCUS_13610 3186 3416 gene locus_tag LOCUS_13620 3186 3416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13620 3596 5344 gene locus_tag LOCUS_13630 3596 5344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13630 5668 6030 gene locus_tag LOCUS_13640 5668 6030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13640 6126 6290 gene locus_tag LOCUS_13650 6126 6290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13650 6349 6741 gene locus_tag LOCUS_13660 6349 6741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13660 7586 6837 gene locus_tag LOCUS_13670 7586 6837 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942121.1 protein_id gnl|my_center|LOCUS_13670 7797 7564 gene locus_tag LOCUS_13680 7797 7564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13680 8961 7804 gene locus_tag LOCUS_13690 8961 7804 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259142.1 protein_id gnl|my_center|LOCUS_13690 9705 10196 gene locus_tag LOCUS_13700 9705 10196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13700 >Feature sequence092 2032 11 gene locus_tag LOCUS_13710 2032 11 CDS product putative cobaltochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020921.1 protein_id gnl|my_center|LOCUS_13710 3122 2037 gene locus_tag LOCUS_13720 3122 2037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13720 3331 3549 gene locus_tag LOCUS_13730 3331 3549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13730 7672 4262 gene locus_tag LOCUS_13740 gene cobN 7672 4262 CDS product cobaltochelatase subunit CobN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020926.1 protein_id gnl|my_center|LOCUS_13740 8497 7730 gene locus_tag LOCUS_13750 8497 7730 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065716.1 protein_id gnl|my_center|LOCUS_13750 9564 8542 gene locus_tag LOCUS_13760 9564 8542 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_157860150.1 protein_id gnl|my_center|LOCUS_13760 <10416 9716 gene locus_tag LOCUS_13770 <10416 9716 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_157860356.1:iron ABC transporter substrate-binding protein >Feature sequence093 512 87 gene locus_tag LOCUS_13780 512 87 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583101.1 protein_id gnl|my_center|LOCUS_13780 1752 574 gene locus_tag LOCUS_13790 1752 574 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941722.1 protein_id gnl|my_center|LOCUS_13790 2009 3184 gene locus_tag LOCUS_13800 2009 3184 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931942.1 protein_id gnl|my_center|LOCUS_13800 3291 4358 gene locus_tag LOCUS_13810 gene ispG 3291 4358 CDS product flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942105.1 protein_id gnl|my_center|LOCUS_13810 4464 6191 gene locus_tag LOCUS_13820 4464 6191 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942106.1 protein_id gnl|my_center|LOCUS_13820 6175 8316 gene locus_tag LOCUS_13830 6175 8316 CDS product bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942876.1 protein_id gnl|my_center|LOCUS_13830 8722 8534 gene locus_tag LOCUS_13840 gene rpmB 8722 8534 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942874.1 protein_id gnl|my_center|LOCUS_13840 >Feature sequence094 1 378 gene locus_tag LOCUS_13850 1 378 CDS product cobalamin B12-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942223.1 protein_id gnl|my_center|LOCUS_13850 391 1386 gene locus_tag LOCUS_13860 gene meaB 391 1386 CDS product methylmalonyl Co-A mutase-associated GTPase MeaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942224.1 protein_id gnl|my_center|LOCUS_13860 1383 1649 gene locus_tag LOCUS_13870 1383 1649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13870 1716 2264 gene locus_tag LOCUS_13880 1716 2264 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112674.1 protein_id gnl|my_center|LOCUS_13880 2379 3521 gene locus_tag LOCUS_13890 gene acdA 2379 3521 CDS product acyl-CoA dehydrogenase AcdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000545532.1 protein_id gnl|my_center|LOCUS_13890 4912 3641 gene locus_tag LOCUS_13900 4912 3641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13900 5012 5347 gene locus_tag LOCUS_13910 5012 5347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13910 5382 5933 gene locus_tag LOCUS_13920 5382 5933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13920 5842 6372 gene locus_tag LOCUS_13930 5842 6372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13930 7687 6374 gene locus_tag LOCUS_13940 7687 6374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13940 8567 7908 gene locus_tag LOCUS_13950 gene radC 8567 7908 CDS product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546157.1 protein_id gnl|my_center|LOCUS_13950 9017 8622 gene locus_tag LOCUS_13960 9017 8622 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545438.1 protein_id gnl|my_center|LOCUS_13960 9287 9649 gene locus_tag LOCUS_13970 9287 9649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13970 >Feature sequence095 264 97 gene locus_tag LOCUS_13980 264 97 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13980 337 1050 gene locus_tag LOCUS_13990 337 1050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13990 1573 1364 gene locus_tag LOCUS_14000 1573 1364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14000 1466 2389 gene locus_tag LOCUS_14010 gene gmd 1466 2389 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868774.1 protein_id gnl|my_center|LOCUS_14010 2855 2661 gene locus_tag LOCUS_14020 2855 2661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14020 3191 3430 gene locus_tag LOCUS_14030 3191 3430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_14030 3504 3752 gene locus_tag LOCUS_14040 3504 3752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14040 4022 4261 gene locus_tag LOCUS_14050 4022 4261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14050 4258 4614 gene locus_tag LOCUS_14060 4258 4614 CDS product DUF5615 family PIN-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_200901620.1 protein_id gnl|my_center|LOCUS_14060 4850 5197 gene locus_tag LOCUS_14070 4850 5197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14070 5194 5607 gene locus_tag LOCUS_14080 5194 5607 CDS product HEPN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392906.1 protein_id gnl|my_center|LOCUS_14080 6098 6367 gene locus_tag LOCUS_14090 6098 6367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14090 6369 6791 gene locus_tag LOCUS_14100 6369 6791 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393694.1 protein_id gnl|my_center|LOCUS_14100 7095 7397 gene locus_tag LOCUS_14110 7095 7397 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259346.1 protein_id gnl|my_center|LOCUS_14110 7390 7563 gene locus_tag LOCUS_14120 7390 7563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14120 7520 7768 gene locus_tag LOCUS_14130 7520 7768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14130 7847 8857 gene locus_tag LOCUS_14140 7847 8857 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941622.1 protein_id gnl|my_center|LOCUS_14140 8905 9180 gene locus_tag LOCUS_14150 8905 9180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14150 9173 9409 gene locus_tag LOCUS_14160 9173 9409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14160 9563 9778 gene locus_tag LOCUS_14170 9563 9778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14170 >Feature sequence096 1236 1024 gene locus_tag LOCUS_14180 1236 1024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_14180 1443 1240 gene locus_tag LOCUS_14190 1443 1240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_14190 2392 1652 gene locus_tag LOCUS_14200 2392 1652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14200 3198 2371 gene locus_tag LOCUS_14210 3198 2371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14210 4834 3098 gene locus_tag LOCUS_14220 4834 3098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14220 6728 4875 gene locus_tag LOCUS_14230 gene nuoF 6728 4875 CDS product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868905.1 protein_id gnl|my_center|LOCUS_14230 7241 6771 gene locus_tag LOCUS_14240 7241 6771 CDS product NAD(P)H-dependent oxidoreductase subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393221.1 protein_id gnl|my_center|LOCUS_14240 7778 7599 gene locus_tag LOCUS_14250 7778 7599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_14250 8717 7848 gene locus_tag LOCUS_14260 8717 7848 CDS product CoB--CoM heterodisulfide reductase iron-sulfur subunit B family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391978.1 protein_id gnl|my_center|LOCUS_14260 <9974 8770 gene locus_tag LOCUS_14270 <9974 8770 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011020733.1:(Fe-S)-binding protein >Feature sequence097 949 182 gene locus_tag LOCUS_14280 949 182 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067768.1 protein_id gnl|my_center|LOCUS_14280 2425 1289 gene locus_tag LOCUS_14290 2425 1289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14290 3687 2581 gene locus_tag LOCUS_14300 3687 2581 CDS product alcohol dehydrogenase catalytic domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762093.1 protein_id gnl|my_center|LOCUS_14300 4556 3804 gene locus_tag LOCUS_14310 gene fabG 4556 3804 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232035.1 protein_id gnl|my_center|LOCUS_14310 4885 5667 gene locus_tag LOCUS_14320 4885 5667 CDS product septal ring lytic transglycosylase RlpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937704.1 protein_id gnl|my_center|LOCUS_14320 5951 5673 gene locus_tag LOCUS_14330 5951 5673 CDS product integration host factor subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942168.1 protein_id gnl|my_center|LOCUS_14330 6674 6177 gene locus_tag LOCUS_14340 gene coaD 6674 6177 CDS product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938824.1 protein_id gnl|my_center|LOCUS_14340 7239 6664 gene locus_tag LOCUS_14350 gene rsmD 7239 6664 CDS product 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003431108.1 protein_id gnl|my_center|LOCUS_14350 8058 7246 gene locus_tag LOCUS_14360 gene pssA 8058 7246 CDS product CDP-diacylglycerol--serine O-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942552.1 protein_id gnl|my_center|LOCUS_14360 8804 8055 gene locus_tag LOCUS_14370 8804 8055 CDS product phosphatidylserine decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942553.1 protein_id gnl|my_center|LOCUS_14370 9591 8875 gene locus_tag LOCUS_14380 gene tsaB 9591 8875 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257859.1 protein_id gnl|my_center|LOCUS_14380 >Feature sequence098 <1 658 gene locus_tag LOCUS_14390 <1 658 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012256508.1:MraY family glycosyltransferase 1228 2805 gene locus_tag LOCUS_14400 1228 2805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14400 2795 3625 gene locus_tag LOCUS_14410 2795 3625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14410 5013 3622 gene locus_tag LOCUS_14420 5013 3622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14420 5330 5010 gene locus_tag LOCUS_14430 5330 5010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14430 5530 6714 gene locus_tag LOCUS_14440 5530 6714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14440 7340 7534 gene locus_tag LOCUS_14450 7340 7534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14450 7870 7589 gene locus_tag LOCUS_14460 7870 7589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14460 8735 7827 gene locus_tag LOCUS_14470 8735 7827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14470 9295 8762 gene locus_tag LOCUS_14480 9295 8762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_14480 <9933 9305 gene locus_tag LOCUS_14490 <9933 9305 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012870021.1:iron-containing alcohol dehydrogenase note possible pseudo, internal stop codon >Feature sequence099 93 1412 gene locus_tag LOCUS_14500 93 1412 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065074.1 protein_id gnl|my_center|LOCUS_14500 4446 1426 gene locus_tag LOCUS_14510 4446 1426 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123110.1 protein_id gnl|my_center|LOCUS_14510 5839 4553 gene locus_tag LOCUS_14520 5839 4553 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071226.1 protein_id gnl|my_center|LOCUS_14520 7289 5880 gene locus_tag LOCUS_14530 7289 5880 CDS product efflux transporter outer membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615477.1 protein_id gnl|my_center|LOCUS_14530 7867 9534 gene locus_tag LOCUS_14540 gene ade 7867 9534 CDS product adenine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964205.1 protein_id gnl|my_center|LOCUS_14540 >Feature sequence100 236 1237 gene locus_tag LOCUS_14550 236 1237 CDS product lipoate--protein ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979957.1 protein_id gnl|my_center|LOCUS_14550 1335 2390 gene locus_tag LOCUS_14560 1335 2390 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881275.1 protein_id gnl|my_center|LOCUS_14560 2561 2637 gene locus_tag LOCUS_t00120 2561 2637 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 2976 3053 gene locus_tag LOCUS_t00130 2976 3053 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 5102 3285 gene locus_tag LOCUS_14570 5102 3285 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928975.1 protein_id gnl|my_center|LOCUS_14570 6255 5128 gene locus_tag LOCUS_14580 6255 5128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14580 6547 6236 gene locus_tag LOCUS_14590 6547 6236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14590 8114 6909 gene locus_tag LOCUS_14600 8114 6909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14600 8858 8370 gene locus_tag LOCUS_14610 8858 8370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14610 9184 8921 gene locus_tag LOCUS_14620 9184 8921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14620 >Feature sequence101 997 635 gene locus_tag LOCUS_14630 997 635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14630 1720 1037 gene locus_tag LOCUS_14640 gene cdaS 1720 1037 CDS product sporulation-specific diadenylate cyclase CdaS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001158737.1 protein_id gnl|my_center|LOCUS_14640 2130 1738 gene locus_tag LOCUS_14650 2130 1738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14650 2399 2238 gene locus_tag LOCUS_14660 2399 2238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14660 3993 2779 gene locus_tag LOCUS_14670 3993 2779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14670 4574 4173 gene locus_tag LOCUS_14680 4574 4173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14680 5192 4629 gene locus_tag LOCUS_14690 5192 4629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14690 5433 5137 gene locus_tag LOCUS_14700 5433 5137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14700 6470 5841 gene locus_tag LOCUS_14710 6470 5841 CDS product GAF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937870.1 protein_id gnl|my_center|LOCUS_14710 6830 6618 gene locus_tag LOCUS_14720 6830 6618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14720 7287 7090 gene locus_tag LOCUS_14730 7287 7090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14730 7523 8905 gene locus_tag LOCUS_14740 7523 8905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14740 <9876 9041 gene locus_tag LOCUS_14750 <9876 9041 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012546124.1:GTP 3',8-cyclase MoaA >Feature sequence102 137 3337 gene locus_tag LOCUS_14760 gene carB 137 3337 CDS product carbamoyl-phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810321.1 protein_id gnl|my_center|LOCUS_14760 3961 3395 gene locus_tag LOCUS_14770 3961 3395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14770 5275 4064 gene locus_tag LOCUS_14780 5275 4064 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090552.1 protein_id gnl|my_center|LOCUS_14780 7263 5458 gene locus_tag LOCUS_14790 7263 5458 CDS product AMP-dependent synthetase/ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090652.1 protein_id gnl|my_center|LOCUS_14790 8056 7271 gene locus_tag LOCUS_14800 8056 7271 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090653.1 protein_id gnl|my_center|LOCUS_14800 8831 8031 gene locus_tag LOCUS_14810 8831 8031 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256973.1 protein_id gnl|my_center|LOCUS_14810 <9851 8976 gene locus_tag LOCUS_14820 <9851 8976 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011090656.1:branched-chain amino acid ABC transporter permease >Feature sequence103 13 996 gene locus_tag LOCUS_14830 13 996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938657.1 protein_id gnl|my_center|LOCUS_14830 1596 1027 gene locus_tag LOCUS_14840 1596 1027 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393180.1 protein_id gnl|my_center|LOCUS_14840 1715 1873 gene locus_tag LOCUS_14850 1715 1873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14850 1924 2196 gene locus_tag LOCUS_14860 1924 2196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14860 2398 2622 gene locus_tag LOCUS_14870 2398 2622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14870 2972 3331 gene locus_tag LOCUS_14880 2972 3331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14880 3342 4856 gene locus_tag LOCUS_14890 3342 4856 CDS product thiamine pyrophosphate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972394.1 protein_id gnl|my_center|LOCUS_14890 4919 6136 gene locus_tag LOCUS_14900 4919 6136 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583067.1 protein_id gnl|my_center|LOCUS_14900 7060 6173 gene locus_tag LOCUS_14910 7060 6173 CDS product nitronate monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003702985.1 protein_id gnl|my_center|LOCUS_14910 7635 7171 gene locus_tag LOCUS_14920 7635 7171 CDS product MarR family winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391266.1 protein_id gnl|my_center|LOCUS_14920 7969 8472 gene locus_tag LOCUS_14930 7969 8472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14930 8531 9421 gene locus_tag LOCUS_14940 gene dapA 8531 9421 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392582.1 protein_id gnl|my_center|LOCUS_14940 >Feature sequence104 1016 657 gene locus_tag LOCUS_14950 1016 657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14950 1276 1013 gene locus_tag LOCUS_14960 1276 1013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14960 2049 1495 gene locus_tag LOCUS_14970 2049 1495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14970 2243 2022 gene locus_tag LOCUS_14980 2243 2022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14980 2625 2329 gene locus_tag LOCUS_14990 2625 2329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14990 3174 2839 gene locus_tag LOCUS_15000 3174 2839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15000 4301 3288 gene locus_tag LOCUS_15010 gene cas1 4301 3288 CDS product CRISPR-associated endonuclease Cas1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879371.1 protein_id gnl|my_center|LOCUS_15010 4948 4538 gene locus_tag LOCUS_15020 4948 4538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15020 5180 4917 gene locus_tag LOCUS_15030 5180 4917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15030 5539 6405 gene locus_tag LOCUS_15040 5539 6405 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065531.1 protein_id gnl|my_center|LOCUS_15040 9494 6300 gene locus_tag LOCUS_15050 9494 6300 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118092.1 protein_id gnl|my_center|LOCUS_15050 >Feature sequence105 1255 1049 gene locus_tag LOCUS_15060 1255 1049 CDS product heavy-metal-associated domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228663.1 protein_id gnl|my_center|LOCUS_15060 1820 1314 gene locus_tag LOCUS_15070 1820 1314 CDS product ferritin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583144.1 protein_id gnl|my_center|LOCUS_15070 3108 1921 gene locus_tag LOCUS_15080 3108 1921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15080 3337 3128 gene locus_tag LOCUS_15090 3337 3128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15090 3572 3414 gene locus_tag LOCUS_15100 3572 3414 CDS product rubredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966063.1 protein_id gnl|my_center|LOCUS_15100 4151 3645 gene locus_tag LOCUS_15110 4151 3645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_15110 4400 4215 gene locus_tag LOCUS_15120 4400 4215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15120 4936 4496 gene locus_tag LOCUS_15130 4936 4496 CDS product flavodoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021802.1 protein_id gnl|my_center|LOCUS_15130 5502 4984 gene locus_tag LOCUS_15140 5502 4984 CDS product ferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875797.1 protein_id gnl|my_center|LOCUS_15140 5882 5508 gene locus_tag LOCUS_15150 5882 5508 CDS product desulfoferrodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940441.1 protein_id gnl|my_center|LOCUS_15150 6463 5966 gene locus_tag LOCUS_15160 6463 5966 CDS product rubrerythrin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545398.1 protein_id gnl|my_center|LOCUS_15160 7115 6540 gene locus_tag LOCUS_15170 7115 6540 CDS product rubrerythrin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943440.1 protein_id gnl|my_center|LOCUS_15170 7808 7197 gene locus_tag LOCUS_15180 7808 7197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15180 8042 7851 gene locus_tag LOCUS_15190 8042 7851 CDS product rubredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940352.1 protein_id gnl|my_center|LOCUS_15190 8285 8079 gene locus_tag LOCUS_15200 8285 8079 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937335.1 protein_id gnl|my_center|LOCUS_15200 8517 8317 gene locus_tag LOCUS_15210 8517 8317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15210 <9754 8969 gene locus_tag LOCUS_15220 <9754 8969 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002675346.1:sigma-54 dependent transcriptional regulator >Feature sequence106 1399 944 gene locus_tag LOCUS_15230 1399 944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15230 2193 1498 gene locus_tag LOCUS_15240 gene mreC 2193 1498 CDS product rod shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942723.1 protein_id gnl|my_center|LOCUS_15240 3472 2438 gene locus_tag LOCUS_15250 3472 2438 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938090.1 protein_id gnl|my_center|LOCUS_15250 3847 4161 gene locus_tag LOCUS_15260 gene rnpA 3847 4161 CDS product ribonuclease P protein component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944077.1 protein_id gnl|my_center|LOCUS_15260 4492 6159 gene locus_tag LOCUS_15270 gene yidC 4492 6159 CDS product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944075.1 protein_id gnl|my_center|LOCUS_15270 6176 6826 gene locus_tag LOCUS_15280 6176 6826 CDS product protein jag inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393997.1 protein_id gnl|my_center|LOCUS_15280 6923 8335 gene locus_tag LOCUS_15290 gene mnmE 6923 8335 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009898860.1 protein_id gnl|my_center|LOCUS_15290 9347 8379 gene locus_tag LOCUS_15300 9347 8379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15300 >Feature sequence107 909 2006 gene locus_tag LOCUS_15310 909 2006 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000892860.1 protein_id gnl|my_center|LOCUS_15310 1999 4794 gene locus_tag LOCUS_15320 1999 4794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15320 4816 5346 gene locus_tag LOCUS_15330 4816 5346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15330 6425 5499 gene locus_tag LOCUS_15340 6425 5499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15340 7259 6618 gene locus_tag LOCUS_15350 7259 6618 CDS product XTP/dITP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942438.1 protein_id gnl|my_center|LOCUS_15350 9349 7838 gene locus_tag LOCUS_15360 9349 7838 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965968.1 protein_id gnl|my_center|LOCUS_15360 >Feature sequence108 2123 2150 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2178 2324 gene locus_tag LOCUS_15370 2178 2324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15370 4481 2436 gene locus_tag LOCUS_15380 4481 2436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15380 >Feature sequence109 672 1892 gene locus_tag LOCUS_15390 gene ffh 672 1892 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941303.1 protein_id gnl|my_center|LOCUS_15390 1953 2204 gene locus_tag LOCUS_15400 gene rpsP 1953 2204 CDS product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357434.1 protein_id gnl|my_center|LOCUS_15400 2256 2486 gene locus_tag LOCUS_15410 2256 2486 CDS product KH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938139.1 protein_id gnl|my_center|LOCUS_15410 2489 3025 gene locus_tag LOCUS_15420 gene rimM 2489 3025 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813199.1 protein_id gnl|my_center|LOCUS_15420 3015 3740 gene locus_tag LOCUS_15430 gene trmD 3015 3740 CDS product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583884.1 protein_id gnl|my_center|LOCUS_15430 3799 4353 gene locus_tag LOCUS_15440 3799 4353 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813203.1 protein_id gnl|my_center|LOCUS_15440 4618 4962 gene locus_tag LOCUS_15450 gene rplS 4618 4962 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392486.1 protein_id gnl|my_center|LOCUS_15450 4988 5659 gene locus_tag LOCUS_15460 4988 5659 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941310.1 protein_id gnl|my_center|LOCUS_15460 5640 6008 gene locus_tag LOCUS_15470 5640 6008 CDS product YraN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941311.1 protein_id gnl|my_center|LOCUS_15470 6023 6961 gene locus_tag LOCUS_15480 gene rsmI 6023 6961 CDS product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546504.1 protein_id gnl|my_center|LOCUS_15480 6939 7211 gene locus_tag LOCUS_15490 6939 7211 CDS product HPr family phosphocarrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812598.1 protein_id gnl|my_center|LOCUS_15490 7208 8992 gene locus_tag LOCUS_15500 gene ptsP 7208 8992 CDS product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_092157593.1 protein_id gnl|my_center|LOCUS_15500 >Feature sequence110 <1 1642 gene locus_tag LOCUS_15510 <1 1642 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_235044941.1:GAF domain-containing sensor histidine kinase 1763 2416 gene locus_tag LOCUS_15520 1763 2416 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940928.1 protein_id gnl|my_center|LOCUS_15520 2737 4095 gene locus_tag LOCUS_15530 gene allB 2737 4095 CDS product allantoinase AllB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461638.1 protein_id gnl|my_center|LOCUS_15530 4142 5578 gene locus_tag LOCUS_15540 4142 5578 CDS product cytosine permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459893.1 protein_id gnl|my_center|LOCUS_15540 5748 6977 gene locus_tag LOCUS_15550 5748 6977 CDS product Zn-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732668.1 protein_id gnl|my_center|LOCUS_15550 7129 7863 gene locus_tag LOCUS_15560 7129 7863 CDS product aspartate/glutamate racemase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406417.1 protein_id gnl|my_center|LOCUS_15560 8185 9042 gene locus_tag LOCUS_15570 8185 9042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811766.1 protein_id gnl|my_center|LOCUS_15570 >Feature sequence111 1572 2585 gene locus_tag LOCUS_15580 1572 2585 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879345.1 protein_id gnl|my_center|LOCUS_15580 2605 3987 gene locus_tag LOCUS_15590 2605 3987 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066616.1 protein_id gnl|my_center|LOCUS_15590 3988 5142 gene locus_tag LOCUS_15600 3988 5142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15600 5856 6884 gene locus_tag LOCUS_15610 5856 6884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15610 7953 7042 gene locus_tag LOCUS_15620 7953 7042 CDS product formylglycine-generating enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121674.1 protein_id gnl|my_center|LOCUS_15620 9286 8294 gene locus_tag LOCUS_15630 9286 8294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15630 >Feature sequence112 707 270 gene locus_tag LOCUS_15640 707 270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15640 1264 647 gene locus_tag LOCUS_15650 1264 647 CDS product DUF488 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545843.1 protein_id gnl|my_center|LOCUS_15650 3122 1365 gene locus_tag LOCUS_15660 3122 1365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15660 5052 4540 gene locus_tag LOCUS_15670 5052 4540 CDS product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969542.1 protein_id gnl|my_center|LOCUS_15670 5242 5039 gene locus_tag LOCUS_15680 5242 5039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15680 5873 6055 gene locus_tag LOCUS_15690 5873 6055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15690 6077 6400 gene locus_tag LOCUS_15700 6077 6400 CDS product HigA family addiction module antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939018.1 protein_id gnl|my_center|LOCUS_15700 7282 6614 gene locus_tag LOCUS_15710 7282 6614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15710 8035 7349 gene locus_tag LOCUS_15720 8035 7349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15720 8324 8088 gene locus_tag LOCUS_15730 8324 8088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15730 8466 8278 gene locus_tag LOCUS_15740 8466 8278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15740 8817 8500 gene locus_tag LOCUS_15750 8817 8500 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938537.1 protein_id gnl|my_center|LOCUS_15750 >Feature sequence113 1108 854 gene locus_tag LOCUS_15760 1108 854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15760 1472 2332 gene locus_tag LOCUS_15770 gene rpsB 1472 2332 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942566.1 protein_id gnl|my_center|LOCUS_15770 2396 2995 gene locus_tag LOCUS_15780 gene tsf 2396 2995 CDS product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392547.1 protein_id gnl|my_center|LOCUS_15780 3354 4076 gene locus_tag LOCUS_15790 gene pyrH 3354 4076 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942564.1 protein_id gnl|my_center|LOCUS_15790 4395 4952 gene locus_tag LOCUS_15800 gene frr 4395 4952 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938169.1 protein_id gnl|my_center|LOCUS_15800 5086 5739 gene locus_tag LOCUS_15810 5086 5739 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942562.1 protein_id gnl|my_center|LOCUS_15810 5989 5810 gene locus_tag LOCUS_15820 5989 5810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15820 6050 6853 gene locus_tag LOCUS_15830 6050 6853 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942561.1 protein_id gnl|my_center|LOCUS_15830 6913 8076 gene locus_tag LOCUS_15840 6913 8076 CDS product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931819.1 protein_id gnl|my_center|LOCUS_15840 8028 8276 gene locus_tag LOCUS_15850 8028 8276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15850 >Feature sequence114 910 410 gene locus_tag LOCUS_15860 910 410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15860 1197 910 gene locus_tag LOCUS_15870 1197 910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15870 2262 1303 gene locus_tag LOCUS_15880 2262 1303 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546078.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15880 2795 2301 gene locus_tag LOCUS_15890 gene leuD 2795 2301 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868466.1 protein_id gnl|my_center|LOCUS_15890 4123 2858 gene locus_tag LOCUS_15900 gene leuC 4123 2858 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393737.1 protein_id gnl|my_center|LOCUS_15900 5726 4185 gene locus_tag LOCUS_15910 5726 4185 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940240.1 protein_id gnl|my_center|LOCUS_15910 7394 5790 gene locus_tag LOCUS_15920 gene cimA 7394 5790 CDS product citramalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546272.1 protein_id gnl|my_center|LOCUS_15920 8133 7810 gene locus_tag LOCUS_15930 8133 7810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15930 9123 8278 gene locus_tag LOCUS_15940 9123 8278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15940 >Feature sequence115 96 1637 gene locus_tag LOCUS_15950 96 1637 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948261.1 protein_id gnl|my_center|LOCUS_15950 1781 5065 gene locus_tag LOCUS_15960 1781 5065 CDS product HsdR family type I site-specific deoxyribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087773.1 protein_id gnl|my_center|LOCUS_15960 5065 5781 gene locus_tag LOCUS_15970 5065 5781 CDS product SprT family zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087772.1 protein_id gnl|my_center|LOCUS_15970 5892 6269 gene locus_tag LOCUS_15980 5892 6269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15980 6726 6256 gene locus_tag LOCUS_15990 6726 6256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15990 7239 7871 gene locus_tag LOCUS_16000 7239 7871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16000 >Feature sequence116 629 156 gene locus_tag LOCUS_16010 629 156 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172509.1 protein_id gnl|my_center|LOCUS_16010 1103 645 gene locus_tag LOCUS_16020 gene rnhA 1103 645 CDS product ribonuclease HI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942713.1 protein_id gnl|my_center|LOCUS_16020 1529 1666 gene locus_tag LOCUS_16030 1529 1666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16030 2508 1867 gene locus_tag LOCUS_16040 2508 1867 CDS product redox-sensing transcriptional repressor Rex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938215.1 protein_id gnl|my_center|LOCUS_16040 2867 5287 gene locus_tag LOCUS_16050 2867 5287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16050 5315 6952 gene locus_tag LOCUS_16060 gene gpmI 5315 6952 CDS product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001973414.1 protein_id gnl|my_center|LOCUS_16060 7968 7096 gene locus_tag LOCUS_16070 7968 7096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16070 8204 7968 gene locus_tag LOCUS_16080 8204 7968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16080 <8918 8250 gene locus_tag LOCUS_16090 <8918 8250 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011393263.1:lipoyl synthase >Feature sequence117 1728 55 gene locus_tag LOCUS_16100 1728 55 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814052.1 protein_id gnl|my_center|LOCUS_16100 2049 1816 gene locus_tag LOCUS_16110 2049 1816 CDS product ferredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814054.1 protein_id gnl|my_center|LOCUS_16110 3890 2211 gene locus_tag LOCUS_16120 3890 2211 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814052.1 protein_id gnl|my_center|LOCUS_16120 5753 4074 gene locus_tag LOCUS_16130 5753 4074 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814052.1 protein_id gnl|my_center|LOCUS_16130 7755 5854 gene locus_tag LOCUS_16140 7755 5854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16140 8887 7862 gene locus_tag LOCUS_16150 8887 7862 CDS product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942697.1 protein_id gnl|my_center|LOCUS_16150 >Feature sequence118 468 106 gene locus_tag LOCUS_16160 468 106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16160 1098 751 gene locus_tag LOCUS_16170 1098 751 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272792.1 protein_id gnl|my_center|LOCUS_16170 2110 3297 gene locus_tag LOCUS_16180 2110 3297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16180 3814 4680 gene locus_tag LOCUS_16190 3814 4680 CDS product flagellin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390485.1 protein_id gnl|my_center|LOCUS_16190 4761 5201 gene locus_tag LOCUS_16200 4761 5201 CDS product flagellar biosynthesis repressor FlbT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390484.1 protein_id gnl|my_center|LOCUS_16200 5140 5520 gene locus_tag LOCUS_16210 gene flaF 5140 5520 CDS product flagellar biosynthesis regulator FlaF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626463.1 protein_id gnl|my_center|LOCUS_16210 8402 5628 gene locus_tag LOCUS_16220 8402 5628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16220 >Feature sequence119 1291 434 gene locus_tag LOCUS_16230 1291 434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16230 1502 1314 gene locus_tag LOCUS_16240 1502 1314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16240 1887 1456 gene locus_tag LOCUS_16250 1887 1456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16250 3243 1930 gene locus_tag LOCUS_16260 3243 1930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16260 6036 3649 gene locus_tag LOCUS_16270 6036 3649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16270 6501 6145 gene locus_tag LOCUS_16280 6501 6145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16280 7543 6512 gene locus_tag LOCUS_16290 7543 6512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16290 8411 7575 gene locus_tag LOCUS_16300 8411 7575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16300 >Feature sequence120 83 2083 gene locus_tag LOCUS_16310 83 2083 CDS product aldehyde ferredoxin oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146547.1 protein_id gnl|my_center|LOCUS_16310 2504 2623 gene locus_tag LOCUS_16320 2504 2623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16320 2785 2609 gene locus_tag LOCUS_16330 2785 2609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16330 2867 3886 gene locus_tag LOCUS_16340 2867 3886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16340 3993 7133 gene locus_tag LOCUS_16350 3993 7133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_except (pos:4221..4223,aa:Sec) note codon on position 77 is selenocysteine opal codon. protein_id gnl|my_center|LOCUS_16350 7343 8104 gene locus_tag LOCUS_16360 7343 8104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_16360 >Feature sequence121 906 427 gene locus_tag LOCUS_16370 906 427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16370 1682 1215 gene locus_tag LOCUS_16380 gene greA 1682 1215 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383382.1 protein_id gnl|my_center|LOCUS_16380 4195 1811 gene locus_tag LOCUS_16390 4195 1811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16390 4490 4239 gene locus_tag LOCUS_16400 4490 4239 CDS product FeoA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939842.1 protein_id gnl|my_center|LOCUS_16400 5394 4594 gene locus_tag LOCUS_16410 5394 4594 CDS product inositol monophosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001158696.1 protein_id gnl|my_center|LOCUS_16410 6565 5423 gene locus_tag LOCUS_16420 6565 5423 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064757.1 protein_id gnl|my_center|LOCUS_16420 7599 6628 gene locus_tag LOCUS_16430 7599 6628 CDS product electron transfer flavoprotein subunit alpha/FixB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877798.1 protein_id gnl|my_center|LOCUS_16430 8391 7600 gene locus_tag LOCUS_16440 8391 7600 CDS product electron transfer flavoprotein subunit beta/FixA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877797.1 protein_id gnl|my_center|LOCUS_16440 >Feature sequence122 2 76 gene locus_tag LOCUS_t00140 2 76 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 92 1045 gene locus_tag LOCUS_16450 92 1045 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941322.1 protein_id gnl|my_center|LOCUS_16450 1119 1790 gene locus_tag LOCUS_16460 1119 1790 CDS product 50S ribosomal protein L25/general stress protein Ctc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391626.1 protein_id gnl|my_center|LOCUS_16460 1830 2414 gene locus_tag LOCUS_16470 gene pth 1830 2414 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048384.1 protein_id gnl|my_center|LOCUS_16470 2414 4480 gene locus_tag LOCUS_16480 2414 4480 CDS product sodium-translocating pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392862.1 protein_id gnl|my_center|LOCUS_16480 4620 5099 gene locus_tag LOCUS_16490 4620 5099 CDS product CarD family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938863.1 protein_id gnl|my_center|LOCUS_16490 5261 6250 gene locus_tag LOCUS_16500 5261 6250 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949041.1 protein_id gnl|my_center|LOCUS_16500 6913 8160 gene locus_tag LOCUS_16510 gene rho 6913 8160 CDS product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943729.1 protein_id gnl|my_center|LOCUS_16510 8208 8432 gene locus_tag LOCUS_16520 gene rpmE 8208 8432 CDS product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940172.1 protein_id gnl|my_center|LOCUS_16520 >Feature sequence123 439 1533 gene locus_tag LOCUS_16530 439 1533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16530 3228 1582 gene locus_tag LOCUS_16540 3228 1582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16540 6553 3428 gene locus_tag LOCUS_16550 6553 3428 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943409.1 protein_id gnl|my_center|LOCUS_16550 7965 6829 gene locus_tag LOCUS_16560 7965 6829 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943408.1 protein_id gnl|my_center|LOCUS_16560 >Feature sequence124 516 1343 gene locus_tag LOCUS_16570 516 1343 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940782.1 protein_id gnl|my_center|LOCUS_16570 1345 2190 gene locus_tag LOCUS_16580 1345 2190 CDS product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940783.1 protein_id gnl|my_center|LOCUS_16580 2550 2753 gene locus_tag LOCUS_16590 2550 2753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16590 3092 3565 gene locus_tag LOCUS_16600 3092 3565 CDS product DUF3842 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545623.1 protein_id gnl|my_center|LOCUS_16600 3558 3746 gene locus_tag LOCUS_16610 3558 3746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16610 4145 3786 gene locus_tag LOCUS_16620 4145 3786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816601.1 protein_id gnl|my_center|LOCUS_16620 5029 4142 gene locus_tag LOCUS_16630 5029 4142 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001099029.1 protein_id gnl|my_center|LOCUS_16630 6759 5017 gene locus_tag LOCUS_16640 gene ispH 6759 5017 CDS product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011417689.1 protein_id gnl|my_center|LOCUS_16640 7733 6756 gene locus_tag LOCUS_16650 gene dusB 7733 6756 CDS product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941670.1 protein_id gnl|my_center|LOCUS_16650 <8457 7819 gene locus_tag LOCUS_16660 <8457 7819 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004081677.1:[Fe-Fe] hydrogenase large subunit C-terminal domain-containing protein >Feature sequence125 <1 1146 gene locus_tag LOCUS_16670 <1 1146 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010879269.1:(Fe-S)-binding protein 1180 1395 gene locus_tag LOCUS_16680 1180 1395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_16680 1411 4248 gene locus_tag LOCUS_16690 1411 4248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_16690 4763 5401 gene locus_tag LOCUS_16700 4763 5401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_16700 5455 5907 gene locus_tag LOCUS_16710 5455 5907 CDS product NAD(P)H-dependent oxidoreductase subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869222.1 protein_id gnl|my_center|LOCUS_16710 5917 7833 gene locus_tag LOCUS_16720 gene nuoF 5917 7833 CDS product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393387.1 protein_id gnl|my_center|LOCUS_16720 7826 8230 gene locus_tag LOCUS_16730 7826 8230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16730 >Feature sequence126 1908 505 gene locus_tag LOCUS_16740 1908 505 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938869.1 protein_id gnl|my_center|LOCUS_16740 2274 1912 gene locus_tag LOCUS_16750 gene rsfS 2274 1912 CDS product ribosome silencing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546466.1 protein_id gnl|my_center|LOCUS_16750 2920 2261 gene locus_tag LOCUS_16760 gene nadD 2920 2261 CDS product nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161458274.1 protein_id gnl|my_center|LOCUS_16760 4530 3472 gene locus_tag LOCUS_16770 4530 3472 CDS product glutamate-5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943829.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16770 5684 4512 gene locus_tag LOCUS_16780 gene proB 5684 4512 CDS product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943830.1 protein_id gnl|my_center|LOCUS_16780 6673 5654 gene locus_tag LOCUS_16790 gene obgE 6673 5654 CDS product GTPase ObgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943831.1 protein_id gnl|my_center|LOCUS_16790 6964 6707 gene locus_tag LOCUS_16800 gene rpmA 6964 6707 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938227.1 protein_id gnl|my_center|LOCUS_16800 7317 7000 gene locus_tag LOCUS_16810 gene rplU 7317 7000 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943851.1 protein_id gnl|my_center|LOCUS_16810 <8439 7424 gene locus_tag LOCUS_16820 <8439 7424 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012545659.1:ATP-binding protein >Feature sequence127 1480 1184 gene locus_tag LOCUS_16830 1480 1184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16830 1670 3073 gene locus_tag LOCUS_16840 1670 3073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16840 3070 3852 gene locus_tag LOCUS_16850 3070 3852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16850 3967 4749 gene locus_tag LOCUS_16860 3967 4749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16860 5235 5621 gene locus_tag LOCUS_16870 5235 5621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16870 5697 6287 gene locus_tag LOCUS_16880 5697 6287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16880 6406 6723 gene locus_tag LOCUS_16890 6406 6723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16890 7083 6862 gene locus_tag LOCUS_16900 7083 6862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16900 7324 7959 gene locus_tag LOCUS_16910 7324 7959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16910 >Feature sequence128 2499 106 gene locus_tag LOCUS_16920 2499 106 CDS product xanthine dehydrogenase family protein molybdopterin-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975050.1 protein_id gnl|my_center|LOCUS_16920 3041 2559 gene locus_tag LOCUS_16930 3041 2559 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062284418.1 protein_id gnl|my_center|LOCUS_16930 3926 3060 gene locus_tag LOCUS_16940 3926 3060 CDS product xanthine dehydrogenase family protein subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969635.1 protein_id gnl|my_center|LOCUS_16940 5228 4038 gene locus_tag LOCUS_16950 5228 4038 CDS product CaiB/BaiF CoA-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259183.1 protein_id gnl|my_center|LOCUS_16950 6742 5441 gene locus_tag LOCUS_16960 6742 5441 CDS product phenylacetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942694.1 protein_id gnl|my_center|LOCUS_16960 <8353 7066 gene locus_tag LOCUS_16970 <8353 7066 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942699.1:TRAP transporter large permease >Feature sequence129 2163 454 gene locus_tag LOCUS_16980 2163 454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16980 3169 2669 gene locus_tag LOCUS_16990 3169 2669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16990 3768 3460 gene locus_tag LOCUS_17000 3768 3460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17000 4473 4036 gene locus_tag LOCUS_17010 4473 4036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17010 5579 4470 gene locus_tag LOCUS_17020 5579 4470 CDS product flagellar basal body P-ring protein FlgI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943673.1 protein_id gnl|my_center|LOCUS_17020 6552 5809 gene locus_tag LOCUS_17030 6552 5809 CDS product flagellar basal body L-ring protein FlgH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943674.1 protein_id gnl|my_center|LOCUS_17030 7450 6572 gene locus_tag LOCUS_17040 7450 6572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17040 <8310 7571 gene locus_tag LOCUS_17050 <8310 7571 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943676.1:flagellar basal-body rod protein FlgG >Feature sequence130 1807 1370 gene locus_tag LOCUS_17060 1807 1370 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392649.1 protein_id gnl|my_center|LOCUS_17060 3029 1911 gene locus_tag LOCUS_17070 3029 1911 CDS product cysteine desulfurase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004552205.1 protein_id gnl|my_center|LOCUS_17070 3459 3202 gene locus_tag LOCUS_17080 3459 3202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17080 3704 3531 gene locus_tag LOCUS_17090 3704 3531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17090 5064 4114 gene locus_tag LOCUS_17100 gene selD 5064 4114 CDS product selenide, water dikinase SelD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_196768338.1 protein_id gnl|my_center|LOCUS_17100 5497 5234 gene locus_tag LOCUS_17110 5497 5234 CDS product sulfurtransferase TusA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392950.1 protein_id gnl|my_center|LOCUS_17110 6418 5522 gene locus_tag LOCUS_17120 6418 5522 CDS product NAD(P)H-hydrate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392951.1 protein_id gnl|my_center|LOCUS_17120 6956 6420 gene locus_tag LOCUS_17130 6956 6420 CDS product DUF3343 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545577.1 protein_id gnl|my_center|LOCUS_17130 8033 6960 gene locus_tag LOCUS_17140 gene yedE 8033 6960 CDS product YedE family putative selenium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392953.1 protein_id gnl|my_center|LOCUS_17140 >Feature sequence131 302 595 gene locus_tag LOCUS_17150 302 595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17150 592 972 gene locus_tag LOCUS_17160 592 972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17160 1049 2239 gene locus_tag LOCUS_17170 gene coaBC 1049 2239 CDS product bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941785.1 protein_id gnl|my_center|LOCUS_17170 2262 3008 gene locus_tag LOCUS_17180 2262 3008 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941787.1 protein_id gnl|my_center|LOCUS_17180 3001 4314 gene locus_tag LOCUS_17190 3001 4314 CDS product nodulation protein NfeD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546843.1 protein_id gnl|my_center|LOCUS_17190 4335 5072 gene locus_tag LOCUS_17200 4335 5072 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932478.1 protein_id gnl|my_center|LOCUS_17200 5221 5775 gene locus_tag LOCUS_17210 5221 5775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17210 6230 6925 gene locus_tag LOCUS_17220 gene ispD 6230 6925 CDS product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943979.1 protein_id gnl|my_center|LOCUS_17220 7308 8195 gene locus_tag LOCUS_17230 gene hemC 7308 8195 CDS product hydroxymethylbilane synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943896.1 protein_id gnl|my_center|LOCUS_17230 >Feature sequence132 788 399 gene locus_tag LOCUS_17240 788 399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_17240 921 1349 gene locus_tag LOCUS_17250 gene tnpA 921 1349 CDS product IS200/IS605 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_039658585.1 protein_id gnl|my_center|LOCUS_17250 1606 1346 gene locus_tag LOCUS_17260 1606 1346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17260 2237 3202 gene locus_tag LOCUS_17270 2237 3202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17270 3209 3436 gene locus_tag LOCUS_17280 3209 3436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17280 3441 3815 gene locus_tag LOCUS_17290 3441 3815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17290 3803 4072 gene locus_tag LOCUS_17300 3803 4072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17300 4223 6025 gene locus_tag LOCUS_17310 4223 6025 CDS product AMP-dependent synthetase/ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090652.1 protein_id gnl|my_center|LOCUS_17310 6068 7048 gene locus_tag LOCUS_17320 6068 7048 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812443.1 protein_id gnl|my_center|LOCUS_17320 7066 7947 gene locus_tag LOCUS_17330 7066 7947 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583298.1 protein_id gnl|my_center|LOCUS_17330 >Feature sequence133 768 28 gene locus_tag LOCUS_17340 768 28 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17340 3922 731 gene locus_tag LOCUS_17350 3922 731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17350 5443 4226 gene locus_tag LOCUS_17360 5443 4226 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108087.1 protein_id gnl|my_center|LOCUS_17360 6255 5989 gene locus_tag LOCUS_17370 6255 5989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17370 6619 6191 gene locus_tag LOCUS_17380 6619 6191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17380 6932 8149 gene locus_tag LOCUS_17390 6932 8149 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259419.1 protein_id gnl|my_center|LOCUS_17390 >Feature sequence134 1448 750 gene locus_tag LOCUS_17400 1448 750 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085971.1 protein_id gnl|my_center|LOCUS_17400 2185 1442 gene locus_tag LOCUS_17410 2185 1442 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085970.1 protein_id gnl|my_center|LOCUS_17410 3148 2186 gene locus_tag LOCUS_17420 3148 2186 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809842.1 protein_id gnl|my_center|LOCUS_17420 4241 3345 gene locus_tag LOCUS_17430 4241 3345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17430 5647 4481 gene locus_tag LOCUS_17440 5647 4481 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088976.1 protein_id gnl|my_center|LOCUS_17440 6361 6693 gene locus_tag LOCUS_17450 6361 6693 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403747.1 protein_id gnl|my_center|LOCUS_17450 6697 7458 gene locus_tag LOCUS_17460 6697 7458 CDS product tyrosine protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099684015.1 protein_id gnl|my_center|LOCUS_17460 7778 7810 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence135 690 1640 gene locus_tag LOCUS_17470 690 1640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17470 1644 4346 gene locus_tag LOCUS_17480 1644 4346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17480 4346 5275 gene locus_tag LOCUS_17490 4346 5275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17490 5287 6210 gene locus_tag LOCUS_17500 gene cmr4 5287 6210 CDS product type III-B CRISPR module RAMP protein Cmr4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880200.1 protein_id gnl|my_center|LOCUS_17500 6207 6617 gene locus_tag LOCUS_17510 6207 6617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17510 6631 7848 gene locus_tag LOCUS_17520 6631 7848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17520 7852 8013 gene locus_tag LOCUS_17530 7852 8013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17530 >Feature sequence136 <1 729 gene locus_tag LOCUS_17540 <1 729 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010964929.1:radical SAM protein 716 925 gene locus_tag LOCUS_17550 716 925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17550 959 1543 gene locus_tag LOCUS_17560 959 1543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17560 2064 3296 gene locus_tag LOCUS_17570 2064 3296 CDS product iron-sulfur cluster carrier protein MrpORP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_223294665.1 protein_id gnl|my_center|LOCUS_17570 3350 3805 gene locus_tag LOCUS_17580 3350 3805 CDS product iron-sulfur cluster assembly scaffold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392929.1 protein_id gnl|my_center|LOCUS_17580 3893 4738 gene locus_tag LOCUS_17590 3893 4738 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392922.1 protein_id gnl|my_center|LOCUS_17590 5040 5357 gene locus_tag LOCUS_17600 gene trxA 5040 5357 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125291.1 protein_id gnl|my_center|LOCUS_17600 5535 6401 gene locus_tag LOCUS_17610 5535 6401 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392921.1 protein_id gnl|my_center|LOCUS_17610 6525 6683 gene locus_tag LOCUS_17620 6525 6683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17620 6753 7346 gene locus_tag LOCUS_17630 6753 7346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17630 7396 7725 gene locus_tag LOCUS_17640 7396 7725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17640 >Feature sequence137 1972 734 gene locus_tag LOCUS_17650 1972 734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17650 4635 1984 gene locus_tag LOCUS_17660 4635 1984 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002484637.1 protein_id gnl|my_center|LOCUS_17660 4938 4699 gene locus_tag LOCUS_17670 4938 4699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17670 5192 4935 gene locus_tag LOCUS_17680 5192 4935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17680 <7975 5189 gene locus_tag LOCUS_17690 <7975 5189 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011109348.1:Eco57I restriction-modification methylase domain-containing protein >Feature sequence138 <1 879 gene locus_tag LOCUS_17700 <1 879 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011791822.1:phosphate ABC transporter permease subunit PstC 923 1831 gene locus_tag LOCUS_17710 gene pstA 923 1831 CDS product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939749.1 protein_id gnl|my_center|LOCUS_17710 1836 2597 gene locus_tag LOCUS_17720 gene pstB 1836 2597 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938383.1 protein_id gnl|my_center|LOCUS_17720 2624 3319 gene locus_tag LOCUS_17730 gene phoU 2624 3319 CDS product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545517.1 protein_id gnl|my_center|LOCUS_17730 3914 3459 gene locus_tag LOCUS_17740 3914 3459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17740 4081 3893 gene locus_tag LOCUS_17750 4081 3893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17750 6200 4260 gene locus_tag LOCUS_17760 6200 4260 CDS product ASKHA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811724.1 protein_id gnl|my_center|LOCUS_17760 7128 6292 gene locus_tag LOCUS_17770 7128 6292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811766.1 protein_id gnl|my_center|LOCUS_17770 7916 7125 gene locus_tag LOCUS_17780 7916 7125 CDS product TIGR02757 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941192.1 protein_id gnl|my_center|LOCUS_17780 >Feature sequence139 1777 44 gene locus_tag LOCUS_17790 gene recJ 1777 44 CDS product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943252.1 protein_id gnl|my_center|LOCUS_17790 2522 1779 gene locus_tag LOCUS_17800 gene kdsB 2522 1779 CDS product 3-deoxy-manno-octulosonate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942541.1 protein_id gnl|my_center|LOCUS_17800 3230 2859 gene locus_tag LOCUS_17810 gene queD 3230 2859 CDS product 6-carboxytetrahydropterin synthase QueD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942365.1 protein_id gnl|my_center|LOCUS_17810 3520 3275 gene locus_tag LOCUS_17820 3520 3275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17820 3879 3715 gene locus_tag LOCUS_17830 3879 3715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17830 4745 3981 gene locus_tag LOCUS_17840 gene hisF 4745 3981 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964259.1 protein_id gnl|my_center|LOCUS_17840 5353 7374 gene locus_tag LOCUS_17850 5353 7374 CDS product aldehyde ferredoxin oxidoreductase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869551.1 protein_id gnl|my_center|LOCUS_17850 7390 7635 gene locus_tag LOCUS_17860 7390 7635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17860 >Feature sequence140 4048 731 gene locus_tag LOCUS_17870 4048 731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17870 5246 4101 gene locus_tag LOCUS_17880 5246 4101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17880 >Feature sequence141 242 760 gene locus_tag LOCUS_17890 242 760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17890 1563 811 gene locus_tag LOCUS_17900 1563 811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17900 2482 1916 gene locus_tag LOCUS_17910 2482 1916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17910 2504 2746 gene locus_tag LOCUS_17920 2504 2746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17920 2874 3518 gene locus_tag LOCUS_17930 2874 3518 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869499.1 protein_id gnl|my_center|LOCUS_17930 3835 4107 gene locus_tag LOCUS_17940 3835 4107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17940 4107 4523 gene locus_tag LOCUS_17950 4107 4523 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000281042.1 protein_id gnl|my_center|LOCUS_17950 5573 7561 gene locus_tag LOCUS_17960 5573 7561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17960 >Feature sequence142 1263 124 gene locus_tag LOCUS_17970 gene dnaJ 1263 124 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454751.1 protein_id gnl|my_center|LOCUS_17970 1618 1319 gene locus_tag LOCUS_17980 1618 1319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17980 1751 3280 gene locus_tag LOCUS_17990 1751 3280 CDS product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941157.1 protein_id gnl|my_center|LOCUS_17990 3277 5628 gene locus_tag LOCUS_18000 3277 5628 CDS product PBP1A family penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937936.1 protein_id gnl|my_center|LOCUS_18000 7004 5688 gene locus_tag LOCUS_18010 7004 5688 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812135.1 protein_id gnl|my_center|LOCUS_18010 >Feature sequence143 1028 39 gene locus_tag LOCUS_18020 1028 39 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792172.1 protein_id gnl|my_center|LOCUS_18020 1519 1106 gene locus_tag LOCUS_18030 1519 1106 CDS product secondary thiamine-phosphate synthase enzyme YjbQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064279.1 protein_id gnl|my_center|LOCUS_18030 2327 2902 gene locus_tag LOCUS_18040 gene elbB 2327 2902 CDS product isoprenoid biosynthesis glyoxalase ElbB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099212.1 protein_id gnl|my_center|LOCUS_18040 4360 2975 gene locus_tag LOCUS_18050 4360 2975 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_148202592.1 protein_id gnl|my_center|LOCUS_18050 4645 4932 gene locus_tag LOCUS_18060 4645 4932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18060 5008 5574 gene locus_tag LOCUS_18070 5008 5574 CDS product HDIG domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_196768286.1 protein_id gnl|my_center|LOCUS_18070 6834 5731 gene locus_tag LOCUS_18080 gene rodA 6834 5731 CDS product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942720.1 protein_id gnl|my_center|LOCUS_18080 <7764 6896 gene locus_tag LOCUS_18090 <7764 6896 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942721.1:penicillin-binding protein 2 >Feature sequence144 775 518 gene locus_tag LOCUS_18100 775 518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18100 1768 1076 gene locus_tag LOCUS_18110 1768 1076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18110 4022 1770 gene locus_tag LOCUS_18120 4022 1770 CDS product DNA translocase FtsK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943733.1 protein_id gnl|my_center|LOCUS_18120 6118 4469 gene locus_tag LOCUS_18130 6118 4469 CDS product ribonuclease J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943734.1 protein_id gnl|my_center|LOCUS_18130 6381 6800 gene locus_tag LOCUS_18140 6381 6800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18140 7063 6869 gene locus_tag LOCUS_18150 7063 6869 CDS product twin-arginine translocase TatA/TatE family subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938662.1 protein_id gnl|my_center|LOCUS_18150 7615 7223 gene locus_tag LOCUS_18160 7615 7223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18160 >Feature sequence145 <1 1192 gene locus_tag LOCUS_18170 <1 1192 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010938157.1:12,18-didecarboxysiroheme deacetylase 1260 2243 gene locus_tag LOCUS_18180 gene hemB 1260 2243 CDS product porphobilinogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546067.1 protein_id gnl|my_center|LOCUS_18180 2262 2657 gene locus_tag LOCUS_18190 2262 2657 CDS product GxxExxY protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963175.1 protein_id gnl|my_center|LOCUS_18190 2734 3777 gene locus_tag LOCUS_18200 gene ahbD 2734 3777 CDS product heme b synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938155.1 protein_id gnl|my_center|LOCUS_18200 3856 4302 gene locus_tag LOCUS_18210 gene ahbA 3856 4302 CDS product siroheme decarboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938154.1 protein_id gnl|my_center|LOCUS_18210 4598 4299 gene locus_tag LOCUS_18220 4598 4299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18220 4982 6124 gene locus_tag LOCUS_18230 4982 6124 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941744.1 protein_id gnl|my_center|LOCUS_18230 6409 7632 gene locus_tag LOCUS_18240 6409 7632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18240 >Feature sequence146 465 148 gene locus_tag LOCUS_18250 465 148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18250 611 429 gene locus_tag LOCUS_18260 611 429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18260 768 583 gene locus_tag LOCUS_18270 768 583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18270 1471 1277 gene locus_tag LOCUS_18280 1471 1277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18280 1644 1486 gene locus_tag LOCUS_18290 1644 1486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18290 2430 1849 gene locus_tag LOCUS_18300 2430 1849 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582951.1 protein_id gnl|my_center|LOCUS_18300 3406 2489 gene locus_tag LOCUS_18310 3406 2489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18310 4526 3432 gene locus_tag LOCUS_18320 4526 3432 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964112.1 protein_id gnl|my_center|LOCUS_18320 5279 4647 gene locus_tag LOCUS_18330 5279 4647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_18330 6011 5496 gene locus_tag LOCUS_18340 6011 5496 CDS product UpxY family transcription antiterminator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546650.1 protein_id gnl|my_center|LOCUS_18340 6586 6008 gene locus_tag LOCUS_18350 6586 6008 CDS product winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941288.1 protein_id gnl|my_center|LOCUS_18350 6773 6931 gene locus_tag LOCUS_18360 6773 6931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18360 6898 6902 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 7267 7569 gene locus_tag LOCUS_18370 7267 7569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18370 >Feature sequence147 113 805 gene locus_tag LOCUS_18380 113 805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18380 979 3027 gene locus_tag LOCUS_18390 gene ligA 979 3027 CDS product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941554.1 protein_id gnl|my_center|LOCUS_18390 3090 3371 gene locus_tag LOCUS_18400 3090 3371 CDS product acylphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763032.1 protein_id gnl|my_center|LOCUS_18400 3720 4655 gene locus_tag LOCUS_18410 3720 4655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18410 6340 4652 gene locus_tag LOCUS_18420 gene recN 6340 4652 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942706.1 protein_id gnl|my_center|LOCUS_18420 7108 6347 gene locus_tag LOCUS_18430 7108 6347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18430 7545 7132 gene locus_tag LOCUS_18440 7545 7132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18440 >Feature sequence148 1936 1517 gene locus_tag LOCUS_18450 1936 1517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18450 3242 2019 gene locus_tag LOCUS_18460 3242 2019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18460 3930 3310 gene locus_tag LOCUS_18470 3930 3310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18470 4606 3884 gene locus_tag LOCUS_18480 4606 3884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18480 7079 4809 gene locus_tag LOCUS_18490 gene topA 7079 4809 CDS product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_203473432.1 protein_id gnl|my_center|LOCUS_18490 >Feature sequence149 3092 1548 gene locus_tag LOCUS_18500 3092 1548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18500 3881 3105 gene locus_tag LOCUS_18510 3881 3105 CDS product A24 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942686.1 protein_id gnl|my_center|LOCUS_18510 4100 4705 gene locus_tag LOCUS_18520 4100 4705 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942241.1 protein_id gnl|my_center|LOCUS_18520 5531 4689 gene locus_tag LOCUS_18530 gene sppA 5531 4689 CDS product signal peptide peptidase SppA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545082.1 protein_id gnl|my_center|LOCUS_18530 <7418 5772 gene locus_tag LOCUS_18540 <7418 5772 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943240.1:30S ribosomal protein S1 >Feature sequence150 664 2268 gene locus_tag LOCUS_18550 664 2268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18550 2557 2285 gene locus_tag LOCUS_18560 2557 2285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18560 2716 2564 gene locus_tag LOCUS_18570 2716 2564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18570 2952 3167 gene locus_tag LOCUS_18580 2952 3167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18580 3331 3999 gene locus_tag LOCUS_18590 3331 3999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18590 4022 4213 gene locus_tag LOCUS_18600 4022 4213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18600 4580 6574 gene locus_tag LOCUS_18610 4580 6574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18610 >Feature sequence151 107 1198 gene locus_tag LOCUS_18620 107 1198 CDS product 2-hydroxyacyl-CoA dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986695.1 protein_id gnl|my_center|LOCUS_18620 1207 2520 gene locus_tag LOCUS_18630 1207 2520 CDS product 2-hydroxyacyl-CoA dehydratase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879450.1 protein_id gnl|my_center|LOCUS_18630 2525 3319 gene locus_tag LOCUS_18640 2525 3319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18640 3969 3370 gene locus_tag LOCUS_18650 3969 3370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18650 4774 4496 gene locus_tag LOCUS_18660 4774 4496 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942391.1 protein_id gnl|my_center|LOCUS_18660 5056 6147 gene locus_tag LOCUS_18670 gene hisC 5056 6147 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392052.1 protein_id gnl|my_center|LOCUS_18670 6248 6916 gene locus_tag LOCUS_18680 gene cmk 6248 6916 CDS product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000094752.1 protein_id gnl|my_center|LOCUS_18680 >Feature sequence152 <1 666 gene locus_tag LOCUS_18690 <1 666 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010940478.1:sigma-54 dependent transcriptional regulator 1916 1032 gene locus_tag LOCUS_18700 gene era 1916 1032 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193360270.1 protein_id gnl|my_center|LOCUS_18700 2947 1913 gene locus_tag LOCUS_18710 2947 1913 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942867.1 protein_id gnl|my_center|LOCUS_18710 3639 2920 gene locus_tag LOCUS_18720 gene rnc 3639 2920 CDS product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002670498.1 protein_id gnl|my_center|LOCUS_18720 3975 4523 gene locus_tag LOCUS_18730 gene pyrR 3975 4523 CDS product bifunctional pyr operon transcriptional regulator/uracil phosphoribosyltransferase PyrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546581.1 protein_id gnl|my_center|LOCUS_18730 4526 5539 gene locus_tag LOCUS_18740 4526 5539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18740 5976 5656 gene locus_tag LOCUS_18750 5976 5656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18750 6434 5961 gene locus_tag LOCUS_18760 6434 5961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18760 6700 6551 gene locus_tag LOCUS_18770 6700 6551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18770 7252 6713 gene locus_tag LOCUS_18780 7252 6713 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870595.1 protein_id gnl|my_center|LOCUS_18780 >Feature sequence153 12 87 gene locus_tag LOCUS_t00150 12 87 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 389 901 gene locus_tag LOCUS_18790 gene hisB 389 901 CDS product imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943719.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18790 917 1621 gene locus_tag LOCUS_18800 917 1621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18800 1638 2369 gene locus_tag LOCUS_18810 gene hisA 1638 2369 CDS product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino]imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943717.1 protein_id gnl|my_center|LOCUS_18810 2444 2887 gene locus_tag LOCUS_18820 2444 2887 CDS product GatB/YqeY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081070.1 protein_id gnl|my_center|LOCUS_18820 2916 5297 gene locus_tag LOCUS_18830 2916 5297 CDS product endonuclease MutS2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229541.1 protein_id gnl|my_center|LOCUS_18830 5353 7092 gene locus_tag LOCUS_18840 gene dnaG 5353 7092 CDS product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392160.1 protein_id gnl|my_center|LOCUS_18840 >Feature sequence154 564 199 gene locus_tag LOCUS_18850 564 199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18850 3376 557 gene locus_tag LOCUS_18860 3376 557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18860 3646 3410 gene locus_tag LOCUS_18870 3646 3410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18870 4202 3636 gene locus_tag LOCUS_18880 gene satP 4202 3636 CDS product acetate uptake transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000528527.1 protein_id gnl|my_center|LOCUS_18880 6378 4399 gene locus_tag LOCUS_18890 gene acs 6378 4399 CDS product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546141.1 protein_id gnl|my_center|LOCUS_18890 <7343 6653 gene locus_tag LOCUS_18900 <7343 6653 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010940040.1:CBS domain-containing protein >Feature sequence155 1521 2093 gene locus_tag LOCUS_18910 1521 2093 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144143.1 protein_id gnl|my_center|LOCUS_18910 2083 2292 gene locus_tag LOCUS_18920 2083 2292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18920 2276 3154 gene locus_tag LOCUS_18930 2276 3154 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966631.1 protein_id gnl|my_center|LOCUS_18930 3735 3328 gene locus_tag LOCUS_18940 3735 3328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18940 3781 4662 gene locus_tag LOCUS_18950 3781 4662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18950 7058 4677 gene locus_tag LOCUS_18960 7058 4677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18960 7278 7030 gene locus_tag LOCUS_18970 7278 7030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18970 >Feature sequence156 772 197 gene locus_tag LOCUS_18980 gene rsxA 772 197 CDS product electron transport complex subunit RsxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005169884.1 protein_id gnl|my_center|LOCUS_18980 1431 820 gene locus_tag LOCUS_18990 1431 820 CDS product electron transport complex subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940061.1 protein_id gnl|my_center|LOCUS_18990 2038 1454 gene locus_tag LOCUS_19000 2038 1454 CDS product FMN-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940060.1 protein_id gnl|my_center|LOCUS_19000 2999 2031 gene locus_tag LOCUS_19010 2999 2031 CDS product RnfABCDGE type electron transport complex subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940059.1 protein_id gnl|my_center|LOCUS_19010 4275 2992 gene locus_tag LOCUS_19020 gene rsxC 4275 2992 CDS product electron transport complex subunit RsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_198480691.1 protein_id gnl|my_center|LOCUS_19020 4731 4357 gene locus_tag LOCUS_19030 4731 4357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19030 5508 6143 gene locus_tag LOCUS_19040 5508 6143 CDS product cytidylate kinase-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583266.1 protein_id gnl|my_center|LOCUS_19040 >Feature sequence157 505 263 gene locus_tag LOCUS_19050 505 263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19050 1499 777 gene locus_tag LOCUS_19060 1499 777 CDS product pyruvate kinase alpha/beta domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877282.1 protein_id gnl|my_center|LOCUS_19060 2713 1697 gene locus_tag LOCUS_19070 2713 1697 CDS product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811098.1 protein_id gnl|my_center|LOCUS_19070 4189 2885 gene locus_tag LOCUS_19080 4189 2885 CDS product TRAP transporter large permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385254.1 protein_id gnl|my_center|LOCUS_19080 4671 4186 gene locus_tag LOCUS_19090 4671 4186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19090 5374 4697 gene locus_tag LOCUS_19100 5374 4697 CDS product N-acyl homoserine lactonase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545445.1 protein_id gnl|my_center|LOCUS_19100 6734 5949 gene locus_tag LOCUS_19110 6734 5949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19110 >Feature sequence158 <1 1722 gene locus_tag LOCUS_19120 <1 1722 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942486.1:SLBB domain-containing protein 2149 1877 gene locus_tag LOCUS_19130 2149 1877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19130 2112 2999 gene locus_tag LOCUS_19140 2112 2999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_19140 3009 3542 gene locus_tag LOCUS_19150 3009 3542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19150 3582 4655 gene locus_tag LOCUS_19160 gene rfbB 3582 4655 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943002.1 protein_id gnl|my_center|LOCUS_19160 4678 5553 gene locus_tag LOCUS_19170 gene rfbA 4678 5553 CDS product glucose-1-phosphate thymidylyltransferase RfbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012027249.1 protein_id gnl|my_center|LOCUS_19170 5553 6140 gene locus_tag LOCUS_19180 gene rfbC 5553 6140 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143691.1 protein_id gnl|my_center|LOCUS_19180 6153 7088 gene locus_tag LOCUS_19190 gene rfbD 6153 7088 CDS product dTDP-4-dehydrorhamnose reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387760.1 protein_id gnl|my_center|LOCUS_19190 >Feature sequence159 1369 365 gene locus_tag LOCUS_19200 1369 365 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254327.1 protein_id gnl|my_center|LOCUS_19200 3312 1366 gene locus_tag LOCUS_19210 3312 1366 CDS product TRAP transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925163.1 protein_id gnl|my_center|LOCUS_19210 4559 3525 gene locus_tag LOCUS_19220 4559 3525 CDS product TAXI family TRAP transporter solute-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048053693.1 protein_id gnl|my_center|LOCUS_19220 4851 4648 gene locus_tag LOCUS_19230 4851 4648 CDS product ferredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814054.1 protein_id gnl|my_center|LOCUS_19230 6591 4873 gene locus_tag LOCUS_19240 6591 4873 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814052.1 protein_id gnl|my_center|LOCUS_19240 >Feature sequence160 2843 348 gene locus_tag LOCUS_19250 2843 348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19250 3951 2845 gene locus_tag LOCUS_19260 3951 2845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19260 4689 4030 gene locus_tag LOCUS_19270 4689 4030 CDS product RloB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228074.1 protein_id gnl|my_center|LOCUS_19270 5960 4689 gene locus_tag LOCUS_19280 5960 4689 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228075.1 protein_id gnl|my_center|LOCUS_19280 6701 6210 gene locus_tag LOCUS_19290 6701 6210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19290 6959 6708 gene locus_tag LOCUS_19300 6959 6708 CDS product UPF0175 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142654.1 protein_id gnl|my_center|LOCUS_19300 >Feature sequence161 1682 1263 gene locus_tag LOCUS_19310 1682 1263 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940496.1 protein_id gnl|my_center|LOCUS_19310 2083 1688 gene locus_tag LOCUS_19320 2083 1688 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937451.1 protein_id gnl|my_center|LOCUS_19320 3893 2166 gene locus_tag LOCUS_19330 3893 2166 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937450.1 protein_id gnl|my_center|LOCUS_19330 4378 3941 gene locus_tag LOCUS_19340 4378 3941 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940473.1 protein_id gnl|my_center|LOCUS_19340 6351 4735 gene locus_tag LOCUS_19350 6351 4735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19350 6937 6377 gene locus_tag LOCUS_19360 6937 6377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19360 >Feature sequence162 997 470 gene locus_tag LOCUS_19370 997 470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19370 1241 987 gene locus_tag LOCUS_19380 1241 987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19380 2863 1238 gene locus_tag LOCUS_19390 2863 1238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19390 4397 2856 gene locus_tag LOCUS_19400 4397 2856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19400 5251 4436 gene locus_tag LOCUS_19410 5251 4436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19410 6259 5255 gene locus_tag LOCUS_19420 6259 5255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19420 6759 6337 gene locus_tag LOCUS_19430 6759 6337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19430 >Feature sequence163 498 262 gene locus_tag LOCUS_19440 498 262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19440 886 584 gene locus_tag LOCUS_19450 886 584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19450 1255 2667 gene locus_tag LOCUS_19460 1255 2667 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021937.1 protein_id gnl|my_center|LOCUS_19460 3387 3019 gene locus_tag LOCUS_19470 3387 3019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19470 3936 3505 gene locus_tag LOCUS_19480 3936 3505 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141088.1 protein_id gnl|my_center|LOCUS_19480 4171 3962 gene locus_tag LOCUS_19490 4171 3962 CDS product ribbon-helix-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146889.1 protein_id gnl|my_center|LOCUS_19490 4474 4244 gene locus_tag LOCUS_19500 4474 4244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_19500 5389 4997 gene locus_tag LOCUS_19510 5389 4997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19510 5666 5400 gene locus_tag LOCUS_19520 5666 5400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19520 6517 5816 gene locus_tag LOCUS_19530 6517 5816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19530 >Feature sequence164 679 128 gene locus_tag LOCUS_19540 679 128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19540 1133 717 gene locus_tag LOCUS_19550 1133 717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19550 2336 1293 gene locus_tag LOCUS_19560 2336 1293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19560 2701 2333 gene locus_tag LOCUS_19570 2701 2333 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626534.1 protein_id gnl|my_center|LOCUS_19570 5052 2722 gene locus_tag LOCUS_19580 5052 2722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19580 6632 6105 gene locus_tag LOCUS_19590 6632 6105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19590 >Feature sequence165 144 395 gene locus_tag LOCUS_19600 144 395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19600 546 887 gene locus_tag LOCUS_19610 546 887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19610 2173 1043 gene locus_tag LOCUS_19620 gene hisC 2173 1043 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392052.1 protein_id gnl|my_center|LOCUS_19620 3489 2170 gene locus_tag LOCUS_19630 3489 2170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19630 4265 3534 gene locus_tag LOCUS_19640 4265 3534 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256822.1 protein_id gnl|my_center|LOCUS_19640 4756 4262 gene locus_tag LOCUS_19650 4756 4262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19650 5034 4753 gene locus_tag LOCUS_19660 5034 4753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19660 6100 5078 gene locus_tag LOCUS_19670 6100 5078 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064073.1 protein_id gnl|my_center|LOCUS_19670 <6952 6149 gene locus_tag LOCUS_19680 <6952 6149 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003086391.1:high-affinity branched-chain amino acid ABC transporter permease LivH >Feature sequence166 <1 930 gene locus_tag LOCUS_19690 <1 930 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_081361214.1:sigma 54-interacting transcriptional regulator 1401 1985 gene locus_tag LOCUS_19700 1401 1985 CDS product glycosyl hydrolase 108 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000158843.1 protein_id gnl|my_center|LOCUS_19700 2216 3922 gene locus_tag LOCUS_19710 2216 3922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19710 3994 4938 gene locus_tag LOCUS_19720 3994 4938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19720 5251 5538 gene locus_tag LOCUS_19730 5251 5538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19730 5528 5788 gene locus_tag LOCUS_19740 5528 5788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19740 6480 6764 gene locus_tag LOCUS_19750 6480 6764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19750 >Feature sequence167 <1 2373 gene locus_tag LOCUS_19760 <1 2373 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_041272623.1:molybdopterin-dependent oxidoreductase 2710 3477 gene locus_tag LOCUS_19770 2710 3477 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937996.1 protein_id gnl|my_center|LOCUS_19770 3768 4862 gene locus_tag LOCUS_19780 gene nrfD 3768 4862 CDS product polysulfide reductase NrfD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937995.1 protein_id gnl|my_center|LOCUS_19780 4883 5080 gene locus_tag LOCUS_19790 4883 5080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19790 6701 5088 gene locus_tag LOCUS_19800 gene nadB 6701 5088 CDS product L-aspartate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942471.1 protein_id gnl|my_center|LOCUS_19800 >Feature sequence168 391 5 gene locus_tag LOCUS_19810 391 5 CDS product PaaI family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005061570.1 protein_id gnl|my_center|LOCUS_19810 1133 468 gene locus_tag LOCUS_19820 1133 468 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256968.1 protein_id gnl|my_center|LOCUS_19820 1806 1363 gene locus_tag LOCUS_19830 1806 1363 CDS product four helix bundle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405056.1 protein_id gnl|my_center|LOCUS_19830 2718 1912 gene locus_tag LOCUS_19840 2718 1912 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256973.1 protein_id gnl|my_center|LOCUS_19840 4837 2939 gene locus_tag LOCUS_19850 4837 2939 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256972.1 protein_id gnl|my_center|LOCUS_19850 6086 4914 gene locus_tag LOCUS_19860 6086 4914 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926442.1 protein_id gnl|my_center|LOCUS_19860 >Feature sequence169 687 839 gene locus_tag LOCUS_19870 687 839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19870 829 1290 gene locus_tag LOCUS_19880 829 1290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19880 1287 2549 gene locus_tag LOCUS_19890 1287 2549 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940986.1 protein_id gnl|my_center|LOCUS_19890 2618 2812 gene locus_tag LOCUS_19900 2618 2812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19900 3049 4860 gene locus_tag LOCUS_19910 gene lepA 3049 4860 CDS product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957093.1 protein_id gnl|my_center|LOCUS_19910 4862 6064 gene locus_tag LOCUS_19920 4862 6064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19920 6655 6002 gene locus_tag LOCUS_19930 6655 6002 CDS product TIGR00730 family Rossman fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938821.1 protein_id gnl|my_center|LOCUS_19930 >Feature sequence170 428 952 gene locus_tag LOCUS_19940 428 952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19940 1360 1004 gene locus_tag LOCUS_19950 1360 1004 CDS product DUF86 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809264.1 protein_id gnl|my_center|LOCUS_19950 1904 1353 gene locus_tag LOCUS_19960 1904 1353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19960 2671 2315 gene locus_tag LOCUS_19970 2671 2315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19970 2919 2665 gene locus_tag LOCUS_19980 2919 2665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19980 4187 3201 gene locus_tag LOCUS_19990 4187 3201 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878131.1 protein_id gnl|my_center|LOCUS_19990 6191 4455 gene locus_tag LOCUS_20000 6191 4455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940971.1 protein_id gnl|my_center|LOCUS_20000 <6845 6256 gene locus_tag LOCUS_20010 <6845 6256 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943921.1:AAA family ATPase >Feature sequence171 470 637 gene locus_tag LOCUS_20020 470 637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20020 3740 705 gene locus_tag LOCUS_20030 3740 705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000871158.1 protein_id gnl|my_center|LOCUS_20030 4478 3960 gene locus_tag LOCUS_20040 4478 3960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_20040 4879 4661 gene locus_tag LOCUS_20050 4879 4661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20050 5271 5522 gene locus_tag LOCUS_20060 5271 5522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20060 6484 5519 gene locus_tag LOCUS_20070 6484 5519 CDS product 3-hydroxyacyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878701.1 protein_id gnl|my_center|LOCUS_20070 >Feature sequence172 1449 208 gene locus_tag LOCUS_20080 1449 208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20080 3108 1582 gene locus_tag LOCUS_20090 3108 1582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20090 4272 3385 gene locus_tag LOCUS_20100 4272 3385 CDS product SLBB domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928960.1 protein_id gnl|my_center|LOCUS_20100 5782 4502 gene locus_tag LOCUS_20110 5782 4502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20110 6601 5915 gene locus_tag LOCUS_20120 6601 5915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20120 >Feature sequence173 <1 753 gene locus_tag LOCUS_20130 <1 753 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164930426.1:sigma-54 dependent transcriptional regulator 1009 1422 gene locus_tag LOCUS_20140 1009 1422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20140 1672 2889 gene locus_tag LOCUS_20150 gene sat 1672 2889 CDS product sulfate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932543.1 protein_id gnl|my_center|LOCUS_20150 3048 3503 gene locus_tag LOCUS_20160 gene aprB 3048 3503 CDS product adenylyl-sulfate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932545.1 protein_id gnl|my_center|LOCUS_20160 3526 5409 gene locus_tag LOCUS_20170 gene aprA 3526 5409 CDS product adenylyl-sulfate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879166.1 protein_id gnl|my_center|LOCUS_20170 >Feature sequence174 2402 1440 gene locus_tag LOCUS_20180 2402 1440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_20180 3369 2326 gene locus_tag LOCUS_20190 3369 2326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20190 4884 3847 gene locus_tag LOCUS_20200 4884 3847 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990611.1 protein_id gnl|my_center|LOCUS_20200 <6775 5048 gene locus_tag LOCUS_20210 <6775 5048 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012545674.1:TonB-dependent receptor >Feature sequence175 430 6441 gene locus_tag LOCUS_20220 430 6441 CDS product DUF4011 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_150670707.1 protein_id gnl|my_center|LOCUS_20220 >Feature sequence176 352 771 gene locus_tag LOCUS_20230 352 771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20230 811 1380 gene locus_tag LOCUS_20240 811 1380 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941382.1 protein_id gnl|my_center|LOCUS_20240 1377 1745 gene locus_tag LOCUS_20250 1377 1745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20250 1800 2375 gene locus_tag LOCUS_20260 1800 2375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20260 3307 3483 gene locus_tag LOCUS_20270 3307 3483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20270 3877 4650 gene locus_tag LOCUS_20280 3877 4650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20280 4827 6590 gene locus_tag LOCUS_20290 4827 6590 CDS product DUF262 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_065612062.1 protein_id gnl|my_center|LOCUS_20290 >Feature sequence177 561 226 gene locus_tag LOCUS_20300 561 226 CDS product type II toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003530441.1 protein_id gnl|my_center|LOCUS_20300 812 558 gene locus_tag LOCUS_20310 812 558 CDS product type II toxin-antitoxin system HicA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_102761837.1 protein_id gnl|my_center|LOCUS_20310 2387 984 gene locus_tag LOCUS_20320 gene fumC 2387 984 CDS product class II fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000857390.1 protein_id gnl|my_center|LOCUS_20320 3095 2832 gene locus_tag LOCUS_20330 3095 2832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_20330 3298 3092 gene locus_tag LOCUS_20340 3298 3092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20340 4048 3497 gene locus_tag LOCUS_20350 4048 3497 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879824.1 protein_id gnl|my_center|LOCUS_20350 4285 4599 gene locus_tag LOCUS_20360 4285 4599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20360 5308 4862 gene locus_tag LOCUS_20370 5308 4862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20370 6277 5363 gene locus_tag LOCUS_20380 6277 5363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20380 >Feature sequence178 673 870 gene locus_tag LOCUS_20390 673 870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20390 1185 2540 gene locus_tag LOCUS_20400 gene xseA 1185 2540 CDS product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942411.1 protein_id gnl|my_center|LOCUS_20400 2656 2898 gene locus_tag LOCUS_20410 2656 2898 CDS product exodeoxyribonuclease VII small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942410.1 protein_id gnl|my_center|LOCUS_20410 2888 3796 gene locus_tag LOCUS_20420 2888 3796 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942409.1 protein_id gnl|my_center|LOCUS_20420 3793 5685 gene locus_tag LOCUS_20430 gene dxs 3793 5685 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941346.1 protein_id gnl|my_center|LOCUS_20430 5730 6470 gene locus_tag LOCUS_20440 5730 6470 CDS product TlyA family rRNA (cytidine-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544951.1 protein_id gnl|my_center|LOCUS_20440 >Feature sequence179 <1 725 gene locus_tag LOCUS_20450 <1 725 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942549.1:TIGR00730 family Rossman fold protein 911 1837 gene locus_tag LOCUS_20460 911 1837 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226986854.1 protein_id gnl|my_center|LOCUS_20460 2505 2104 gene locus_tag LOCUS_20470 2505 2104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20470 2795 2544 gene locus_tag LOCUS_20480 2795 2544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20480 4944 3016 gene locus_tag LOCUS_20490 4944 3016 CDS product RecQ family ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046236934.1 protein_id gnl|my_center|LOCUS_20490 6021 5053 gene locus_tag LOCUS_20500 6021 5053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20500 6509 6237 gene locus_tag LOCUS_20510 6509 6237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20510 >Feature sequence180 <1 1443 gene locus_tag LOCUS_20520 <1 1443 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942299.1:response regulator 1567 2634 gene locus_tag LOCUS_20530 1567 2634 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958239.1 protein_id gnl|my_center|LOCUS_20530 3011 4039 gene locus_tag LOCUS_20540 3011 4039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20540 4154 4789 gene locus_tag LOCUS_20550 4154 4789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_20550 4755 6458 gene locus_tag LOCUS_20560 4755 6458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20560 6472 6648 gene locus_tag LOCUS_20570 6472 6648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20570 >Feature sequence181 213 374 gene locus_tag LOCUS_20580 213 374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20580 394 1179 gene locus_tag LOCUS_20590 394 1179 CDS product HpnL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004206084.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_20590 1261 2301 gene locus_tag LOCUS_20600 gene hpnH 1261 2301 CDS product adenosyl-hopene transferase HpnH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387821.1 protein_id gnl|my_center|LOCUS_20600 2311 2910 gene locus_tag LOCUS_20610 2311 2910 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389281.1 protein_id gnl|my_center|LOCUS_20610 3134 3649 gene locus_tag LOCUS_20620 3134 3649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_20620 3624 4985 gene locus_tag LOCUS_20630 3624 4985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_20630 4982 5692 gene locus_tag LOCUS_20640 4982 5692 CDS product purine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387822.1 protein_id gnl|my_center|LOCUS_20640 >Feature sequence182 846 1241 gene locus_tag LOCUS_20650 846 1241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20650 1491 2201 gene locus_tag LOCUS_20660 1491 2201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20660 2878 2204 gene locus_tag LOCUS_20670 2878 2204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20670 3980 3024 gene locus_tag LOCUS_20680 3980 3024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20680 5765 4203 gene locus_tag LOCUS_20690 5765 4203 CDS product ASKHA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461578.1 protein_id gnl|my_center|LOCUS_20690 6246 5830 gene locus_tag LOCUS_20700 6246 5830 CDS product secondary thiamine-phosphate synthase enzyme YjbQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943269.1 protein_id gnl|my_center|LOCUS_20700 6673 6398 gene locus_tag LOCUS_20710 6673 6398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20710 >Feature sequence183 20 1057 gene locus_tag LOCUS_20720 gene dapA 20 1057 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869742.1 protein_id gnl|my_center|LOCUS_20720 2113 1301 gene locus_tag LOCUS_20730 gene pgeF 2113 1301 CDS product peptidoglycan editing factor PgeF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392375.1 protein_id gnl|my_center|LOCUS_20730 2323 3309 gene locus_tag LOCUS_20740 gene wtpA 2323 3309 CDS product tungstate ABC transporter substrate-binding protein WtpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870699.1 protein_id gnl|my_center|LOCUS_20740 3318 4109 gene locus_tag LOCUS_20750 3318 4109 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020339.1 protein_id gnl|my_center|LOCUS_20750 4106 5143 gene locus_tag LOCUS_20760 gene wtpC 4106 5143 CDS product tungstate ABC transporter ATP-binding protein WtpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867278.1 protein_id gnl|my_center|LOCUS_20760 5106 5366 gene locus_tag LOCUS_20770 5106 5366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20770 5492 5710 gene locus_tag LOCUS_20780 5492 5710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_20780 5718 6032 gene locus_tag LOCUS_20790 5718 6032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20790 6025 6183 gene locus_tag LOCUS_20800 6025 6183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20800 >Feature sequence184 3635 2469 gene locus_tag LOCUS_20810 3635 2469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20810 5133 4060 gene locus_tag LOCUS_20820 5133 4060 CDS product HD-GYP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000712870.1 protein_id gnl|my_center|LOCUS_20820 5917 5117 gene locus_tag LOCUS_20830 5917 5117 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942861.1 protein_id gnl|my_center|LOCUS_20830 6182 5994 gene locus_tag LOCUS_20840 6182 5994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20840 >Feature sequence185 <1 879 gene locus_tag LOCUS_20850 <1 879 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011072519.1:AsmA family protein 934 2268 gene locus_tag LOCUS_20860 934 2268 CDS product YihY/virulence factor BrkB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943098.1 protein_id gnl|my_center|LOCUS_20860 2522 3832 gene locus_tag LOCUS_20870 2522 3832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20870 3836 4981 gene locus_tag LOCUS_20880 3836 4981 CDS product MlaE family lipid ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005772900.1 protein_id gnl|my_center|LOCUS_20880 4992 5771 gene locus_tag LOCUS_20890 4992 5771 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454839.1 protein_id gnl|my_center|LOCUS_20890 >Feature sequence186 <1 742 gene locus_tag LOCUS_20900 <1 742 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004544567.1:glycosyltransferase family 4 protein 781 1887 gene locus_tag LOCUS_20910 781 1887 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392196.1 protein_id gnl|my_center|LOCUS_20910 1922 3352 gene locus_tag LOCUS_20920 1922 3352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20920 3456 3791 gene locus_tag LOCUS_20930 3456 3791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20930 3823 4506 gene locus_tag LOCUS_20940 3823 4506 CDS product WbqC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064741.1 protein_id gnl|my_center|LOCUS_20940 4503 5120 gene locus_tag LOCUS_20950 4503 5120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20950 5220 6290 gene locus_tag LOCUS_20960 5220 6290 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868279.1 protein_id gnl|my_center|LOCUS_20960 >Feature sequence187 2619 1411 gene locus_tag LOCUS_20970 2619 1411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_20970 5890 2612 gene locus_tag LOCUS_20980 gene recC 5890 2612 CDS product exodeoxyribonuclease V subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942180.1 protein_id gnl|my_center|LOCUS_20980 >Feature sequence188 774 313 gene locus_tag LOCUS_20990 774 313 CDS product PaaI family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937904.1 protein_id gnl|my_center|LOCUS_20990 1047 2795 gene locus_tag LOCUS_21000 1047 2795 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940470.1 protein_id gnl|my_center|LOCUS_21000 3240 2764 gene locus_tag LOCUS_21010 3240 2764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21010 3493 3197 gene locus_tag LOCUS_21020 3493 3197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21020 3713 4312 gene locus_tag LOCUS_21030 3713 4312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21030 4300 5073 gene locus_tag LOCUS_21040 4300 5073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21040 6356 5103 gene locus_tag LOCUS_21050 6356 5103 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958343.1 protein_id gnl|my_center|LOCUS_21050 >Feature sequence189 123 872 gene locus_tag LOCUS_21060 gene truA 123 872 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966380.1 protein_id gnl|my_center|LOCUS_21060 1164 1006 gene locus_tag LOCUS_21070 1164 1006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21070 2387 1377 gene locus_tag LOCUS_21080 gene amrS 2387 1377 CDS product AmmeMemoRadiSam system radical SAM enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546747.1 protein_id gnl|my_center|LOCUS_21080 3177 2365 gene locus_tag LOCUS_21090 3177 2365 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940624.1 protein_id gnl|my_center|LOCUS_21090 3369 5630 gene locus_tag LOCUS_21100 3369 5630 CDS product ATP-dependent RecD-like DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938194.1 protein_id gnl|my_center|LOCUS_21100 <6451 5665 gene locus_tag LOCUS_21110 <6451 5665 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014206400.1:2-(1,2-epoxy-1,2-dihydrophenyl)acetyl-CoA isomerase PaaG >Feature sequence190 1818 1108 gene locus_tag LOCUS_21120 1818 1108 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086609.1 protein_id gnl|my_center|LOCUS_21120 2563 1820 gene locus_tag LOCUS_21130 2563 1820 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000149338.1 protein_id gnl|my_center|LOCUS_21130 3549 2563 gene locus_tag LOCUS_21140 3549 2563 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088974.1 protein_id gnl|my_center|LOCUS_21140 4440 3568 gene locus_tag LOCUS_21150 4440 3568 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039304.1 protein_id gnl|my_center|LOCUS_21150 5851 4505 gene locus_tag LOCUS_21160 5851 4505 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085967.1 protein_id gnl|my_center|LOCUS_21160 >Feature sequence191 442 290 gene locus_tag LOCUS_21170 442 290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21170 1105 854 gene locus_tag LOCUS_21180 1105 854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21180 1606 1370 gene locus_tag LOCUS_21190 1606 1370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21190 1589 2026 gene locus_tag LOCUS_21200 1589 2026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21200 2068 3447 gene locus_tag LOCUS_21210 gene glcD 2068 3447 CDS product glycolate oxidase subunit GlcD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000890729.1 protein_id gnl|my_center|LOCUS_21210 3602 4432 gene locus_tag LOCUS_21220 3602 4432 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878013.1 protein_id gnl|my_center|LOCUS_21220 4493 4621 gene locus_tag LOCUS_21230 4493 4621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21230 4672 4851 gene locus_tag LOCUS_21240 4672 4851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21240 4955 6097 gene locus_tag LOCUS_21250 4955 6097 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020733.1 protein_id gnl|my_center|LOCUS_21250 >Feature sequence192 376 1104 gene locus_tag LOCUS_21260 376 1104 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113099.1 protein_id gnl|my_center|LOCUS_21260 1181 2032 gene locus_tag LOCUS_21270 1181 2032 CDS product 3-keto-5-aminohexanoate cleavage protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029490830.1 protein_id gnl|my_center|LOCUS_21270 2183 2944 gene locus_tag LOCUS_21280 2183 2944 CDS product cyclase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012296767.1 protein_id gnl|my_center|LOCUS_21280 2977 3741 gene locus_tag LOCUS_21290 2977 3741 CDS product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878702.1 protein_id gnl|my_center|LOCUS_21290 3769 4098 gene locus_tag LOCUS_21300 3769 4098 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878703.1 protein_id gnl|my_center|LOCUS_21300 4123 5076 gene locus_tag LOCUS_21310 4123 5076 CDS product 3-hydroxyacyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815911.1 protein_id gnl|my_center|LOCUS_21310 5330 5569 gene locus_tag LOCUS_21320 5330 5569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21320 >Feature sequence193 2040 1009 gene locus_tag LOCUS_21330 2040 1009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21330 2474 2094 gene locus_tag LOCUS_21340 2474 2094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21340 3495 2659 gene locus_tag LOCUS_21350 3495 2659 CDS product methylenetetrahydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392705.1 protein_id gnl|my_center|LOCUS_21350 4118 3492 gene locus_tag LOCUS_21360 4118 3492 CDS product methylenetetrahydrofolate reductase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392706.1 protein_id gnl|my_center|LOCUS_21360 4642 4289 gene locus_tag LOCUS_21370 4642 4289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_21370 <6303 4720 gene locus_tag LOCUS_21380 <6303 4720 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011392708.1:FAD-dependent oxidoreductase >Feature sequence194 2907 3683 gene locus_tag LOCUS_21390 2907 3683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21390 3699 4100 gene locus_tag LOCUS_21400 3699 4100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21400 6284 4278 gene locus_tag LOCUS_21410 6284 4278 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941590.1 protein_id gnl|my_center|LOCUS_21410 >Feature sequence195 <1 1563 gene locus_tag LOCUS_21420 <1 1563 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005902654.1:carboxyl transferase domain-containing protein 1810 2985 gene locus_tag LOCUS_21430 1810 2985 CDS product hydroxymethylglutaryl-CoA lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206797.1 protein_id gnl|my_center|LOCUS_21430 3418 3032 gene locus_tag LOCUS_21440 3418 3032 CDS product DUF3795 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022708.1 protein_id gnl|my_center|LOCUS_21440 4651 3482 gene locus_tag LOCUS_21450 4651 3482 CDS product Xaa-Pro peptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927165.1 protein_id gnl|my_center|LOCUS_21450 5546 4734 gene locus_tag LOCUS_21460 5546 4734 CDS product DUF169 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012468436.1 protein_id gnl|my_center|LOCUS_21460 >Feature sequence196 799 311 gene locus_tag LOCUS_21470 gene sixA 799 311 CDS product phosphohistidine phosphatase SixA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878502.1 protein_id gnl|my_center|LOCUS_21470 1171 4164 gene locus_tag LOCUS_21480 1171 4164 CDS product phosphoribosylformylglycinamidine synthase subunit PurS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942279.1 protein_id gnl|my_center|LOCUS_21480 4161 4997 gene locus_tag LOCUS_21490 4161 4997 CDS product phosphoribosylformylglycinamidine synthase subunit PurQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938913.1 protein_id gnl|my_center|LOCUS_21490 6242 5199 gene locus_tag LOCUS_21500 6242 5199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21500 >Feature sequence197 145 2184 gene locus_tag LOCUS_21510 gene tkt 145 2184 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142294.1 protein_id gnl|my_center|LOCUS_21510 2208 3806 gene locus_tag LOCUS_21520 2208 3806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21520 4378 3893 gene locus_tag LOCUS_21530 4378 3893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21530 4996 4580 gene locus_tag LOCUS_21540 4996 4580 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041170054.1 protein_id gnl|my_center|LOCUS_21540 5904 5443 gene locus_tag LOCUS_21550 5904 5443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21550 >Feature sequence198 2430 700 gene locus_tag LOCUS_21560 2430 700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21560 3680 2460 gene locus_tag LOCUS_21570 3680 2460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21570 4185 3682 gene locus_tag LOCUS_21580 4185 3682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21580 5493 4210 gene locus_tag LOCUS_21590 5493 4210 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940511.1 protein_id gnl|my_center|LOCUS_21590 >Feature sequence199 145 1254 gene locus_tag LOCUS_21600 gene asnA 145 1254 CDS product aspartate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000284917.1 protein_id gnl|my_center|LOCUS_21600 2890 1301 gene locus_tag LOCUS_21610 2890 1301 CDS product glycine betaine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957420.1 protein_id gnl|my_center|LOCUS_21610 3648 2887 gene locus_tag LOCUS_21620 3648 2887 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005772946.1 protein_id gnl|my_center|LOCUS_21620 3834 4331 gene locus_tag LOCUS_21630 3834 4331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21630 4740 4540 gene locus_tag LOCUS_21640 4740 4540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21640 5089 6066 gene locus_tag LOCUS_21650 5089 6066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21650 >Feature sequence200 147 668 gene locus_tag LOCUS_21660 147 668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21660 1275 2546 gene locus_tag LOCUS_21670 1275 2546 CDS product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010925892.1 protein_id gnl|my_center|LOCUS_21670 2571 3329 gene locus_tag LOCUS_21680 2571 3329 CDS product cyclase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_075549536.1 protein_id gnl|my_center|LOCUS_21680 3451 5703 gene locus_tag LOCUS_21690 3451 5703 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462063.1 protein_id gnl|my_center|LOCUS_21690 5704 6030 gene locus_tag LOCUS_21700 5704 6030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21700 >Feature sequence201 2863 1832 gene locus_tag LOCUS_21710 gene ahbD 2863 1832 CDS product heme b synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020622.1 protein_id gnl|my_center|LOCUS_21710 3125 3373 gene locus_tag LOCUS_21720 3125 3373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21720 4231 3536 gene locus_tag LOCUS_21730 4231 3536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21730 4518 4231 gene locus_tag LOCUS_21740 4518 4231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21740 5056 4637 gene locus_tag LOCUS_21750 5056 4637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21750 5916 4942 gene locus_tag LOCUS_21760 gene hemB 5916 4942 CDS product porphobilinogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940811.1 protein_id gnl|my_center|LOCUS_21760 >Feature sequence202 1121 516 gene locus_tag LOCUS_21770 1121 516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21770 1364 2836 gene locus_tag LOCUS_21780 1364 2836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21780 2833 4263 gene locus_tag LOCUS_21790 2833 4263 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937421.1 protein_id gnl|my_center|LOCUS_21790 4512 4793 gene locus_tag LOCUS_21800 4512 4793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21800 4928 5575 gene locus_tag LOCUS_21810 4928 5575 CDS product CBS and ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080265.1 protein_id gnl|my_center|LOCUS_21810 5674 5937 gene locus_tag LOCUS_21820 5674 5937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21820 >Feature sequence203 703 2016 gene locus_tag LOCUS_21830 703 2016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_21830 2074 2520 gene locus_tag LOCUS_21840 2074 2520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_21840 2688 3629 gene locus_tag LOCUS_21850 2688 3629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21850 3637 5028 gene locus_tag LOCUS_21860 3637 5028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_21860 >Feature sequence204 413 1198 gene locus_tag LOCUS_21870 413 1198 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009566968.1 protein_id gnl|my_center|LOCUS_21870 1233 2114 gene locus_tag LOCUS_21880 1233 2114 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104319.1 protein_id gnl|my_center|LOCUS_21880 2267 3325 gene locus_tag LOCUS_21890 2267 3325 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007246481.1 protein_id gnl|my_center|LOCUS_21890 3406 3693 gene locus_tag LOCUS_21900 3406 3693 CDS product GIY-YIG nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089332.1 protein_id gnl|my_center|LOCUS_21900 3830 5203 gene locus_tag LOCUS_21910 3830 5203 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104318.1 protein_id gnl|my_center|LOCUS_21910 >Feature sequence205 549 394 gene locus_tag LOCUS_21920 549 394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21920 775 563 gene locus_tag LOCUS_21930 775 563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21930 2182 2586 gene locus_tag LOCUS_21940 2182 2586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21940 2579 4018 gene locus_tag LOCUS_21950 2579 4018 CDS product flippase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875981.1 protein_id gnl|my_center|LOCUS_21950 4037 5152 gene locus_tag LOCUS_21960 4037 5152 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256879.1 protein_id gnl|my_center|LOCUS_21960 >Feature sequence206 3681 2062 gene locus_tag LOCUS_21970 3681 2062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21970 4730 3840 gene locus_tag LOCUS_21980 4730 3840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21980 5413 4778 gene locus_tag LOCUS_21990 5413 4778 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941479.1 protein_id gnl|my_center|LOCUS_21990 5902 5462 gene locus_tag LOCUS_22000 gene mlaD 5902 5462 CDS product outer membrane lipid asymmetry maintenance protein MlaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941481.1 protein_id gnl|my_center|LOCUS_22000 >Feature sequence207 <1 626 gene locus_tag LOCUS_22010 <1 626 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011141698.1:protein-L-isoaspartate(D-aspartate) O-methyltransferase 1795 653 gene locus_tag LOCUS_22020 1795 653 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061599.1 protein_id gnl|my_center|LOCUS_22020 2905 1877 gene locus_tag LOCUS_22030 2905 1877 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941783.1 protein_id gnl|my_center|LOCUS_22030 4181 2898 gene locus_tag LOCUS_22040 4181 2898 CDS product class II fructose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941850.1 protein_id gnl|my_center|LOCUS_22040 5419 4370 gene locus_tag LOCUS_22050 5419 4370 CDS product zinc-dependent dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545362.1 protein_id gnl|my_center|LOCUS_22050 >Feature sequence208 778 176 gene locus_tag LOCUS_22060 778 176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22060 1327 2193 gene locus_tag LOCUS_22070 1327 2193 CDS product ChaN family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012164238.1 protein_id gnl|my_center|LOCUS_22070 2441 3028 gene locus_tag LOCUS_22080 2441 3028 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000872605.1 protein_id gnl|my_center|LOCUS_22080 3181 3414 gene locus_tag LOCUS_22090 3181 3414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22090 3852 5144 gene locus_tag LOCUS_22100 gene hisD 3852 5144 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496833.1 protein_id gnl|my_center|LOCUS_22100 5363 5806 gene locus_tag LOCUS_22110 gene gcvH 5363 5806 CDS product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391976.1 protein_id gnl|my_center|LOCUS_22110 >Feature sequence209 344 1684 gene locus_tag LOCUS_22120 gene rimO 344 1684 CDS product 30S ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943823.1 protein_id gnl|my_center|LOCUS_22120 1724 1861 gene locus_tag LOCUS_22130 1724 1861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22130 4591 2165 gene locus_tag LOCUS_22140 4591 2165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22140 >Feature sequence210 2038 1109 gene locus_tag LOCUS_22150 2038 1109 CDS product MinD/ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002657813.1 protein_id gnl|my_center|LOCUS_22150 2721 3290 gene locus_tag LOCUS_22160 gene orn 2721 3290 CDS product oligoribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000010183.1 protein_id gnl|my_center|LOCUS_22160 3414 4589 gene locus_tag LOCUS_22170 gene sucC 3414 4589 CDS product ADP-forming succinate--CoA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881049.1 protein_id gnl|my_center|LOCUS_22170 4915 5790 gene locus_tag LOCUS_22180 gene sucD 4915 5790 CDS product succinate--CoA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931961.1 protein_id gnl|my_center|LOCUS_22180 >Feature sequence211 3045 1894 gene locus_tag LOCUS_22190 3045 1894 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000397283.1 protein_id gnl|my_center|LOCUS_22190 5076 3235 gene locus_tag LOCUS_22200 5076 3235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_098076974.1 protein_id gnl|my_center|LOCUS_22200 >Feature sequence212 98 448 gene locus_tag LOCUS_22210 98 448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22210 923 1126 gene locus_tag LOCUS_22220 923 1126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22220 1510 3180 gene locus_tag LOCUS_22230 gene ilvD 1510 3180 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393742.1 protein_id gnl|my_center|LOCUS_22230 3273 4958 gene locus_tag LOCUS_22240 gene ilvB 3273 4958 CDS product biosynthetic-type acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938671.1 protein_id gnl|my_center|LOCUS_22240 5157 5645 gene locus_tag LOCUS_22250 gene ilvN 5157 5645 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938672.1 protein_id gnl|my_center|LOCUS_22250 >Feature sequence213 395 1432 gene locus_tag LOCUS_22260 395 1432 CDS product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942697.1 protein_id gnl|my_center|LOCUS_22260 2401 2550 gene locus_tag LOCUS_22270 2401 2550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22270 2608 2787 gene locus_tag LOCUS_22280 2608 2787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22280 3492 2974 gene locus_tag LOCUS_22290 3492 2974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22290 4301 4540 gene locus_tag LOCUS_22300 4301 4540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22300 4622 4846 gene locus_tag LOCUS_22310 4622 4846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22310 5365 5544 gene locus_tag LOCUS_22320 5365 5544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22320 >Feature sequence214 799 5 gene locus_tag LOCUS_22330 799 5 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546451.1 protein_id gnl|my_center|LOCUS_22330 1114 932 gene locus_tag LOCUS_22340 1114 932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22340 1101 1442 gene locus_tag LOCUS_22350 1101 1442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22350 1439 1771 gene locus_tag LOCUS_22360 1439 1771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22360 2181 1783 gene locus_tag LOCUS_22370 2181 1783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22370 2485 5283 gene locus_tag LOCUS_22380 gene ileS 2485 5283 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943758.1 protein_id gnl|my_center|LOCUS_22380 >Feature sequence215 <1 1557 gene locus_tag LOCUS_22390 <1 1557 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012546680.1:phosphoglycerate dehydrogenase 1658 3022 gene locus_tag LOCUS_22400 1658 3022 CDS product TrpB-like pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583619.1 protein_id gnl|my_center|LOCUS_22400 3152 3421 gene locus_tag LOCUS_22410 3152 3421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22410 3414 5273 gene locus_tag LOCUS_22420 3414 5273 CDS product thiamine pyrophosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942696.1 protein_id gnl|my_center|LOCUS_22420 >Feature sequence216 <1 597 gene locus_tag LOCUS_22430 <1 597 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010938321.1:ABC transporter ATP-binding protein 552 1778 gene locus_tag LOCUS_22440 552 1778 CDS product SufD family Fe-S cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938320.1 protein_id gnl|my_center|LOCUS_22440 1803 2054 gene locus_tag LOCUS_22450 1803 2054 CDS product glutaredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938182.1 protein_id gnl|my_center|LOCUS_22450 2051 2386 gene locus_tag LOCUS_22460 2051 2386 CDS product ferredoxin-thioredoxin reductase catalytic domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938183.1 protein_id gnl|my_center|LOCUS_22460 2520 3257 gene locus_tag LOCUS_22470 2520 3257 CDS product epoxyqueuosine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879896.1 protein_id gnl|my_center|LOCUS_22470 3863 3552 gene locus_tag LOCUS_22480 3863 3552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_22480 5171 4125 gene locus_tag LOCUS_22490 5171 4125 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931304.1 protein_id gnl|my_center|LOCUS_22490 >Feature sequence217 436 1338 gene locus_tag LOCUS_22500 436 1338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22500 1421 3433 gene locus_tag LOCUS_22510 1421 3433 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164924828.1 protein_id gnl|my_center|LOCUS_22510 3348 4883 gene locus_tag LOCUS_22520 3348 4883 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937845.1 protein_id gnl|my_center|LOCUS_22520 5187 4963 gene locus_tag LOCUS_22530 5187 4963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22530 >Feature sequence218 4139 984 gene locus_tag LOCUS_22540 4139 984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22540 4598 4143 gene locus_tag LOCUS_22550 gene nuoE 4598 4143 CDS product NADH-quinone oxidoreductase subunit NuoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877157.1 protein_id gnl|my_center|LOCUS_22550 5246 4647 gene locus_tag LOCUS_22560 5246 4647 CDS product molybdenum cofactor guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545242.1 protein_id gnl|my_center|LOCUS_22560 >Feature sequence219 1041 22 gene locus_tag LOCUS_22570 gene rfbB 1041 22 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056311.1 protein_id gnl|my_center|LOCUS_22570 2111 1170 gene locus_tag LOCUS_22580 2111 1170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22580 4154 2838 gene locus_tag LOCUS_22590 4154 2838 CDS product Coenzyme F420 hydrogenase/dehydrogenase, beta subunit C-terminal domain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875980.1 protein_id gnl|my_center|LOCUS_22590 5419 4154 gene locus_tag LOCUS_22600 5419 4154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22600 >Feature sequence220 954 754 gene locus_tag LOCUS_22610 954 754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22610 1706 1056 gene locus_tag LOCUS_22620 1706 1056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22620 2290 1724 gene locus_tag LOCUS_22630 2290 1724 CDS product HDIG domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937640.1 protein_id gnl|my_center|LOCUS_22630 2684 3541 gene locus_tag LOCUS_22640 2684 3541 CDS product mannosyl-3-phosphoglycerate phosphatase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124881.1 protein_id gnl|my_center|LOCUS_22640 3701 4933 gene locus_tag LOCUS_22650 3701 4933 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868852.1 protein_id gnl|my_center|LOCUS_22650 <5533 4989 gene locus_tag LOCUS_22660 <5533 4989 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012256515.1:glycerate kinase >Feature sequence221 255 2264 gene locus_tag LOCUS_22670 gene fadJ 255 2264 CDS product fatty acid oxidation complex subunit alpha FadJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479507.1 protein_id gnl|my_center|LOCUS_22670 5448 2323 gene locus_tag LOCUS_22680 5448 2323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22680 >Feature sequence222 768 3623 gene locus_tag LOCUS_22690 gene secA 768 3623 CDS product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932908.1 protein_id gnl|my_center|LOCUS_22690 4136 5326 gene locus_tag LOCUS_22700 gene argJ 4136 5326 CDS product bifunctional glutamate N-acetyltransferase/amino-acid acetyltransferase ArgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942692.1 protein_id gnl|my_center|LOCUS_22700 >Feature sequence223 329 670 gene locus_tag LOCUS_22710 329 670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22710 680 856 gene locus_tag LOCUS_22720 680 856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22720 933 1496 gene locus_tag LOCUS_22730 933 1496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22730 1645 2913 gene locus_tag LOCUS_22740 gene eno 1645 2913 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391810.1 protein_id gnl|my_center|LOCUS_22740 2963 3217 gene locus_tag LOCUS_22750 2963 3217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22750 4184 3336 gene locus_tag LOCUS_22760 4184 3336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22760 4401 4177 gene locus_tag LOCUS_22770 4401 4177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22770 >Feature sequence224 940 227 gene locus_tag LOCUS_22780 940 227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22780 1176 2348 gene locus_tag LOCUS_22790 1176 2348 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957791.1 protein_id gnl|my_center|LOCUS_22790 2669 3115 gene locus_tag LOCUS_22800 2669 3115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22800 <5494 3246 gene locus_tag LOCUS_22810 <5494 3246 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_202319769.1:formate C-acetyltransferase/glycerol dehydratase family glycyl radical enzyme >Feature sequence225 <1 1504 gene locus_tag LOCUS_22820 <1 1504 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010883927.1:DNA methyltransferase 1476 1646 gene locus_tag LOCUS_22830 1476 1646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22830 1977 1858 gene locus_tag LOCUS_22840 1977 1858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22840 2198 2614 gene locus_tag LOCUS_22850 gene arfB 2198 2614 CDS product alternative ribosome rescue aminoacyl-tRNA hydrolase ArfB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957569.1 protein_id gnl|my_center|LOCUS_22850 2660 3184 gene locus_tag LOCUS_22860 2660 3184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22860 3352 5070 gene locus_tag LOCUS_22870 3352 5070 CDS product NAD+ synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080010.1 protein_id gnl|my_center|LOCUS_22870 >Feature sequence226 32 1456 gene locus_tag LOCUS_22880 32 1456 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392350.1 protein_id gnl|my_center|LOCUS_22880 1672 1881 gene locus_tag LOCUS_22890 1672 1881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22890 2819 1887 gene locus_tag LOCUS_22900 2819 1887 CDS product glycosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022353.1 protein_id gnl|my_center|LOCUS_22900 3764 2820 gene locus_tag LOCUS_22910 3764 2820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22910 4942 3830 gene locus_tag LOCUS_22920 4942 3830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22920 5217 4942 gene locus_tag LOCUS_22930 5217 4942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22930 >Feature sequence227 268 2463 gene locus_tag LOCUS_22940 268 2463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_22940 2701 3060 gene locus_tag LOCUS_22950 2701 3060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_22950 3286 3954 gene locus_tag LOCUS_22960 3286 3954 CDS product methylenetetrahydrofolate reductase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392706.1 protein_id gnl|my_center|LOCUS_22960 3951 4883 gene locus_tag LOCUS_22970 3951 4883 CDS product methylenetetrahydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392705.1 protein_id gnl|my_center|LOCUS_22970 >Feature sequence228 621 851 gene locus_tag LOCUS_22980 621 851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22980 848 1330 gene locus_tag LOCUS_22990 848 1330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22990 1706 1383 gene locus_tag LOCUS_23000 1706 1383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23000 2053 2129 gene locus_tag LOCUS_t00160 2053 2129 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 2239 2802 gene locus_tag LOCUS_23010 2239 2802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23010 3688 3038 gene locus_tag LOCUS_23020 3688 3038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23020 4200 3802 gene locus_tag LOCUS_23030 4200 3802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23030 4662 4255 gene locus_tag LOCUS_23040 4662 4255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23040 5201 4890 gene locus_tag LOCUS_23050 5201 4890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23050 >Feature sequence229 4579 1793 gene locus_tag LOCUS_23060 4579 1793 CDS product HsdR family type I site-specific deoxyribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681375.1 protein_id gnl|my_center|LOCUS_23060 4983 4576 gene locus_tag LOCUS_23070 4983 4576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23070 >Feature sequence230 464 303 gene locus_tag LOCUS_23080 464 303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23080 730 464 gene locus_tag LOCUS_23090 730 464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23090 2381 1014 gene locus_tag LOCUS_23100 2381 1014 CDS product TrpB-like pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583619.1 protein_id gnl|my_center|LOCUS_23100 3531 2812 gene locus_tag LOCUS_23110 3531 2812 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065023.1 protein_id gnl|my_center|LOCUS_23110 4635 3769 gene locus_tag LOCUS_23120 4635 3769 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763625.1 protein_id gnl|my_center|LOCUS_23120 4763 4623 gene locus_tag LOCUS_23130 4763 4623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23130 >Feature sequence231 451 1524 gene locus_tag LOCUS_23140 451 1524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23140 1838 1554 gene locus_tag LOCUS_23150 1838 1554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23150 2513 1839 gene locus_tag LOCUS_23160 2513 1839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23160 3710 2535 gene locus_tag LOCUS_23170 3710 2535 CDS product PilT/PilU family type 4a pilus ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545245.1 protein_id gnl|my_center|LOCUS_23170 5109 3982 gene locus_tag LOCUS_23180 5109 3982 CDS product type IV pilus twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546105.1 protein_id gnl|my_center|LOCUS_23180 5281 5087 gene locus_tag LOCUS_23190 5281 5087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23190 >Feature sequence232 513 313 gene locus_tag LOCUS_23200 513 313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23200 1418 651 gene locus_tag LOCUS_23210 1418 651 CDS product P-loop NTPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869576.1 protein_id gnl|my_center|LOCUS_23210 1816 1436 gene locus_tag LOCUS_23220 1816 1436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23220 2212 1856 gene locus_tag LOCUS_23230 2212 1856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23230 2479 2237 gene locus_tag LOCUS_23240 2479 2237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23240 3337 2876 gene locus_tag LOCUS_23250 3337 2876 CDS product iron-sulfur cluster assembly scaffold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880545.1 protein_id gnl|my_center|LOCUS_23250 3548 3375 gene locus_tag LOCUS_23260 3548 3375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23260 3979 3743 gene locus_tag LOCUS_23270 3979 3743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23270 4879 4049 gene locus_tag LOCUS_23280 4879 4049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23280 5247 4972 gene locus_tag LOCUS_23290 5247 4972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23290 >Feature sequence233 <1 1476 gene locus_tag LOCUS_23300 <1 1476 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257961.1:ATP-binding protein 1651 1881 gene locus_tag LOCUS_23310 1651 1881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23310 2114 2284 gene locus_tag LOCUS_23320 2114 2284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23320 2259 4643 gene locus_tag LOCUS_23330 2259 4643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23330 >Feature sequence234 <1 1964 gene locus_tag LOCUS_23340 <1 1964 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011391795.1:excinuclease ABC subunit UvrB 2915 1980 gene locus_tag LOCUS_23350 gene fabD 2915 1980 CDS product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356280.1 protein_id gnl|my_center|LOCUS_23350 3124 3333 gene locus_tag LOCUS_23360 3124 3333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23360 3609 5159 gene locus_tag LOCUS_23370 3609 5159 CDS product acyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005800651.1 protein_id gnl|my_center|LOCUS_23370 >Feature sequence235 1185 1397 gene locus_tag LOCUS_23380 1185 1397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23380 1618 2847 gene locus_tag LOCUS_23390 1618 2847 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461177.1 protein_id gnl|my_center|LOCUS_23390 3911 2877 gene locus_tag LOCUS_23400 3911 2877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23400 4096 4623 gene locus_tag LOCUS_23410 gene cobO 4096 4623 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392864.1 protein_id gnl|my_center|LOCUS_23410 >Feature sequence236 385 2235 gene locus_tag LOCUS_23420 385 2235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23420 2292 2459 gene locus_tag LOCUS_23430 2292 2459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23430 2476 3024 gene locus_tag LOCUS_23440 2476 3024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23440 3021 3731 gene locus_tag LOCUS_23450 3021 3731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_23450 3725 5131 gene locus_tag LOCUS_23460 3725 5131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_23460 >Feature sequence237 578 213 gene locus_tag LOCUS_23470 578 213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23470 3393 583 gene locus_tag LOCUS_23480 3393 583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_23480 3614 4399 gene locus_tag LOCUS_23490 3614 4399 CDS product DUF1538 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478515.1 protein_id gnl|my_center|LOCUS_23490 4400 5185 gene locus_tag LOCUS_23500 4400 5185 CDS product DUF1538 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454529.1 protein_id gnl|my_center|LOCUS_23500 >Feature sequence238 590 1624 gene locus_tag LOCUS_23510 590 1624 CDS product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037402005.1 protein_id gnl|my_center|LOCUS_23510 1820 2341 gene locus_tag LOCUS_23520 1820 2341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23520 2901 3614 gene locus_tag LOCUS_23530 gene rph 2901 3614 CDS product ribonuclease PH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857993.1 protein_id gnl|my_center|LOCUS_23530 4129 3854 gene locus_tag LOCUS_23540 4129 3854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23540 4406 4203 gene locus_tag LOCUS_23550 4406 4203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23550 4886 4686 gene locus_tag LOCUS_23560 4886 4686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23560 >Feature sequence239 1641 520 gene locus_tag LOCUS_23570 1641 520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23570 3130 1652 gene locus_tag LOCUS_23580 3130 1652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23580 3546 3277 gene locus_tag LOCUS_23590 3546 3277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23590 4564 3653 gene locus_tag LOCUS_23600 4564 3653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868097.1 protein_id gnl|my_center|LOCUS_23600 >Feature sequence240 <1 1134 gene locus_tag LOCUS_23610 <1 1134 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010938190.1:aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme 1136 1498 gene locus_tag LOCUS_23620 1136 1498 CDS product GxxExxY protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119424.1 protein_id gnl|my_center|LOCUS_23620 1599 2906 gene locus_tag LOCUS_23630 1599 2906 CDS product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545264.1 protein_id gnl|my_center|LOCUS_23630 2893 4113 gene locus_tag LOCUS_23640 2893 4113 CDS product cofactor-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545558.1 protein_id gnl|my_center|LOCUS_23640 4371 5060 gene locus_tag LOCUS_23650 4371 5060 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939218.1 protein_id gnl|my_center|LOCUS_23650 >Feature sequence241 45 269 gene locus_tag LOCUS_23660 45 269 CDS product ferrous iron transport protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545730.1 protein_id gnl|my_center|LOCUS_23660 266 2734 gene locus_tag LOCUS_23670 266 2734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23670 2745 3074 gene locus_tag LOCUS_23680 2745 3074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002674683.1 protein_id gnl|my_center|LOCUS_23680 3152 3973 gene locus_tag LOCUS_23690 3152 3973 CDS product DUF4198 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679851.1 protein_id gnl|my_center|LOCUS_23690 >Feature sequence242 2 2086 gene locus_tag LOCUS_23700 2 2086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_23700 2133 3863 gene locus_tag LOCUS_23710 2133 3863 CDS product hydantoinase B/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086403.1 protein_id gnl|my_center|LOCUS_23710 <5127 4000 gene locus_tag LOCUS_23720 <5127 4000 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012868777.1:isocitrate dehydrogenase (NADP(+)) >Feature sequence243 167 370 gene locus_tag LOCUS_23730 167 370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23730 599 4177 gene locus_tag LOCUS_23740 599 4177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23740 4167 5123 gene locus_tag LOCUS_23750 4167 5123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23750 >Feature sequence244 1593 121 gene locus_tag LOCUS_23760 1593 121 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940686.1 protein_id gnl|my_center|LOCUS_23760 3545 1593 gene locus_tag LOCUS_23770 3545 1593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23770 3866 3609 gene locus_tag LOCUS_23780 3866 3609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23780 4908 3976 gene locus_tag LOCUS_23790 4908 3976 CDS product methylenetetrahydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392705.1 protein_id gnl|my_center|LOCUS_23790 >Feature sequence245 1734 724 gene locus_tag LOCUS_23800 1734 724 CDS product zinc-binding alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_165476103.1 protein_id gnl|my_center|LOCUS_23800 4089 2113 gene locus_tag LOCUS_23810 4089 2113 CDS product CoB--CoM heterodisulfide reductase iron-sulfur subunit A family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011018621.1 protein_id gnl|my_center|LOCUS_23810 <5090 4100 gene locus_tag LOCUS_23820 <5090 4100 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257680.1:heterodisulfide reductase-related iron-sulfur binding cluster >Feature sequence246 <1 1116 gene locus_tag LOCUS_23830 <1 1116 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942899.1:3-deoxy-D-manno-octulosonic acid transferase 1166 2383 gene locus_tag LOCUS_23840 1166 2383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23840 3198 2545 gene locus_tag LOCUS_23850 gene hisH 3198 2545 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937594.1 protein_id gnl|my_center|LOCUS_23850 4733 3204 gene locus_tag LOCUS_23860 gene guaA 4733 3204 CDS product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545424.1 protein_id gnl|my_center|LOCUS_23860 >Feature sequence247 370 146 gene locus_tag LOCUS_23870 370 146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23870 1130 372 gene locus_tag LOCUS_23880 1130 372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23880 1782 1123 gene locus_tag LOCUS_23890 1782 1123 CDS product precorrin-8X methylmutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940346.1 protein_id gnl|my_center|LOCUS_23890 2567 1788 gene locus_tag LOCUS_23900 2567 1788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23900 3066 2668 gene locus_tag LOCUS_23910 3066 2668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23910 4559 3063 gene locus_tag LOCUS_23920 4559 3063 CDS product cobyric acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836536.1 protein_id gnl|my_center|LOCUS_23920 >Feature sequence248 166 1278 gene locus_tag LOCUS_23930 gene alr 166 1278 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941268.1 protein_id gnl|my_center|LOCUS_23930 1275 2951 gene locus_tag LOCUS_23940 gene argS 1275 2951 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_039648220.1 protein_id gnl|my_center|LOCUS_23940 2967 3644 gene locus_tag LOCUS_23950 2967 3644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23950 3647 4162 gene locus_tag LOCUS_23960 3647 4162 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546022.1 protein_id gnl|my_center|LOCUS_23960 >Feature sequence249 758 1972 gene locus_tag LOCUS_23970 758 1972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23970 1960 2883 gene locus_tag LOCUS_23980 1960 2883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23980 4479 3244 gene locus_tag LOCUS_23990 4479 3244 CDS product IS110-like element ISDha12 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808714.1 protein_id gnl|my_center|LOCUS_23990 >Feature sequence250 336 1136 gene locus_tag LOCUS_24000 336 1136 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025568069.1 protein_id gnl|my_center|LOCUS_24000 1157 1678 gene locus_tag LOCUS_24010 1157 1678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24010 1760 4006 gene locus_tag LOCUS_24020 1760 4006 CDS product molybdopterin oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459738.1 protein_id gnl|my_center|LOCUS_24020 4009 4644 gene locus_tag LOCUS_24030 4009 4644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24030 >Feature sequence251 410 1222 gene locus_tag LOCUS_24040 gene yqeB 410 1222 CDS product selenium-dependent molybdenum cofactor biosynthesis protein YqeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393498.1 protein_id gnl|my_center|LOCUS_24040 2561 1275 gene locus_tag LOCUS_24050 2561 1275 CDS product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000852462.1 protein_id gnl|my_center|LOCUS_24050 2831 4780 gene locus_tag LOCUS_24060 2831 4780 CDS product aconitate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393382.1 protein_id gnl|my_center|LOCUS_24060 >Feature sequence252 664 413 gene locus_tag LOCUS_24070 664 413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_24070 1003 728 gene locus_tag LOCUS_24080 1003 728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24080 1972 1058 gene locus_tag LOCUS_24090 gene fmt 1972 1058 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940806.1 protein_id gnl|my_center|LOCUS_24090 3028 2132 gene locus_tag LOCUS_24100 3028 2132 CDS product CoA ester lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391941.1 protein_id gnl|my_center|LOCUS_24100 3946 3050 gene locus_tag LOCUS_24110 3946 3050 CDS product CoA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391940.1 protein_id gnl|my_center|LOCUS_24110 4242 3958 gene locus_tag LOCUS_24120 4242 3958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391939.1 protein_id gnl|my_center|LOCUS_24120 <5008 4412 gene locus_tag LOCUS_24130 <5008 4412 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011391938.1:acetate--CoA ligase family protein >Feature sequence253 269 1456 gene locus_tag LOCUS_24140 269 1456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_24140 1434 1925 gene locus_tag LOCUS_24150 1434 1925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_24150 2001 2672 gene locus_tag LOCUS_24160 2001 2672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24160 2673 3908 gene locus_tag LOCUS_24170 2673 3908 CDS product M20 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939114.1 protein_id gnl|my_center|LOCUS_24170 4044 4418 gene locus_tag LOCUS_24180 4044 4418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24180 4393 4782 gene locus_tag LOCUS_24190 4393 4782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24190 >Feature sequence254 <1 1141 gene locus_tag LOCUS_24200 <1 1141 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011266923.1:membrane-bound lytic murein transglycosylase MltF 1477 1184 gene locus_tag LOCUS_24210 1477 1184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_24210 2268 1549 gene locus_tag LOCUS_24220 2268 1549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_24220 2456 2292 gene locus_tag LOCUS_24230 2456 2292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24230 2980 2453 gene locus_tag LOCUS_24240 2980 2453 CDS product TRAP transporter small permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942698.1 protein_id gnl|my_center|LOCUS_24240 3573 4598 gene locus_tag LOCUS_24250 3573 4598 CDS product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942697.1 protein_id gnl|my_center|LOCUS_24250 >Feature sequence255 <1 897 gene locus_tag LOCUS_24260 <1 897 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_041272661.1:DUF362 domain-containing protein note possible pseudo, frameshifted 888 1070 gene locus_tag LOCUS_24270 888 1070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24270 2350 1154 gene locus_tag LOCUS_24280 gene amrS 2350 1154 CDS product AmmeMemoRadiSam system radical SAM enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867880.1 protein_id gnl|my_center|LOCUS_24280 4634 2523 gene locus_tag LOCUS_24290 4634 2523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24290 >Feature sequence256 1867 494 gene locus_tag LOCUS_24300 1867 494 CDS product F420-non-reducing hydrogenase subunit A, selenocysteine-containing inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545782.1 protein_id gnl|my_center|LOCUS_24300 2856 1876 gene locus_tag LOCUS_24310 2856 1876 CDS product F420-non-reducing hydrogenase subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545939.1 protein_id gnl|my_center|LOCUS_24310 3344 3544 gene locus_tag LOCUS_24320 3344 3544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_24320 3599 3793 gene locus_tag LOCUS_24330 3599 3793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_24330 3883 4575 gene locus_tag LOCUS_24340 3883 4575 CDS product phenylalanine--tRNA ligase beta subunit-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037397506.1 protein_id gnl|my_center|LOCUS_24340 >Feature sequence257 2675 1104 gene locus_tag LOCUS_24350 2675 1104 CDS product class I adenylate-forming enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461744.1 protein_id gnl|my_center|LOCUS_24350 3651 2971 gene locus_tag LOCUS_24360 3651 2971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24360 3841 4419 gene locus_tag LOCUS_24370 3841 4419 CDS product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932641.1 protein_id gnl|my_center|LOCUS_24370 4861 4547 gene locus_tag LOCUS_24380 4861 4547 CDS product divalent-cation tolerance protein CutA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877119.1 protein_id gnl|my_center|LOCUS_24380 >Feature sequence258 838 1356 gene locus_tag LOCUS_24390 838 1356 CDS product type 1 glutamine amidotransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868874.1 protein_id gnl|my_center|LOCUS_24390 2779 1640 gene locus_tag LOCUS_24400 2779 1640 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938041.1 protein_id gnl|my_center|LOCUS_24400 2980 4365 gene locus_tag LOCUS_24410 2980 4365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24410 >Feature sequence259 <1 999 gene locus_tag LOCUS_24420 <1 999 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943017.1:anthranilate phosphoribosyltransferase 968 1756 gene locus_tag LOCUS_24430 gene trpC 968 1756 CDS product indole-3-glycerol phosphate synthase TrpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392852.1 protein_id gnl|my_center|LOCUS_24430 1942 2373 gene locus_tag LOCUS_24440 1942 2373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_24440 2366 3592 gene locus_tag LOCUS_24450 gene trpB 2366 3592 CDS product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880421.1 protein_id gnl|my_center|LOCUS_24450 3585 4346 gene locus_tag LOCUS_24460 gene trpA 3585 4346 CDS product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392849.1 protein_id gnl|my_center|LOCUS_24460 >Feature sequence260 52 495 gene locus_tag LOCUS_24470 52 495 CDS product HIT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014524404.1 protein_id gnl|my_center|LOCUS_24470 499 846 gene locus_tag LOCUS_24480 499 846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24480 933 2204 gene locus_tag LOCUS_24490 gene lapB 933 2204 CDS product lipopolysaccharide assembly protein LapB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481625.1 protein_id gnl|my_center|LOCUS_24490 >Feature sequence261 1648 3987 gene locus_tag LOCUS_24500 1648 3987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24500 4409 4272 gene locus_tag LOCUS_24510 4409 4272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24510 >Feature sequence262 1266 34 gene locus_tag LOCUS_24520 1266 34 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072957.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_24520 1561 1289 gene locus_tag LOCUS_24530 1561 1289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24530 1790 1960 gene locus_tag LOCUS_24540 1790 1960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24540 2000 2893 gene locus_tag LOCUS_24550 2000 2893 CDS product N-acyl homoserine lactonase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019565706.1 protein_id gnl|my_center|LOCUS_24550 3049 3657 gene locus_tag LOCUS_24560 3049 3657 CDS product DUF1295 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030520.1 protein_id gnl|my_center|LOCUS_24560 4407 3637 gene locus_tag LOCUS_24570 4407 3637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24570 >Feature sequence263 384 1286 gene locus_tag LOCUS_24580 384 1286 CDS product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942175.1 protein_id gnl|my_center|LOCUS_24580 1322 4495 gene locus_tag LOCUS_24590 1322 4495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24590 >Feature sequence264 266 610 gene locus_tag LOCUS_24600 266 610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24600 607 1008 gene locus_tag LOCUS_24610 607 1008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24610 1157 3403 gene locus_tag LOCUS_24620 1157 3403 CDS product DUF1156 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_207707612.1 protein_id gnl|my_center|LOCUS_24620 3372 4415 gene locus_tag LOCUS_24630 3372 4415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393763.1 protein_id gnl|my_center|LOCUS_24630 4450 4572 gene locus_tag LOCUS_24640 4450 4572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24640 >Feature sequence265 594 668 gene locus_tag LOCUS_t00170 594 668 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 700 957 gene locus_tag LOCUS_24650 700 957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24650 1105 986 gene locus_tag LOCUS_24660 1105 986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24660 1490 1086 gene locus_tag LOCUS_24670 1490 1086 CDS product phage holin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198632.1 protein_id gnl|my_center|LOCUS_24670 2306 1683 gene locus_tag LOCUS_24680 2306 1683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24680 2797 3549 gene locus_tag LOCUS_24690 2797 3549 CDS product NAD-dependent protein deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967135.1 protein_id gnl|my_center|LOCUS_24690 >Feature sequence266 262 486 gene locus_tag LOCUS_24700 262 486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24700 645 854 gene locus_tag LOCUS_24710 645 854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24710 854 1231 gene locus_tag LOCUS_24720 854 1231 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868296.1 protein_id gnl|my_center|LOCUS_24720 1508 1732 gene locus_tag LOCUS_24730 1508 1732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24730 >Feature sequence267 388 1500 gene locus_tag LOCUS_24740 388 1500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24740 2042 3301 gene locus_tag LOCUS_24750 2042 3301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24750 3722 4525 gene locus_tag LOCUS_24760 3722 4525 CDS product sulfide/dihydroorotate dehydrogenase-like FAD/NAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393027.1 protein_id gnl|my_center|LOCUS_24760 >Feature sequence268 497 1516 gene locus_tag LOCUS_24770 497 1516 CDS product RNA ligase (ATP) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189831439.1 protein_id gnl|my_center|LOCUS_24770 3367 2693 gene locus_tag LOCUS_24780 3367 2693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24780 3377 4108 gene locus_tag LOCUS_24790 3377 4108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24790 4125 4412 gene locus_tag LOCUS_24800 4125 4412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24800 >Feature sequence269 1790 762 gene locus_tag LOCUS_24810 1790 762 CDS product nitronate monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582795.1 protein_id gnl|my_center|LOCUS_24810 2736 2188 gene locus_tag LOCUS_24820 2736 2188 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940892.1 protein_id gnl|my_center|LOCUS_24820 4087 3176 gene locus_tag LOCUS_24830 4087 3176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24830 >Feature sequence270 46 4686 gene locus_tag LOCUS_24840 46 4686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24840 >Feature sequence271 1198 986 gene locus_tag LOCUS_24850 1198 986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_24850 1631 1200 gene locus_tag LOCUS_24860 1631 1200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_24860 2109 1549 gene locus_tag LOCUS_24870 2109 1549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_24870 2286 2137 gene locus_tag LOCUS_24880 2286 2137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24880 4036 2330 gene locus_tag LOCUS_24890 4036 2330 CDS product GspE/PulE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938568.1 protein_id gnl|my_center|LOCUS_24890 >Feature sequence272 1359 340 gene locus_tag LOCUS_24900 1359 340 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102158.1 protein_id gnl|my_center|LOCUS_24900 3316 1466 gene locus_tag LOCUS_24910 3316 1466 CDS product TRAP transporter fused permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261721.1 protein_id gnl|my_center|LOCUS_24910 4389 3346 gene locus_tag LOCUS_24920 4389 3346 CDS product TAXI family TRAP transporter solute-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878139.1 protein_id gnl|my_center|LOCUS_24920 4634 4491 gene locus_tag LOCUS_24930 4634 4491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24930 >Feature sequence273 772 443 gene locus_tag LOCUS_24940 772 443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24940 1304 873 gene locus_tag LOCUS_24950 1304 873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_24950 1592 1377 gene locus_tag LOCUS_24960 1592 1377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24960 1679 2134 gene locus_tag LOCUS_24970 1679 2134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_24970 2144 3049 gene locus_tag LOCUS_24980 2144 3049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_24980 3478 3720 gene locus_tag LOCUS_24990 3478 3720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24990 3827 4375 gene locus_tag LOCUS_25000 3827 4375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25000 4468 4620 gene locus_tag LOCUS_25010 4468 4620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_25010 >Feature sequence274 341 673 gene locus_tag LOCUS_25020 341 673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064500.1 protein_id gnl|my_center|LOCUS_25020 723 1784 gene locus_tag LOCUS_25030 gene hgcA 723 1784 CDS product mercury methylation corrinoid protein HgcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942086.1 protein_id gnl|my_center|LOCUS_25030 1797 2144 gene locus_tag LOCUS_25040 1797 2144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25040 2278 2922 gene locus_tag LOCUS_25050 2278 2922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25050 2983 3897 gene locus_tag LOCUS_25060 2983 3897 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783522.1 protein_id gnl|my_center|LOCUS_25060 >Feature sequence275 76 318 gene locus_tag LOCUS_25070 76 318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_25070 345 1190 gene locus_tag LOCUS_25080 gene tgt 345 1190 CDS product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943257.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_25080 1214 1534 gene locus_tag LOCUS_25090 gene yajC 1214 1534 CDS product preprotein translocase subunit YajC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943256.1 protein_id gnl|my_center|LOCUS_25090 1837 3324 gene locus_tag LOCUS_25100 gene secD 1837 3324 CDS product protein translocase subunit SecD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943255.1 protein_id gnl|my_center|LOCUS_25100 3372 4433 gene locus_tag LOCUS_25110 gene secF 3372 4433 CDS product protein translocase subunit SecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939105.1 protein_id gnl|my_center|LOCUS_25110 >Feature sequence276 958 344 gene locus_tag LOCUS_25120 958 344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_25120 1179 919 gene locus_tag LOCUS_25130 1179 919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25130 4270 1364 gene locus_tag LOCUS_25140 4270 1364 CDS product phosphoribosylformylglycinamidine synthase subunit PurS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942279.1 protein_id gnl|my_center|LOCUS_25140 >Feature sequence277 152 76 gene locus_tag LOCUS_t00180 152 76 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 494 171 gene locus_tag LOCUS_25150 494 171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_25150 1696 935 gene locus_tag LOCUS_25160 gene pyrE 1696 935 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963356.1 protein_id gnl|my_center|LOCUS_25160 2526 1693 gene locus_tag LOCUS_25170 2526 1693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25170 4273 2555 gene locus_tag LOCUS_25180 4273 2555 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942184.1 protein_id gnl|my_center|LOCUS_25180 >Feature sequence278 1253 177 gene locus_tag LOCUS_25190 1253 177 CDS product cysteine desulfurase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004552205.1 protein_id gnl|my_center|LOCUS_25190 1545 2570 gene locus_tag LOCUS_25200 1545 2570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_25200 2534 3775 gene locus_tag LOCUS_25210 2534 3775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_25210 >Feature sequence279 274 1299 gene locus_tag LOCUS_25220 274 1299 CDS product chemotaxis response regulator protein-glutamate methylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704959.1 protein_id gnl|my_center|LOCUS_25220 1555 1878 gene locus_tag LOCUS_25230 1555 1878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25230 2022 3413 gene locus_tag LOCUS_25240 gene flgK 2022 3413 CDS product flagellar hook-associated protein FlgK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943669.1 protein_id gnl|my_center|LOCUS_25240 >Feature sequence280 879 448 gene locus_tag LOCUS_25250 879 448 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546418.1 protein_id gnl|my_center|LOCUS_25250 1878 910 gene locus_tag LOCUS_25260 1878 910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_25260 2621 1851 gene locus_tag LOCUS_25270 2621 1851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_25270 4359 2680 gene locus_tag LOCUS_25280 4359 2680 CDS product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327432.1 protein_id gnl|my_center|LOCUS_25280 >Feature sequence281 <1 530 gene locus_tag LOCUS_25290 <1 530 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010938240.1:insulinase family protein 653 1036 gene locus_tag LOCUS_25300 653 1036 CDS product polymer-forming cytoskeletal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000246073.1 protein_id gnl|my_center|LOCUS_25300 1495 1241 gene locus_tag LOCUS_25310 1495 1241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25310 1604 2071 gene locus_tag LOCUS_25320 1604 2071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25320 2101 2634 gene locus_tag LOCUS_25330 gene nuoE 2101 2634 CDS product NADH-quinone oxidoreductase subunit NuoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011343661.1 protein_id gnl|my_center|LOCUS_25330 2618 4546 gene locus_tag LOCUS_25340 gene nuoF 2618 4546 CDS product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082447.1 protein_id gnl|my_center|LOCUS_25340 >Feature sequence282 1123 302 gene locus_tag LOCUS_25350 1123 302 CDS product NDP-sugar synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140474.1 protein_id gnl|my_center|LOCUS_25350 1711 2034 gene locus_tag LOCUS_25360 1711 2034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25360 2031 2297 gene locus_tag LOCUS_25370 2031 2297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25370 2494 2751 gene locus_tag LOCUS_25380 2494 2751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25380 2751 3170 gene locus_tag LOCUS_25390 2751 3170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25390 3830 4042 gene locus_tag LOCUS_25400 3830 4042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25400 >Feature sequence283 1613 579 gene locus_tag LOCUS_25410 gene mtaA 1613 579 CDS product methylcobamide:CoM methyltransferase MtaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021625.1 protein_id gnl|my_center|LOCUS_25410 4086 1804 gene locus_tag LOCUS_25420 4086 1804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25420 3979 4203 gene locus_tag LOCUS_25430 3979 4203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25430 >Feature sequence284 1740 316 gene locus_tag LOCUS_25440 gene purF 1740 316 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937472.1 protein_id gnl|my_center|LOCUS_25440 3038 1833 gene locus_tag LOCUS_25450 3038 1833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25450 3538 3164 gene locus_tag LOCUS_25460 3538 3164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25460 4508 3543 gene locus_tag LOCUS_25470 4508 3543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_25470 >Feature sequence285 1849 809 gene locus_tag LOCUS_25480 1849 809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25480 2755 2411 gene locus_tag LOCUS_25490 gene mazF9 2755 2411 CDS product type II toxin-antitoxin system toxin endoribonuclease MazF9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414166.1 protein_id gnl|my_center|LOCUS_25490 2966 2742 gene locus_tag LOCUS_25500 2966 2742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25500 3191 4477 gene locus_tag LOCUS_25510 3191 4477 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545078.1 protein_id gnl|my_center|LOCUS_25510 >Feature sequence286 585 1055 gene locus_tag LOCUS_25520 585 1055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_25520 1028 1207 gene locus_tag LOCUS_25530 1028 1207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_25530 1249 2529 gene locus_tag LOCUS_25540 gene thiC 1249 2529 CDS product phosphomethylpyrimidine synthase ThiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392914.1 protein_id gnl|my_center|LOCUS_25540 2650 3015 gene locus_tag LOCUS_25550 2650 3015 CDS product four helix bundle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405056.1 protein_id gnl|my_center|LOCUS_25550 4374 3193 gene locus_tag LOCUS_25560 4374 3193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25560 >Feature sequence287 482 715 gene locus_tag LOCUS_25570 482 715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25570 693 3179 gene locus_tag LOCUS_25580 gene fdhF 693 3179 CDS product formate dehydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_080510933.1 protein_id gnl|my_center|LOCUS_25580 <4442 3235 gene locus_tag LOCUS_25590 <4442 3235 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943991.1:Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB >Feature sequence288 460 308 gene locus_tag LOCUS_25600 460 308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25600 608 1150 gene locus_tag LOCUS_25610 608 1150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25610 1512 1847 gene locus_tag LOCUS_25620 1512 1847 CDS product STAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809935.1 protein_id gnl|my_center|LOCUS_25620 1967 2380 gene locus_tag LOCUS_25630 1967 2380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25630 2421 2648 gene locus_tag LOCUS_25640 2421 2648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25640 2958 3452 gene locus_tag LOCUS_25650 2958 3452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25650 <4411 3497 gene locus_tag LOCUS_25660 <4411 3497 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942246.1:ketoacyl-ACP synthase III >Feature sequence289 132 254 gene locus_tag LOCUS_25670 132 254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25670 337 513 gene locus_tag LOCUS_25680 337 513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25680 676 1299 gene locus_tag LOCUS_25690 676 1299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25690 1454 2152 gene locus_tag LOCUS_25700 1454 2152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25700 2432 3640 gene locus_tag LOCUS_25710 2432 3640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_25710 3538 4128 gene locus_tag LOCUS_25720 3538 4128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_25720 >Feature sequence290 1372 2784 gene locus_tag LOCUS_25730 1372 2784 CDS product IS1380 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064987376.1 protein_id gnl|my_center|LOCUS_25730 3136 3609 gene locus_tag LOCUS_25740 3136 3609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_25740 3636 4268 gene locus_tag LOCUS_25750 3636 4268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_25750 >Feature sequence291 2161 1289 gene locus_tag LOCUS_25760 2161 1289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25760 2771 3454 gene locus_tag LOCUS_25770 2771 3454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25770 <4377 3513 gene locus_tag LOCUS_25780 <4377 3513 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013226825.1:crotonase/enoyl-CoA hydratase family protein >Feature sequence292 468 1073 gene locus_tag LOCUS_25790 gene lexA 468 1073 CDS product transcriptional repressor LexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392634.1 protein_id gnl|my_center|LOCUS_25790 1581 1384 gene locus_tag LOCUS_25800 1581 1384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25800 1541 2533 gene locus_tag LOCUS_25810 gene dinB 1541 2533 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_087861794.1 protein_id gnl|my_center|LOCUS_25810 >Feature sequence293 404 1510 gene locus_tag LOCUS_25820 gene dprA 404 1510 CDS product DNA-processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943186.1 protein_id gnl|my_center|LOCUS_25820 1578 4172 gene locus_tag LOCUS_25830 gene topA 1578 4172 CDS product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931749.1 protein_id gnl|my_center|LOCUS_25830 >Feature sequence294 883 53 gene locus_tag LOCUS_25840 883 53 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066246.1 protein_id gnl|my_center|LOCUS_25840 1200 922 gene locus_tag LOCUS_25850 1200 922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25850 2944 1742 gene locus_tag LOCUS_25860 gene orpR 2944 1742 CDS product sigma 54-interacting transcriptional regulator OrpR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939383.1 protein_id gnl|my_center|LOCUS_25860 3413 3252 gene locus_tag LOCUS_25870 3413 3252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25870 3990 3466 gene locus_tag LOCUS_25880 3990 3466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25880 >Feature sequence295 2201 1764 gene locus_tag LOCUS_25890 2201 1764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_25890 2800 2117 gene locus_tag LOCUS_25900 2800 2117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_25900 3591 2803 gene locus_tag LOCUS_25910 3591 2803 CDS product short-chain-enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965999.1 protein_id gnl|my_center|LOCUS_25910 <4309 3698 gene locus_tag LOCUS_25920 <4309 3698 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010878693.1:acetyl-CoA C-acetyltransferase >Feature sequence296 432 145 gene locus_tag LOCUS_25930 432 145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25930 637 437 gene locus_tag LOCUS_25940 637 437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25940 1082 714 gene locus_tag LOCUS_25950 1082 714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25950 4029 1054 gene locus_tag LOCUS_25960 4029 1054 CDS product helicase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_204874017.1 protein_id gnl|my_center|LOCUS_25960 >Feature sequence297 409 1227 gene locus_tag LOCUS_25970 409 1227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25970 2935 1262 gene locus_tag LOCUS_25980 2935 1262 CDS product adenylate/guanylate cyclase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164924872.1 protein_id gnl|my_center|LOCUS_25980 3308 3012 gene locus_tag LOCUS_25990 3308 3012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_25990 >Feature sequence298 1945 1559 gene locus_tag LOCUS_26000 1945 1559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26000 <4191 1971 gene locus_tag LOCUS_26010 <4191 1971 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011074152.1:pitrilysin family protein >Feature sequence299 385 1317 gene locus_tag LOCUS_26020 gene amrS 385 1317 CDS product AmmeMemoRadiSam system radical SAM enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867880.1 protein_id gnl|my_center|LOCUS_26020 2399 1350 gene locus_tag LOCUS_26030 2399 1350 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545758.1 protein_id gnl|my_center|LOCUS_26030 2683 3498 gene locus_tag LOCUS_26040 2683 3498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26040 >Feature sequence300 <1 982 gene locus_tag LOCUS_26050 <1 982 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942386.1:exopolyphosphatase 975 2438 gene locus_tag LOCUS_26060 gene guaB 975 2438 CDS product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942835.1 protein_id gnl|my_center|LOCUS_26060 2749 3456 gene locus_tag LOCUS_26070 2749 3456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_26070 3453 3902 gene locus_tag LOCUS_26080 3453 3902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_26080 3887 4117 gene locus_tag LOCUS_26090 3887 4117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26090 >Feature sequence301 1098 121 gene locus_tag LOCUS_26100 1098 121 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941971.1 protein_id gnl|my_center|LOCUS_26100 2474 1254 gene locus_tag LOCUS_26110 gene rimO 2474 1254 CDS product 30S ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943823.1 protein_id gnl|my_center|LOCUS_26110 3171 2695 gene locus_tag LOCUS_26120 3171 2695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26120 >Feature sequence302 98 223 gene locus_tag LOCUS_26130 98 223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26130 344 2449 gene locus_tag LOCUS_26140 344 2449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26140 2873 2409 gene locus_tag LOCUS_26150 2873 2409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26150 3884 3474 gene locus_tag LOCUS_26160 3884 3474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26160 >Feature sequence303 <1 711 gene locus_tag LOCUS_26170 <1 711 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_051618802.1:ABC transporter ATP-binding protein 741 1721 gene locus_tag LOCUS_26180 741 1721 CDS product dipeptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014519085.1 protein_id gnl|my_center|LOCUS_26180 1768 1841 gene locus_tag LOCUS_t00190 1768 1841 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 1919 1994 gene locus_tag LOCUS_t00200 1919 1994 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 2407 3009 gene locus_tag LOCUS_26190 2407 3009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26190 3051 3287 gene locus_tag LOCUS_26200 3051 3287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26200 3479 3787 gene locus_tag LOCUS_26210 3479 3787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26210 3774 4115 gene locus_tag LOCUS_26220 3774 4115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26220 >Feature sequence304 221 2896 gene locus_tag LOCUS_26230 221 2896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26230 2889 3800 gene locus_tag LOCUS_26240 2889 3800 CDS product 3-methyl-2-oxobutanoate dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868480.1 protein_id gnl|my_center|LOCUS_26240 >Feature sequence305 366 1268 gene locus_tag LOCUS_26250 366 1268 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546439.1 protein_id gnl|my_center|LOCUS_26250 1586 1804 gene locus_tag LOCUS_26260 1586 1804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26260 1779 2348 gene locus_tag LOCUS_26270 1779 2348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26270 2350 2739 gene locus_tag LOCUS_26280 2350 2739 CDS product NifB/NifX family molybdenum-iron cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870084.1 protein_id gnl|my_center|LOCUS_26280 2779 3231 gene locus_tag LOCUS_26290 2779 3231 CDS product iron-sulfur cluster assembly scaffold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880545.1 protein_id gnl|my_center|LOCUS_26290 3231 3590 gene locus_tag LOCUS_26300 3231 3590 CDS product NifB/NifX family molybdenum-iron cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939385.1 protein_id gnl|my_center|LOCUS_26300 3663 3908 gene locus_tag LOCUS_26310 3663 3908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26310 >Feature sequence306 1039 440 gene locus_tag LOCUS_26320 1039 440 CDS product SagB/ThcOx family dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249791.1 protein_id gnl|my_center|LOCUS_26320 1622 1287 gene locus_tag LOCUS_26330 1622 1287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26330 1957 1619 gene locus_tag LOCUS_26340 1957 1619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26340 2190 3320 gene locus_tag LOCUS_26350 2190 3320 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001129615.1 protein_id gnl|my_center|LOCUS_26350 4012 3632 gene locus_tag LOCUS_26360 4012 3632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26360 >Feature sequence307 <1 1227 gene locus_tag LOCUS_26370 <1 1227 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005808174.1:sigma-54 dependent transcriptional regulator 1224 1796 gene locus_tag LOCUS_26380 1224 1796 CDS product archaemetzincin family Zn-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584147.1 protein_id gnl|my_center|LOCUS_26380 2734 1805 gene locus_tag LOCUS_26390 2734 1805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26390 3654 2782 gene locus_tag LOCUS_26400 3654 2782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26400 3785 3648 gene locus_tag LOCUS_26410 3785 3648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26410 >Feature sequence308 87 314 gene locus_tag LOCUS_26420 87 314 CDS product DUF433 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391714.1 protein_id gnl|my_center|LOCUS_26420 331 588 gene locus_tag LOCUS_26430 331 588 CDS product UPF0175 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142654.1 protein_id gnl|my_center|LOCUS_26430 578 1078 gene locus_tag LOCUS_26440 578 1078 CDS product DUF3368 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878102.1 protein_id gnl|my_center|LOCUS_26440 1171 3999 gene locus_tag LOCUS_26450 1171 3999 CDS product DUF499 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228376.1 protein_id gnl|my_center|LOCUS_26450 >Feature sequence309 1299 124 gene locus_tag LOCUS_26460 gene nifS 1299 124 CDS product cysteine desulfurase NifS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583089.1 protein_id gnl|my_center|LOCUS_26460 1560 1315 gene locus_tag LOCUS_26470 1560 1315 CDS product sulfurtransferase TusA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391974.1 protein_id gnl|my_center|LOCUS_26470 2663 1743 gene locus_tag LOCUS_26480 gene cysK 2663 1743 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022680.1 protein_id gnl|my_center|LOCUS_26480 3490 2669 gene locus_tag LOCUS_26490 3490 2669 CDS product serine acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120272.1 protein_id gnl|my_center|LOCUS_26490 3549 3743 gene locus_tag LOCUS_26500 3549 3743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26500 >Feature sequence310 2165 285 gene locus_tag LOCUS_26510 2165 285 CDS product heterodisulfide reductase-related iron-sulfur binding cluster inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878258.1 protein_id gnl|my_center|LOCUS_26510 3186 2605 gene locus_tag LOCUS_26520 3186 2605 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810741.1 protein_id gnl|my_center|LOCUS_26520 3599 3847 gene locus_tag LOCUS_26530 3599 3847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26530 >Feature sequence311 3480 241 gene locus_tag LOCUS_26540 3480 241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26540 4031 3956 gene locus_tag LOCUS_t00210 4031 3956 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence312 2161 431 gene locus_tag LOCUS_26550 2161 431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_26550 3128 2193 gene locus_tag LOCUS_26560 3128 2193 CDS product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256169.1 protein_id gnl|my_center|LOCUS_26560 3997 3155 gene locus_tag LOCUS_26570 3997 3155 CDS product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583151.1 protein_id gnl|my_center|LOCUS_26570 >Feature sequence313 819 412 gene locus_tag LOCUS_26580 819 412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26580 1013 816 gene locus_tag LOCUS_26590 1013 816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26590 2994 2053 gene locus_tag LOCUS_26600 2994 2053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26600 <4054 3385 gene locus_tag LOCUS_26610 <4054 3385 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000573847.1:DNA cytosine methyltransferase >Feature sequence314 3679 1247 gene locus_tag LOCUS_26620 3679 1247 CDS product 3-hydroxyacyl-CoA dehydrogenase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000486386.1 protein_id gnl|my_center|LOCUS_26620 >Feature sequence315 1660 785 gene locus_tag LOCUS_26630 1660 785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26630 1854 1669 gene locus_tag LOCUS_26640 1854 1669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26640 2410 3789 gene locus_tag LOCUS_26650 gene mgtE 2410 3789 CDS product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870202.1 protein_id gnl|my_center|LOCUS_26650 >Feature sequence316 2698 1388 gene locus_tag LOCUS_26660 2698 1388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_26660 3945 2704 gene locus_tag LOCUS_26670 3945 2704 CDS product DNA repair exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389026.1 protein_id gnl|my_center|LOCUS_26670 >Feature sequence317 75 884 gene locus_tag LOCUS_26680 75 884 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000939802.1 protein_id gnl|my_center|LOCUS_26680 888 3044 gene locus_tag LOCUS_26690 888 3044 CDS product acetate--CoA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071541107.1 protein_id gnl|my_center|LOCUS_26690 >Feature sequence318 20 979 gene locus_tag LOCUS_26700 gene pdhA 20 979 CDS product pyruvate dehydrogenase (acetyl-transferring) E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949161.1 protein_id gnl|my_center|LOCUS_26700 1063 2139 gene locus_tag LOCUS_26710 1063 2139 CDS product alpha-ketoacid dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004453964.1 protein_id gnl|my_center|LOCUS_26710 2190 3527 gene locus_tag LOCUS_26720 2190 3527 CDS product dihydrolipoamide acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002309917.1 protein_id gnl|my_center|LOCUS_26720 >Feature sequence319 965 459 gene locus_tag LOCUS_26730 965 459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_26730 2113 1016 gene locus_tag LOCUS_26740 2113 1016 CDS product mechanosensitive ion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870654.1 protein_id gnl|my_center|LOCUS_26740 4018 2300 gene locus_tag LOCUS_26750 4018 2300 CDS product hydantoinase B/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226376432.1 protein_id gnl|my_center|LOCUS_26750 >Feature sequence320 549 3857 gene locus_tag LOCUS_26760 549 3857 CDS product N-6 DNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048053708.1 protein_id gnl|my_center|LOCUS_26760 >Feature sequence321 1 177 gene locus_tag LOCUS_26770 1 177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26770 623 2101 gene locus_tag LOCUS_26780 623 2101 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028668529.1 protein_id gnl|my_center|LOCUS_26780 2233 3834 gene locus_tag LOCUS_26790 2233 3834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26790 >Feature sequence322 517 389 gene locus_tag LOCUS_26800 517 389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26800 687 538 gene locus_tag LOCUS_26810 687 538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26810 896 699 gene locus_tag LOCUS_26820 896 699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26820 1327 1668 gene locus_tag LOCUS_26830 1327 1668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26830 1684 1947 gene locus_tag LOCUS_26840 1684 1947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26840 1905 2357 gene locus_tag LOCUS_26850 1905 2357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26850 2327 2548 gene locus_tag LOCUS_26860 2327 2548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26860 3639 2545 gene locus_tag LOCUS_26870 3639 2545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26870 >Feature sequence323 448 957 gene locus_tag LOCUS_26880 448 957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26880 959 1444 gene locus_tag LOCUS_26890 959 1444 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837364.1 protein_id gnl|my_center|LOCUS_26890 >Feature sequence324 2210 1728 gene locus_tag LOCUS_26900 gene nuoE 2210 1728 CDS product NADH-quinone oxidoreductase subunit NuoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011343661.1 protein_id gnl|my_center|LOCUS_26900 2495 2316 gene locus_tag LOCUS_26910 2495 2316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_26910 2711 2532 gene locus_tag LOCUS_26920 2711 2532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_26920 2975 3478 gene locus_tag LOCUS_26930 2975 3478 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391977.1 protein_id gnl|my_center|LOCUS_26930 >Feature sequence325 551 276 gene locus_tag LOCUS_26940 551 276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26940 913 551 gene locus_tag LOCUS_26950 913 551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26950 1553 2383 gene locus_tag LOCUS_26960 1553 2383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26960 2519 3172 gene locus_tag LOCUS_26970 2519 3172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26970 3232 3555 gene locus_tag LOCUS_26980 3232 3555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_26980 >Feature sequence326 370 397 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 859 1218 gene locus_tag LOCUS_26990 859 1218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_26990 1202 1339 gene locus_tag LOCUS_27000 1202 1339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27000 >Feature sequence327 280 74 gene locus_tag LOCUS_27010 280 74 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27010 539 285 gene locus_tag LOCUS_27020 539 285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27020 888 1169 gene locus_tag LOCUS_27030 888 1169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_27030 1391 1176 gene locus_tag LOCUS_27040 gene infA 1391 1176 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327290.1 protein_id gnl|my_center|LOCUS_27040 1734 2342 gene locus_tag LOCUS_27050 1734 2342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27050 2482 3525 gene locus_tag LOCUS_27060 2482 3525 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792562.1 protein_id gnl|my_center|LOCUS_27060 3652 3518 gene locus_tag LOCUS_27070 3652 3518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27070 >Feature sequence328 1395 685 gene locus_tag LOCUS_27080 1395 685 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004523242.1 protein_id gnl|my_center|LOCUS_27080 2243 2581 gene locus_tag LOCUS_27090 2243 2581 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879039.1 protein_id gnl|my_center|LOCUS_27090 2738 3520 gene locus_tag LOCUS_27100 2738 3520 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022984.1 protein_id gnl|my_center|LOCUS_27100 >Feature sequence329 41 2818 gene locus_tag LOCUS_27110 41 2818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27110 >Feature sequence330 919 1155 gene locus_tag LOCUS_27120 919 1155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27120 1152 1592 gene locus_tag LOCUS_27130 1152 1592 CDS product putative toxin-antitoxin system toxin component, PIN family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140283.1 protein_id gnl|my_center|LOCUS_27130 1686 2759 gene locus_tag LOCUS_27140 1686 2759 CDS product aryl-sulfate sulfotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808599.1 protein_id gnl|my_center|LOCUS_27140 2756 3334 gene locus_tag LOCUS_27150 2756 3334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27150 >Feature sequence331 414 1289 gene locus_tag LOCUS_27160 414 1289 CDS product methylenetetrahydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436920.1 protein_id gnl|my_center|LOCUS_27160 1312 1503 gene locus_tag LOCUS_27170 1312 1503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_27170 >Feature sequence332 23 181 gene locus_tag LOCUS_27180 23 181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27180 339 1382 gene locus_tag LOCUS_27190 gene prfA 339 1382 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393874.1 protein_id gnl|my_center|LOCUS_27190 1372 2262 gene locus_tag LOCUS_27200 gene prmC 1372 2262 CDS product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943724.1 protein_id gnl|my_center|LOCUS_27200 3073 2267 gene locus_tag LOCUS_27210 3073 2267 CDS product nitrilase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868514.1 protein_id gnl|my_center|LOCUS_27210 3843 3226 gene locus_tag LOCUS_27220 3843 3226 CDS product DUF2284 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024115.1 protein_id gnl|my_center|LOCUS_27220 >Feature sequence333 360 494 gene locus_tag LOCUS_27230 360 494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27230 563 733 gene locus_tag LOCUS_27240 563 733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_27240 836 979 gene locus_tag LOCUS_27250 836 979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27250 976 1575 gene locus_tag LOCUS_27260 976 1575 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530520.1 protein_id gnl|my_center|LOCUS_27260 1654 1992 gene locus_tag LOCUS_27270 1654 1992 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544974.1 protein_id gnl|my_center|LOCUS_27270 2025 3590 gene locus_tag LOCUS_27280 2025 3590 CDS product GAF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877215.1 protein_id gnl|my_center|LOCUS_27280 >Feature sequence334 2154 220 gene locus_tag LOCUS_27290 2154 220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27290 2461 2114 gene locus_tag LOCUS_27300 2461 2114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_27300 2825 2511 gene locus_tag LOCUS_27310 2825 2511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_27310 3033 2857 gene locus_tag LOCUS_27320 3033 2857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27320 3703 3224 gene locus_tag LOCUS_27330 3703 3224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27330 >Feature sequence335 657 959 gene locus_tag LOCUS_27340 657 959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27340 2042 1284 gene locus_tag LOCUS_27350 2042 1284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27350 2542 2129 gene locus_tag LOCUS_27360 2542 2129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27360 3390 2479 gene locus_tag LOCUS_27370 3390 2479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27370 3691 3503 gene locus_tag LOCUS_27380 3691 3503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27380 >Feature sequence336 493 954 gene locus_tag LOCUS_27390 493 954 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941779.1 protein_id gnl|my_center|LOCUS_27390 965 1210 gene locus_tag LOCUS_27400 965 1210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27400 1253 1459 gene locus_tag LOCUS_27410 1253 1459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27410 1574 2293 gene locus_tag LOCUS_27420 1574 2293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_except (pos:1826..1828,aa:Sec) note codon on position 85 is selenocysteine opal codon. protein_id gnl|my_center|LOCUS_27420 >Feature sequence337 1727 555 gene locus_tag LOCUS_27430 1727 555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27430 2396 1905 gene locus_tag LOCUS_27440 2396 1905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27440 2914 2597 gene locus_tag LOCUS_27450 2914 2597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_27450 3720 2857 gene locus_tag LOCUS_27460 3720 2857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_27460 >Feature sequence338 1621 506 gene locus_tag LOCUS_27470 gene mnmA 1621 506 CDS product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943205.1 protein_id gnl|my_center|LOCUS_27470 3071 1698 gene locus_tag LOCUS_27480 3071 1698 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108087.1 protein_id gnl|my_center|LOCUS_27480 3299 3078 gene locus_tag LOCUS_27490 3299 3078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27490 >Feature sequence339 2147 993 gene locus_tag LOCUS_27500 2147 993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27500 3278 2292 gene locus_tag LOCUS_27510 gene etfA 3278 2292 CDS product electron transfer flavoprotein subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398999.1 protein_id gnl|my_center|LOCUS_27510 <3817 3313 gene locus_tag LOCUS_27520 <3817 3313 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004398765.1:electron transfer flavoprotein subunit beta >Feature sequence340 150 425 gene locus_tag LOCUS_27530 150 425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27530 1337 927 gene locus_tag LOCUS_27540 1337 927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27540 1734 1345 gene locus_tag LOCUS_27550 1734 1345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27550 3410 1731 gene locus_tag LOCUS_27560 3410 1731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27560 >Feature sequence341 38 400 gene locus_tag LOCUS_27570 38 400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_27570 402 1469 gene locus_tag LOCUS_27580 402 1469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_27580 1622 2968 gene locus_tag LOCUS_27590 gene acsC 1622 2968 CDS product acetyl-CoA decarbonylase/synthase complex subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392715.1 protein_id gnl|my_center|LOCUS_27590 >Feature sequence342 576 713 gene locus_tag LOCUS_27600 576 713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27600 734 1990 gene locus_tag LOCUS_27610 734 1990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_27610 1932 2264 gene locus_tag LOCUS_27620 1932 2264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_27620 2279 3463 gene locus_tag LOCUS_27630 2279 3463 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063921556.1 protein_id gnl|my_center|LOCUS_27630 >Feature sequence343 1044 742 gene locus_tag LOCUS_27640 1044 742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27640 1496 1059 gene locus_tag LOCUS_27650 gene flgC 1496 1059 CDS product flagellar basal body rod protein FlgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941076.1 protein_id gnl|my_center|LOCUS_27650 1918 1499 gene locus_tag LOCUS_27660 gene flgB 1918 1499 CDS product flagellar basal body rod protein FlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546345.1 protein_id gnl|my_center|LOCUS_27660 3621 2272 gene locus_tag LOCUS_27670 3621 2272 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028842237.1 protein_id gnl|my_center|LOCUS_27670 >Feature sequence344 290 102 gene locus_tag LOCUS_27680 290 102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27680 3276 436 gene locus_tag LOCUS_27690 3276 436 CDS product DUF499 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228376.1 protein_id gnl|my_center|LOCUS_27690 >Feature sequence345 <1 1287 gene locus_tag LOCUS_27700 <1 1287 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012546530.1:RtcB family protein 1588 2745 gene locus_tag LOCUS_27710 1588 2745 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546471.1 protein_id gnl|my_center|LOCUS_27710 3235 2828 gene locus_tag LOCUS_27720 3235 2828 CDS product cobalamin B12-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942223.1 protein_id gnl|my_center|LOCUS_27720 >Feature sequence346 1225 1857 gene locus_tag LOCUS_27730 1225 1857 CDS product CBS and ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815172.1 protein_id gnl|my_center|LOCUS_27730 2942 1872 gene locus_tag LOCUS_27740 gene wtpC 2942 1872 CDS product tungstate ABC transporter ATP-binding protein WtpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867278.1 protein_id gnl|my_center|LOCUS_27740 <3689 2939 gene locus_tag LOCUS_27750 <3689 2939 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011020339.1:ABC transporter permease >Feature sequence347 1130 84 gene locus_tag LOCUS_27760 1130 84 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27760 1557 1081 gene locus_tag LOCUS_27770 1557 1081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27770 2081 2209 gene locus_tag LOCUS_27780 2081 2209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27780 2686 2312 gene locus_tag LOCUS_27790 2686 2312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27790 <3688 2702 gene locus_tag LOCUS_27800 <3688 2702 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012258276.1:tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB >Feature sequence348 2 1915 gene locus_tag LOCUS_27810 2 1915 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004455018.1 protein_id gnl|my_center|LOCUS_27810 2054 2248 gene locus_tag LOCUS_27820 2054 2248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27820 2789 2187 gene locus_tag LOCUS_27830 2789 2187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27830 <3672 2782 gene locus_tag LOCUS_27840 <3672 2782 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010947446.1:type I methionyl aminopeptidase >Feature sequence349 232 1311 gene locus_tag LOCUS_27850 232 1311 CDS product 3-methyl-2-oxobutanoate dehydrogenase subunit VorB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869339.1 protein_id gnl|my_center|LOCUS_27850 1315 2070 gene locus_tag LOCUS_27860 1315 2070 CDS product thiamine pyrophosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546413.1 protein_id gnl|my_center|LOCUS_27860 2086 2637 gene locus_tag LOCUS_27870 2086 2637 CDS product 2-oxoacid:acceptor oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869337.1 protein_id gnl|my_center|LOCUS_27870 2634 2999 gene locus_tag LOCUS_27880 2634 2999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27880 <3661 3084 gene locus_tag LOCUS_27890 <3661 3084 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004080707.1:pyruvate kinase alpha/beta domain-containing protein >Feature sequence350 >Feature sequence351 1561 728 gene locus_tag LOCUS_27900 1561 728 CDS product stage 0 sporulation family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404857.1 protein_id gnl|my_center|LOCUS_27900 2674 1619 gene locus_tag LOCUS_27910 gene holB 2674 1619 CDS product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942870.1 protein_id gnl|my_center|LOCUS_27910 3428 2802 gene locus_tag LOCUS_27920 gene tmk 3428 2802 CDS product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942869.1 protein_id gnl|my_center|LOCUS_27920 >Feature sequence352 2077 248 gene locus_tag LOCUS_27930 gene aspS 2077 248 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000840895.1 protein_id gnl|my_center|LOCUS_27930 <3641 2364 gene locus_tag LOCUS_27940 <3641 2364 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942303.1:histidine--tRNA ligase >Feature sequence353 1 540 gene locus_tag LOCUS_27950 1 540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27950 1049 1762 gene locus_tag LOCUS_27960 1049 1762 CDS product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005063534.1 protein_id gnl|my_center|LOCUS_27960 1986 2996 gene locus_tag LOCUS_27970 1986 2996 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878758.1 protein_id gnl|my_center|LOCUS_27970 >Feature sequence354 512 1675 gene locus_tag LOCUS_27980 512 1675 CDS product isovaleryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483372.1 protein_id gnl|my_center|LOCUS_27980 1710 3443 gene locus_tag LOCUS_27990 1710 3443 CDS product carboxyl transferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902654.1 protein_id gnl|my_center|LOCUS_27990 >Feature sequence355 53 2947 gene locus_tag LOCUS_28000 53 2947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_except (pos:242..244,aa:Sec) note codon on position 64 is selenocysteine opal codon. protein_id gnl|my_center|LOCUS_28000 2892 3305 gene locus_tag LOCUS_28010 2892 3305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_28010 >Feature sequence356 >Feature sequence357 131 1192 gene locus_tag LOCUS_28020 131 1192 CDS product 3-methyl-2-oxobutanoate dehydrogenase subunit VorB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942506.1 protein_id gnl|my_center|LOCUS_28020 1193 1933 gene locus_tag LOCUS_28030 1193 1933 CDS product thiamine pyrophosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942505.1 protein_id gnl|my_center|LOCUS_28030 1933 3231 gene locus_tag LOCUS_28040 1933 3231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28040 >Feature sequence358 <1 1092 gene locus_tag LOCUS_28050 <1 1092 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010940474.1:PAS domain-containing sensor histidine kinase 1089 2981 gene locus_tag LOCUS_28060 1089 2981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_28060 3056 3442 gene locus_tag LOCUS_28070 3056 3442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_28070 >Feature sequence359 446 856 gene locus_tag LOCUS_28080 446 856 CDS product F0F1 ATP synthase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938075.1 protein_id gnl|my_center|LOCUS_28080 978 1217 gene locus_tag LOCUS_28090 978 1217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28090 1244 1525 gene locus_tag LOCUS_28100 1244 1525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28100 2035 3438 gene locus_tag LOCUS_28110 gene rny 2035 3438 CDS product ribonuclease Y inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941798.1 protein_id gnl|my_center|LOCUS_28110 >Feature sequence360 1621 1830 gene locus_tag LOCUS_28120 1621 1830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28120 1986 2357 gene locus_tag LOCUS_28130 1986 2357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28130 >Feature sequence361 1886 213 gene locus_tag LOCUS_28140 1886 213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28140 2230 1904 gene locus_tag LOCUS_28150 2230 1904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28150 2600 2860 gene locus_tag LOCUS_28160 2600 2860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28160 2901 3122 gene locus_tag LOCUS_28170 2901 3122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28170 >Feature sequence362 1 1179 gene locus_tag LOCUS_28180 1 1179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28180 1176 2120 gene locus_tag LOCUS_28190 1176 2120 CDS product xanthine dehydrogenase family protein subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975841.1 protein_id gnl|my_center|LOCUS_28190 2117 2590 gene locus_tag LOCUS_28200 2117 2590 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062284418.1 protein_id gnl|my_center|LOCUS_28200 >Feature sequence363 1526 2581 gene locus_tag LOCUS_28210 gene purM 1526 2581 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942402.1 protein_id gnl|my_center|LOCUS_28210 2553 3089 gene locus_tag LOCUS_28220 2553 3089 CDS product DUF523 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009932058.1 protein_id gnl|my_center|LOCUS_28220 3101 3394 gene locus_tag LOCUS_28230 3101 3394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28230 >Feature sequence364 939 499 gene locus_tag LOCUS_28240 939 499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28240 1952 1098 gene locus_tag LOCUS_28250 1952 1098 CDS product 3-hydroxybutyryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965995.1 protein_id gnl|my_center|LOCUS_28250 2299 1958 gene locus_tag LOCUS_28260 2299 1958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_28260 2975 2220 gene locus_tag LOCUS_28270 2975 2220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_28270 3174 2995 gene locus_tag LOCUS_28280 3174 2995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_28280 3296 3177 gene locus_tag LOCUS_28290 3296 3177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28290 >Feature sequence365 1818 124 gene locus_tag LOCUS_28300 1818 124 CDS product AarF/UbiB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941749.1 protein_id gnl|my_center|LOCUS_28300 2771 1794 gene locus_tag LOCUS_28310 gene rssA 2771 1794 CDS product patatin-like phospholipase RssA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005169303.1 protein_id gnl|my_center|LOCUS_28310 3088 2786 gene locus_tag LOCUS_28320 3088 2786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28320 3329 3165 gene locus_tag LOCUS_28330 3329 3165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28330 >Feature sequence366 642 157 gene locus_tag LOCUS_28340 642 157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28340 987 670 gene locus_tag LOCUS_28350 987 670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28350 1927 1064 gene locus_tag LOCUS_28360 1927 1064 CDS product HDOD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869527.1 protein_id gnl|my_center|LOCUS_28360 2397 1924 gene locus_tag LOCUS_28370 2397 1924 CDS product chemotaxis protein CheD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868668.1 protein_id gnl|my_center|LOCUS_28370 3244 2591 gene locus_tag LOCUS_28380 3244 2591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28380 >Feature sequence367 140 916 gene locus_tag LOCUS_28390 140 916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28390 2243 927 gene locus_tag LOCUS_28400 2243 927 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808174.1 protein_id gnl|my_center|LOCUS_28400 3076 3300 gene locus_tag LOCUS_28410 3076 3300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28410 >Feature sequence368 1035 874 gene locus_tag LOCUS_28420 1035 874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28420 2849 1065 gene locus_tag LOCUS_28430 2849 1065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28430 3459 3010 gene locus_tag LOCUS_28440 3459 3010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28440 >Feature sequence369 1310 252 gene locus_tag LOCUS_28450 1310 252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28450 1935 2633 gene locus_tag LOCUS_28460 1935 2633 CDS product CBS and ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080265.1 protein_id gnl|my_center|LOCUS_28460 >Feature sequence370 1039 116 gene locus_tag LOCUS_28470 gene trxB 1039 116 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393897.1 protein_id gnl|my_center|LOCUS_28470 2648 1260 gene locus_tag LOCUS_28480 2648 1260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28480 2996 2679 gene locus_tag LOCUS_28490 2996 2679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28490 >Feature sequence371 498 292 gene locus_tag LOCUS_28500 498 292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28500 935 495 gene locus_tag LOCUS_28510 935 495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28510 1615 1193 gene locus_tag LOCUS_28520 1615 1193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28520 2375 1632 gene locus_tag LOCUS_28530 2375 1632 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942188.1 protein_id gnl|my_center|LOCUS_28530 2608 2480 gene locus_tag LOCUS_28540 2608 2480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28540 2952 2773 gene locus_tag LOCUS_28550 2952 2773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28550 3215 2970 gene locus_tag LOCUS_28560 3215 2970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28560 >Feature sequence372 597 163 gene locus_tag LOCUS_28570 597 163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28570 918 1970 gene locus_tag LOCUS_28580 gene hflK 918 1970 CDS product FtsH protease activity modulator HflK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678884.1 protein_id gnl|my_center|LOCUS_28580 1967 2899 gene locus_tag LOCUS_28590 1967 2899 CDS product protease modulator HflC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582429.1 protein_id gnl|my_center|LOCUS_28590 2924 3406 gene locus_tag LOCUS_28600 2924 3406 CDS product ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875801.1 protein_id gnl|my_center|LOCUS_28600 >Feature sequence373 <1 762 gene locus_tag LOCUS_28610 <1 762 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010964682.1:sirohydrochlorin cobaltochelatase 1485 814 gene locus_tag LOCUS_28620 gene cobI 1485 814 CDS product precorrin-2 C(20)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937949.1 protein_id gnl|my_center|LOCUS_28620 2338 1403 gene locus_tag LOCUS_28630 gene cobJ 2338 1403 CDS product precorrin-3B C(17)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940428.1 protein_id gnl|my_center|LOCUS_28630 3138 2239 gene locus_tag LOCUS_28640 3138 2239 CDS product cobalt-precorrin 5A hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943623.1 protein_id gnl|my_center|LOCUS_28640 >Feature sequence374 <1 901 gene locus_tag LOCUS_28650 <1 901 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_168188351.1:nucleotidyl transferase AbiEii/AbiGii toxin family protein 2236 1157 gene locus_tag LOCUS_28660 2236 1157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28660 2605 2312 gene locus_tag LOCUS_28670 2605 2312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28670 >Feature sequence375 1085 585 gene locus_tag LOCUS_28680 1085 585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28680 2003 1341 gene locus_tag LOCUS_28690 2003 1341 CDS product aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251082.1 protein_id gnl|my_center|LOCUS_28690 2159 2004 gene locus_tag LOCUS_28700 2159 2004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28700 2240 2395 gene locus_tag LOCUS_28710 2240 2395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28710 2554 3450 gene locus_tag LOCUS_28720 2554 3450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28720 >Feature sequence376 >Feature sequence377 2774 1791 gene locus_tag LOCUS_28730 2774 1791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28730 3108 2779 gene locus_tag LOCUS_28740 3108 2779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_28740 >Feature sequence378 64 429 gene locus_tag LOCUS_28750 gene dksA 64 429 CDS product RNA polymerase-binding protein DksA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940956.1 protein_id gnl|my_center|LOCUS_28750 645 1490 gene locus_tag LOCUS_28760 645 1490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_28760 1504 3258 gene locus_tag LOCUS_28770 1504 3258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_28770 >Feature sequence379 <1 537 gene locus_tag LOCUS_28780 <1 537 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013384255.1:translational GTPase TypA 584 1009 gene locus_tag LOCUS_28790 584 1009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_28790 969 2117 gene locus_tag LOCUS_28800 969 2117 CDS product peptide chain release factor 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940375.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_28800 2440 3411 gene locus_tag LOCUS_28810 gene ychF 2440 3411 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921763.1 protein_id gnl|my_center|LOCUS_28810 >Feature sequence380 558 1013 gene locus_tag LOCUS_28820 558 1013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_28820 1019 1195 gene locus_tag LOCUS_28830 1019 1195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28830 1373 1744 gene locus_tag LOCUS_28840 1373 1744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_28840 1737 2546 gene locus_tag LOCUS_28850 1737 2546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_28850 >Feature sequence381 570 1907 gene locus_tag LOCUS_28860 570 1907 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940356.1 protein_id gnl|my_center|LOCUS_28860 2042 2698 gene locus_tag LOCUS_28870 gene ftsE 2042 2698 CDS product cell division ATP-binding protein FtsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942419.1 protein_id gnl|my_center|LOCUS_28870 >Feature sequence382 122 219 gene locus_tag LOCUS_t00220 122 219 tRNA product tRNA-SeC inference COORDINATES:profile:Aragorn:1.2.38 595 1674 gene locus_tag LOCUS_28880 595 1674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28880 3224 2289 gene locus_tag LOCUS_28890 3224 2289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28890 >Feature sequence383 622 65 gene locus_tag LOCUS_28900 622 65 CDS product Fe-S-containing hydro-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393765.1 protein_id gnl|my_center|LOCUS_28900 1573 731 gene locus_tag LOCUS_28910 1573 731 CDS product fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816933.1 protein_id gnl|my_center|LOCUS_28910 3385 1832 gene locus_tag LOCUS_28920 3385 1832 CDS product carboxyl transferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392670.1 protein_id gnl|my_center|LOCUS_28920 >Feature sequence384 467 72 gene locus_tag LOCUS_28930 467 72 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_28930 1104 448 gene locus_tag LOCUS_28940 1104 448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_28940 2014 1250 gene locus_tag LOCUS_28950 2014 1250 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022348.1 protein_id gnl|my_center|LOCUS_28950 >Feature sequence385 425 1417 gene locus_tag LOCUS_28960 gene dctP 425 1417 CDS product TRAP transporter substrate-binding protein DctP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808804.1 protein_id gnl|my_center|LOCUS_28960 1513 2028 gene locus_tag LOCUS_28970 1513 2028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28970 >Feature sequence386 2008 380 gene locus_tag LOCUS_28980 2008 380 CDS product ATP-dependent acyl-CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000892286.1 protein_id gnl|my_center|LOCUS_28980 2732 3247 gene locus_tag LOCUS_28990 gene cobO 2732 3247 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002666509.1 protein_id gnl|my_center|LOCUS_28990 >Feature sequence387 1477 578 gene locus_tag LOCUS_29000 gene ptb 1477 578 CDS product phosphate butyryltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966357.1 protein_id gnl|my_center|LOCUS_29000 2782 1589 gene locus_tag LOCUS_29010 2782 1589 CDS product acetate--CoA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867476.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_29010 2954 2760 gene locus_tag LOCUS_29020 2954 2760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29020 >Feature sequence388 647 393 gene locus_tag LOCUS_29030 647 393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29030 1031 765 gene locus_tag LOCUS_29040 1031 765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926944.1 protein_id gnl|my_center|LOCUS_29040 2174 1278 gene locus_tag LOCUS_29050 2174 1278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29050 2403 2179 gene locus_tag LOCUS_29060 2403 2179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29060 <3352 2422 gene locus_tag LOCUS_29070 <3352 2422 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010932548.1:FAD-dependent oxidoreductase >Feature sequence389 535 1701 gene locus_tag LOCUS_29080 535 1701 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941790.1 protein_id gnl|my_center|LOCUS_29080 >Feature sequence390 2109 307 gene locus_tag LOCUS_29090 gene lepA 2109 307 CDS product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957093.1 protein_id gnl|my_center|LOCUS_29090 2535 2191 gene locus_tag LOCUS_29100 2535 2191 CDS product type II toxin-antitoxin system PemK/MazF family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817423.1 protein_id gnl|my_center|LOCUS_29100 2773 2525 gene locus_tag LOCUS_29110 2773 2525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29110 >Feature sequence391 127 1788 gene locus_tag LOCUS_29120 127 1788 CDS product PAS domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940474.1 protein_id gnl|my_center|LOCUS_29120 1823 3127 gene locus_tag LOCUS_29130 1823 3127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29130 >Feature sequence392 2922 301 gene locus_tag LOCUS_29140 2922 301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29140 >Feature sequence393 596 132 gene locus_tag LOCUS_29150 596 132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_29150 2707 695 gene locus_tag LOCUS_29160 2707 695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_29160 >Feature sequence394 136 708 gene locus_tag LOCUS_29170 gene thiE 136 708 CDS product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256280.1 protein_id gnl|my_center|LOCUS_29170 705 1715 gene locus_tag LOCUS_29180 705 1715 CDS product DHH family phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937763.1 protein_id gnl|my_center|LOCUS_29180 1732 3099 gene locus_tag LOCUS_29190 gene mgtE 1732 3099 CDS product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404919.1 protein_id gnl|my_center|LOCUS_29190 >Feature sequence395 921 103 gene locus_tag LOCUS_29200 921 103 CDS product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939505.1 protein_id gnl|my_center|LOCUS_29200 1132 1725 gene locus_tag LOCUS_29210 1132 1725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29210 2052 3104 gene locus_tag LOCUS_29220 2052 3104 CDS product Coenzyme F420 hydrogenase/dehydrogenase, beta subunit C-terminal domain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024396.1 protein_id gnl|my_center|LOCUS_29220 >Feature sequence396 2 535 gene locus_tag LOCUS_29230 2 535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29230 495 1949 gene locus_tag LOCUS_29240 495 1949 CDS product 4-hydroxyphenylacetate 3-hydroxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064616.1 protein_id gnl|my_center|LOCUS_29240 1974 2699 gene locus_tag LOCUS_29250 gene radC 1974 2699 CDS product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073923.1 protein_id gnl|my_center|LOCUS_29250 >Feature sequence397 266 1738 gene locus_tag LOCUS_29260 266 1738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_223294578.1 protein_id gnl|my_center|LOCUS_29260 1748 2287 gene locus_tag LOCUS_29270 1748 2287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29270 2305 2829 gene locus_tag LOCUS_29280 2305 2829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29280 >Feature sequence398 1069 1683 gene locus_tag LOCUS_29290 1069 1683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29290 >Feature sequence399 <1 1638 gene locus_tag LOCUS_29300 <1 1638 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942688.1:valine--tRNA ligase 1631 2488 gene locus_tag LOCUS_29310 gene nadC 1631 2488 CDS product carboxylating nicotinate-nucleotide diphosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_067615902.1 protein_id gnl|my_center|LOCUS_29310 2485 2892 gene locus_tag LOCUS_29320 2485 2892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29320 2906 3037 gene locus_tag LOCUS_29330 2906 3037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29330 >Feature sequence400 1199 627 gene locus_tag LOCUS_29340 gene rfbC 1199 627 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143691.1 protein_id gnl|my_center|LOCUS_29340 2302 1430 gene locus_tag LOCUS_29350 gene rfbA 2302 1430 CDS product glucose-1-phosphate thymidylyltransferase RfbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000857508.1 protein_id gnl|my_center|LOCUS_29350 2914 2528 gene locus_tag LOCUS_29360 2914 2528 CDS product four helix bundle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870231.1 protein_id gnl|my_center|LOCUS_29360 >Feature sequence401 418 975 gene locus_tag LOCUS_29370 418 975 CDS product pyruvate/ketoisovalerate ferredoxin oxidoreductase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868483.1 protein_id gnl|my_center|LOCUS_29370 1161 2963 gene locus_tag LOCUS_29380 1161 2963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29380 >Feature sequence402 550 687 gene locus_tag LOCUS_29390 550 687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29390 2662 1946 gene locus_tag LOCUS_29400 2662 1946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29400 >Feature sequence403 663 1436 gene locus_tag LOCUS_29410 663 1436 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813226.1 protein_id gnl|my_center|LOCUS_29410 2179 1460 gene locus_tag LOCUS_29420 2179 1460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29420 <3182 2385 gene locus_tag LOCUS_29430 <3182 2385 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012545557.1:glycosyltransferase family 4 protein >Feature sequence404 197 69 gene locus_tag LOCUS_29440 197 69 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29440 1629 187 gene locus_tag LOCUS_29450 1629 187 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943698.1 protein_id gnl|my_center|LOCUS_29450 3177 1705 gene locus_tag LOCUS_29460 3177 1705 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943699.1 protein_id gnl|my_center|LOCUS_29460 >Feature sequence405 177 1298 gene locus_tag LOCUS_29470 177 1298 CDS product 2-oxoacid:acceptor oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939231.1 protein_id gnl|my_center|LOCUS_29470 1291 2592 gene locus_tag LOCUS_29480 1291 2592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29480 3162 2665 gene locus_tag LOCUS_29490 3162 2665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29490 >Feature sequence406 647 1801 gene locus_tag LOCUS_29500 gene acdB 647 1801 CDS product putative isocaproyl-CoA dehydrogenase AcdB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986694.1 protein_id gnl|my_center|LOCUS_29500 1836 2633 gene locus_tag LOCUS_29510 1836 2633 CDS product electron transfer flavoprotein subunit beta/FixA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546330.1 protein_id gnl|my_center|LOCUS_29510 >Feature sequence407 148 420 gene locus_tag LOCUS_29520 148 420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29520 435 878 gene locus_tag LOCUS_29530 435 878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29530 878 2143 gene locus_tag LOCUS_29540 878 2143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29540 2352 2939 gene locus_tag LOCUS_29550 2352 2939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29550 >Feature sequence408 192 16 gene locus_tag LOCUS_29560 192 16 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29560 127 705 gene locus_tag LOCUS_29570 127 705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29570 774 983 gene locus_tag LOCUS_29580 774 983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29580 1809 1261 gene locus_tag LOCUS_29590 1809 1261 CDS product small multi-drug export protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064945.1 protein_id gnl|my_center|LOCUS_29590 1983 2990 gene locus_tag LOCUS_29600 1983 2990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_29600 >Feature sequence409 2998 509 gene locus_tag LOCUS_29610 2998 509 CDS product vitamin B12-dependent ribonucleotide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164561900.1 protein_id gnl|my_center|LOCUS_29610 >Feature sequence410 397 194 gene locus_tag LOCUS_29620 397 194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_29620 1134 391 gene locus_tag LOCUS_29630 1134 391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_29630 <3133 1219 gene locus_tag LOCUS_29640 <3133 1219 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011391800.1:excinuclease ABC subunit UvrC >Feature sequence411 518 1201 gene locus_tag LOCUS_29650 518 1201 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392599.1 protein_id gnl|my_center|LOCUS_29650 2339 2677 gene locus_tag LOCUS_29660 2339 2677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29660 >Feature sequence412 36 2126 gene locus_tag LOCUS_29670 36 2126 CDS product ribonucleoside triphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392959.1 protein_id gnl|my_center|LOCUS_29670 2142 2840 gene locus_tag LOCUS_29680 2142 2840 CDS product anaerobic ribonucleoside-triphosphate reductase activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392958.1 protein_id gnl|my_center|LOCUS_29680 >Feature sequence413 920 147 gene locus_tag LOCUS_29690 920 147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29690 1938 1150 gene locus_tag LOCUS_29700 1938 1150 CDS product TIGR00266 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072060.1 protein_id gnl|my_center|LOCUS_29700 <3106 2496 gene locus_tag LOCUS_29710 <3106 2496 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011391964.1:3-oxoacyl-ACP reductase FabG >Feature sequence414 2869 893 gene locus_tag LOCUS_29720 gene acs 2869 893 CDS product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546141.1 protein_id gnl|my_center|LOCUS_29720 >Feature sequence415 <1 1491 gene locus_tag LOCUS_29730 <1 1491 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011073062.1:asparagine synthase (glutamine-hydrolyzing) 1532 2683 gene locus_tag LOCUS_29740 gene lptF 1532 2683 CDS product LPS export ABC transporter permease LptF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942567.1 protein_id gnl|my_center|LOCUS_29740 >Feature sequence416 >Feature sequence417 387 1712 gene locus_tag LOCUS_29750 387 1712 CDS product IS5 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_114714636.1 protein_id gnl|my_center|LOCUS_29750 1765 2082 gene locus_tag LOCUS_29760 1765 2082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29760 2214 2360 gene locus_tag LOCUS_29770 2214 2360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29770 >Feature sequence418 1748 1122 gene locus_tag LOCUS_29780 1748 1122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29780 2112 1720 gene locus_tag LOCUS_29790 2112 1720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29790 2830 2117 gene locus_tag LOCUS_29800 2830 2117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29800 >Feature sequence419 701 6 gene locus_tag LOCUS_29810 701 6 CDS product PIG-L family deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256262.1 protein_id gnl|my_center|LOCUS_29810 1564 746 gene locus_tag LOCUS_29820 1564 746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_29820 1982 1692 gene locus_tag LOCUS_29830 1982 1692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_29830 2307 2020 gene locus_tag LOCUS_29840 2307 2020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29840 >Feature sequence420 343 1860 gene locus_tag LOCUS_29850 343 1860 CDS product DUF1846 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357216.1 protein_id gnl|my_center|LOCUS_29850 2255 2830 gene locus_tag LOCUS_29860 2255 2830 CDS product TIGR00296 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023500.1 protein_id gnl|my_center|LOCUS_29860 >Feature sequence421 <1 543 gene locus_tag LOCUS_29870 <1 543 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012546455.1:argininosuccinate lyase 540 1043 gene locus_tag LOCUS_29880 540 1043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29880 1019 2230 gene locus_tag LOCUS_29890 gene lysA 1019 2230 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940834.1 protein_id gnl|my_center|LOCUS_29890 >Feature sequence422 877 35 gene locus_tag LOCUS_29900 877 35 CDS product sulfide/dihydroorotate dehydrogenase-like FAD/NAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868068.1 protein_id gnl|my_center|LOCUS_29900 2959 896 gene locus_tag LOCUS_29910 gene fdhF 2959 896 CDS product formate dehydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_080510933.1 protein_id gnl|my_center|LOCUS_29910 >Feature sequence423 378 1166 gene locus_tag LOCUS_29920 378 1166 CDS product type IV toxin-antitoxin system AbiEi family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_174408902.1 protein_id gnl|my_center|LOCUS_29920 1163 1732 gene locus_tag LOCUS_29930 1163 1732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_29930 1761 2021 gene locus_tag LOCUS_29940 1761 2021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_29940 2727 2981 gene locus_tag LOCUS_29950 2727 2981 CDS product UPF0175 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142654.1 protein_id gnl|my_center|LOCUS_29950 >Feature sequence424 387 76 gene locus_tag LOCUS_29960 387 76 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29960 1229 525 gene locus_tag LOCUS_29970 1229 525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29970 <3031 1226 gene locus_tag LOCUS_29980 <3031 1226 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002682356.1:elongation factor G >Feature sequence425 523 1398 gene locus_tag LOCUS_29990 523 1398 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259484.1 protein_id gnl|my_center|LOCUS_29990 1955 2881 gene locus_tag LOCUS_30000 1955 2881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30000 >Feature sequence426 110 1849 gene locus_tag LOCUS_30010 110 1849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30010 >Feature sequence427 782 21 gene locus_tag LOCUS_30020 782 21 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30020 2358 733 gene locus_tag LOCUS_30030 2358 733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30030 3016 2417 gene locus_tag LOCUS_30040 3016 2417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30040 >Feature sequence428 1614 604 gene locus_tag LOCUS_30050 1614 604 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257502.1 protein_id gnl|my_center|LOCUS_30050 2769 1666 gene locus_tag LOCUS_30060 2769 1666 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257503.1 protein_id gnl|my_center|LOCUS_30060 >Feature sequence429 1859 627 gene locus_tag LOCUS_30070 1859 627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30070 2324 1881 gene locus_tag LOCUS_30080 gene nuoE 2324 1881 CDS product NADH-quinone oxidoreductase subunit NuoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583281.1 protein_id gnl|my_center|LOCUS_30080 <2989 2326 gene locus_tag LOCUS_30090 <2989 2326 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012868906.1:NADH-dependent [FeFe] hydrogenase, group A6 >Feature sequence430 1318 1091 gene locus_tag LOCUS_30100 gene acpP 1318 1091 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005544465.1 protein_id gnl|my_center|LOCUS_30100 1885 1334 gene locus_tag LOCUS_30110 1885 1334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_30110 2060 1809 gene locus_tag LOCUS_30120 2060 1809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_30120 2971 2063 gene locus_tag LOCUS_30130 2971 2063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30130 >Feature sequence431 <2954 759 gene locus_tag LOCUS_30140 <2954 759 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_021760008.1:formate dehydrogenase-N subunit alpha >Feature sequence432 2435 402 gene locus_tag LOCUS_30150 2435 402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30150 2735 2517 gene locus_tag LOCUS_30160 2735 2517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30160 >Feature sequence433 492 698 gene locus_tag LOCUS_30170 492 698 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932357.1 protein_id gnl|my_center|LOCUS_30170 725 979 gene locus_tag LOCUS_30180 725 979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30180 976 1401 gene locus_tag LOCUS_30190 976 1401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30190 1401 1970 gene locus_tag LOCUS_30200 1401 1970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30200 >Feature sequence434 317 1282 gene locus_tag LOCUS_30210 gene guaA 317 1282 CDS product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877764.1 protein_id gnl|my_center|LOCUS_30210 1358 2080 gene locus_tag LOCUS_30220 1358 2080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30220 >Feature sequence435 1230 463 gene locus_tag LOCUS_30230 1230 463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30230 1957 1460 gene locus_tag LOCUS_30240 1957 1460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30240 2735 2013 gene locus_tag LOCUS_30250 2735 2013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30250 >Feature sequence436 534 31 gene locus_tag LOCUS_30260 534 31 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30260 1000 605 gene locus_tag LOCUS_30270 1000 605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30270 1867 1049 gene locus_tag LOCUS_30280 gene dapF 1867 1049 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546632.1 protein_id gnl|my_center|LOCUS_30280 <2918 2175 gene locus_tag LOCUS_30290 <2918 2175 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012583441.1:tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA >Feature sequence437 120 548 gene locus_tag LOCUS_30300 120 548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_30300 1518 2621 gene locus_tag LOCUS_30310 1518 2621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30310 >Feature sequence438 375 650 gene locus_tag LOCUS_30320 375 650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30320 647 1048 gene locus_tag LOCUS_30330 647 1048 CDS product putative toxin-antitoxin system toxin component, PIN family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228775.1 protein_id gnl|my_center|LOCUS_30330 2284 1532 gene locus_tag LOCUS_30340 2284 1532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30340 >Feature sequence439 2749 1766 gene locus_tag LOCUS_30350 2749 1766 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938090.1 protein_id gnl|my_center|LOCUS_30350 >Feature sequence440 430 1692 gene locus_tag LOCUS_30360 430 1692 CDS product CoB--CoM heterodisulfide reductase iron-sulfur subunit A family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546111.1 protein_id gnl|my_center|LOCUS_30360 >Feature sequence441 <1 807 gene locus_tag LOCUS_30370 <1 807 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010902295.1:phosphoadenosine phosphosulfate reductase family protein 886 1017 gene locus_tag LOCUS_30380 886 1017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30380 1020 1568 gene locus_tag LOCUS_30390 1020 1568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_30390 1603 1734 gene locus_tag LOCUS_30400 1603 1734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_30400 >Feature sequence442 1500 205 gene locus_tag LOCUS_30410 1500 205 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958607.1 protein_id gnl|my_center|LOCUS_30410 1968 2222 gene locus_tag LOCUS_30420 1968 2222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30420 2225 2641 gene locus_tag LOCUS_30430 2225 2641 CDS product PIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393269.1 protein_id gnl|my_center|LOCUS_30430 >Feature sequence443 2791 572 gene locus_tag LOCUS_30440 2791 572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30440 >Feature sequence444 152 1522 gene locus_tag LOCUS_30450 gene istA 152 1522 CDS product IS21 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974233.1 protein_id gnl|my_center|LOCUS_30450 1596 2300 gene locus_tag LOCUS_30460 gene istB 1596 2300 CDS product IS21-like element helper ATPase IstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974232.1 protein_id gnl|my_center|LOCUS_30460 >Feature sequence445 908 600 gene locus_tag LOCUS_30470 908 600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30470 1548 1336 gene locus_tag LOCUS_30480 1548 1336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30480 1848 2837 gene locus_tag LOCUS_30490 1848 2837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30490 >Feature sequence446 309 1652 gene locus_tag LOCUS_30500 309 1652 CDS product bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868207.1 protein_id gnl|my_center|LOCUS_30500 1741 2577 gene locus_tag LOCUS_30510 1741 2577 CDS product sulfide-dependent adenosine diphosphate thiazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061316.1 protein_id gnl|my_center|LOCUS_30510 >Feature sequence447 315 64 gene locus_tag LOCUS_30520 315 64 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30520 1410 469 gene locus_tag LOCUS_30530 1410 469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30530 1980 1438 gene locus_tag LOCUS_30540 1980 1438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_30540 2233 1988 gene locus_tag LOCUS_30550 2233 1988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_30550 2520 2320 gene locus_tag LOCUS_30560 2520 2320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30560 >Feature sequence448 1630 1457 gene locus_tag LOCUS_30570 1630 1457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30570 2069 1692 gene locus_tag LOCUS_30580 2069 1692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30580 >Feature sequence449 969 769 gene locus_tag LOCUS_30590 969 769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30590 1463 1188 gene locus_tag LOCUS_30600 1463 1188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30600 2372 1596 gene locus_tag LOCUS_30610 2372 1596 CDS product electron transfer flavoprotein subunit beta/FixA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048185.1 protein_id gnl|my_center|LOCUS_30610 >Feature sequence450 577 2655 gene locus_tag LOCUS_30620 gene fusA 577 2655 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942578.1 protein_id gnl|my_center|LOCUS_30620 >Feature sequence451 727 164 gene locus_tag LOCUS_30630 727 164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30630 2011 860 gene locus_tag LOCUS_30640 2011 860 CDS product trypsin-like peptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583661.1 protein_id gnl|my_center|LOCUS_30640 >Feature sequence452 266 93 gene locus_tag LOCUS_30650 266 93 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30650 1287 286 gene locus_tag LOCUS_30660 1287 286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30660 2275 1292 gene locus_tag LOCUS_30670 2275 1292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30670 2436 2272 gene locus_tag LOCUS_30680 2436 2272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_30680 >Feature sequence453 2201 1314 gene locus_tag LOCUS_30690 2201 1314 CDS product DUF116 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940807.1 protein_id gnl|my_center|LOCUS_30690 <2825 2198 gene locus_tag LOCUS_30700 <2825 2198 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011392417.1:methionyl-tRNA formyltransferase >Feature sequence454 <1 993 gene locus_tag LOCUS_30710 <1 993 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011088976.1:ABC transporter substrate-binding protein >Feature sequence455 429 1259 gene locus_tag LOCUS_30720 429 1259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_30720 1315 2286 gene locus_tag LOCUS_30730 gene nagB 1315 2286 CDS product glucosamine-6-phosphate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003817044.1 protein_id gnl|my_center|LOCUS_30730 >Feature sequence456 322 441 gene locus_tag LOCUS_30740 322 441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30740 1190 435 gene locus_tag LOCUS_30750 1190 435 CDS product FadR/GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003532444.1 protein_id gnl|my_center|LOCUS_30750 1818 1231 gene locus_tag LOCUS_30760 1818 1231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_30760 2234 1761 gene locus_tag LOCUS_30770 2234 1761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_30770 2271 2426 gene locus_tag LOCUS_30780 2271 2426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30780 >Feature sequence457 1752 877 gene locus_tag LOCUS_30790 1752 877 CDS product CoB--CoM heterodisulfide reductase iron-sulfur subunit B family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391978.1 protein_id gnl|my_center|LOCUS_30790 >Feature sequence458 2376 1120 gene locus_tag LOCUS_30800 gene murA 2376 1120 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943723.1 protein_id gnl|my_center|LOCUS_30800 >Feature sequence459 1401 190 gene locus_tag LOCUS_30810 1401 190 CDS product cell wall biogenesis glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008659403.1 protein_id gnl|my_center|LOCUS_30810 2725 1451 gene locus_tag LOCUS_30820 gene glgC 2725 1451 CDS product glucose-1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329623.1 protein_id gnl|my_center|LOCUS_30820 >Feature sequence460 <1 714 gene locus_tag LOCUS_30830 <1 714 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010939297.1:FprA family A-type flavoprotein 900 2564 gene locus_tag LOCUS_30840 gene hcp 900 2564 CDS product hydroxylamine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939296.1 protein_id gnl|my_center|LOCUS_30840 >Feature sequence461 760 338 gene locus_tag LOCUS_30850 760 338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_30850 1164 796 gene locus_tag LOCUS_30860 1164 796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_30860 2040 1447 gene locus_tag LOCUS_30870 2040 1447 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268942.1 protein_id gnl|my_center|LOCUS_30870 >Feature sequence462 <1 1103 gene locus_tag LOCUS_30880 <1 1103 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012546831.1:bifunctional acetate--CoA ligase family protein/GNAT family N-acetyltransferase 1118 2563 gene locus_tag LOCUS_30890 gene acdAI 1118 2563 CDS product acetate--CoA ligase II subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867767.1 protein_id gnl|my_center|LOCUS_30890 >Feature sequence463 757 2304 gene locus_tag LOCUS_30900 757 2304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_098076974.1 protein_id gnl|my_center|LOCUS_30900 2491 2685 gene locus_tag LOCUS_30910 2491 2685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30910 >Feature sequence464 27 782 gene locus_tag LOCUS_30920 27 782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30920 1102 2100 gene locus_tag LOCUS_30930 gene cas1 1102 2100 CDS product CRISPR-associated endonuclease Cas1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879371.1 protein_id gnl|my_center|LOCUS_30930 2293 2457 gene locus_tag LOCUS_30940 2293 2457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30940 >Feature sequence465 267 884 gene locus_tag LOCUS_30950 267 884 CDS product deoxynucleoside kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103016590.1 protein_id gnl|my_center|LOCUS_30950 1178 1411 gene locus_tag LOCUS_30960 1178 1411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30960 1408 1773 gene locus_tag LOCUS_30970 1408 1773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30970 2233 2352 gene locus_tag LOCUS_30980 2233 2352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30980 >Feature sequence466 <1 559 gene locus_tag LOCUS_30990 <1 559 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010879779.1:histone deacetylase family protein 577 1509 gene locus_tag LOCUS_31000 577 1509 CDS product diacylglycerol kinase family lipid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808357.1 protein_id gnl|my_center|LOCUS_31000 1785 2234 gene locus_tag LOCUS_31010 gene mraZ 1785 2234 CDS product division/cell wall cluster transcriptional repressor MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172625480.1 protein_id gnl|my_center|LOCUS_31010 >Feature sequence467 <1 873 gene locus_tag LOCUS_31020 <1 873 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010937453.1:tryptophan--tRNA ligase 881 1603 gene locus_tag LOCUS_31030 881 1603 CDS product segregation/condensation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942476.1 protein_id gnl|my_center|LOCUS_31030 1615 2313 gene locus_tag LOCUS_31040 gene scpB 1615 2313 CDS product SMC-Scp complex subunit ScpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942475.1 protein_id gnl|my_center|LOCUS_31040 >Feature sequence468 598 1434 gene locus_tag LOCUS_31050 598 1434 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392922.1 protein_id gnl|my_center|LOCUS_31050 1450 2316 gene locus_tag LOCUS_31060 1450 2316 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392921.1 protein_id gnl|my_center|LOCUS_31060 >Feature sequence469 157 768 gene locus_tag LOCUS_31070 157 768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31070 1137 862 gene locus_tag LOCUS_31080 1137 862 CDS product type II toxin-antitoxin system YafQ family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002360769.1 protein_id gnl|my_center|LOCUS_31080 1391 1134 gene locus_tag LOCUS_31090 1391 1134 CDS product type II toxin-antitoxin system RelB/DinJ family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811036.1 protein_id gnl|my_center|LOCUS_31090 1630 2040 gene locus_tag LOCUS_31100 1630 2040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31100 2043 2474 gene locus_tag LOCUS_31110 2043 2474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31110 >Feature sequence470 <1 609 gene locus_tag LOCUS_31120 <1 609 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012545142.1:FmdE family protein 624 1100 gene locus_tag LOCUS_31130 624 1100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_31130 1049 1792 gene locus_tag LOCUS_31140 1049 1792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_31140 1915 2064 gene locus_tag LOCUS_31150 1915 2064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31150 >Feature sequence471 342 608 gene locus_tag LOCUS_31160 342 608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31160 679 885 gene locus_tag LOCUS_31170 679 885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31170 932 1399 gene locus_tag LOCUS_31180 932 1399 CDS product Zn-ribbon domain-containing OB-fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878466.1 protein_id gnl|my_center|LOCUS_31180 1436 2218 gene locus_tag LOCUS_31190 1436 2218 CDS product 3-oxoacid CoA-transferase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004552494.1 protein_id gnl|my_center|LOCUS_31190 >Feature sequence472 94 357 gene locus_tag LOCUS_31200 94 357 CDS product AbrB/MazE/SpoVT family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118837971.1 protein_id gnl|my_center|LOCUS_31200 354 788 gene locus_tag LOCUS_31210 354 788 CDS product PIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017285767.1 protein_id gnl|my_center|LOCUS_31210 1197 2402 gene locus_tag LOCUS_31220 1197 2402 CDS product TRC40/GET3/ArsA family transport-energizing ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880406.1 protein_id gnl|my_center|LOCUS_31220 2383 2613 gene locus_tag LOCUS_31230 2383 2613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31230 >Feature sequence473 464 823 gene locus_tag LOCUS_31240 464 823 CDS product four helix bundle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123903.1 protein_id gnl|my_center|LOCUS_31240 902 2440 gene locus_tag LOCUS_31250 902 2440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31250 >Feature sequence474 337 603 gene locus_tag LOCUS_31260 337 603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31260 596 1603 gene locus_tag LOCUS_31270 596 1603 CDS product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015940983.1 protein_id gnl|my_center|LOCUS_31270 1621 2232 gene locus_tag LOCUS_31280 1621 2232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31280 2365 2213 gene locus_tag LOCUS_31290 2365 2213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31290 >Feature sequence475 969 13 gene locus_tag LOCUS_31300 gene hflC 969 13 CDS product protease modulator HflC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678885.1 protein_id gnl|my_center|LOCUS_31300 2009 966 gene locus_tag LOCUS_31310 gene hflK 2009 966 CDS product FtsH protease activity modulator HflK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678884.1 protein_id gnl|my_center|LOCUS_31310 2324 2028 gene locus_tag LOCUS_31320 2324 2028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31320 >Feature sequence476 2314 605 gene locus_tag LOCUS_31330 2314 605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31330 >Feature sequence477 <2652 1881 gene locus_tag LOCUS_31340 <2652 1881 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003400979.1:SDR family oxidoreductase >Feature sequence478 700 449 gene locus_tag LOCUS_31350 700 449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_31350 1022 723 gene locus_tag LOCUS_31360 1022 723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_31360 1442 1026 gene locus_tag LOCUS_31370 1442 1026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_31370 2380 1727 gene locus_tag LOCUS_31380 2380 1727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31380 >Feature sequence479 484 1461 gene locus_tag LOCUS_31390 gene moaA 484 1461 CDS product GTP 3',8-cyclase MoaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393625.1 protein_id gnl|my_center|LOCUS_31390 1462 1905 gene locus_tag LOCUS_31400 gene moaC 1462 1905 CDS product cyclic pyranopterin monophosphate synthase MoaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986478.1 protein_id gnl|my_center|LOCUS_31400 >Feature sequence480 1 705 gene locus_tag LOCUS_31410 1 705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31410 707 1159 gene locus_tag LOCUS_31420 707 1159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31420 >Feature sequence481 1073 288 gene locus_tag LOCUS_31430 1073 288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_31430 2045 1332 gene locus_tag LOCUS_31440 2045 1332 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113600.1 protein_id gnl|my_center|LOCUS_31440 2322 2167 gene locus_tag LOCUS_31450 2322 2167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31450 >Feature sequence482 230 979 gene locus_tag LOCUS_31460 230 979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31460 2041 1067 gene locus_tag LOCUS_31470 2041 1067 CDS product zinc-ribbon and DUF3426 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938880.1 protein_id gnl|my_center|LOCUS_31470 <2611 2073 gene locus_tag LOCUS_31480 <2611 2073 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011393596.1:hypoxanthine phosphoribosyltransferase >Feature sequence483 527 2365 gene locus_tag LOCUS_31490 527 2365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31490 >Feature sequence484 27 1865 gene locus_tag LOCUS_31500 27 1865 CDS product aldehyde ferredoxin oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249027.1 protein_id gnl|my_center|LOCUS_31500 1893 2027 gene locus_tag LOCUS_31510 1893 2027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31510 >Feature sequence485 217 2304 gene locus_tag LOCUS_31520 217 2304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31520 >Feature sequence486 581 387 gene locus_tag LOCUS_31530 581 387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31530 921 679 gene locus_tag LOCUS_31540 921 679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31540 1259 993 gene locus_tag LOCUS_31550 1259 993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31550 1422 1231 gene locus_tag LOCUS_31560 1422 1231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31560 1698 1426 gene locus_tag LOCUS_31570 1698 1426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31570 1863 1702 gene locus_tag LOCUS_31580 1863 1702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31580 2087 1860 gene locus_tag LOCUS_31590 2087 1860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31590 2299 2084 gene locus_tag LOCUS_31600 2299 2084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31600 >Feature sequence487 2153 597 gene locus_tag LOCUS_31610 2153 597 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938822.1 protein_id gnl|my_center|LOCUS_31610 >Feature sequence488 <1 737 gene locus_tag LOCUS_31620 <1 737 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011392708.1:FAD-dependent oxidoreductase note possible pseudo, frameshifted 730 2346 gene locus_tag LOCUS_31630 730 2346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_31630 >Feature sequence489 1363 1001 gene locus_tag LOCUS_31640 1363 1001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_31640 1661 2005 gene locus_tag LOCUS_31650 1661 2005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31650 2144 2428 gene locus_tag LOCUS_31660 2144 2428 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065850.1 protein_id gnl|my_center|LOCUS_31660 >Feature sequence490 283 723 gene locus_tag LOCUS_31670 283 723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31670 738 1043 gene locus_tag LOCUS_31680 738 1043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31680 985 1194 gene locus_tag LOCUS_31690 985 1194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31690 1227 1595 gene locus_tag LOCUS_31700 1227 1595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31700 1722 2252 gene locus_tag LOCUS_31710 1722 2252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31710 2334 2534 gene locus_tag LOCUS_31720 2334 2534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31720 >Feature sequence491 12 2390 gene locus_tag LOCUS_31730 12 2390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31730 >Feature sequence492 2292 841 gene locus_tag LOCUS_31740 2292 841 CDS product DegQ family serine endoprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940999.1 protein_id gnl|my_center|LOCUS_31740 >Feature sequence493 832 377 gene locus_tag LOCUS_31750 832 377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31750 2321 846 gene locus_tag LOCUS_31760 2321 846 CDS product 4-hydroxyphenylacetate 3-hydroxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878527.1 protein_id gnl|my_center|LOCUS_31760 >Feature sequence494 899 111 gene locus_tag LOCUS_31770 899 111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31770 1656 1135 gene locus_tag LOCUS_31780 1656 1135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31780 1825 1649 gene locus_tag LOCUS_31790 1825 1649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31790 >Feature sequence495 395 78 gene locus_tag LOCUS_31800 395 78 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31800 822 430 gene locus_tag LOCUS_31810 822 430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31810 1558 833 gene locus_tag LOCUS_31820 1558 833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31820 <2491 1685 gene locus_tag LOCUS_31830 <2491 1685 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011227677.1:ATP-dependent DNA helicase RecG >Feature sequence496 2413 1724 gene locus_tag LOCUS_31840 2413 1724 CDS product methylenetetrahydrofolate reductase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392706.1 protein_id gnl|my_center|LOCUS_31840 >Feature sequence497 362 219 gene locus_tag LOCUS_31850 362 219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31850 885 733 gene locus_tag LOCUS_31860 885 733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31860 1628 882 gene locus_tag LOCUS_31870 gene mshB 1628 882 CDS product N-acetyl-1-D-myo-inositol-2-amino-2-deoxy-alpha-D-glucopyranoside deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_089212260.1 protein_id gnl|my_center|LOCUS_31870 >Feature sequence498 1639 260 gene locus_tag LOCUS_31880 1639 260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31880 2108 1950 gene locus_tag LOCUS_31890 2108 1950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31890 >Feature sequence499 1244 204 gene locus_tag LOCUS_31900 1244 204 CDS product lipid A deacylase LpxR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389754.1 protein_id gnl|my_center|LOCUS_31900 1400 1251 gene locus_tag LOCUS_31910 1400 1251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31910 1560 2183 gene locus_tag LOCUS_31920 1560 2183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31920 >Feature sequence500 <1 887 gene locus_tag LOCUS_31930 <1 887 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012258479.1:cyclopropane fatty acyl phospholipid synthase 938 1612 gene locus_tag LOCUS_31940 938 1612 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868175.1 protein_id gnl|my_center|LOCUS_31940 <2456 1593 gene locus_tag LOCUS_31950 <2456 1593 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012868777.1:isocitrate dehydrogenase (NADP(+)) >Feature sequence501 1063 2 gene locus_tag LOCUS_31960 1063 2 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546078.1 protein_id gnl|my_center|LOCUS_31960 1559 1068 gene locus_tag LOCUS_31970 gene leuD 1559 1068 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868466.1 protein_id gnl|my_center|LOCUS_31970 <2453 1590 gene locus_tag LOCUS_31980 <2453 1590 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012545762.1:3-isopropylmalate dehydratase large subunit >Feature sequence502 525 211 gene locus_tag LOCUS_31990 525 211 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016227.1 protein_id gnl|my_center|LOCUS_31990 743 516 gene locus_tag LOCUS_32000 743 516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32000 1003 2100 gene locus_tag LOCUS_32010 1003 2100 CDS product GSU2403 family nucleotidyltransferase fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_081162719.1 protein_id gnl|my_center|LOCUS_32010 2166 2339 gene locus_tag LOCUS_32020 2166 2339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32020 >Feature sequence503 1 1962 gene locus_tag LOCUS_32030 1 1962 CDS product SNF2-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398544.1 protein_id gnl|my_center|LOCUS_32030 >Feature sequence504 308 1738 gene locus_tag LOCUS_32040 308 1738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32040 >Feature sequence505 233 1018 gene locus_tag LOCUS_32050 233 1018 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090653.1 protein_id gnl|my_center|LOCUS_32050 1023 1520 gene locus_tag LOCUS_32060 1023 1520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32060 >Feature sequence506 932 381 gene locus_tag LOCUS_32070 932 381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32070 1408 971 gene locus_tag LOCUS_32080 1408 971 CDS product putative toxin-antitoxin system toxin component, PIN family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392184.1 protein_id gnl|my_center|LOCUS_32080 1638 1408 gene locus_tag LOCUS_32090 1638 1408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32090 1967 2107 gene locus_tag LOCUS_32100 1967 2107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32100 2421 2203 gene locus_tag LOCUS_32110 2421 2203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32110 >Feature sequence507 421 609 gene locus_tag LOCUS_32120 421 609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32120 2110 710 gene locus_tag LOCUS_32130 2110 710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32130 >Feature sequence508 <1 1295 gene locus_tag LOCUS_32140 <1 1295 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011020091.1:pyruvate synthase subunit PorA >Feature sequence509 2343 1141 gene locus_tag LOCUS_32150 gene rpsA 2343 1141 CDS product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941857.1 protein_id gnl|my_center|LOCUS_32150 >Feature sequence510 <2402 1742 gene locus_tag LOCUS_32160 <2402 1742 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011020733.1:(Fe-S)-binding protein >Feature sequence511 >Feature sequence512 62 190 gene locus_tag LOCUS_32170 62 190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32170 602 841 gene locus_tag LOCUS_32180 602 841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32180 1495 746 gene locus_tag LOCUS_32190 gene istB 1495 746 CDS product IS21-like element ISMt2 family helper ATPase IstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418125.1 protein_id gnl|my_center|LOCUS_32190 2255 1497 gene locus_tag LOCUS_32200 2255 1497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32200 >Feature sequence513 2006 1311 gene locus_tag LOCUS_32210 2006 1311 CDS product acetate--CoA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867423.1 protein_id gnl|my_center|LOCUS_32210 2187 2113 gene locus_tag LOCUS_t00230 2187 2113 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence514 <1 1310 gene locus_tag LOCUS_32220 <1 1310 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010940646.1:glutamine synthetase family protein >Feature sequence515 1283 63 gene locus_tag LOCUS_32230 1283 63 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32230 <2385 1280 gene locus_tag LOCUS_32240 <2385 1280 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942899.1:3-deoxy-D-manno-octulosonic acid transferase >Feature sequence516 2159 222 gene locus_tag LOCUS_32250 gene thrS 2159 222 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545243.1 protein_id gnl|my_center|LOCUS_32250 2334 2203 gene locus_tag LOCUS_32260 2334 2203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32260 >Feature sequence517 462 2267 gene locus_tag LOCUS_32270 462 2267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32270 >Feature sequence518 1271 63 gene locus_tag LOCUS_32280 1271 63 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940829.1 protein_id gnl|my_center|LOCUS_32280 2192 1275 gene locus_tag LOCUS_32290 gene argF 2192 1275 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940828.1 protein_id gnl|my_center|LOCUS_32290 >Feature sequence519 399 584 gene locus_tag LOCUS_32300 399 584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32300 644 1333 gene locus_tag LOCUS_32310 644 1333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32310 >Feature sequence520 <1 783 gene locus_tag LOCUS_32320 <1 783 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002679398.1:2-hydroxyacyl-CoA dehydratase note possible pseudo, frameshifted 774 1841 gene locus_tag LOCUS_32330 774 1841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32330 1908 2198 gene locus_tag LOCUS_32340 1908 2198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32340 >Feature sequence521 1419 1168 gene locus_tag LOCUS_32350 1419 1168 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921431.1 protein_id gnl|my_center|LOCUS_32350 <2350 1465 gene locus_tag LOCUS_32360 <2350 1465 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007325817.1:beta-ketoacyl-[acyl-carrier-protein] synthase family protein >Feature sequence522 687 1283 gene locus_tag LOCUS_32370 687 1283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32370 1630 1349 gene locus_tag LOCUS_32380 1630 1349 CDS product DUF3467 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762031.1 protein_id gnl|my_center|LOCUS_32380 >Feature sequence523 1724 783 gene locus_tag LOCUS_32390 1724 783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32390 1938 1684 gene locus_tag LOCUS_32400 1938 1684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32400 2106 1939 gene locus_tag LOCUS_32410 2106 1939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_32410 >Feature sequence524 817 611 gene locus_tag LOCUS_32420 817 611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32420 <2340 856 gene locus_tag LOCUS_32430 <2340 856 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000087584.1:CoA-disulfide reductase >Feature sequence525 159 917 gene locus_tag LOCUS_32440 159 917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32440 1429 1034 gene locus_tag LOCUS_32450 1429 1034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32450 1918 1457 gene locus_tag LOCUS_32460 1918 1457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32460 >Feature sequence526 819 121 gene locus_tag LOCUS_32470 819 121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_32470 1004 816 gene locus_tag LOCUS_32480 1004 816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32480 1476 2330 gene locus_tag LOCUS_32490 gene thiL 1476 2330 CDS product thiamine-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943812.1 protein_id gnl|my_center|LOCUS_32490 >Feature sequence527 <1 1215 gene locus_tag LOCUS_32500 <1 1215 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010940829.1:argininosuccinate synthase 1529 2050 gene locus_tag LOCUS_32510 1529 2050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_32510 >Feature sequence528 1066 530 gene locus_tag LOCUS_32520 1066 530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32520 >Feature sequence529 <1 889 gene locus_tag LOCUS_32530 <1 889 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010877884.1:CO dehydrogenase/acetyl-CoA synthase subunit delta 893 2296 gene locus_tag LOCUS_32540 gene acsC 893 2296 CDS product acetyl-CoA decarbonylase/synthase complex subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877321.1 protein_id gnl|my_center|LOCUS_32540 >Feature sequence530 1210 245 gene locus_tag LOCUS_32550 1210 245 CDS product zinc-dependent alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164931000.1 protein_id gnl|my_center|LOCUS_32550 1948 1436 gene locus_tag LOCUS_32560 1948 1436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32560 >Feature sequence531 539 300 gene locus_tag LOCUS_32570 539 300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32570 817 674 gene locus_tag LOCUS_32580 817 674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32580 941 1096 gene locus_tag LOCUS_32590 941 1096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32590 1341 1898 gene locus_tag LOCUS_32600 1341 1898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32600 1871 2188 gene locus_tag LOCUS_32610 1871 2188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32610 >Feature sequence532 1888 473 gene locus_tag LOCUS_32620 1888 473 CDS product cytochrome c biogenesis protein ResB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941275.1 protein_id gnl|my_center|LOCUS_32620 >Feature sequence533 686 342 gene locus_tag LOCUS_32630 686 342 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026148953.1 protein_id gnl|my_center|LOCUS_32630 1037 750 gene locus_tag LOCUS_32640 1037 750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_32640 1806 1111 gene locus_tag LOCUS_32650 1806 1111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_32650 2280 1888 gene locus_tag LOCUS_32660 2280 1888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32660 >Feature sequence534 283 552 gene locus_tag LOCUS_32670 283 552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32670 726 2015 gene locus_tag LOCUS_32680 726 2015 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942487.1 protein_id gnl|my_center|LOCUS_32680 >Feature sequence535 86 256 gene locus_tag LOCUS_32690 86 256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32690 261 689 gene locus_tag LOCUS_32700 261 689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32700 691 1128 gene locus_tag LOCUS_32710 691 1128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32710 1512 1114 gene locus_tag LOCUS_32720 1512 1114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32720 1879 1718 gene locus_tag LOCUS_32730 1879 1718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32730 >Feature sequence536 335 117 gene locus_tag LOCUS_32740 335 117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32740 1832 381 gene locus_tag LOCUS_32750 1832 381 CDS product acyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869044.1 protein_id gnl|my_center|LOCUS_32750 >Feature sequence537 351 1424 gene locus_tag LOCUS_32760 351 1424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_32760 1327 1845 gene locus_tag LOCUS_32770 1327 1845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_32770 >Feature sequence538 115 555 gene locus_tag LOCUS_32780 115 555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32780 555 986 gene locus_tag LOCUS_32790 555 986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_32790 989 1315 gene locus_tag LOCUS_32800 989 1315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_32800 1290 1775 gene locus_tag LOCUS_32810 1290 1775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_32810 >Feature sequence539 472 278 gene locus_tag LOCUS_32820 472 278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32820 1262 495 gene locus_tag LOCUS_32830 1262 495 CDS product transketolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943549.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_32830 1512 1249 gene locus_tag LOCUS_32840 1512 1249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_32840 1804 1490 gene locus_tag LOCUS_32850 1804 1490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_32850 2256 1711 gene locus_tag LOCUS_32860 2256 1711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_32860 >Feature sequence540 360 674 gene locus_tag LOCUS_32870 360 674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32870 671 874 gene locus_tag LOCUS_32880 671 874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32880 852 1370 gene locus_tag LOCUS_32890 852 1370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32890 >Feature sequence541 <1 774 gene locus_tag LOCUS_32900 <1 774 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010876780.1:tetrahydromethanopterin S-methyltransferase subunit H 845 1525 gene locus_tag LOCUS_32910 845 1525 CDS product corrinoid protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949054.1 protein_id gnl|my_center|LOCUS_32910 >Feature sequence542 <2239 1252 gene locus_tag LOCUS_32920 <2239 1252 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011084126.1:tetratricopeptide repeat protein >Feature sequence543 <1 1447 gene locus_tag LOCUS_32930 <1 1447 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011393846.1:efflux RND transporter permease subunit 1444 1734 gene locus_tag LOCUS_32940 1444 1734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32940 >Feature sequence544 2217 28 gene locus_tag LOCUS_32950 2217 28 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32950 >Feature sequence545 <1 600 gene locus_tag LOCUS_32960 <1 600 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012258498.1:DNA polymerase III subunit beta 627 821 gene locus_tag LOCUS_32970 627 821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32970 1210 890 gene locus_tag LOCUS_32980 1210 890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32980 >Feature sequence546 41 379 gene locus_tag LOCUS_32990 41 379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32990 544 678 gene locus_tag LOCUS_33000 544 678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33000 821 1039 gene locus_tag LOCUS_33010 821 1039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33010 1469 1164 gene locus_tag LOCUS_33020 1469 1164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33020 <2226 1622 gene locus_tag LOCUS_33030 <2226 1622 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011392941.1:DUF364 domain-containing protein >Feature sequence547 1917 514 gene locus_tag LOCUS_33040 gene rlmD 1917 514 CDS product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226986823.1 protein_id gnl|my_center|LOCUS_33040 >Feature sequence548 >Feature sequence549 1826 738 gene locus_tag LOCUS_33050 1826 738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33050 >Feature sequence550 816 253 gene locus_tag LOCUS_33060 816 253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33060 1442 1068 gene locus_tag LOCUS_33070 1442 1068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33070 >Feature sequence551 <1 631 gene locus_tag LOCUS_33080 <1 631 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011762251.1:nucleotide sugar dehydrogenase 1051 737 gene locus_tag LOCUS_33090 1051 737 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209585.1 protein_id gnl|my_center|LOCUS_33090 1320 1060 gene locus_tag LOCUS_33100 1320 1060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33100 >Feature sequence552 1446 856 gene locus_tag LOCUS_33110 1446 856 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267143.1 protein_id gnl|my_center|LOCUS_33110 1944 1450 gene locus_tag LOCUS_33120 1944 1450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33120 >Feature sequence553 >Feature sequence554 126 503 gene locus_tag LOCUS_33130 126 503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33130 860 1006 gene locus_tag LOCUS_33140 860 1006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_33140 972 1580 gene locus_tag LOCUS_33150 972 1580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_33150 1534 1734 gene locus_tag LOCUS_33160 1534 1734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_33160 >Feature sequence555 415 1830 gene locus_tag LOCUS_33170 415 1830 CDS product glutamate synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005062753.1 protein_id gnl|my_center|LOCUS_33170 >Feature sequence556 259 582 gene locus_tag LOCUS_33180 259 582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33180 >Feature sequence557 1490 669 gene locus_tag LOCUS_33190 1490 669 CDS product DUF4198 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679851.1 protein_id gnl|my_center|LOCUS_33190 1882 1559 gene locus_tag LOCUS_33200 1882 1559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003089624.1 protein_id gnl|my_center|LOCUS_33200 >Feature sequence558 661 155 gene locus_tag LOCUS_33210 661 155 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392242.1 protein_id gnl|my_center|LOCUS_33210 <2167 683 gene locus_tag LOCUS_33220 <2167 683 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_048146547.1:aldehyde ferredoxin oxidoreductase family protein >Feature sequence559 253 678 gene locus_tag LOCUS_33230 253 678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33230 651 2030 gene locus_tag LOCUS_33240 651 2030 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937450.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_33240 >Feature sequence560 120 407 gene locus_tag LOCUS_33250 gene groES 120 407 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943951.1 protein_id gnl|my_center|LOCUS_33250 465 2111 gene locus_tag LOCUS_33260 gene groL 465 2111 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939262.1 protein_id gnl|my_center|LOCUS_33260 >Feature sequence561 360 184 gene locus_tag LOCUS_33270 360 184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33270 887 591 gene locus_tag LOCUS_33280 887 591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33280 1976 954 gene locus_tag LOCUS_33290 1976 954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33290 >Feature sequence562 1431 898 gene locus_tag LOCUS_33300 gene ispF 1431 898 CDS product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943978.1 protein_id gnl|my_center|LOCUS_33300 >Feature sequence563 >Feature sequence564 543 391 gene locus_tag LOCUS_33310 543 391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33310 848 1801 gene locus_tag LOCUS_33320 848 1801 CDS product IS110 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047962736.1 protein_id gnl|my_center|LOCUS_33320 >Feature sequence565 >Feature sequence566 1954 959 gene locus_tag LOCUS_33330 1954 959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33330 >Feature sequence567 <2132 1286 gene locus_tag LOCUS_33340 <2132 1286 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010938147.1:adenylyl-sulfate reductase subunit alpha >Feature sequence568 2023 1139 gene locus_tag LOCUS_33350 2023 1139 CDS product IS3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_152609748.1 protein_id gnl|my_center|LOCUS_33350 >Feature sequence569 372 1928 gene locus_tag LOCUS_33360 372 1928 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109635.1 protein_id gnl|my_center|LOCUS_33360 >Feature sequence570 26 550 gene locus_tag LOCUS_33370 26 550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33370 1365 562 gene locus_tag LOCUS_33380 1365 562 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938516.1 protein_id gnl|my_center|LOCUS_33380 2084 1545 gene locus_tag LOCUS_33390 2084 1545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33390 >Feature sequence571 1502 699 gene locus_tag LOCUS_33400 1502 699 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258329.1 protein_id gnl|my_center|LOCUS_33400 1873 1571 gene locus_tag LOCUS_33410 1873 1571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33410 >Feature sequence572 41 1165 gene locus_tag LOCUS_33420 41 1165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33420 >Feature sequence573 >Feature sequence574 658 134 gene locus_tag LOCUS_33430 658 134 CDS product pellicle/biofilm biosynthesis outer membrane protein PelC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091288.1 protein_id gnl|my_center|LOCUS_33430 >Feature sequence575 20 790 gene locus_tag LOCUS_33440 20 790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33440 896 1063 gene locus_tag LOCUS_33450 896 1063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_33450 >Feature sequence576 345 178 gene locus_tag LOCUS_33460 345 178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33460 1204 326 gene locus_tag LOCUS_33470 1204 326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33470 1789 1220 gene locus_tag LOCUS_33480 gene tsaB 1789 1220 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257859.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_33480 >Feature sequence577 <1 938 gene locus_tag LOCUS_33490 <1 938 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010963447.1:methyl-accepting chemotaxis protein 1127 1732 gene locus_tag LOCUS_33500 1127 1732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33500 >Feature sequence578 1142 366 gene locus_tag LOCUS_33510 1142 366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33510 1596 1117 gene locus_tag LOCUS_33520 1596 1117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33520 1739 1900 gene locus_tag LOCUS_33530 1739 1900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33530 >Feature sequence579 599 339 gene locus_tag LOCUS_33540 599 339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33540 965 768 gene locus_tag LOCUS_33550 965 768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_33550 1864 1043 gene locus_tag LOCUS_33560 1864 1043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_33560 1763 1774 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence580 248 619 gene locus_tag LOCUS_33570 248 619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33570 616 819 gene locus_tag LOCUS_33580 616 819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33580 1171 1341 gene locus_tag LOCUS_33590 1171 1341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33590 1341 1631 gene locus_tag LOCUS_33600 1341 1631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33600 >Feature sequence581 1095 1346 gene locus_tag LOCUS_33610 1095 1346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33610 >Feature sequence582 527 1153 gene locus_tag LOCUS_33620 527 1153 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384250.1 protein_id gnl|my_center|LOCUS_33620 1470 1772 gene locus_tag LOCUS_33630 1470 1772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33630 >Feature sequence583 132 605 gene locus_tag LOCUS_33640 132 605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33640 981 634 gene locus_tag LOCUS_33650 981 634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33650 >Feature sequence584 971 222 gene locus_tag LOCUS_33660 971 222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33660 1072 863 gene locus_tag LOCUS_33670 1072 863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33670 >Feature sequence585 >Feature sequence586 510 322 gene locus_tag LOCUS_33680 510 322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33680 791 624 gene locus_tag LOCUS_33690 791 624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33690 1401 769 gene locus_tag LOCUS_33700 1401 769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33700 1774 1538 gene locus_tag LOCUS_33710 1774 1538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33710 >Feature sequence587 <1 821 gene locus_tag LOCUS_33720 <1 821 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003134758.1:arabinose-5-phosphate isomerase KdsD 784 1728 gene locus_tag LOCUS_33730 784 1728 CDS product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000714563.1 protein_id gnl|my_center|LOCUS_33730 >Feature sequence588 404 198 gene locus_tag LOCUS_33740 404 198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33740 1412 417 gene locus_tag LOCUS_33750 1412 417 CDS product aminotransferase class IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940306.1 protein_id gnl|my_center|LOCUS_33750 >Feature sequence589 284 403 gene locus_tag LOCUS_33760 284 403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33760 423 1454 gene locus_tag LOCUS_33770 423 1454 CDS product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357329.1 protein_id gnl|my_center|LOCUS_33770 >Feature sequence590 1262 1834 gene locus_tag LOCUS_33780 1262 1834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33780 >Feature sequence591 115 360 gene locus_tag LOCUS_33790 115 360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33790 357 1421 gene locus_tag LOCUS_33800 357 1421 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258069.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_33800 >Feature sequence592 1461 46 gene locus_tag LOCUS_33810 1461 46 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33810 1934 1458 gene locus_tag LOCUS_33820 1934 1458 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942129.1 protein_id gnl|my_center|LOCUS_33820 >Feature sequence593 915 634 gene locus_tag LOCUS_33830 915 634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33830