>Feature sequence001 8 1281 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq attgaagagaagattccattaaaacaaggattgaaac 3161 1488 gene locus_tag LOCUS_00010 3161 1488 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108753.1 protein_id gnl|my_center|LOCUS_00010 4166 3432 gene locus_tag LOCUS_00020 4166 3432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00020 5125 4259 gene locus_tag LOCUS_00030 5125 4259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00030 6013 5282 gene locus_tag LOCUS_00040 6013 5282 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942524.1 protein_id gnl|my_center|LOCUS_00040 6661 6032 gene locus_tag LOCUS_00050 6661 6032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00050 6876 6658 gene locus_tag LOCUS_00060 6876 6658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00060 7350 7499 gene locus_tag LOCUS_00070 7350 7499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00070 7468 9258 gene locus_tag LOCUS_00080 7468 9258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00080 9704 9219 gene locus_tag LOCUS_00090 9704 9219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00090 9850 9638 gene locus_tag LOCUS_00100 9850 9638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00100 12151 9881 gene locus_tag LOCUS_00110 12151 9881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00110 12631 12188 gene locus_tag LOCUS_00120 12631 12188 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932389.1 protein_id gnl|my_center|LOCUS_00120 13981 12680 gene locus_tag LOCUS_00130 13981 12680 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001253865.1 protein_id gnl|my_center|LOCUS_00130 15939 14350 gene locus_tag LOCUS_00140 15939 14350 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942540.1 protein_id gnl|my_center|LOCUS_00140 16840 15989 gene locus_tag LOCUS_00150 16840 15989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00150 18408 17131 gene locus_tag LOCUS_00160 gene eno 18408 17131 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583776.1 protein_id gnl|my_center|LOCUS_00160 18532 18948 gene locus_tag LOCUS_00170 18532 18948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00170 18929 20065 gene locus_tag LOCUS_00180 gene mpl 18929 20065 CDS product UDP-N-acetylmuramate:L-alanyl-gamma-D-glutamyl-meso-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947479.1 protein_id gnl|my_center|LOCUS_00180 >Feature sequence002 858 343 gene locus_tag LOCUS_00190 858 343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00190 1731 1231 gene locus_tag LOCUS_00200 1731 1231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00200 2725 1796 gene locus_tag LOCUS_00210 2725 1796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00210 3054 2728 gene locus_tag LOCUS_00220 3054 2728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00220 3890 3081 gene locus_tag LOCUS_00230 3890 3081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00230 4167 3988 gene locus_tag LOCUS_00240 4167 3988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00240 4495 4196 gene locus_tag LOCUS_00250 4495 4196 CDS product PAAR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941651.1 protein_id gnl|my_center|LOCUS_00250 5311 4577 gene locus_tag LOCUS_00260 5311 4577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00260 6198 5344 gene locus_tag LOCUS_00270 6198 5344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00270 7079 6216 gene locus_tag LOCUS_00280 7079 6216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00280 8805 6988 gene locus_tag LOCUS_00290 8805 6988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00290 9799 8774 gene locus_tag LOCUS_00300 9799 8774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00300 10200 9799 gene locus_tag LOCUS_00310 10200 9799 CDS product GPW/gp25 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941652.1 protein_id gnl|my_center|LOCUS_00310 11091 10231 gene locus_tag LOCUS_00320 11091 10231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00320 12170 11088 gene locus_tag LOCUS_00330 12170 11088 CDS product phage late control D family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941649.1 protein_id gnl|my_center|LOCUS_00330 12826 12206 gene locus_tag LOCUS_00340 12826 12206 CDS product peptidoglycan-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941648.1 protein_id gnl|my_center|LOCUS_00340 13923 12835 gene locus_tag LOCUS_00350 13923 12835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00350 14359 13925 gene locus_tag LOCUS_00360 14359 13925 CDS product phage tail protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941646.1 protein_id gnl|my_center|LOCUS_00360 14906 14544 gene locus_tag LOCUS_00370 14906 14544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941644.1 protein_id gnl|my_center|LOCUS_00370 15368 14925 gene locus_tag LOCUS_00380 15368 14925 CDS product phage tail protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941643.1 protein_id gnl|my_center|LOCUS_00380 17042 15405 gene locus_tag LOCUS_00390 17042 15405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00390 17708 17121 gene locus_tag LOCUS_00400 17708 17121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00400 18346 17891 gene locus_tag LOCUS_00410 18346 17891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00410 >Feature sequence003 674 6 gene locus_tag LOCUS_00420 674 6 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00420 1174 671 gene locus_tag LOCUS_00430 1174 671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00430 2520 1294 gene locus_tag LOCUS_00440 gene ftsA 2520 1294 CDS product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943689.1 protein_id gnl|my_center|LOCUS_00440 3376 2522 gene locus_tag LOCUS_00450 3376 2522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00450 4310 3363 gene locus_tag LOCUS_00460 gene murB 4310 3363 CDS product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048307.1 protein_id gnl|my_center|LOCUS_00460 5796 4417 gene locus_tag LOCUS_00470 gene murC 5796 4417 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943693.1 protein_id gnl|my_center|LOCUS_00470 7169 6117 gene locus_tag LOCUS_00480 gene murG 7169 6117 CDS product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943694.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00480 8280 7129 gene locus_tag LOCUS_00490 gene ftsW 8280 7129 CDS product putative lipid II flippase FtsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943695.1 protein_id gnl|my_center|LOCUS_00490 9311 8379 gene locus_tag LOCUS_00500 9311 8379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00500 9699 9271 gene locus_tag LOCUS_00510 9699 9271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00510 10644 9877 gene locus_tag LOCUS_00520 10644 9877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00520 12195 10801 gene locus_tag LOCUS_00530 12195 10801 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943698.1 protein_id gnl|my_center|LOCUS_00530 13313 12273 gene locus_tag LOCUS_00540 13313 12273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00540 13866 13444 gene locus_tag LOCUS_00550 13866 13444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00550 14549 13863 gene locus_tag LOCUS_00560 14549 13863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00560 15537 14587 gene locus_tag LOCUS_00570 15537 14587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00570 15785 15534 gene locus_tag LOCUS_00580 15785 15534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00580 >Feature sequence004 1172 966 gene locus_tag LOCUS_00590 gene rpmE 1172 966 CDS product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669000.1 protein_id gnl|my_center|LOCUS_00590 2436 1189 gene locus_tag LOCUS_00600 gene rho 2436 1189 CDS product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943729.1 protein_id gnl|my_center|LOCUS_00600 3980 3339 gene locus_tag LOCUS_00610 gene coaE 3980 3339 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393338.1 protein_id gnl|my_center|LOCUS_00610 4176 5546 gene locus_tag LOCUS_00620 4176 5546 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583871.1 protein_id gnl|my_center|LOCUS_00620 5869 6543 gene locus_tag LOCUS_00630 5869 6543 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939218.1 protein_id gnl|my_center|LOCUS_00630 6749 6949 gene locus_tag LOCUS_00640 6749 6949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00640 7058 8326 gene locus_tag LOCUS_00650 7058 8326 CDS product folylpolyglutamate synthase/dihydrofolate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009903674.1 protein_id gnl|my_center|LOCUS_00650 8782 8570 gene locus_tag LOCUS_00660 gene rpmB 8782 8570 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942874.1 protein_id gnl|my_center|LOCUS_00660 9280 8873 gene locus_tag LOCUS_00670 9280 8873 CDS product DUF523 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207987.1 protein_id gnl|my_center|LOCUS_00670 9932 9288 gene locus_tag LOCUS_00680 9932 9288 CDS product outer membrane protein assembly factor BamD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792195.1 protein_id gnl|my_center|LOCUS_00680 11022 10105 gene locus_tag LOCUS_00690 gene trxB 11022 10105 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229015.1 protein_id gnl|my_center|LOCUS_00690 11360 11034 gene locus_tag LOCUS_00700 gene trxA 11360 11034 CDS product thioredoxin TrxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943892.1 protein_id gnl|my_center|LOCUS_00700 11841 12245 gene locus_tag LOCUS_00710 11841 12245 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546014.1 protein_id gnl|my_center|LOCUS_00710 12235 12873 gene locus_tag LOCUS_00720 12235 12873 CDS product TIGR00153 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546415.1 protein_id gnl|my_center|LOCUS_00720 13268 13948 gene locus_tag LOCUS_00730 13268 13948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00730 14078 14509 gene locus_tag LOCUS_00740 14078 14509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00740 >Feature sequence005 <1 522 gene locus_tag LOCUS_00750 <1 522 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012546680.1:phosphoglycerate dehydrogenase note possible pseudo, frameshifted 614 1537 gene locus_tag LOCUS_00760 614 1537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00760 1576 1956 gene locus_tag LOCUS_00770 1576 1956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00770 2082 3545 gene locus_tag LOCUS_00780 2082 3545 CDS product DegQ family serine endoprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940999.1 protein_id gnl|my_center|LOCUS_00780 3612 4415 gene locus_tag LOCUS_00790 gene ispE 3612 4415 CDS product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941321.1 protein_id gnl|my_center|LOCUS_00790 4518 4592 gene locus_tag LOCUS_t00010 4518 4592 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 4693 5631 gene locus_tag LOCUS_00800 4693 5631 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938866.1 protein_id gnl|my_center|LOCUS_00800 5906 6559 gene locus_tag LOCUS_00810 5906 6559 CDS product 50S ribosomal protein L25/general stress protein Ctc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583150.1 protein_id gnl|my_center|LOCUS_00810 6569 7189 gene locus_tag LOCUS_00820 gene pth 6569 7189 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941324.1 protein_id gnl|my_center|LOCUS_00820 7466 7981 gene locus_tag LOCUS_00830 7466 7981 CDS product CarD family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810219.1 protein_id gnl|my_center|LOCUS_00830 8000 9001 gene locus_tag LOCUS_00840 8000 9001 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949041.1 protein_id gnl|my_center|LOCUS_00840 9131 10246 gene locus_tag LOCUS_00850 gene alr 9131 10246 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071542276.1 protein_id gnl|my_center|LOCUS_00850 10394 10651 gene locus_tag LOCUS_00860 10394 10651 CDS product type II toxin-antitoxin system RelB/DinJ family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812625.1 protein_id gnl|my_center|LOCUS_00860 10651 10920 gene locus_tag LOCUS_00870 10651 10920 CDS product type II toxin-antitoxin system YafQ family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002360769.1 protein_id gnl|my_center|LOCUS_00870 13381 11237 gene locus_tag LOCUS_00880 13381 11237 CDS product bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942876.1 protein_id gnl|my_center|LOCUS_00880 >Feature sequence006 1537 1283 gene locus_tag LOCUS_00890 1537 1283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00890 2359 1898 gene locus_tag LOCUS_00900 2359 1898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00900 5948 3360 gene locus_tag LOCUS_00910 5948 3360 CDS product PEP/pyruvate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545874.1 protein_id gnl|my_center|LOCUS_00910 6222 6022 gene locus_tag LOCUS_00920 6222 6022 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072720.1 protein_id gnl|my_center|LOCUS_00920 6641 6264 gene locus_tag LOCUS_00930 6641 6264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00930 8229 6943 gene locus_tag LOCUS_00940 8229 6943 CDS product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941157.1 note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_00940 8467 8222 gene locus_tag LOCUS_00950 8467 8222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_00950 8684 10204 gene locus_tag LOCUS_00960 8684 10204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00960 10652 10263 gene locus_tag LOCUS_00970 10652 10263 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940473.1 protein_id gnl|my_center|LOCUS_00970 12530 10848 gene locus_tag LOCUS_00980 12530 10848 CDS product PAS domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940474.1 protein_id gnl|my_center|LOCUS_00980 >Feature sequence007 805 65 gene locus_tag LOCUS_00990 gene cas6 805 65 CDS product CRISPR-associated endoribonuclease Cas6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545251.1 protein_id gnl|my_center|LOCUS_00990 1463 2890 gene locus_tag LOCUS_01000 1463 2890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01000 3094 3537 gene locus_tag LOCUS_01010 3094 3537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01010 3657 4385 gene locus_tag LOCUS_01020 gene rsmA 3657 4385 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009892086.1 protein_id gnl|my_center|LOCUS_01020 5759 4521 gene locus_tag LOCUS_01030 5759 4521 CDS product glyceraldehyde 3-phosphate dehydrogenase NAD-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546756.1 protein_id gnl|my_center|LOCUS_01030 10283 6102 gene locus_tag LOCUS_01040 10283 6102 CDS product PEP/pyruvate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545209.1 protein_id gnl|my_center|LOCUS_01040 12225 10258 gene locus_tag LOCUS_01050 12225 10258 CDS product ASKHA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811724.1 protein_id gnl|my_center|LOCUS_01050 >Feature sequence008 119 442 gene locus_tag LOCUS_01060 119 442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01060 551 1738 gene locus_tag LOCUS_01070 551 1738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01070 1924 2595 gene locus_tag LOCUS_01080 1924 2595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01080 2941 2777 gene locus_tag LOCUS_01090 2941 2777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01090 3089 3433 gene locus_tag LOCUS_01100 3089 3433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01100 4624 3443 gene locus_tag LOCUS_01110 4624 3443 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958440.1 protein_id gnl|my_center|LOCUS_01110 5428 5700 gene locus_tag LOCUS_01120 5428 5700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01120 5746 5883 gene locus_tag LOCUS_01130 5746 5883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01130 6059 6271 gene locus_tag LOCUS_01140 6059 6271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01140 6268 6615 gene locus_tag LOCUS_01150 6268 6615 CDS product type II toxin-antitoxin system PemK/MazF family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250020.1 protein_id gnl|my_center|LOCUS_01150 6763 6996 gene locus_tag LOCUS_01160 6763 6996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01160 6989 7180 gene locus_tag LOCUS_01170 6989 7180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01170 7778 7500 gene locus_tag LOCUS_01180 7778 7500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01180 9508 7805 gene locus_tag LOCUS_01190 9508 7805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01190 10895 9516 gene locus_tag LOCUS_01200 10895 9516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01200 11942 10905 gene locus_tag LOCUS_01210 11942 10905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01210 >Feature sequence009 1249 848 gene locus_tag LOCUS_01220 gene gcvH 1249 848 CDS product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003222781.1 protein_id gnl|my_center|LOCUS_01220 1880 1530 gene locus_tag LOCUS_01230 1880 1530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01230 2136 1861 gene locus_tag LOCUS_01240 2136 1861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01240 2575 2075 gene locus_tag LOCUS_01250 2575 2075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01250 3109 2594 gene locus_tag LOCUS_01260 3109 2594 CDS product DUF4433 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143359.1 protein_id gnl|my_center|LOCUS_01260 4335 4916 gene locus_tag LOCUS_01270 4335 4916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01270 4865 5140 gene locus_tag LOCUS_01280 4865 5140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01280 5188 5898 gene locus_tag LOCUS_01290 5188 5898 CDS product SagB/ThcOx family dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867364.1 protein_id gnl|my_center|LOCUS_01290 5891 6118 gene locus_tag LOCUS_01300 5891 6118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01300 6174 7478 gene locus_tag LOCUS_01310 6174 7478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_01310 8638 7805 gene locus_tag LOCUS_01320 8638 7805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01320 8818 9009 gene locus_tag LOCUS_01330 8818 9009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01330 9855 9154 gene locus_tag LOCUS_01340 9855 9154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01340 12074 9852 gene locus_tag LOCUS_01350 12074 9852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01350 >Feature sequence010 179 412 gene locus_tag LOCUS_01360 179 412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01360 1357 959 gene locus_tag LOCUS_01370 1357 959 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529139.1 protein_id gnl|my_center|LOCUS_01370 1569 1354 gene locus_tag LOCUS_01380 1569 1354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01380 2506 2162 gene locus_tag LOCUS_01390 2506 2162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01390 2816 3358 gene locus_tag LOCUS_01400 2816 3358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01400 4052 4606 gene locus_tag LOCUS_01410 4052 4606 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_133957191.1 protein_id gnl|my_center|LOCUS_01410 5057 5326 gene locus_tag LOCUS_01420 5057 5326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01420 5326 5553 gene locus_tag LOCUS_01430 5326 5553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01430 5650 5952 gene locus_tag LOCUS_01440 5650 5952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01440 6974 5895 gene locus_tag LOCUS_01450 6974 5895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01450 9369 6964 gene locus_tag LOCUS_01460 9369 6964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01460 9761 11431 gene locus_tag LOCUS_01470 gene ilvD 9761 11431 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393742.1 protein_id gnl|my_center|LOCUS_01470 >Feature sequence011 739 173 gene locus_tag LOCUS_01480 739 173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01480 1041 1256 gene locus_tag LOCUS_01490 1041 1256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01490 1671 4724 gene locus_tag LOCUS_01500 1671 4724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01500 5094 4915 gene locus_tag LOCUS_01510 5094 4915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01510 6577 5051 gene locus_tag LOCUS_01520 6577 5051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01520 8072 6630 gene locus_tag LOCUS_01530 gene gatB 8072 6630 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545415.1 protein_id gnl|my_center|LOCUS_01530 8254 8955 gene locus_tag LOCUS_01540 8254 8955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01540 8983 9351 gene locus_tag LOCUS_01550 8983 9351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01550 9332 10081 gene locus_tag LOCUS_01560 9332 10081 CDS product HDOD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545798.1 protein_id gnl|my_center|LOCUS_01560 10122 10349 gene locus_tag LOCUS_01570 10122 10349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01570 10322 10543 gene locus_tag LOCUS_01580 10322 10543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01580 10612 11211 gene locus_tag LOCUS_01590 10612 11211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01590 >Feature sequence012 2083 740 gene locus_tag LOCUS_01600 gene hflX 2083 740 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545622.1 protein_id gnl|my_center|LOCUS_01600 2012 2194 gene locus_tag LOCUS_01610 2012 2194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01610 3671 2307 gene locus_tag LOCUS_01620 gene dnaB 3671 2307 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938258.1 protein_id gnl|my_center|LOCUS_01620 4130 3687 gene locus_tag LOCUS_01630 gene rplI 4130 3687 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545246.1 protein_id gnl|my_center|LOCUS_01630 4742 5011 gene locus_tag LOCUS_01640 4742 5011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01640 6299 5847 gene locus_tag LOCUS_01650 6299 5847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01650 6744 7355 gene locus_tag LOCUS_01660 6744 7355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01660 7577 7386 gene locus_tag LOCUS_01670 7577 7386 CDS product twin-arginine translocase TatA/TatE family subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943808.1 protein_id gnl|my_center|LOCUS_01670 7778 7587 gene locus_tag LOCUS_01680 7778 7587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01680 8311 8123 gene locus_tag LOCUS_01690 8311 8123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01690 8865 9137 gene locus_tag LOCUS_01700 8865 9137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01700 9674 10750 gene locus_tag LOCUS_01710 9674 10750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546406.1 protein_id gnl|my_center|LOCUS_01710 11378 10782 gene locus_tag LOCUS_01720 11378 10782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01720 11521 11378 gene locus_tag LOCUS_01730 11521 11378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01730 >Feature sequence013 <1 2008 gene locus_tag LOCUS_01740 <1 2008 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001974549.1:adenylate/guanylate cyclase domain-containing protein 2013 2906 gene locus_tag LOCUS_01750 2013 2906 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583782.1 protein_id gnl|my_center|LOCUS_01750 3179 3580 gene locus_tag LOCUS_01760 3179 3580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01760 3603 4196 gene locus_tag LOCUS_01770 gene hisB 3603 4196 CDS product imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943719.1 protein_id gnl|my_center|LOCUS_01770 4321 5016 gene locus_tag LOCUS_01780 4321 5016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01780 5013 5762 gene locus_tag LOCUS_01790 gene hisA 5013 5762 CDS product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino]imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943717.1 protein_id gnl|my_center|LOCUS_01790 6197 7978 gene locus_tag LOCUS_01800 gene dnaG 6197 7978 CDS product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943711.1 protein_id gnl|my_center|LOCUS_01800 8176 9942 gene locus_tag LOCUS_01810 gene rpoD 8176 9942 CDS product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943710.1 protein_id gnl|my_center|LOCUS_01810 10145 10217 gene locus_tag LOCUS_t00020 10145 10217 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence014 <1 702 gene locus_tag LOCUS_01820 <1 702 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012582599.1:histidinol-phosphatase 1015 2334 gene locus_tag LOCUS_01830 1015 2334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01830 2447 3652 gene locus_tag LOCUS_01840 2447 3652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01840 3652 4686 gene locus_tag LOCUS_01850 3652 4686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01850 4653 6143 gene locus_tag LOCUS_01860 gene pelF 4653 6143 CDS product GT4 family glycosyltransferase PelF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964052.1 protein_id gnl|my_center|LOCUS_01860 6106 7437 gene locus_tag LOCUS_01870 6106 7437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01870 7403 8167 gene locus_tag LOCUS_01880 7403 8167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01880 8168 10456 gene locus_tag LOCUS_01890 8168 10456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01890 10830 10522 gene locus_tag LOCUS_01900 10830 10522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01900 >Feature sequence015 2232 247 gene locus_tag LOCUS_01910 2232 247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01910 2786 2373 gene locus_tag LOCUS_01920 2786 2373 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963160.1 protein_id gnl|my_center|LOCUS_01920 4617 2773 gene locus_tag LOCUS_01930 4617 2773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01930 5525 4641 gene locus_tag LOCUS_01940 5525 4641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01940 8145 5572 gene locus_tag LOCUS_01950 8145 5572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01950 10596 8239 gene locus_tag LOCUS_01960 10596 8239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01960 >Feature sequence016 1727 198 gene locus_tag LOCUS_01970 1727 198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01970 2651 1731 gene locus_tag LOCUS_01980 2651 1731 CDS product hydrogenase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939203.1 protein_id gnl|my_center|LOCUS_01980 4184 2670 gene locus_tag LOCUS_01990 4184 2670 CDS product periplasmic [NiFeSe] hydrogenase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniprotKB:P13065 protein_id gnl|my_center|LOCUS_01990 5702 4611 gene locus_tag LOCUS_02000 gene hypD 5702 4611 CDS product hydrogenase formation protein HypD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545661.1 protein_id gnl|my_center|LOCUS_02000 7990 5711 gene locus_tag LOCUS_02010 gene hypF 7990 5711 CDS product carbamoyltransferase HypF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940975.1 protein_id gnl|my_center|LOCUS_02010 8208 7993 gene locus_tag LOCUS_02020 8208 7993 CDS product HypC/HybG/HupF family hydrogenase formation chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545287.1 protein_id gnl|my_center|LOCUS_02020 8378 8244 gene locus_tag LOCUS_02030 8378 8244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02030 8998 8336 gene locus_tag LOCUS_02040 gene hypB 8998 8336 CDS product hydrogenase nickel incorporation protein HypB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940974.1 protein_id gnl|my_center|LOCUS_02040 9512 9162 gene locus_tag LOCUS_02050 9512 9162 CDS product hydrogenase maturation nickel metallochaperone HypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225637.1 protein_id gnl|my_center|LOCUS_02050 10542 9532 gene locus_tag LOCUS_02060 gene hypE 10542 9532 CDS product hydrogenase expression/formation protein HypE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940978.1 protein_id gnl|my_center|LOCUS_02060 >Feature sequence017 289 453 gene locus_tag LOCUS_02070 289 453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02070 590 3781 gene locus_tag LOCUS_02080 590 3781 CDS product helicase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_204874017.1 protein_id gnl|my_center|LOCUS_02080 3784 7227 gene locus_tag LOCUS_02090 3784 7227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02090 7553 9520 gene locus_tag LOCUS_02100 7553 9520 CDS product ATP-dependent endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250346.1 protein_id gnl|my_center|LOCUS_02100 >Feature sequence018 <1 1723 gene locus_tag LOCUS_02110 <1 1723 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010870743.1:sodium-extruding oxaloacetate decarboxylase subunit alpha 1941 2936 gene locus_tag LOCUS_02120 gene sucC 1941 2936 CDS product ADP-forming succinate--CoA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244732.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02120 3163 4032 gene locus_tag LOCUS_02130 gene sucD 3163 4032 CDS product succinate--CoA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003238566.1 protein_id gnl|my_center|LOCUS_02130 4691 5008 gene locus_tag LOCUS_02140 4691 5008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02140 5478 5182 gene locus_tag LOCUS_02150 5478 5182 CDS product MTH1187 family thiamine-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230139.1 protein_id gnl|my_center|LOCUS_02150 5715 7364 gene locus_tag LOCUS_02160 gene pfaD 5715 7364 CDS product eicosapentaenoate synthase subunit PfaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071756.1 protein_id gnl|my_center|LOCUS_02160 >Feature sequence019 705 2438 gene locus_tag LOCUS_02170 705 2438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258154.1 protein_id gnl|my_center|LOCUS_02170 2431 3087 gene locus_tag LOCUS_02180 gene csx7 2431 3087 CDS product CRISPR-associated RAMP protein Csx7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258158.1 protein_id gnl|my_center|LOCUS_02180 3084 4196 gene locus_tag LOCUS_02190 3084 4196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02190 4214 4699 gene locus_tag LOCUS_02200 4214 4699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02200 4696 5502 gene locus_tag LOCUS_02210 gene csx7 4696 5502 CDS product CRISPR-associated RAMP protein Csx7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258158.1 protein_id gnl|my_center|LOCUS_02210 5502 6515 gene locus_tag LOCUS_02220 5502 6515 CDS product RAMP superfamily CRISPR-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258159.1 protein_id gnl|my_center|LOCUS_02220 6512 7105 gene locus_tag LOCUS_02230 6512 7105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02230 7102 8502 gene locus_tag LOCUS_02240 7102 8502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02240 8525 9460 gene locus_tag LOCUS_02250 8525 9460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02250 9457 9696 gene locus_tag LOCUS_02260 9457 9696 CDS product CRISPR-associated protein Csx3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546514.1 protein_id gnl|my_center|LOCUS_02260 9890 10189 gene locus_tag LOCUS_02270 9890 10189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02270 10244 10615 gene locus_tag LOCUS_02280 10244 10615 CDS product GxxExxY protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784536.1 protein_id gnl|my_center|LOCUS_02280 >Feature sequence020 895 32 gene locus_tag LOCUS_02290 gene cobJ 895 32 CDS product precorrin-3B C(17)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461546.1 protein_id gnl|my_center|LOCUS_02290 2643 787 gene locus_tag LOCUS_02300 2643 787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02300 4057 2846 gene locus_tag LOCUS_02310 4057 2846 CDS product bifunctional cobalt-precorrin-7 (C(5))-methyltransferase/cobalt-precorrin-6B (C(15))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943626.1 protein_id gnl|my_center|LOCUS_02310 5184 4054 gene locus_tag LOCUS_02320 gene cbiD 5184 4054 CDS product cobalt-precorrin-5B (C(1))-methyltransferase CbiD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940016.1 protein_id gnl|my_center|LOCUS_02320 6419 5364 gene locus_tag LOCUS_02330 6419 5364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937954.1 protein_id gnl|my_center|LOCUS_02330 7137 6400 gene locus_tag LOCUS_02340 gene cobI 7137 6400 CDS product precorrin-2 C(20)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937949.1 protein_id gnl|my_center|LOCUS_02340 7924 7319 gene locus_tag LOCUS_02350 7924 7319 CDS product precorrin-8X methylmutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943629.1 protein_id gnl|my_center|LOCUS_02350 8916 7945 gene locus_tag LOCUS_02360 8916 7945 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868809.1 protein_id gnl|my_center|LOCUS_02360 9693 8920 gene locus_tag LOCUS_02370 9693 8920 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948093.1 protein_id gnl|my_center|LOCUS_02370 10706 9696 gene locus_tag LOCUS_02380 10706 9696 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937952.1 protein_id gnl|my_center|LOCUS_02380 >Feature sequence021 1539 646 gene locus_tag LOCUS_02390 1539 646 CDS product F0F1 ATP synthase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938077.1 protein_id gnl|my_center|LOCUS_02390 3150 1633 gene locus_tag LOCUS_02400 gene atpA 3150 1633 CDS product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940787.1 protein_id gnl|my_center|LOCUS_02400 3600 3160 gene locus_tag LOCUS_02410 3600 3160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02410 4199 3600 gene locus_tag LOCUS_02420 4199 3600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02420 4624 4199 gene locus_tag LOCUS_02430 4624 4199 CDS product ATP synthase F0 subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940784.1 protein_id gnl|my_center|LOCUS_02430 5873 4773 gene locus_tag LOCUS_02440 gene rodA 5873 4773 CDS product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942720.1 protein_id gnl|my_center|LOCUS_02440 7801 6014 gene locus_tag LOCUS_02450 gene mrdA 7801 6014 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942721.1 protein_id gnl|my_center|LOCUS_02450 8921 8412 gene locus_tag LOCUS_02460 8921 8412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02460 10217 9198 gene locus_tag LOCUS_02470 10217 9198 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938090.1 protein_id gnl|my_center|LOCUS_02470 >Feature sequence022 <1 900 gene locus_tag LOCUS_02480 <1 900 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010937763.1:DHH family phosphoesterase 1043 1690 gene locus_tag LOCUS_02490 1043 1690 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022348.1 protein_id gnl|my_center|LOCUS_02490 1821 2210 gene locus_tag LOCUS_02500 1821 2210 CDS product HEPN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545820.1 protein_id gnl|my_center|LOCUS_02500 2186 2521 gene locus_tag LOCUS_02510 2186 2521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02510 2652 3314 gene locus_tag LOCUS_02520 2652 3314 CDS product bifunctional precorrin-2 dehydrogenase/sirohydrochlorin ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811192.1 protein_id gnl|my_center|LOCUS_02520 3684 4397 gene locus_tag LOCUS_02530 gene ccsB 3684 4397 CDS product c-type cytochrome biogenesis protein CcsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943894.1 protein_id gnl|my_center|LOCUS_02530 4692 5960 gene locus_tag LOCUS_02540 gene hemA 4692 5960 CDS product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943895.1 protein_id gnl|my_center|LOCUS_02540 6197 7129 gene locus_tag LOCUS_02550 gene fabD 6197 7129 CDS product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000515899.1 protein_id gnl|my_center|LOCUS_02550 7337 7699 gene locus_tag LOCUS_02560 gene dksA 7337 7699 CDS product RNA polymerase-binding protein DksA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939427.1 protein_id gnl|my_center|LOCUS_02560 7689 8570 gene locus_tag LOCUS_02570 7689 8570 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392599.1 protein_id gnl|my_center|LOCUS_02570 8788 9495 gene locus_tag LOCUS_02580 gene rnc 8788 9495 CDS product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002557292.1 protein_id gnl|my_center|LOCUS_02580 >Feature sequence023 1592 522 gene locus_tag LOCUS_02590 1592 522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02590 1875 2318 gene locus_tag LOCUS_02600 1875 2318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02600 3988 2480 gene locus_tag LOCUS_02610 3988 2480 CDS product NuoM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142531.1 protein_id gnl|my_center|LOCUS_02610 6044 4014 gene locus_tag LOCUS_02620 6044 4014 CDS product NAD(P)H-quinone oxidoreductase subunit 5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056567.1 protein_id gnl|my_center|LOCUS_02620 7553 6060 gene locus_tag LOCUS_02630 7553 6060 CDS product monovalent cation/H+ antiporter subunit D family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328227.1 protein_id gnl|my_center|LOCUS_02630 7963 7556 gene locus_tag LOCUS_02640 7963 7556 CDS product cation:proton antiporter subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389326.1 protein_id gnl|my_center|LOCUS_02640 8249 7965 gene locus_tag LOCUS_02650 8249 7965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02650 8491 8246 gene locus_tag LOCUS_02660 8491 8246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02660 8811 8488 gene locus_tag LOCUS_02670 gene mnhG 8811 8488 CDS product monovalent cation/H(+) antiporter subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249571.1 protein_id gnl|my_center|LOCUS_02670 9077 8811 gene locus_tag LOCUS_02680 9077 8811 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902381.1 protein_id gnl|my_center|LOCUS_02680 10017 9136 gene locus_tag LOCUS_02690 10017 9136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02690 10574 10080 gene locus_tag LOCUS_02700 10574 10080 CDS product Na(+)/H(+) antiporter subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328225.1 protein_id gnl|my_center|LOCUS_02700 >Feature sequence024 290 108 gene locus_tag LOCUS_02710 290 108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02710 658 314 gene locus_tag LOCUS_02720 658 314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02720 1239 1448 gene locus_tag LOCUS_02730 1239 1448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02730 1515 2810 gene locus_tag LOCUS_02740 1515 2810 CDS product class II fructose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941850.1 protein_id gnl|my_center|LOCUS_02740 2812 3318 gene locus_tag LOCUS_02750 2812 3318 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926900.1 protein_id gnl|my_center|LOCUS_02750 3366 3725 gene locus_tag LOCUS_02760 3366 3725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02760 4530 3751 gene locus_tag LOCUS_02770 gene hisF 4530 3751 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937595.1 protein_id gnl|my_center|LOCUS_02770 5472 4843 gene locus_tag LOCUS_02780 gene hisH 5472 4843 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937594.1 protein_id gnl|my_center|LOCUS_02780 6284 5490 gene locus_tag LOCUS_02790 6284 5490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02790 6983 6459 gene locus_tag LOCUS_02800 6983 6459 CDS product CvpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938481.1 protein_id gnl|my_center|LOCUS_02800 7252 8310 gene locus_tag LOCUS_02810 7252 8310 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792172.1 protein_id gnl|my_center|LOCUS_02810 8307 9581 gene locus_tag LOCUS_02820 8307 9581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02820 9512 9904 gene locus_tag LOCUS_02830 9512 9904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02830 9891 10358 gene locus_tag LOCUS_02840 9891 10358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02840 >Feature sequence025 777 196 gene locus_tag LOCUS_02850 777 196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02850 1441 800 gene locus_tag LOCUS_02860 1441 800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02860 2241 1906 gene locus_tag LOCUS_02870 2241 1906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02870 2891 2319 gene locus_tag LOCUS_02880 2891 2319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02880 3262 2891 gene locus_tag LOCUS_02890 3262 2891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02890 4265 4957 gene locus_tag LOCUS_02900 4265 4957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02900 5067 5759 gene locus_tag LOCUS_02910 5067 5759 CDS product CpsD/CapB family tyrosine-protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986981.1 protein_id gnl|my_center|LOCUS_02910 5874 6254 gene locus_tag LOCUS_02920 5874 6254 CDS product four helix bundle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_180982954.1 protein_id gnl|my_center|LOCUS_02920 6347 7063 gene locus_tag LOCUS_02930 6347 7063 CDS product polysaccharide biosynthesis/export family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640491.1 protein_id gnl|my_center|LOCUS_02930 7325 8164 gene locus_tag LOCUS_02940 7325 8164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02940 8399 8058 gene locus_tag LOCUS_02950 8399 8058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02950 8692 8396 gene locus_tag LOCUS_02960 8692 8396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02960 9383 9093 gene locus_tag LOCUS_02970 9383 9093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02970 9571 9380 gene locus_tag LOCUS_02980 9571 9380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02980 9874 9590 gene locus_tag LOCUS_02990 9874 9590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02990 >Feature sequence026 5663 1548 gene locus_tag LOCUS_03000 gene rpoB 5663 1548 CDS product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943493.1 protein_id gnl|my_center|LOCUS_03000 6259 5873 gene locus_tag LOCUS_03010 gene rplL 6259 5873 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881266.1 protein_id gnl|my_center|LOCUS_03010 6855 6334 gene locus_tag LOCUS_03020 gene rplJ 6855 6334 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943495.1 protein_id gnl|my_center|LOCUS_03020 7892 7218 gene locus_tag LOCUS_03030 gene rplA 7892 7218 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943496.1 protein_id gnl|my_center|LOCUS_03030 8487 8065 gene locus_tag LOCUS_03040 gene rplK 8487 8065 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081512.1 protein_id gnl|my_center|LOCUS_03040 9282 8752 gene locus_tag LOCUS_03050 gene nusG 9282 8752 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940183.1 protein_id gnl|my_center|LOCUS_03050 9726 9298 gene locus_tag LOCUS_03060 9726 9298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03060 9902 9827 gene locus_tag LOCUS_t00030 9902 9827 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence027 1431 3302 gene locus_tag LOCUS_03070 1431 3302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03070 3540 5480 gene locus_tag LOCUS_03080 3540 5480 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937885.1 protein_id gnl|my_center|LOCUS_03080 5614 7242 gene locus_tag LOCUS_03090 5614 7242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03090 7288 7680 gene locus_tag LOCUS_03100 7288 7680 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937569.1 protein_id gnl|my_center|LOCUS_03100 8724 7858 gene locus_tag LOCUS_03110 8724 7858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03110 9313 10089 gene locus_tag LOCUS_03120 9313 10089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03120 >Feature sequence028 <1 651 gene locus_tag LOCUS_03130 <1 651 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010939847.1:response regulator transcription factor 1803 664 gene locus_tag LOCUS_03140 1803 664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03140 2213 2046 gene locus_tag LOCUS_03150 2213 2046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03150 2456 2289 gene locus_tag LOCUS_03160 2456 2289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03160 2576 2950 gene locus_tag LOCUS_03170 2576 2950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03170 3779 2970 gene locus_tag LOCUS_03180 3779 2970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03180 4198 3998 gene locus_tag LOCUS_03190 4198 3998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03190 6468 4426 gene locus_tag LOCUS_03200 6468 4426 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941478.1 protein_id gnl|my_center|LOCUS_03200 7144 6575 gene locus_tag LOCUS_03210 7144 6575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03210 8199 7315 gene locus_tag LOCUS_03220 gene lpxC 8199 7315 CDS product UDP-3-O-acyl-N-acetylglucosamine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002555040.1 protein_id gnl|my_center|LOCUS_03220 8421 8275 gene locus_tag LOCUS_03230 8421 8275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03230 9371 8367 gene locus_tag LOCUS_03240 9371 8367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03240 10160 9540 gene locus_tag LOCUS_03250 10160 9540 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940530.1 protein_id gnl|my_center|LOCUS_03250 >Feature sequence029 466 119 gene locus_tag LOCUS_03260 466 119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03260 956 444 gene locus_tag LOCUS_03270 956 444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03270 1070 1486 gene locus_tag LOCUS_03280 1070 1486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03280 1786 2472 gene locus_tag LOCUS_03290 1786 2472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03290 3332 4300 gene locus_tag LOCUS_03300 3332 4300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03300 4771 4343 gene locus_tag LOCUS_03310 4771 4343 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003529815.1 protein_id gnl|my_center|LOCUS_03310 5004 4771 gene locus_tag LOCUS_03320 5004 4771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03320 6467 5358 gene locus_tag LOCUS_03330 6467 5358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03330 6985 6740 gene locus_tag LOCUS_03340 6985 6740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03340 8214 7219 gene locus_tag LOCUS_03350 8214 7219 CDS product virulence RhuM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681377.1 protein_id gnl|my_center|LOCUS_03350 8763 8323 gene locus_tag LOCUS_03360 8763 8323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03360 8983 8741 gene locus_tag LOCUS_03370 8983 8741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03370 9233 8994 gene locus_tag LOCUS_03380 9233 8994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03380 9756 9391 gene locus_tag LOCUS_03390 9756 9391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03390 10010 9753 gene locus_tag LOCUS_03400 10010 9753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03400 >Feature sequence030 137 637 gene locus_tag LOCUS_03410 137 637 CDS product TIR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970310.1 protein_id gnl|my_center|LOCUS_03410 754 1578 gene locus_tag LOCUS_03420 754 1578 CDS product DUF6430 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026431513.1 protein_id gnl|my_center|LOCUS_03420 1642 3051 gene locus_tag LOCUS_03430 1642 3051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03430 3252 3695 gene locus_tag LOCUS_03440 3252 3695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03440 3916 5670 gene locus_tag LOCUS_03450 3916 5670 CDS product ATP-dependent endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974287.1 protein_id gnl|my_center|LOCUS_03450 5667 7367 gene locus_tag LOCUS_03460 5667 7367 CDS product ATP-dependent helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000181735.1 protein_id gnl|my_center|LOCUS_03460 7555 7902 gene locus_tag LOCUS_03470 7555 7902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03470 8386 8559 gene locus_tag LOCUS_03480 8386 8559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03480 9010 8609 gene locus_tag LOCUS_03490 9010 8609 CDS product PIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545852.1 protein_id gnl|my_center|LOCUS_03490 9300 9007 gene locus_tag LOCUS_03500 9300 9007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03500 >Feature sequence031 2153 840 gene locus_tag LOCUS_03510 2153 840 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938989.1 protein_id gnl|my_center|LOCUS_03510 3056 2262 gene locus_tag LOCUS_03520 3056 2262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03520 5311 3092 gene locus_tag LOCUS_03530 5311 3092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03530 5960 6148 gene locus_tag LOCUS_03540 5960 6148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03540 9386 7359 gene locus_tag LOCUS_03550 9386 7359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03550 9721 9413 gene locus_tag LOCUS_03560 9721 9413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03560 >Feature sequence032 2023 887 gene locus_tag LOCUS_03570 2023 887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03570 3504 2251 gene locus_tag LOCUS_03580 gene murA 3504 2251 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943723.1 protein_id gnl|my_center|LOCUS_03580 3955 3797 gene locus_tag LOCUS_03590 3955 3797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03590 5199 3967 gene locus_tag LOCUS_03600 gene nrfD 5199 3967 CDS product polysulfide reductase NrfD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937995.1 protein_id gnl|my_center|LOCUS_03600 8235 5269 gene locus_tag LOCUS_03610 8235 5269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03610 9013 8291 gene locus_tag LOCUS_03620 9013 8291 CDS product cytochrome c3 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940677.1 protein_id gnl|my_center|LOCUS_03620 <9943 9149 gene locus_tag LOCUS_03630 <9943 9149 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941276.1:c-type cytochrome biogenesis protein CcsB >Feature sequence033 105 1895 gene locus_tag LOCUS_03640 105 1895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03640 1927 2565 gene locus_tag LOCUS_03650 1927 2565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03650 2576 3313 gene locus_tag LOCUS_03660 gene cas5c 2576 3313 CDS product type I-C CRISPR-associated protein Cas5c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205009051.1 protein_id gnl|my_center|LOCUS_03660 3300 5252 gene locus_tag LOCUS_03670 3300 5252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03670 5236 6078 gene locus_tag LOCUS_03680 gene cas7c 5236 6078 CDS product type I-C CRISPR-associated protein Cas7/Csd2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922510.1 protein_id gnl|my_center|LOCUS_03680 6282 7286 gene locus_tag LOCUS_03690 gene rhuM 6282 7286 CDS product RhuM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070741.1 protein_id gnl|my_center|LOCUS_03690 7315 7965 gene locus_tag LOCUS_03700 gene cas4 7315 7965 CDS product CRISPR-associated protein Cas4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932803.1 protein_id gnl|my_center|LOCUS_03700 7962 8993 gene locus_tag LOCUS_03710 gene cas1c 7962 8993 CDS product type I-C CRISPR-associated endonuclease Cas1c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011176711.1 protein_id gnl|my_center|LOCUS_03710 9003 9293 gene locus_tag LOCUS_03720 gene cas2 9003 9293 CDS product CRISPR-associated endonuclease Cas2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011787408.1 protein_id gnl|my_center|LOCUS_03720 9556 9854 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtcgctccccatgcgggagcgtggattgaaac >Feature sequence034 2088 436 gene locus_tag LOCUS_03730 2088 436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03730 3291 2107 gene locus_tag LOCUS_03740 3291 2107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03740 3900 4130 gene locus_tag LOCUS_03750 3900 4130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03750 5398 4757 gene locus_tag LOCUS_03760 5398 4757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03760 6084 5407 gene locus_tag LOCUS_03770 6084 5407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03770 6719 6081 gene locus_tag LOCUS_03780 6719 6081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03780 8122 6743 gene locus_tag LOCUS_03790 8122 6743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03790 8970 8182 gene locus_tag LOCUS_03800 8970 8182 CDS product FkbM family methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122212.1 protein_id gnl|my_center|LOCUS_03800 >Feature sequence035 980 369 gene locus_tag LOCUS_03810 980 369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03810 1471 965 gene locus_tag LOCUS_03820 1471 965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03820 2162 1605 gene locus_tag LOCUS_03830 2162 1605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03830 2805 2173 gene locus_tag LOCUS_03840 2805 2173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03840 3756 2815 gene locus_tag LOCUS_03850 3756 2815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03850 5492 3762 gene locus_tag LOCUS_03860 5492 3762 CDS product GspE/PulE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942427.1 protein_id gnl|my_center|LOCUS_03860 5981 5532 gene locus_tag LOCUS_03870 5981 5532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03870 6637 5978 gene locus_tag LOCUS_03880 6637 5978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03880 7369 7184 gene locus_tag LOCUS_03890 7369 7184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03890 7362 7634 gene locus_tag LOCUS_03900 7362 7634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03900 >Feature sequence036 93 1295 gene locus_tag LOCUS_03910 93 1295 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763756.1 protein_id gnl|my_center|LOCUS_03910 2536 1328 gene locus_tag LOCUS_03920 2536 1328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792214.1 protein_id gnl|my_center|LOCUS_03920 3022 2576 gene locus_tag LOCUS_03930 3022 2576 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941779.1 protein_id gnl|my_center|LOCUS_03930 4364 3207 gene locus_tag LOCUS_03940 4364 3207 CDS product cyclopropane-fatty-acyl-phospholipid synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986159.1 protein_id gnl|my_center|LOCUS_03940 4461 4658 gene locus_tag LOCUS_03950 4461 4658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03950 5977 4859 gene locus_tag LOCUS_03960 5977 4859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03960 8073 6010 gene locus_tag LOCUS_03970 8073 6010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03970 8404 8078 gene locus_tag LOCUS_03980 8404 8078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03980 9206 8574 gene locus_tag LOCUS_03990 9206 8574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03990 >Feature sequence037 <1 1283 gene locus_tag LOCUS_04000 <1 1283 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011393979.1:ABC transporter substrate-binding protein 2684 1356 gene locus_tag LOCUS_04010 2684 1356 CDS product ATP-dependent 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000448293.1 protein_id gnl|my_center|LOCUS_04010 3722 2748 gene locus_tag LOCUS_04020 3722 2748 CDS product KpsF/GutQ family sugar-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544949.1 protein_id gnl|my_center|LOCUS_04020 4123 4401 gene locus_tag LOCUS_04030 4123 4401 CDS product PxxKW family cysteine-rich protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942657.1 protein_id gnl|my_center|LOCUS_04030 5007 6329 gene locus_tag LOCUS_04040 5007 6329 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812135.1 protein_id gnl|my_center|LOCUS_04040 6370 8202 gene locus_tag LOCUS_04050 6370 8202 CDS product chloride channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119127.1 protein_id gnl|my_center|LOCUS_04050 9015 8275 gene locus_tag LOCUS_04060 gene truA 9015 8275 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966380.1 protein_id gnl|my_center|LOCUS_04060 >Feature sequence038 582 833 gene locus_tag LOCUS_04070 582 833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04070 830 1207 gene locus_tag LOCUS_04080 830 1207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04080 1650 1408 gene locus_tag LOCUS_04090 1650 1408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04090 5114 2058 gene locus_tag LOCUS_04100 5114 2058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04100 5407 5252 gene locus_tag LOCUS_04110 5407 5252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04110 6069 7187 gene locus_tag LOCUS_04120 gene dnaN 6069 7187 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940679.1 protein_id gnl|my_center|LOCUS_04120 7184 7489 gene locus_tag LOCUS_04130 7184 7489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04130 7498 9567 gene locus_tag LOCUS_04140 gene gyrB 7498 9567 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005175131.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04140 >Feature sequence039 744 1433 gene locus_tag LOCUS_04150 744 1433 CDS product serine/threonine-protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963364.1 protein_id gnl|my_center|LOCUS_04150 1426 2097 gene locus_tag LOCUS_04160 1426 2097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04160 3256 2075 gene locus_tag LOCUS_04170 3256 2075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04170 4049 3258 gene locus_tag LOCUS_04180 4049 3258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04180 4817 4230 gene locus_tag LOCUS_04190 4817 4230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04190 5068 4799 gene locus_tag LOCUS_04200 5068 4799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04200 5332 5105 gene locus_tag LOCUS_04210 5332 5105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04210 6504 5374 gene locus_tag LOCUS_04220 6504 5374 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790984.1 protein_id gnl|my_center|LOCUS_04220 8806 7427 gene locus_tag LOCUS_04230 gene dnaJ 8806 7427 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392123.1 protein_id gnl|my_center|LOCUS_04230 >Feature sequence040 1008 190 gene locus_tag LOCUS_04240 1008 190 CDS product ComEC/Rec2 family competence protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948181.1 protein_id gnl|my_center|LOCUS_04240 3877 1001 gene locus_tag LOCUS_04250 3877 1001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04250 4763 3945 gene locus_tag LOCUS_04260 4763 3945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04260 5139 4768 gene locus_tag LOCUS_04270 5139 4768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04270 5764 5288 gene locus_tag LOCUS_04280 5764 5288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04280 6426 5761 gene locus_tag LOCUS_04290 6426 5761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04290 6917 6426 gene locus_tag LOCUS_04300 6917 6426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04300 7263 7027 gene locus_tag LOCUS_04310 7263 7027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04310 8180 7707 gene locus_tag LOCUS_04320 8180 7707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04320 9050 8412 gene locus_tag LOCUS_04330 9050 8412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_04330 >Feature sequence041 38 520 gene locus_tag LOCUS_04340 38 520 CDS product Na(+)/H(+) antiporter subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328225.1 protein_id gnl|my_center|LOCUS_04340 585 1466 gene locus_tag LOCUS_04350 585 1466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04350 1523 1789 gene locus_tag LOCUS_04360 1523 1789 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902381.1 protein_id gnl|my_center|LOCUS_04360 1789 2112 gene locus_tag LOCUS_04370 1789 2112 CDS product Na+/H+ antiporter subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004597332.1 protein_id gnl|my_center|LOCUS_04370 2109 2354 gene locus_tag LOCUS_04380 2109 2354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04380 2351 2635 gene locus_tag LOCUS_04390 2351 2635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04390 2637 3032 gene locus_tag LOCUS_04400 2637 3032 CDS product cation:proton antiporter subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389326.1 protein_id gnl|my_center|LOCUS_04400 3035 4534 gene locus_tag LOCUS_04410 3035 4534 CDS product monovalent cation/H+ antiporter subunit D family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389325.1 protein_id gnl|my_center|LOCUS_04410 4546 6045 gene locus_tag LOCUS_04420 4546 6045 CDS product monovalent cation/H+ antiporter subunit D family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969265.1 protein_id gnl|my_center|LOCUS_04420 6047 6259 gene locus_tag LOCUS_04430 6047 6259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037396786.1 protein_id gnl|my_center|LOCUS_04430 6252 8024 gene locus_tag LOCUS_04440 6252 8024 CDS product Na(+)/H(+) antiporter subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037396787.1 protein_id gnl|my_center|LOCUS_04440 8310 8089 gene locus_tag LOCUS_04450 8310 8089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04450 >Feature sequence042 661 305 gene locus_tag LOCUS_04460 661 305 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000147081.1 protein_id gnl|my_center|LOCUS_04460 929 636 gene locus_tag LOCUS_04470 929 636 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_045599895.1 protein_id gnl|my_center|LOCUS_04470 1968 1102 gene locus_tag LOCUS_04480 1968 1102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04480 3164 2130 gene locus_tag LOCUS_04490 3164 2130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04490 3312 3497 gene locus_tag LOCUS_04500 3312 3497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04500 3720 3466 gene locus_tag LOCUS_04510 3720 3466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04510 4537 3809 gene locus_tag LOCUS_04520 4537 3809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04520 4920 4651 gene locus_tag LOCUS_04530 4920 4651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04530 5732 5046 gene locus_tag LOCUS_04540 5732 5046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04540 6310 5897 gene locus_tag LOCUS_04550 6310 5897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04550 7583 6597 gene locus_tag LOCUS_04560 7583 6597 CDS product virulence RhuM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681377.1 protein_id gnl|my_center|LOCUS_04560 8168 7620 gene locus_tag LOCUS_04570 8168 7620 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546058.1 protein_id gnl|my_center|LOCUS_04570 <8935 8173 gene locus_tag LOCUS_04580 <8935 8173 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_084205591.1:peptide chain release factor 2 >Feature sequence043 370 978 gene locus_tag LOCUS_04590 370 978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04590 893 1462 gene locus_tag LOCUS_04600 893 1462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04600 1474 2451 gene locus_tag LOCUS_04610 gene hemB 1474 2451 CDS product porphobilinogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940811.1 protein_id gnl|my_center|LOCUS_04610 2577 3686 gene locus_tag LOCUS_04620 gene ahbD 2577 3686 CDS product heme b synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938155.1 protein_id gnl|my_center|LOCUS_04620 3683 4288 gene locus_tag LOCUS_04630 3683 4288 CDS product CBS and ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228227.1 protein_id gnl|my_center|LOCUS_04630 4626 4294 gene locus_tag LOCUS_04640 4626 4294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04640 5117 4641 gene locus_tag LOCUS_04650 5117 4641 CDS product low molecular weight protein arginine phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_072772321.1 protein_id gnl|my_center|LOCUS_04650 5637 5302 gene locus_tag LOCUS_04660 5637 5302 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064244108.1 protein_id gnl|my_center|LOCUS_04660 5915 5634 gene locus_tag LOCUS_04670 5915 5634 CDS product type II toxin-antitoxin system Phd/YefM family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957712.1 protein_id gnl|my_center|LOCUS_04670 6929 6174 gene locus_tag LOCUS_04680 gene bioD 6929 6174 CDS product dethiobiotin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939835.1 protein_id gnl|my_center|LOCUS_04680 8058 6901 gene locus_tag LOCUS_04690 gene bioF 8058 6901 CDS product 8-amino-7-oxononanoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001075620.1 protein_id gnl|my_center|LOCUS_04690 8486 8025 gene locus_tag LOCUS_04700 8486 8025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04700 >Feature sequence044 638 198 gene locus_tag LOCUS_04710 638 198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04710 1061 639 gene locus_tag LOCUS_04720 1061 639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04720 1648 1923 gene locus_tag LOCUS_04730 1648 1923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04730 2019 2753 gene locus_tag LOCUS_04740 gene radC 2019 2753 CDS product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704181.1 protein_id gnl|my_center|LOCUS_04740 2772 4853 gene locus_tag LOCUS_04750 2772 4853 CDS product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545530.1 protein_id gnl|my_center|LOCUS_04750 4846 7371 gene locus_tag LOCUS_04760 4846 7371 CDS product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545345.1 protein_id gnl|my_center|LOCUS_04760 7918 8193 gene locus_tag LOCUS_04770 7918 8193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04770 8184 8702 gene locus_tag LOCUS_04780 8184 8702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04780 >Feature sequence045 1417 269 gene locus_tag LOCUS_04790 1417 269 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020838.1 protein_id gnl|my_center|LOCUS_04790 2928 1636 gene locus_tag LOCUS_04800 2928 1636 CDS product phenylacetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964343.1 protein_id gnl|my_center|LOCUS_04800 3179 2928 gene locus_tag LOCUS_04810 3179 2928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04810 3942 3676 gene locus_tag LOCUS_04820 3942 3676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04820 4361 3939 gene locus_tag LOCUS_04830 4361 3939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04830 4951 4445 gene locus_tag LOCUS_04840 4951 4445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04840 5795 5148 gene locus_tag LOCUS_04850 5795 5148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04850 6583 5864 gene locus_tag LOCUS_04860 6583 5864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04860 7262 6585 gene locus_tag LOCUS_04870 gene fabG 7262 6585 CDS product 3-oxoacyl-ACP reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964375.1 protein_id gnl|my_center|LOCUS_04870 7679 8074 gene locus_tag LOCUS_04880 7679 8074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04880 8110 8676 gene locus_tag LOCUS_04890 8110 8676 CDS product C39 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545498.1 protein_id gnl|my_center|LOCUS_04890 >Feature sequence046 689 1303 gene locus_tag LOCUS_04900 689 1303 CDS product thiamine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583622.1 protein_id gnl|my_center|LOCUS_04900 1319 1339 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1830 3644 gene locus_tag LOCUS_04910 1830 3644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04910 4260 3646 gene locus_tag LOCUS_04920 4260 3646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04920 4430 4260 gene locus_tag LOCUS_04930 4430 4260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04930 5524 4424 gene locus_tag LOCUS_04940 5524 4424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04940 5651 6613 gene locus_tag LOCUS_04950 5651 6613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04950 >Feature sequence047 135 977 gene locus_tag LOCUS_04960 135 977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04960 1280 2656 gene locus_tag LOCUS_04970 1280 2656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04970 2685 2897 gene locus_tag LOCUS_04980 2685 2897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04980 2911 3564 gene locus_tag LOCUS_04990 2911 3564 CDS product lactate utilization protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939415.1 protein_id gnl|my_center|LOCUS_04990 6162 3625 gene locus_tag LOCUS_05000 gene tssH 6162 3625 CDS product type VI secretion system ATPase TssH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269330.1 protein_id gnl|my_center|LOCUS_05000 7230 6433 gene locus_tag LOCUS_05010 7230 6433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05010 8144 7194 gene locus_tag LOCUS_05020 8144 7194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05020 >Feature sequence048 385 1020 gene locus_tag LOCUS_05030 385 1020 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880179.1 protein_id gnl|my_center|LOCUS_05030 1017 1745 gene locus_tag LOCUS_05040 1017 1745 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941482.1 protein_id gnl|my_center|LOCUS_05040 1756 3153 gene locus_tag LOCUS_05050 1756 3153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05050 3643 3158 gene locus_tag LOCUS_05060 3643 3158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05060 3998 3666 gene locus_tag LOCUS_05070 3998 3666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05070 4327 3971 gene locus_tag LOCUS_05080 4327 3971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05080 4937 4338 gene locus_tag LOCUS_05090 4937 4338 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545344.1 protein_id gnl|my_center|LOCUS_05090 5702 5064 gene locus_tag LOCUS_05100 5702 5064 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080979.1 protein_id gnl|my_center|LOCUS_05100 6681 5704 gene locus_tag LOCUS_05110 6681 5704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05110 7784 6681 gene locus_tag LOCUS_05120 7784 6681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05120 8154 7918 gene locus_tag LOCUS_05130 8154 7918 CDS product FeoA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460243.1 protein_id gnl|my_center|LOCUS_05130 >Feature sequence049 1626 1 gene locus_tag LOCUS_05140 1626 1 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942140.1 protein_id gnl|my_center|LOCUS_05140 3103 1736 gene locus_tag LOCUS_05150 3103 1736 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942141.1 protein_id gnl|my_center|LOCUS_05150 4373 3090 gene locus_tag LOCUS_05160 4373 3090 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941927.1 protein_id gnl|my_center|LOCUS_05160 5295 4357 gene locus_tag LOCUS_05170 5295 4357 CDS product aspartate carbamoyltransferase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583924.1 protein_id gnl|my_center|LOCUS_05170 5949 5308 gene locus_tag LOCUS_05180 gene lepB 5949 5308 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545806.1 protein_id gnl|my_center|LOCUS_05180 6465 5998 gene locus_tag LOCUS_05190 6465 5998 CDS product phosphatidylglycerophosphatase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940818.1 protein_id gnl|my_center|LOCUS_05190 7661 6462 gene locus_tag LOCUS_05200 gene larC 7661 6462 CDS product nickel pincer cofactor biosynthesis protein LarC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583893.1 protein_id gnl|my_center|LOCUS_05200 <8395 7663 gene locus_tag LOCUS_05210 <8395 7663 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003230352.1:tripeptidase T >Feature sequence050 3 800 gene locus_tag LOCUS_05220 3 800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05220 794 1042 gene locus_tag LOCUS_05230 794 1042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05230 1052 1933 gene locus_tag LOCUS_05240 1052 1933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05240 1911 2477 gene locus_tag LOCUS_05250 1911 2477 CDS product SLATT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039060.1 protein_id gnl|my_center|LOCUS_05250 2627 7309 gene locus_tag LOCUS_05260 2627 7309 CDS product very short patch repair endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933286.1 protein_id gnl|my_center|LOCUS_05260 7471 7740 gene locus_tag LOCUS_05270 7471 7740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05270 7748 8104 gene locus_tag LOCUS_05280 7748 8104 CDS product DUF6516 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062280560.1 protein_id gnl|my_center|LOCUS_05280 >Feature sequence051 435 238 gene locus_tag LOCUS_05290 435 238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05290 1436 708 gene locus_tag LOCUS_05300 gene istB 1436 708 CDS product IS21-like element IS21 family helper ATPase IstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000544830.1 protein_id gnl|my_center|LOCUS_05300 2703 1426 gene locus_tag LOCUS_05310 gene istA 2703 1426 CDS product IS21-like element IS21 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000952372.1 protein_id gnl|my_center|LOCUS_05310 3601 2639 gene locus_tag LOCUS_05320 3601 2639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05320 4119 3673 gene locus_tag LOCUS_05330 4119 3673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05330 4157 4294 gene locus_tag LOCUS_05340 4157 4294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05340 4300 6402 gene locus_tag LOCUS_05350 4300 6402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05350 6645 7457 gene locus_tag LOCUS_05360 6645 7457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05360 >Feature sequence052 300 593 gene locus_tag LOCUS_05370 300 593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05370 900 1154 gene locus_tag LOCUS_05380 900 1154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05380 1175 1909 gene locus_tag LOCUS_05390 1175 1909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05390 2186 2260 gene locus_tag LOCUS_t00040 2186 2260 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 2602 2916 gene locus_tag LOCUS_05400 2602 2916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05400 2944 3747 gene locus_tag LOCUS_05410 gene purN 2944 3747 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001028592.1 protein_id gnl|my_center|LOCUS_05410 4899 3733 gene locus_tag LOCUS_05420 4899 3733 CDS product TraB/GumN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811492.1 protein_id gnl|my_center|LOCUS_05420 5107 6417 gene locus_tag LOCUS_05430 5107 6417 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011791554.1 protein_id gnl|my_center|LOCUS_05430 7011 7709 gene locus_tag LOCUS_05440 7011 7709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05440 >Feature sequence053 <1 655 gene locus_tag LOCUS_05450 <1 655 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_009890514.1:DUF364 domain-containing protein 1093 854 gene locus_tag LOCUS_05460 1093 854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05460 1875 1546 gene locus_tag LOCUS_05470 1875 1546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05470 3204 1879 gene locus_tag LOCUS_05480 3204 1879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05480 4223 3204 gene locus_tag LOCUS_05490 4223 3204 CDS product PDDEXK nuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266508.1 protein_id gnl|my_center|LOCUS_05490 4900 4220 gene locus_tag LOCUS_05500 4900 4220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05500 5648 4845 gene locus_tag LOCUS_05510 5648 4845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05510 7471 5654 gene locus_tag LOCUS_05520 7471 5654 CDS product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105653.1 protein_id gnl|my_center|LOCUS_05520 >Feature sequence054 148 459 gene locus_tag LOCUS_05530 gene rpsJ 148 459 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943487.1 protein_id gnl|my_center|LOCUS_05530 517 1149 gene locus_tag LOCUS_05540 gene rplC 517 1149 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081835.1 protein_id gnl|my_center|LOCUS_05540 1302 1823 gene locus_tag LOCUS_05550 gene rplD 1302 1823 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393936.1 protein_id gnl|my_center|LOCUS_05550 1849 2136 gene locus_tag LOCUS_05560 1849 2136 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943484.1 protein_id gnl|my_center|LOCUS_05560 2155 2982 gene locus_tag LOCUS_05570 gene rplB 2155 2982 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943483.1 protein_id gnl|my_center|LOCUS_05570 2997 3278 gene locus_tag LOCUS_05580 gene rpsS 2997 3278 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938602.1 protein_id gnl|my_center|LOCUS_05580 3313 3651 gene locus_tag LOCUS_05590 gene rplV 3313 3651 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003027193.1 protein_id gnl|my_center|LOCUS_05590 3667 4257 gene locus_tag LOCUS_05600 gene rpsC 3667 4257 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943480.1 protein_id gnl|my_center|LOCUS_05600 4274 4687 gene locus_tag LOCUS_05610 gene rplP 4274 4687 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943479.1 protein_id gnl|my_center|LOCUS_05610 4687 4881 gene locus_tag LOCUS_05620 gene rpmC 4687 4881 CDS product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966404.1 protein_id gnl|my_center|LOCUS_05620 4900 5157 gene locus_tag LOCUS_05630 gene rpsQ 4900 5157 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938607.1 protein_id gnl|my_center|LOCUS_05630 5180 5548 gene locus_tag LOCUS_05640 gene rplN 5180 5548 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943476.1 protein_id gnl|my_center|LOCUS_05640 5578 5907 gene locus_tag LOCUS_05650 gene rplX 5578 5907 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_187422288.1 protein_id gnl|my_center|LOCUS_05650 6062 6412 gene locus_tag LOCUS_05660 6062 6412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05660 6396 6593 gene locus_tag LOCUS_05670 6396 6593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05670 6604 6789 gene locus_tag LOCUS_05680 6604 6789 CDS product type Z 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938611.1 protein_id gnl|my_center|LOCUS_05680 6947 7345 gene locus_tag LOCUS_05690 gene rpsH 6947 7345 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003241998.1 protein_id gnl|my_center|LOCUS_05690 >Feature sequence055 1569 751 gene locus_tag LOCUS_05700 1569 751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05700 1860 2510 gene locus_tag LOCUS_05710 1860 2510 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258772.1 protein_id gnl|my_center|LOCUS_05710 2524 3732 gene locus_tag LOCUS_05720 2524 3732 CDS product DNA cytosine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109411.1 protein_id gnl|my_center|LOCUS_05720 3752 6112 gene locus_tag LOCUS_05730 3752 6112 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816115.1 protein_id gnl|my_center|LOCUS_05730 6109 7011 gene locus_tag LOCUS_05740 6109 7011 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816114.1 protein_id gnl|my_center|LOCUS_05740 7572 7297 gene locus_tag LOCUS_05750 7572 7297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05750 >Feature sequence056 1383 205 gene locus_tag LOCUS_05760 1383 205 CDS product FprA family A-type flavoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939297.1 protein_id gnl|my_center|LOCUS_05760 3008 1809 gene locus_tag LOCUS_05770 3008 1809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05770 3754 4032 gene locus_tag LOCUS_05780 3754 4032 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942391.1 protein_id gnl|my_center|LOCUS_05780 4035 4289 gene locus_tag LOCUS_05790 4035 4289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05790 4809 5795 gene locus_tag LOCUS_05800 4809 5795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05800 6091 7005 gene locus_tag LOCUS_05810 gene prfB 6091 7005 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_084205591.1 protein_id gnl|my_center|LOCUS_05810 7010 7558 gene locus_tag LOCUS_05820 7010 7558 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546058.1 protein_id gnl|my_center|LOCUS_05820 >Feature sequence057 796 146 gene locus_tag LOCUS_05830 796 146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05830 1193 1405 gene locus_tag LOCUS_05840 1193 1405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05840 1482 2552 gene locus_tag LOCUS_05850 1482 2552 CDS product ABC transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164924795.1 protein_id gnl|my_center|LOCUS_05850 2741 5383 gene locus_tag LOCUS_05860 2741 5383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05860 6279 6440 gene locus_tag LOCUS_05870 6279 6440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05870 >Feature sequence058 409 606 gene locus_tag LOCUS_05880 gene rpmI 409 606 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942164.1 protein_id gnl|my_center|LOCUS_05880 639 989 gene locus_tag LOCUS_05890 gene rplT 639 989 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942165.1 protein_id gnl|my_center|LOCUS_05890 1174 2181 gene locus_tag LOCUS_05900 gene pheS 1174 2181 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393252.1 protein_id gnl|my_center|LOCUS_05900 2183 4549 gene locus_tag LOCUS_05910 gene pheT 2183 4549 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942167.1 protein_id gnl|my_center|LOCUS_05910 4553 4900 gene locus_tag LOCUS_05920 4553 4900 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546816.1 protein_id gnl|my_center|LOCUS_05920 5266 5796 gene locus_tag LOCUS_05930 5266 5796 CDS product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583566.1 protein_id gnl|my_center|LOCUS_05930 6013 7419 gene locus_tag LOCUS_05940 gene nusA 6013 7419 CDS product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942231.1 protein_id gnl|my_center|LOCUS_05940 >Feature sequence059 3147 391 gene locus_tag LOCUS_05950 3147 391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05950 4334 3144 gene locus_tag LOCUS_05960 4334 3144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05960 5050 4331 gene locus_tag LOCUS_05970 5050 4331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05970 7222 5054 gene locus_tag LOCUS_05980 7222 5054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05980 >Feature sequence060 <1 1767 gene locus_tag LOCUS_05990 <1 1767 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011071257.1:formate dehydrogenase subunit alpha 2715 1768 gene locus_tag LOCUS_06000 2715 1768 CDS product DUF362 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140932.1 protein_id gnl|my_center|LOCUS_06000 2971 3801 gene locus_tag LOCUS_06010 gene tatD 2971 3801 CDS product 3'-5' ssDNA/RNA exonuclease TatD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_186277865.1 protein_id gnl|my_center|LOCUS_06010 3911 4114 gene locus_tag LOCUS_06020 3911 4114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06020 4689 4883 gene locus_tag LOCUS_06030 4689 4883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06030 4993 5796 gene locus_tag LOCUS_06040 4993 5796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06040 5853 6947 gene locus_tag LOCUS_06050 5853 6947 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041271909.1 protein_id gnl|my_center|LOCUS_06050 >Feature sequence061 440 273 gene locus_tag LOCUS_06060 440 273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06060 569 1084 gene locus_tag LOCUS_06070 569 1084 CDS product DivIVA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941529.1 protein_id gnl|my_center|LOCUS_06070 1098 2180 gene locus_tag LOCUS_06080 1098 2180 CDS product type IV pilus twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546105.1 protein_id gnl|my_center|LOCUS_06080 2405 3505 gene locus_tag LOCUS_06090 2405 3505 CDS product PilT/PilU family type 4a pilus ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545245.1 protein_id gnl|my_center|LOCUS_06090 3518 4210 gene locus_tag LOCUS_06100 3518 4210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06100 4989 4207 gene locus_tag LOCUS_06110 4989 4207 CDS product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942579.1 protein_id gnl|my_center|LOCUS_06110 6184 5249 gene locus_tag LOCUS_06120 6184 5249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06120 6806 6171 gene locus_tag LOCUS_06130 6806 6171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06130 >Feature sequence062 577 1572 gene locus_tag LOCUS_06140 577 1572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06140 1575 2174 gene locus_tag LOCUS_06150 gene tsf 1575 2174 CDS product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392547.1 protein_id gnl|my_center|LOCUS_06150 2178 2894 gene locus_tag LOCUS_06160 gene pyrH 2178 2894 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005904124.1 protein_id gnl|my_center|LOCUS_06160 3121 3699 gene locus_tag LOCUS_06170 gene frr 3121 3699 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723450.1 protein_id gnl|my_center|LOCUS_06170 3689 4423 gene locus_tag LOCUS_06180 3689 4423 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460415.1 protein_id gnl|my_center|LOCUS_06180 4518 5321 gene locus_tag LOCUS_06190 4518 5321 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942561.1 protein_id gnl|my_center|LOCUS_06190 5426 6580 gene locus_tag LOCUS_06200 5426 6580 CDS product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861463.1 protein_id gnl|my_center|LOCUS_06200 >Feature sequence063 2 892 gene locus_tag LOCUS_06210 2 892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06210 922 1338 gene locus_tag LOCUS_06220 922 1338 CDS product F0F1 ATP synthase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938075.1 protein_id gnl|my_center|LOCUS_06220 1480 2274 gene locus_tag LOCUS_06230 1480 2274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06230 2327 2566 gene locus_tag LOCUS_06240 2327 2566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06240 2615 2908 gene locus_tag LOCUS_06250 2615 2908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06250 3626 4585 gene locus_tag LOCUS_06260 3626 4585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06260 4642 5172 gene locus_tag LOCUS_06270 4642 5172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06270 5427 6737 gene locus_tag LOCUS_06280 gene tyrS 5427 6737 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048264.1 protein_id gnl|my_center|LOCUS_06280 >Feature sequence064 659 237 gene locus_tag LOCUS_06290 659 237 CDS product CoA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296996.1 protein_id gnl|my_center|LOCUS_06290 1092 2717 gene locus_tag LOCUS_06300 1092 2717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06300 2720 3724 gene locus_tag LOCUS_06310 2720 3724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06310 3991 4191 gene locus_tag LOCUS_06320 3991 4191 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940882.1 protein_id gnl|my_center|LOCUS_06320 5171 4302 gene locus_tag LOCUS_06330 5171 4302 CDS product M28 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000680714.1 protein_id gnl|my_center|LOCUS_06330 5532 5239 gene locus_tag LOCUS_06340 5532 5239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06340 5722 5561 gene locus_tag LOCUS_06350 5722 5561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06350 5955 5722 gene locus_tag LOCUS_06360 5955 5722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06360 7018 6653 gene locus_tag LOCUS_06370 7018 6653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06370 >Feature sequence065 2137 803 gene locus_tag LOCUS_06380 2137 803 CDS product CpaF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_223294683.1 protein_id gnl|my_center|LOCUS_06380 3319 2165 gene locus_tag LOCUS_06390 3319 2165 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939398.1 protein_id gnl|my_center|LOCUS_06390 3708 3466 gene locus_tag LOCUS_06400 3708 3466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06400 5203 3806 gene locus_tag LOCUS_06410 5203 3806 CDS product type II and III secretion system protein family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939396.1 protein_id gnl|my_center|LOCUS_06410 6067 5222 gene locus_tag LOCUS_06420 gene cpaB 6067 5222 CDS product Flp pilus assembly protein CpaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939395.1 protein_id gnl|my_center|LOCUS_06420 6979 6401 gene locus_tag LOCUS_06430 6979 6401 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002677237.1 protein_id gnl|my_center|LOCUS_06430 >Feature sequence066 <1 550 gene locus_tag LOCUS_06440 <1 550 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012545817.1:glycosyltransferase family 9 protein 885 2483 gene locus_tag LOCUS_06450 885 2483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06450 2762 3229 gene locus_tag LOCUS_06460 2762 3229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06460 3233 4105 gene locus_tag LOCUS_06470 3233 4105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06470 6363 4378 gene locus_tag LOCUS_06480 6363 4378 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259283.1 protein_id gnl|my_center|LOCUS_06480 7005 6820 gene locus_tag LOCUS_06490 7005 6820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06490 >Feature sequence067 1193 345 gene locus_tag LOCUS_06500 1193 345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06500 2241 1855 gene locus_tag LOCUS_06510 2241 1855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06510 2588 2515 gene locus_tag LOCUS_t00050 2588 2515 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 2983 3165 gene locus_tag LOCUS_06520 gene rpmF 2983 3165 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888992.1 protein_id gnl|my_center|LOCUS_06520 3169 4830 gene locus_tag LOCUS_06530 3169 4830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06530 4833 5591 gene locus_tag LOCUS_06540 gene fabG 4833 5591 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989818.1 protein_id gnl|my_center|LOCUS_06540 5643 5873 gene locus_tag LOCUS_06550 gene acpP 5643 5873 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003362599.1 protein_id gnl|my_center|LOCUS_06550 5934 7202 gene locus_tag LOCUS_06560 gene fabF 5934 7202 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942250.1 protein_id gnl|my_center|LOCUS_06560 >Feature sequence068 1669 605 gene locus_tag LOCUS_06570 1669 605 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765261.1 protein_id gnl|my_center|LOCUS_06570 3611 2160 gene locus_tag LOCUS_06580 3611 2160 CDS product lipopolysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202937.1 protein_id gnl|my_center|LOCUS_06580 4609 3731 gene locus_tag LOCUS_06590 4609 3731 CDS product sulfotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403763.1 protein_id gnl|my_center|LOCUS_06590 5876 4752 gene locus_tag LOCUS_06600 5876 4752 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762980.1 protein_id gnl|my_center|LOCUS_06600 6125 6283 gene locus_tag LOCUS_06610 6125 6283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06610 6990 6754 gene locus_tag LOCUS_06620 6990 6754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06620 >Feature sequence069 588 4058 gene locus_tag LOCUS_06630 588 4058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06630 4288 4055 gene locus_tag LOCUS_06640 4288 4055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06640 4439 4609 gene locus_tag LOCUS_06650 4439 4609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06650 5100 4873 gene locus_tag LOCUS_06660 5100 4873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06660 5862 5560 gene locus_tag LOCUS_06670 5862 5560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06670 6257 5853 gene locus_tag LOCUS_06680 6257 5853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06680 7065 6250 gene locus_tag LOCUS_06690 7065 6250 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020083.1 protein_id gnl|my_center|LOCUS_06690 >Feature sequence070 <1 616 gene locus_tag LOCUS_06700 <1 616 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012164238.1:ChaN family lipoprotein 603 1664 gene locus_tag LOCUS_06710 603 1664 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259367.1 protein_id gnl|my_center|LOCUS_06710 1636 2169 gene locus_tag LOCUS_06720 1636 2169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06720 2368 2871 gene locus_tag LOCUS_06730 2368 2871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06730 3362 4078 gene locus_tag LOCUS_06740 3362 4078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06740 4094 6034 gene locus_tag LOCUS_06750 gene acs 4094 6034 CDS product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546141.1 protein_id gnl|my_center|LOCUS_06750 6055 6792 gene locus_tag LOCUS_06760 6055 6792 CDS product DUF72 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403241.1 protein_id gnl|my_center|LOCUS_06760 >Feature sequence071 1727 603 gene locus_tag LOCUS_06770 gene nifV 1727 603 CDS product homocitrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418528.1 protein_id gnl|my_center|LOCUS_06770 2893 1763 gene locus_tag LOCUS_06780 2893 1763 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081574.1 protein_id gnl|my_center|LOCUS_06780 3647 2895 gene locus_tag LOCUS_06790 3647 2895 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496487.1 protein_id gnl|my_center|LOCUS_06790 4702 3644 gene locus_tag LOCUS_06800 4702 3644 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861411.1 protein_id gnl|my_center|LOCUS_06800 6102 4750 gene locus_tag LOCUS_06810 6102 4750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06810 <6947 6293 gene locus_tag LOCUS_06820 <6947 6293 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_009890514.1:DUF364 domain-containing protein >Feature sequence072 <1 703 gene locus_tag LOCUS_06830 <1 703 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943339.1:ABC transporter permease 703 1383 gene locus_tag LOCUS_06840 703 1383 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943340.1 protein_id gnl|my_center|LOCUS_06840 1958 1401 gene locus_tag LOCUS_06850 1958 1401 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022735.1 protein_id gnl|my_center|LOCUS_06850 2408 2154 gene locus_tag LOCUS_06860 2408 2154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06860 3922 2519 gene locus_tag LOCUS_06870 3922 2519 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764741.1 protein_id gnl|my_center|LOCUS_06870 4309 6795 gene locus_tag LOCUS_06880 4309 6795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06880 >Feature sequence073 766 446 gene locus_tag LOCUS_06890 766 446 CDS product archease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583624.1 protein_id gnl|my_center|LOCUS_06890 2304 832 gene locus_tag LOCUS_06900 2304 832 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016159.1 protein_id gnl|my_center|LOCUS_06900 3174 3962 gene locus_tag LOCUS_06910 3174 3962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06910 4001 4204 gene locus_tag LOCUS_06920 4001 4204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06920 4235 6502 gene locus_tag LOCUS_06930 4235 6502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06930 >Feature sequence074 1736 450 gene locus_tag LOCUS_06940 1736 450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06940 3187 1778 gene locus_tag LOCUS_06950 3187 1778 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943546.1 protein_id gnl|my_center|LOCUS_06950 4695 3184 gene locus_tag LOCUS_06960 4695 3184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06960 4857 5201 gene locus_tag LOCUS_06970 4857 5201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06970 5415 6227 gene locus_tag LOCUS_06980 5415 6227 CDS product DUF1848 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108052.1 protein_id gnl|my_center|LOCUS_06980 6220 6678 gene locus_tag LOCUS_06990 6220 6678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06990 >Feature sequence075 1749 796 gene locus_tag LOCUS_07000 1749 796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07000 2755 1883 gene locus_tag LOCUS_07010 2755 1883 CDS product general secretion pathway protein GspC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000991320.1 protein_id gnl|my_center|LOCUS_07010 3469 2933 gene locus_tag LOCUS_07020 3469 2933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07020 4947 3469 gene locus_tag LOCUS_07030 4947 3469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07030 5988 4963 gene locus_tag LOCUS_07040 gene gspK 5988 4963 CDS product type II secretion system minor pseudopilin GspK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121457.1 protein_id gnl|my_center|LOCUS_07040 6492 6031 gene locus_tag LOCUS_07050 6492 6031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07050 6413 6649 gene locus_tag LOCUS_07060 6413 6649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07060 >Feature sequence076 2335 1085 gene locus_tag LOCUS_07070 2335 1085 CDS product flippase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868271.1 protein_id gnl|my_center|LOCUS_07070 3816 2536 gene locus_tag LOCUS_07080 3816 2536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07080 4272 3910 gene locus_tag LOCUS_07090 4272 3910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07090 4523 4696 gene locus_tag LOCUS_07100 4523 4696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07100 5219 4758 gene locus_tag LOCUS_07110 5219 4758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07110 5385 5191 gene locus_tag LOCUS_07120 5385 5191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07120 5682 5413 gene locus_tag LOCUS_07130 5682 5413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07130 6839 5679 gene locus_tag LOCUS_07140 6839 5679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07140 >Feature sequence077 779 534 gene locus_tag LOCUS_07150 779 534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07150 1171 842 gene locus_tag LOCUS_07160 1171 842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07160 2125 1217 gene locus_tag LOCUS_07170 2125 1217 CDS product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390141.1 protein_id gnl|my_center|LOCUS_07170 3002 2271 gene locus_tag LOCUS_07180 3002 2271 CDS product metal ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015842.1 protein_id gnl|my_center|LOCUS_07180 3957 3004 gene locus_tag LOCUS_07190 3957 3004 CDS product metal ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010204647.1 protein_id gnl|my_center|LOCUS_07190 4635 4003 gene locus_tag LOCUS_07200 4635 4003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07200 5878 4637 gene locus_tag LOCUS_07210 5878 4637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07210 6420 6100 gene locus_tag LOCUS_07220 6420 6100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002674683.1 protein_id gnl|my_center|LOCUS_07220 >Feature sequence078 490 705 gene locus_tag LOCUS_07230 490 705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07230 3413 1332 gene locus_tag LOCUS_07240 3413 1332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07240 3777 3418 gene locus_tag LOCUS_07250 3777 3418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07250 5137 4472 gene locus_tag LOCUS_07260 5137 4472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07260 >Feature sequence079 535 122 gene locus_tag LOCUS_07270 535 122 CDS product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067454.1 protein_id gnl|my_center|LOCUS_07270 1434 571 gene locus_tag LOCUS_07280 gene rapZ 1434 571 CDS product RNase adapter RapZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942529.1 protein_id gnl|my_center|LOCUS_07280 1898 1440 gene locus_tag LOCUS_07290 1898 1440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07290 3008 2520 gene locus_tag LOCUS_07300 gene raiA 3008 2520 CDS product ribosome-associated translation inhibitor RaiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942531.1 protein_id gnl|my_center|LOCUS_07300 4453 3023 gene locus_tag LOCUS_07310 gene rpoN 4453 3023 CDS product RNA polymerase factor sigma-54 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942532.1 protein_id gnl|my_center|LOCUS_07310 5177 4455 gene locus_tag LOCUS_07320 gene lptB 5177 4455 CDS product LPS export ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073698.1 protein_id gnl|my_center|LOCUS_07320 5888 5340 gene locus_tag LOCUS_07330 5888 5340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07330 6453 5869 gene locus_tag LOCUS_07340 6453 5869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07340 6620 6441 gene locus_tag LOCUS_07350 6620 6441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07350 >Feature sequence080 588 16 gene locus_tag LOCUS_07360 588 16 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07360 1949 609 gene locus_tag LOCUS_07370 1949 609 CDS product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942582.1 protein_id gnl|my_center|LOCUS_07370 2044 2238 gene locus_tag LOCUS_07380 2044 2238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07380 2355 2975 gene locus_tag LOCUS_07390 2355 2975 CDS product YchE family NAAT transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001190428.1 protein_id gnl|my_center|LOCUS_07390 3387 2989 gene locus_tag LOCUS_07400 3387 2989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07400 3869 4801 gene locus_tag LOCUS_07410 3869 4801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07410 4843 5310 gene locus_tag LOCUS_07420 4843 5310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07420 6752 5388 gene locus_tag LOCUS_07430 6752 5388 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942141.1 protein_id gnl|my_center|LOCUS_07430 >Feature sequence081 1174 3162 gene locus_tag LOCUS_07440 1174 3162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07440 3140 4483 gene locus_tag LOCUS_07450 3140 4483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07450 4476 5258 gene locus_tag LOCUS_07460 4476 5258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07460 >Feature sequence082 309 236 gene locus_tag LOCUS_t00060 309 236 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 631 556 gene locus_tag LOCUS_t00070 631 556 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 883 799 gene locus_tag LOCUS_t00080 883 799 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 1024 952 gene locus_tag LOCUS_t00090 1024 952 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 1666 3264 gene locus_tag LOCUS_07470 1666 3264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07470 3742 4479 gene locus_tag LOCUS_07480 3742 4479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07480 4434 4826 gene locus_tag LOCUS_07490 4434 4826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07490 4829 6280 gene locus_tag LOCUS_07500 gene proS 4829 6280 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921836.1 protein_id gnl|my_center|LOCUS_07500 >Feature sequence083 19 2544 gene locus_tag LOCUS_07510 gene secA 19 2544 CDS product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015945439.1 protein_id gnl|my_center|LOCUS_07510 2562 2870 gene locus_tag LOCUS_07520 2562 2870 CDS product ATP-dependent Clp protease adaptor ClpS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938892.1 protein_id gnl|my_center|LOCUS_07520 2874 5129 gene locus_tag LOCUS_07530 gene clpA 2874 5129 CDS product ATP-dependent Clp protease ATP-binding subunit ClpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546336.1 protein_id gnl|my_center|LOCUS_07530 5201 5830 gene locus_tag LOCUS_07540 gene aat 5201 5830 CDS product leucyl/phenylalanyl-tRNA--protein transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964441.1 protein_id gnl|my_center|LOCUS_07540 6307 5891 gene locus_tag LOCUS_07550 6307 5891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07550 >Feature sequence084 1391 1609 gene locus_tag LOCUS_07560 1391 1609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07560 1584 2138 gene locus_tag LOCUS_07570 1584 2138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07570 2135 2605 gene locus_tag LOCUS_07580 2135 2605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07580 2624 3004 gene locus_tag LOCUS_07590 2624 3004 CDS product class III cytochrome C family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546815.1 protein_id gnl|my_center|LOCUS_07590 3135 4415 gene locus_tag LOCUS_07600 3135 4415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07600 4408 5367 gene locus_tag LOCUS_07610 4408 5367 CDS product RnfABCDGE type electron transport complex subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761244.1 protein_id gnl|my_center|LOCUS_07610 5369 5959 gene locus_tag LOCUS_07620 5369 5959 CDS product FMN-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940060.1 protein_id gnl|my_center|LOCUS_07620 >Feature sequence085 1477 299 gene locus_tag LOCUS_07630 1477 299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07630 2256 1474 gene locus_tag LOCUS_07640 gene rlmB 2256 1474 CDS product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942108.1 protein_id gnl|my_center|LOCUS_07640 2787 2308 gene locus_tag LOCUS_07650 gene gmk 2787 2308 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003691634.1 protein_id gnl|my_center|LOCUS_07650 3189 2935 gene locus_tag LOCUS_07660 3189 2935 CDS product DUF370 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938198.1 protein_id gnl|my_center|LOCUS_07660 4096 3215 gene locus_tag LOCUS_07670 4096 3215 CDS product YicC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392409.1 protein_id gnl|my_center|LOCUS_07670 4785 4384 gene locus_tag LOCUS_07680 4785 4384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07680 4962 4789 gene locus_tag LOCUS_07690 4962 4789 CDS product Trm112 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545155.1 protein_id gnl|my_center|LOCUS_07690 <6453 5159 gene locus_tag LOCUS_07700 <6453 5159 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010937642.1:glycosyltransferase N-terminal domain-containing protein >Feature sequence086 1374 979 gene locus_tag LOCUS_07710 1374 979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07710 2226 1393 gene locus_tag LOCUS_07720 2226 1393 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920959.1 protein_id gnl|my_center|LOCUS_07720 3092 2415 gene locus_tag LOCUS_07730 3092 2415 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940040.1 protein_id gnl|my_center|LOCUS_07730 4201 3248 gene locus_tag LOCUS_07740 4201 3248 CDS product histone deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881382.1 protein_id gnl|my_center|LOCUS_07740 5212 4466 gene locus_tag LOCUS_07750 5212 4466 CDS product carbon monoxide dehydrogenase accessory protein CooC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418348.1 protein_id gnl|my_center|LOCUS_07750 <6396 5313 gene locus_tag LOCUS_07760 <6396 5313 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003689235.1:electron transfer flavoprotein-ubiquinone oxidoreductase >Feature sequence087 315 557 gene locus_tag LOCUS_07770 315 557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07770 700 2307 gene locus_tag LOCUS_07780 gene fliF 700 2307 CDS product flagellar basal-body MS-ring/collar protein FliF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941078.1 protein_id gnl|my_center|LOCUS_07780 2379 3338 gene locus_tag LOCUS_07790 gene fliG 2379 3338 CDS product flagellar motor switch protein FliG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082903.1 protein_id gnl|my_center|LOCUS_07790 3331 3918 gene locus_tag LOCUS_07800 3331 3918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07800 4064 5416 gene locus_tag LOCUS_07810 4064 5416 CDS product FliI/YscN family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941081.1 protein_id gnl|my_center|LOCUS_07810 5599 6075 gene locus_tag LOCUS_07820 5599 6075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07820 >Feature sequence088 495 2612 gene locus_tag LOCUS_07830 495 2612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07830 3093 4040 gene locus_tag LOCUS_07840 3093 4040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07840 4079 5497 gene locus_tag LOCUS_07850 4079 5497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07850 >Feature sequence089 711 319 gene locus_tag LOCUS_07860 711 319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07860 4906 2045 gene locus_tag LOCUS_07870 4906 2045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07870 >Feature sequence090 1295 312 gene locus_tag LOCUS_07880 1295 312 CDS product calcium/sodium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070719.1 protein_id gnl|my_center|LOCUS_07880 2575 1823 gene locus_tag LOCUS_07890 2575 1823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07890 3153 2677 gene locus_tag LOCUS_07900 3153 2677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07900 3311 4258 gene locus_tag LOCUS_07910 3311 4258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07910 4242 4613 gene locus_tag LOCUS_07920 4242 4613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07920 4915 5145 gene locus_tag LOCUS_07930 4915 5145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07930 5142 5444 gene locus_tag LOCUS_07940 5142 5444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07940 5705 5926 gene locus_tag LOCUS_07950 5705 5926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07950 6002 6265 gene locus_tag LOCUS_07960 6002 6265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07960 >Feature sequence091 <1 690 gene locus_tag LOCUS_07970 <1 690 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012546144.1:SLC13 family permease 1121 1597 gene locus_tag LOCUS_07980 1121 1597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07980 1844 4405 gene locus_tag LOCUS_07990 1844 4405 CDS product PEP/pyruvate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545874.1 protein_id gnl|my_center|LOCUS_07990 4659 4915 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq tctgaaactgagacctgatgaataagggattgagac >Feature sequence092 394 687 gene locus_tag LOCUS_08000 394 687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08000 1023 1226 gene locus_tag LOCUS_08010 1023 1226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08010 1659 3011 gene locus_tag LOCUS_08020 1659 3011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08020 3023 3376 gene locus_tag LOCUS_08030 3023 3376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08030 4491 4826 gene locus_tag LOCUS_08040 4491 4826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08040 4913 5335 gene locus_tag LOCUS_08050 4913 5335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08050 5496 6248 gene locus_tag LOCUS_08060 gene mqnB 5496 6248 CDS product futalosine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941120.1 protein_id gnl|my_center|LOCUS_08060 >Feature sequence093 473 1102 gene locus_tag LOCUS_08070 473 1102 CDS product flagellar basal body L-ring protein FlgH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943674.1 protein_id gnl|my_center|LOCUS_08070 1193 1711 gene locus_tag LOCUS_08080 1193 1711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08080 1680 2333 gene locus_tag LOCUS_08090 1680 2333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08090 2432 2602 gene locus_tag LOCUS_08100 2432 2602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08100 2760 3068 gene locus_tag LOCUS_08110 gene flgM 2760 3068 CDS product flagellar biosynthesis anti-sigma factor FlgM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860681.1 protein_id gnl|my_center|LOCUS_08110 3217 3753 gene locus_tag LOCUS_08120 3217 3753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08120 >Feature sequence094 107 964 gene locus_tag LOCUS_08130 gene rsmI 107 964 CDS product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941314.1 protein_id gnl|my_center|LOCUS_08130 967 3138 gene locus_tag LOCUS_08140 967 3138 CDS product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259750.1 protein_id gnl|my_center|LOCUS_08140 3163 3735 gene locus_tag LOCUS_08150 3163 3735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08150 4210 4452 gene locus_tag LOCUS_08160 4210 4452 CDS product DUF433 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_149266694.1 protein_id gnl|my_center|LOCUS_08160 5735 5418 gene locus_tag LOCUS_08170 5735 5418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08170 6010 5732 gene locus_tag LOCUS_08180 6010 5732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08180 >Feature sequence095 <1 519 gene locus_tag LOCUS_08190 <1 519 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942475.1:SMC-Scp complex subunit ScpB 557 631 gene locus_tag LOCUS_t00100 557 631 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 728 1126 gene locus_tag LOCUS_08200 728 1126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08200 1198 3207 gene locus_tag LOCUS_08210 gene tkt 1198 3207 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403054.1 protein_id gnl|my_center|LOCUS_08210 3253 3534 gene locus_tag LOCUS_08220 3253 3534 CDS product TMEM165/GDT1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140124.1 protein_id gnl|my_center|LOCUS_08220 3658 4155 gene locus_tag LOCUS_08230 3658 4155 CDS product cytochrome c family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545087.1 protein_id gnl|my_center|LOCUS_08230 5920 4181 gene locus_tag LOCUS_08240 5920 4181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08240 >Feature sequence096 487 1539 gene locus_tag LOCUS_08250 487 1539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08250 3011 3520 gene locus_tag LOCUS_08260 3011 3520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08260 3856 4410 gene locus_tag LOCUS_08270 3856 4410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08270 4544 5437 gene locus_tag LOCUS_08280 4544 5437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08280 5670 5837 gene locus_tag LOCUS_08290 5670 5837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08290 >Feature sequence097 1055 1633 gene locus_tag LOCUS_08300 1055 1633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08300 1915 3417 gene locus_tag LOCUS_08310 1915 3417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08310 3422 3997 gene locus_tag LOCUS_08320 3422 3997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08320 4196 5410 gene locus_tag LOCUS_08330 4196 5410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08330 >Feature sequence098 1377 382 gene locus_tag LOCUS_08340 gene rhuM 1377 382 CDS product RhuM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070741.1 protein_id gnl|my_center|LOCUS_08340 2772 1801 gene locus_tag LOCUS_08350 2772 1801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08350 2659 2880 gene locus_tag LOCUS_08360 2659 2880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08360 3493 2954 gene locus_tag LOCUS_08370 3493 2954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08370 5070 3760 gene locus_tag LOCUS_08380 5070 3760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08380 <6083 5074 gene locus_tag LOCUS_08390 <6083 5074 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001387312.1:type I restriction-modification system subunit M >Feature sequence099 2406 1 gene locus_tag LOCUS_08400 2406 1 CDS product PBP1A family penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937936.1 protein_id gnl|my_center|LOCUS_08400 2871 3251 gene locus_tag LOCUS_08410 gene hisI 2871 3251 CDS product phosphoribosyl-AMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937424.1 protein_id gnl|my_center|LOCUS_08410 3248 4123 gene locus_tag LOCUS_08420 gene hisG 3248 4123 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937425.1 protein_id gnl|my_center|LOCUS_08420 4442 4750 gene locus_tag LOCUS_08430 4442 4750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_08430 4747 4959 gene locus_tag LOCUS_08440 4747 4959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08440 4943 5587 gene locus_tag LOCUS_08450 4943 5587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08450 >Feature sequence100 3 788 gene locus_tag LOCUS_08460 3 788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08460 794 1945 gene locus_tag LOCUS_08470 794 1945 CDS product deoxyguanosinetriphosphate triphosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546176.1 protein_id gnl|my_center|LOCUS_08470 2017 2853 gene locus_tag LOCUS_08480 2017 2853 CDS product UPF0280 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583102.1 protein_id gnl|my_center|LOCUS_08480 3144 3515 gene locus_tag LOCUS_08490 3144 3515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08490 >Feature sequence101 <1 852 gene locus_tag LOCUS_08500 <1 852 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_235045033.1:transposase 974 1237 gene locus_tag LOCUS_08510 974 1237 CDS product prevent-host-death protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461031.1 protein_id gnl|my_center|LOCUS_08510 1234 1539 gene locus_tag LOCUS_08520 1234 1539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08520 1802 2014 gene locus_tag LOCUS_08530 1802 2014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08530 2007 2465 gene locus_tag LOCUS_08540 2007 2465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08540 3609 3684 gene locus_tag LOCUS_t00110 3609 3684 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 3749 4630 gene locus_tag LOCUS_08550 3749 4630 CDS product ARMT1-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582978.1 protein_id gnl|my_center|LOCUS_08550 4649 5923 gene locus_tag LOCUS_08560 4649 5923 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881356.1 protein_id gnl|my_center|LOCUS_08560 >Feature sequence102 2243 474 gene locus_tag LOCUS_08570 2243 474 CDS product aldehyde ferredoxin oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_202319085.1 protein_id gnl|my_center|LOCUS_08570 3180 3755 gene locus_tag LOCUS_08580 gene pyrF 3180 3755 CDS product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545803.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08580 5039 3855 gene locus_tag LOCUS_08590 5039 3855 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942444.1 protein_id gnl|my_center|LOCUS_08590 5612 5136 gene locus_tag LOCUS_08600 gene tsaE 5612 5136 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434423.1 protein_id gnl|my_center|LOCUS_08600 >Feature sequence103 289 2040 gene locus_tag LOCUS_08610 289 2040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08610 2033 2911 gene locus_tag LOCUS_08620 gene hdrB 2033 2911 CDS product CoB--CoM heterodisulfide reductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870378.1 protein_id gnl|my_center|LOCUS_08620 3158 4747 gene locus_tag LOCUS_08630 3158 4747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08630 >Feature sequence104 1357 488 gene locus_tag LOCUS_08640 1357 488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08640 2290 1715 gene locus_tag LOCUS_08650 2290 1715 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812610.1 protein_id gnl|my_center|LOCUS_08650 2726 2463 gene locus_tag LOCUS_08660 2726 2463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08660 3343 2723 gene locus_tag LOCUS_08670 3343 2723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08670 4889 3558 gene locus_tag LOCUS_08680 4889 3558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08680 5307 4948 gene locus_tag LOCUS_08690 5307 4948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08690 >Feature sequence105 <1 1042 gene locus_tag LOCUS_08700 <1 1042 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010938193.1:chorismate synthase 1362 2171 gene locus_tag LOCUS_08710 1362 2171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08710 2371 2162 gene locus_tag LOCUS_08720 2371 2162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08720 3137 2493 gene locus_tag LOCUS_08730 3137 2493 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401268.1 protein_id gnl|my_center|LOCUS_08730 3529 3867 gene locus_tag LOCUS_08740 3529 3867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08740 3909 4661 gene locus_tag LOCUS_08750 3909 4661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08750 4968 5939 gene locus_tag LOCUS_08760 4968 5939 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545566.1 protein_id gnl|my_center|LOCUS_08760 >Feature sequence106 2438 717 gene locus_tag LOCUS_08770 2438 717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08770 3179 3952 gene locus_tag LOCUS_08780 gene xerA 3179 3952 CDS product tyrosine recombinase XerA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867504.1 protein_id gnl|my_center|LOCUS_08780 5101 4181 gene locus_tag LOCUS_08790 5101 4181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08790 >Feature sequence107 2425 1322 gene locus_tag LOCUS_08800 2425 1322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08800 2939 4402 gene locus_tag LOCUS_08810 2939 4402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08810 4502 5251 gene locus_tag LOCUS_08820 4502 5251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08820 >Feature sequence108 858 70 gene locus_tag LOCUS_08830 858 70 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938583.1 protein_id gnl|my_center|LOCUS_08830 1268 858 gene locus_tag LOCUS_08840 gene dsrJ 1268 858 CDS product sulfate reduction electron transfer complex DsrMKJOP subunit DsrJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393111.1 protein_id gnl|my_center|LOCUS_08840 2977 1316 gene locus_tag LOCUS_08850 2977 1316 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393112.1 protein_id gnl|my_center|LOCUS_08850 3984 2977 gene locus_tag LOCUS_08860 gene dsrM 3984 2977 CDS product sulfate reduction electron transfer complex DsrMKJOP subunit DsrM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810497.1 protein_id gnl|my_center|LOCUS_08860 4608 4078 gene locus_tag LOCUS_08870 4608 4078 CDS product RsbRD N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810499.1 protein_id gnl|my_center|LOCUS_08870 >Feature sequence109 800 450 gene locus_tag LOCUS_08880 800 450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08880 2190 790 gene locus_tag LOCUS_08890 2190 790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08890 2626 2231 gene locus_tag LOCUS_08900 2626 2231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08900 2943 3488 gene locus_tag LOCUS_08910 2943 3488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08910 3735 4853 gene locus_tag LOCUS_08920 3735 4853 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017115.1 protein_id gnl|my_center|LOCUS_08920 5816 5166 gene locus_tag LOCUS_08930 5816 5166 CDS product TrkA family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022192.1 protein_id gnl|my_center|LOCUS_08930 >Feature sequence110 921 1 gene locus_tag LOCUS_08940 921 1 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08940 2336 969 gene locus_tag LOCUS_08950 gene rsmB 2336 969 CDS product 16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943984.1 protein_id gnl|my_center|LOCUS_08950 3694 2750 gene locus_tag LOCUS_08960 gene fmt 3694 2750 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940806.1 protein_id gnl|my_center|LOCUS_08960 4368 3862 gene locus_tag LOCUS_08970 gene def 4368 3862 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545479.1 protein_id gnl|my_center|LOCUS_08970 5422 4355 gene locus_tag LOCUS_08980 5422 4355 CDS product lysylphosphatidylglycerol synthase transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259095.1 protein_id gnl|my_center|LOCUS_08980 >Feature sequence111 731 465 gene locus_tag LOCUS_08990 731 465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08990 1270 656 gene locus_tag LOCUS_09000 1270 656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09000 1726 1325 gene locus_tag LOCUS_09010 1726 1325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09010 2204 1680 gene locus_tag LOCUS_09020 2204 1680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09020 3245 2379 gene locus_tag LOCUS_09030 3245 2379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09030 3913 3644 gene locus_tag LOCUS_09040 3913 3644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09040 4165 3992 gene locus_tag LOCUS_09050 4165 3992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09050 4457 4167 gene locus_tag LOCUS_09060 4457 4167 CDS product HigA family addiction module antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816231.1 protein_id gnl|my_center|LOCUS_09060 4735 4457 gene locus_tag LOCUS_09070 4735 4457 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000605676.1 protein_id gnl|my_center|LOCUS_09070 <5853 5177 gene locus_tag LOCUS_09080 <5853 5177 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_048096703.1:thymidylate synthase >Feature sequence112 454 1446 gene locus_tag LOCUS_09090 454 1446 CDS product 3-dehydroquinate synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881255.1 protein_id gnl|my_center|LOCUS_09090 1451 2581 gene locus_tag LOCUS_09100 gene pheA 1451 2581 CDS product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943245.1 protein_id gnl|my_center|LOCUS_09100 2853 3671 gene locus_tag LOCUS_09110 gene aroE 2853 3671 CDS product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870596.1 protein_id gnl|my_center|LOCUS_09110 3778 5421 gene locus_tag LOCUS_09120 3778 5421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09120 >Feature sequence113 942 13 gene locus_tag LOCUS_09130 942 13 CDS product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942950.1 protein_id gnl|my_center|LOCUS_09130 1295 939 gene locus_tag LOCUS_09140 1295 939 CDS product Hpt domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921000.1 protein_id gnl|my_center|LOCUS_09140 2114 1365 gene locus_tag LOCUS_09150 gene larB 2114 1365 CDS product nickel pincer cofactor biosynthesis protein LarB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947959.1 protein_id gnl|my_center|LOCUS_09150 2489 3226 gene locus_tag LOCUS_09160 gene kdsB 2489 3226 CDS product 3-deoxy-manno-octulosonate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072444.1 protein_id gnl|my_center|LOCUS_09160 4029 3241 gene locus_tag LOCUS_09170 4029 3241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09170 4268 4068 gene locus_tag LOCUS_09180 4268 4068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09180 5560 4340 gene locus_tag LOCUS_09190 gene guaA 5560 4340 CDS product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545424.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09190 >Feature sequence114 1391 468 gene locus_tag LOCUS_09200 1391 468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09200 2551 1952 gene locus_tag LOCUS_09210 2551 1952 CDS product RloB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228074.1 protein_id gnl|my_center|LOCUS_09210 3919 2567 gene locus_tag LOCUS_09220 3919 2567 CDS product ATP/GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015670.1 protein_id gnl|my_center|LOCUS_09220 4272 3988 gene locus_tag LOCUS_09230 4272 3988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09230 5095 4823 gene locus_tag LOCUS_09240 5095 4823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09240 5776 5132 gene locus_tag LOCUS_09250 5776 5132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09250 >Feature sequence115 923 1165 gene locus_tag LOCUS_09260 923 1165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09260 1155 1499 gene locus_tag LOCUS_09270 gene mazF9 1155 1499 CDS product type II toxin-antitoxin system toxin endoribonuclease MazF9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414166.1 protein_id gnl|my_center|LOCUS_09270 1588 3453 gene locus_tag LOCUS_09280 1588 3453 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202910.1 protein_id gnl|my_center|LOCUS_09280 3589 5307 gene locus_tag LOCUS_09290 gene fumA 3589 5307 CDS product class I fumarate hydratase FumA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209418.1 protein_id gnl|my_center|LOCUS_09290 >Feature sequence116 2 1579 gene locus_tag LOCUS_09300 2 1579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09300 1923 2702 gene locus_tag LOCUS_09310 1923 2702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09310 2699 3088 gene locus_tag LOCUS_09320 2699 3088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09320 3216 3665 gene locus_tag LOCUS_09330 3216 3665 CDS product MarR family winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033447334.1 protein_id gnl|my_center|LOCUS_09330 4532 5575 gene locus_tag LOCUS_09340 4532 5575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09340 5530 5751 gene locus_tag LOCUS_09350 5530 5751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09350 >Feature sequence117 1693 3132 gene locus_tag LOCUS_09360 1693 3132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09360 3167 3763 gene locus_tag LOCUS_09370 3167 3763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09370 4114 5286 gene locus_tag LOCUS_09380 4114 5286 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546410.1 protein_id gnl|my_center|LOCUS_09380 >Feature sequence118 347 1549 gene locus_tag LOCUS_09390 347 1549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09390 1695 2300 gene locus_tag LOCUS_09400 1695 2300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09400 2541 3131 gene locus_tag LOCUS_09410 2541 3131 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902963.1 protein_id gnl|my_center|LOCUS_09410 3163 4449 gene locus_tag LOCUS_09420 3163 4449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09420 4523 5143 gene locus_tag LOCUS_09430 4523 5143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09430 >Feature sequence119 1015 362 gene locus_tag LOCUS_09440 1015 362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09440 2849 1008 gene locus_tag LOCUS_09450 2849 1008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09450 3010 2855 gene locus_tag LOCUS_09460 3010 2855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09460 3878 3015 gene locus_tag LOCUS_09470 3878 3015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_09470 4669 3914 gene locus_tag LOCUS_09480 4669 3914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_09480 5086 4727 gene locus_tag LOCUS_09490 5086 4727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09490 >Feature sequence120 944 1474 gene locus_tag LOCUS_09500 gene wcaF 944 1474 CDS product colanic acid biosynthesis acetyltransferase WcaF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097875.1 protein_id gnl|my_center|LOCUS_09500 1479 2879 gene locus_tag LOCUS_09510 1479 2879 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011787346.1 protein_id gnl|my_center|LOCUS_09510 2892 4085 gene locus_tag LOCUS_09520 2892 4085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09520 4233 5180 gene locus_tag LOCUS_09530 4233 5180 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965470.1 protein_id gnl|my_center|LOCUS_09530 >Feature sequence121 2818 875 gene locus_tag LOCUS_09540 gene metG 2818 875 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939333.1 protein_id gnl|my_center|LOCUS_09540 3358 2843 gene locus_tag LOCUS_09550 3358 2843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09550 4491 3424 gene locus_tag LOCUS_09560 gene holB 4491 3424 CDS product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942870.1 protein_id gnl|my_center|LOCUS_09560 4771 4496 gene locus_tag LOCUS_09570 4771 4496 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942391.1 protein_id gnl|my_center|LOCUS_09570 5382 4846 gene locus_tag LOCUS_09580 gene nusG 5382 4846 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546677.1 protein_id gnl|my_center|LOCUS_09580 >Feature sequence122 61 489 gene locus_tag LOCUS_09590 61 489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09590 444 896 gene locus_tag LOCUS_09600 444 896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09600 1060 1869 gene locus_tag LOCUS_09610 1060 1869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09610 1895 3124 gene locus_tag LOCUS_09620 1895 3124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09620 3280 5133 gene locus_tag LOCUS_09630 3280 5133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09630 5287 5177 gene locus_tag LOCUS_r00010 5287 5177 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 >Feature sequence123 396 941 gene locus_tag LOCUS_09640 396 941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09640 2155 2457 gene locus_tag LOCUS_09650 2155 2457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09650 2447 5365 gene locus_tag LOCUS_09660 2447 5365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09660 >Feature sequence124 522 1364 gene locus_tag LOCUS_09670 522 1364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09670 1526 1702 gene locus_tag LOCUS_09680 1526 1702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09680 1932 4019 gene locus_tag LOCUS_09690 gene pnp 1932 4019 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041914012.1 protein_id gnl|my_center|LOCUS_09690 4012 5283 gene locus_tag LOCUS_09700 4012 5283 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942239.1 protein_id gnl|my_center|LOCUS_09700 >Feature sequence125 902 417 gene locus_tag LOCUS_09710 902 417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09710 1132 890 gene locus_tag LOCUS_09720 1132 890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09720 3004 1430 gene locus_tag LOCUS_09730 3004 1430 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942079.1 protein_id gnl|my_center|LOCUS_09730 3340 3005 gene locus_tag LOCUS_09740 3340 3005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09740 3915 3436 gene locus_tag LOCUS_09750 3915 3436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09750 4016 4092 gene locus_tag LOCUS_t00120 4016 4092 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence126 <1 621 gene locus_tag LOCUS_09760 <1 621 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942333.1:bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II 761 1234 gene locus_tag LOCUS_09770 gene ribE 761 1234 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545200.1 protein_id gnl|my_center|LOCUS_09770 1270 1650 gene locus_tag LOCUS_09780 gene nusB 1270 1650 CDS product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460271.1 protein_id gnl|my_center|LOCUS_09780 1936 2562 gene locus_tag LOCUS_09790 1936 2562 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393180.1 protein_id gnl|my_center|LOCUS_09790 4079 2661 gene locus_tag LOCUS_09800 gene mltF 4079 2661 CDS product membrane-bound lytic murein transglycosylase MltF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261381.1 protein_id gnl|my_center|LOCUS_09800 4517 4080 gene locus_tag LOCUS_09810 4517 4080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09810 5222 5058 gene locus_tag LOCUS_09820 5222 5058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09820 >Feature sequence127 1649 657 gene locus_tag LOCUS_09830 1649 657 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003433836.1 protein_id gnl|my_center|LOCUS_09830 3200 1926 gene locus_tag LOCUS_09840 3200 1926 CDS product integron integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943105.1 protein_id gnl|my_center|LOCUS_09840 3328 4170 gene locus_tag LOCUS_09850 3328 4170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09850 4396 5277 gene locus_tag LOCUS_09860 4396 5277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09860 >Feature sequence128 <1 978 gene locus_tag LOCUS_09870 <1 978 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005776619.1:glycosyltransferase family 4 protein 1399 1737 gene locus_tag LOCUS_09880 1399 1737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09880 1734 1949 gene locus_tag LOCUS_09890 1734 1949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09890 2169 2648 gene locus_tag LOCUS_09900 2169 2648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09900 2641 3048 gene locus_tag LOCUS_09910 2641 3048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09910 3060 4328 gene locus_tag LOCUS_09920 3060 4328 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868793.1 protein_id gnl|my_center|LOCUS_09920 4681 4403 gene locus_tag LOCUS_09930 4681 4403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09930 4944 4681 gene locus_tag LOCUS_09940 4944 4681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09940 >Feature sequence129 227 688 gene locus_tag LOCUS_09950 227 688 CDS product flagellar basal body-associated FliL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881216.1 protein_id gnl|my_center|LOCUS_09950 702 1658 gene locus_tag LOCUS_09960 gene fliM 702 1658 CDS product flagellar motor switch protein FliM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545847.1 protein_id gnl|my_center|LOCUS_09960 1678 2079 gene locus_tag LOCUS_09970 1678 2079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09970 2076 2453 gene locus_tag LOCUS_09980 2076 2453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09980 2645 3364 gene locus_tag LOCUS_09990 gene fliP 2645 3364 CDS product flagellar type III secretion system pore protein FliP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941092.1 protein_id gnl|my_center|LOCUS_09990 3357 3653 gene locus_tag LOCUS_10000 gene fliQ 3357 3653 CDS product flagellar biosynthesis protein FliQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937354.1 protein_id gnl|my_center|LOCUS_10000 3885 3682 gene locus_tag LOCUS_10010 3885 3682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10010 3779 4426 gene locus_tag LOCUS_10020 gene fliR 3779 4426 CDS product flagellar biosynthetic protein FliR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392309.1 protein_id gnl|my_center|LOCUS_10020 >Feature sequence130 566 405 gene locus_tag LOCUS_10030 566 405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10030 1434 502 gene locus_tag LOCUS_10040 gene ruvB 1434 502 CDS product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426579.1 protein_id gnl|my_center|LOCUS_10040 1844 2323 gene locus_tag LOCUS_10050 1844 2323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10050 2765 2415 gene locus_tag LOCUS_10060 2765 2415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10060 3456 2758 gene locus_tag LOCUS_10070 3456 2758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940532.1 protein_id gnl|my_center|LOCUS_10070 <5404 3927 gene locus_tag LOCUS_10080 <5404 3927 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011016067.1:tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE >Feature sequence131 1273 2118 gene locus_tag LOCUS_10090 1273 2118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10090 2158 3702 gene locus_tag LOCUS_10100 2158 3702 CDS product polyamine aminopropyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880867.1 protein_id gnl|my_center|LOCUS_10100 3810 4157 gene locus_tag LOCUS_10110 3810 4157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10110 4253 4489 gene locus_tag LOCUS_10120 4253 4489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10120 4450 4947 gene locus_tag LOCUS_10130 4450 4947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10130 >Feature sequence132 1829 1107 gene locus_tag LOCUS_10140 gene nagR 1829 1107 CDS product transcriptional regulator NagR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228089.1 protein_id gnl|my_center|LOCUS_10140 2488 2105 gene locus_tag LOCUS_10150 2488 2105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10150 2811 4643 gene locus_tag LOCUS_10160 gene ligA 2811 4643 CDS product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880378.1 protein_id gnl|my_center|LOCUS_10160 4797 5147 gene locus_tag LOCUS_10170 gene ihfA 4797 5147 CDS product integration host factor subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005419121.1 protein_id gnl|my_center|LOCUS_10170 >Feature sequence133 1096 878 gene locus_tag LOCUS_10180 1096 878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10180 1914 1141 gene locus_tag LOCUS_10190 1914 1141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10190 2611 2270 gene locus_tag LOCUS_10200 2611 2270 CDS product Mth938-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546371.1 protein_id gnl|my_center|LOCUS_10200 4142 2820 gene locus_tag LOCUS_10210 4142 2820 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065074.1 protein_id gnl|my_center|LOCUS_10210 5155 4205 gene locus_tag LOCUS_10220 5155 4205 CDS product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_174269896.1 protein_id gnl|my_center|LOCUS_10220 >Feature sequence134 520 852 gene locus_tag LOCUS_10230 520 852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_10230 946 1119 gene locus_tag LOCUS_10240 946 1119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_10240 1345 1992 gene locus_tag LOCUS_10250 1345 1992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10250 3582 2008 gene locus_tag LOCUS_10260 3582 2008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10260 >Feature sequence135 2529 556 gene locus_tag LOCUS_10270 gene aprA 2529 556 CDS product adenylyl-sulfate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938147.1 protein_id gnl|my_center|LOCUS_10270 3034 2603 gene locus_tag LOCUS_10280 gene aprB 3034 2603 CDS product adenylyl-sulfate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932545.1 protein_id gnl|my_center|LOCUS_10280 3562 4158 gene locus_tag LOCUS_10290 3562 4158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10290 >Feature sequence136 602 441 gene locus_tag LOCUS_10300 602 441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10300 2006 1215 gene locus_tag LOCUS_10310 2006 1215 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023815.1 protein_id gnl|my_center|LOCUS_10310 2740 2207 gene locus_tag LOCUS_10320 2740 2207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10320 3194 2769 gene locus_tag LOCUS_10330 3194 2769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10330 4091 3777 gene locus_tag LOCUS_10340 4091 3777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10340 4688 4332 gene locus_tag LOCUS_10350 4688 4332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10350 >Feature sequence137 1893 40 gene locus_tag LOCUS_10360 1893 40 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10360 <5112 2206 gene locus_tag LOCUS_10370 <5112 2206 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011266458.1:bifunctional [glutamate--ammonia ligase]-adenylyl-L-tyrosine phosphorylase/[glutamate--ammonia-ligase] adenylyltransferase >Feature sequence138 295 2034 gene locus_tag LOCUS_10380 295 2034 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108823.1 protein_id gnl|my_center|LOCUS_10380 2352 2579 gene locus_tag LOCUS_10390 2352 2579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10390 2928 3122 gene locus_tag LOCUS_10400 2928 3122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10400 >Feature sequence139 169 1557 gene locus_tag LOCUS_10410 169 1557 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405033.1 protein_id gnl|my_center|LOCUS_10410 1558 2070 gene locus_tag LOCUS_10420 1558 2070 CDS product Slp family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942462.1 protein_id gnl|my_center|LOCUS_10420 2484 3275 gene locus_tag LOCUS_10430 2484 3275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10430 3447 4322 gene locus_tag LOCUS_10440 3447 4322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10440 >Feature sequence140 <1 962 gene locus_tag LOCUS_10450 <1 962 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012546272.1:citramalate synthase 1237 2793 gene locus_tag LOCUS_10460 1237 2793 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546793.1 protein_id gnl|my_center|LOCUS_10460 3061 3540 gene locus_tag LOCUS_10470 3061 3540 CDS product mobile mystery protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942039.1 protein_id gnl|my_center|LOCUS_10470 3537 4121 gene locus_tag LOCUS_10480 3537 4121 CDS product mobile mystery protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942040.1 protein_id gnl|my_center|LOCUS_10480 >Feature sequence141 2 880 gene locus_tag LOCUS_10490 gene ftsX 2 880 CDS product permease-like cell division protein FtsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942418.1 protein_id gnl|my_center|LOCUS_10490 844 2052 gene locus_tag LOCUS_10500 844 2052 CDS product peptidoglycan DD-metalloendopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942417.1 protein_id gnl|my_center|LOCUS_10500 2082 3446 gene locus_tag LOCUS_10510 2082 3446 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942416.1 protein_id gnl|my_center|LOCUS_10510 3653 4432 gene locus_tag LOCUS_10520 3653 4432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10520 5043 4970 gene locus_tag LOCUS_t00130 5043 4970 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence142 1801 38 gene locus_tag LOCUS_10530 1801 38 CDS product formate--tetrahydrofolate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546634.1 protein_id gnl|my_center|LOCUS_10530 2752 2117 gene locus_tag LOCUS_10540 2752 2117 CDS product histidinol phosphate phosphatase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545579.1 protein_id gnl|my_center|LOCUS_10540 3392 2991 gene locus_tag LOCUS_10550 3392 2991 CDS product bifunctional nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583213.1 protein_id gnl|my_center|LOCUS_10550 4800 3544 gene locus_tag LOCUS_10560 gene miaB 4800 3544 CDS product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005620645.1 protein_id gnl|my_center|LOCUS_10560 >Feature sequence143 911 150 gene locus_tag LOCUS_10570 gene pstB 911 150 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938383.1 protein_id gnl|my_center|LOCUS_10570 1240 1076 gene locus_tag LOCUS_10580 1240 1076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10580 1917 1240 gene locus_tag LOCUS_10590 1917 1240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10590 2971 2066 gene locus_tag LOCUS_10600 gene pstC 2971 2066 CDS product phosphate ABC transporter permease subunit PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011791822.1 protein_id gnl|my_center|LOCUS_10600 4040 3114 gene locus_tag LOCUS_10610 4040 3114 CDS product phosphate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868851.1 protein_id gnl|my_center|LOCUS_10610 >Feature sequence144 524 724 gene locus_tag LOCUS_10620 524 724 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263390.1 protein_id gnl|my_center|LOCUS_10620 753 2216 gene locus_tag LOCUS_10630 gene ppcA 753 2216 CDS product phosphoenolpyruvate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060929.1 protein_id gnl|my_center|LOCUS_10630 2253 2408 gene locus_tag LOCUS_10640 2253 2408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10640 2380 3057 gene locus_tag LOCUS_10650 2380 3057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10650 3108 3524 gene locus_tag LOCUS_10660 3108 3524 CDS product DUF2914 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235044869.1 protein_id gnl|my_center|LOCUS_10660 3728 3856 gene locus_tag LOCUS_10670 3728 3856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10670 3837 3974 gene locus_tag LOCUS_10680 3837 3974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10680 3999 4244 gene locus_tag LOCUS_10690 3999 4244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10690 >Feature sequence145 1065 1199 gene locus_tag LOCUS_10700 1065 1199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10700 1880 1323 gene locus_tag LOCUS_10710 1880 1323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10710 4525 1880 gene locus_tag LOCUS_10720 4525 1880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10720 >Feature sequence146 122 1090 gene locus_tag LOCUS_10730 gene cas6 122 1090 CDS product CRISPR system precrRNA processing endoribonuclease RAMP protein Cas6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545643.1 protein_id gnl|my_center|LOCUS_10730 1095 2681 gene locus_tag LOCUS_10740 1095 2681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10740 2843 3043 gene locus_tag LOCUS_10750 2843 3043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10750 3171 3323 gene locus_tag LOCUS_10760 3171 3323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10760 3601 3882 gene locus_tag LOCUS_10770 3601 3882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10770 3872 4210 gene locus_tag LOCUS_10780 3872 4210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545064.1 protein_id gnl|my_center|LOCUS_10780 4295 4549 gene locus_tag LOCUS_10790 4295 4549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10790 >Feature sequence147 706 1629 gene locus_tag LOCUS_10800 706 1629 CDS product manganese-dependent inorganic pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938927.1 protein_id gnl|my_center|LOCUS_10800 2151 2720 gene locus_tag LOCUS_10810 2151 2720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10810 2717 4654 gene locus_tag LOCUS_10820 gene fusA 2717 4654 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545225.1 protein_id gnl|my_center|LOCUS_10820 >Feature sequence148 1743 484 gene locus_tag LOCUS_10830 gene dnaA 1743 484 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947895.1 protein_id gnl|my_center|LOCUS_10830 2581 3588 gene locus_tag LOCUS_10840 gene pdxA 2581 3588 CDS product 4-hydroxythreonine-4-phosphate dehydrogenase PdxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940791.1 protein_id gnl|my_center|LOCUS_10840 >Feature sequence149 618 151 gene locus_tag LOCUS_10850 gene ispF 618 151 CDS product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002367570.1 protein_id gnl|my_center|LOCUS_10850 3065 846 gene locus_tag LOCUS_10860 gene pilB 3065 846 CDS product type IV-A pilus assembly ATPase PilB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546013.1 protein_id gnl|my_center|LOCUS_10860 3322 3095 gene locus_tag LOCUS_10870 3322 3095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10870 4889 3327 gene locus_tag LOCUS_10880 4889 3327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10880 >Feature sequence150 1286 432 gene locus_tag LOCUS_10890 1286 432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10890 2761 1694 gene locus_tag LOCUS_10900 2761 1694 CDS product toll/interleukin-1 receptor domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002213208.1 protein_id gnl|my_center|LOCUS_10900 3594 2881 gene locus_tag LOCUS_10910 3594 2881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10910 4067 4621 gene locus_tag LOCUS_10920 4067 4621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10920 >Feature sequence151 604 1107 gene locus_tag LOCUS_10930 604 1107 CDS product molybdenum cofactor biosynthesis protein MoaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000117124.1 protein_id gnl|my_center|LOCUS_10930 1936 1253 gene locus_tag LOCUS_10940 1936 1253 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939817.1 protein_id gnl|my_center|LOCUS_10940 2051 2467 gene locus_tag LOCUS_10950 2051 2467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10950 2425 2982 gene locus_tag LOCUS_10960 2425 2982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10960 3087 3632 gene locus_tag LOCUS_10970 3087 3632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10970 3677 4420 gene locus_tag LOCUS_10980 3677 4420 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943860.1 protein_id gnl|my_center|LOCUS_10980 >Feature sequence152 393 659 gene locus_tag LOCUS_10990 393 659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10990 877 1908 gene locus_tag LOCUS_11000 877 1908 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164924797.1 protein_id gnl|my_center|LOCUS_11000 2440 2081 gene locus_tag LOCUS_11010 2440 2081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11010 2919 2437 gene locus_tag LOCUS_11020 2919 2437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11020 3299 2913 gene locus_tag LOCUS_11030 3299 2913 CDS product prepilin-type N-terminal cleavage/methylation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942420.1 protein_id gnl|my_center|LOCUS_11030 4105 3638 gene locus_tag LOCUS_11040 4105 3638 CDS product type II secretion system protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942421.1 protein_id gnl|my_center|LOCUS_11040 4829 4128 gene locus_tag LOCUS_11050 4829 4128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11050 >Feature sequence153 157 372 gene locus_tag LOCUS_11060 157 372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11060 853 515 gene locus_tag LOCUS_11070 853 515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11070 995 777 gene locus_tag LOCUS_11080 995 777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11080 2130 1057 gene locus_tag LOCUS_11090 2130 1057 CDS product THUMP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144029.1 protein_id gnl|my_center|LOCUS_11090 2782 2174 gene locus_tag LOCUS_11100 2782 2174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11100 4593 2779 gene locus_tag LOCUS_11110 4593 2779 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942184.1 protein_id gnl|my_center|LOCUS_11110 >Feature sequence154 1461 508 gene locus_tag LOCUS_11120 gene argC 1461 508 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943503.1 protein_id gnl|my_center|LOCUS_11120 2107 3741 gene locus_tag LOCUS_11130 gene panP 2107 3741 CDS product putative pyridoxal-dependent aspartate 1-decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483514.1 protein_id gnl|my_center|LOCUS_11130 >Feature sequence155 424 2115 gene locus_tag LOCUS_11140 424 2115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_11140 2283 2648 gene locus_tag LOCUS_11150 2283 2648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11150 3181 3756 gene locus_tag LOCUS_11160 3181 3756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11160 >Feature sequence156 1962 823 gene locus_tag LOCUS_11170 1962 823 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228090.1 protein_id gnl|my_center|LOCUS_11170 3252 2017 gene locus_tag LOCUS_11180 3252 2017 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257578.1 protein_id gnl|my_center|LOCUS_11180 4228 3197 gene locus_tag LOCUS_11190 4228 3197 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942605.1 protein_id gnl|my_center|LOCUS_11190 >Feature sequence157 2 520 gene locus_tag LOCUS_11200 gene ruvC 2 520 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902123.1 protein_id gnl|my_center|LOCUS_11200 517 1134 gene locus_tag LOCUS_11210 gene ruvA 517 1134 CDS product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941737.1 protein_id gnl|my_center|LOCUS_11210 1532 1705 gene locus_tag LOCUS_11220 1532 1705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11220 2052 3227 gene locus_tag LOCUS_11230 2052 3227 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250773.1 protein_id gnl|my_center|LOCUS_11230 3327 4667 gene locus_tag LOCUS_11240 3327 4667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11240 >Feature sequence158 1620 244 gene locus_tag LOCUS_11250 1620 244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11250 3985 1913 gene locus_tag LOCUS_11260 gene fusA 3985 1913 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942578.1 protein_id gnl|my_center|LOCUS_11260 >Feature sequence159 55 1251 gene locus_tag LOCUS_11270 gene pgk 55 1251 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942273.1 protein_id gnl|my_center|LOCUS_11270 1565 2140 gene locus_tag LOCUS_11280 1565 2140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11280 2209 3270 gene locus_tag LOCUS_11290 2209 3270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11290 3860 3399 gene locus_tag LOCUS_11300 3860 3399 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546022.1 protein_id gnl|my_center|LOCUS_11300 4185 4691 gene locus_tag LOCUS_11310 4185 4691 CDS product HNH endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125831.1 protein_id gnl|my_center|LOCUS_11310 >Feature sequence160 2837 1860 gene locus_tag LOCUS_11320 2837 1860 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_045231753.1 protein_id gnl|my_center|LOCUS_11320 3358 3092 gene locus_tag LOCUS_11330 3358 3092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11330 4487 3795 gene locus_tag LOCUS_11340 4487 3795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11340 >Feature sequence161 1011 268 gene locus_tag LOCUS_11350 gene panB 1011 268 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942349.1 protein_id gnl|my_center|LOCUS_11350 1358 2629 gene locus_tag LOCUS_11360 gene hisS 1358 2629 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942303.1 protein_id gnl|my_center|LOCUS_11360 2938 4329 gene locus_tag LOCUS_11370 gene aspS 2938 4329 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942109.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11370 4274 4666 gene locus_tag LOCUS_11380 4274 4666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11380 >Feature sequence162 361 3777 gene locus_tag LOCUS_11390 361 3777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11390 >Feature sequence163 1627 1121 gene locus_tag LOCUS_11400 1627 1121 CDS product type IV toxin-antitoxin system AbiEi family antitoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142655.1 protein_id gnl|my_center|LOCUS_11400 2093 2263 gene locus_tag LOCUS_11410 2093 2263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11410 2229 2798 gene locus_tag LOCUS_11420 2229 2798 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203468.1 protein_id gnl|my_center|LOCUS_11420 2853 3521 gene locus_tag LOCUS_11430 2853 3521 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861855.1 protein_id gnl|my_center|LOCUS_11430 4128 3619 gene locus_tag LOCUS_11440 4128 3619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11440 <4697 4135 gene locus_tag LOCUS_11450 <4697 4135 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012259389.1:lactate racemase domain-containing protein >Feature sequence164 110 1312 gene locus_tag LOCUS_11460 110 1312 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072442.1 protein_id gnl|my_center|LOCUS_11460 1567 2634 gene locus_tag LOCUS_11470 1567 2634 CDS product iron-containing alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072443.1 protein_id gnl|my_center|LOCUS_11470 >Feature sequence165 744 1061 gene locus_tag LOCUS_11480 744 1061 CDS product DUF6516 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_045668639.1 protein_id gnl|my_center|LOCUS_11480 1063 1404 gene locus_tag LOCUS_11490 1063 1404 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941219.1 protein_id gnl|my_center|LOCUS_11490 1513 3279 gene locus_tag LOCUS_11500 1513 3279 CDS product BatD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003021648.1 protein_id gnl|my_center|LOCUS_11500 3276 4094 gene locus_tag LOCUS_11510 3276 4094 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962306.1 protein_id gnl|my_center|LOCUS_11510 4149 4664 gene locus_tag LOCUS_11520 gene cobO 4149 4664 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002666509.1 protein_id gnl|my_center|LOCUS_11520 >Feature sequence166 1174 413 gene locus_tag LOCUS_11530 gene pstB 1174 413 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938383.1 protein_id gnl|my_center|LOCUS_11530 1668 1504 gene locus_tag LOCUS_11540 1668 1504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11540 2219 1668 gene locus_tag LOCUS_11550 2219 1668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11550 3203 2343 gene locus_tag LOCUS_11560 gene pstC 3203 2343 CDS product phosphate ABC transporter permease subunit PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011791822.1 protein_id gnl|my_center|LOCUS_11560 4357 3485 gene locus_tag LOCUS_11570 4357 3485 CDS product phosphate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868851.1 protein_id gnl|my_center|LOCUS_11570 >Feature sequence167 2336 2989 gene locus_tag LOCUS_11580 2336 2989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11580 3023 3508 gene locus_tag LOCUS_11590 3023 3508 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258683.1 protein_id gnl|my_center|LOCUS_11590 >Feature sequence168 433 939 gene locus_tag LOCUS_11600 433 939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11600 1072 1728 gene locus_tag LOCUS_11610 1072 1728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11610 1721 2326 gene locus_tag LOCUS_11620 1721 2326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11620 2337 2471 gene locus_tag LOCUS_11630 2337 2471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11630 4272 2986 gene locus_tag LOCUS_11640 4272 2986 CDS product IS110 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066867479.1 protein_id gnl|my_center|LOCUS_11640 >Feature sequence169 771 436 gene locus_tag LOCUS_11650 771 436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11650 2156 1098 gene locus_tag LOCUS_11660 2156 1098 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000029699.1 protein_id gnl|my_center|LOCUS_11660 3266 2541 gene locus_tag LOCUS_11670 3266 2541 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038753.1 protein_id gnl|my_center|LOCUS_11670 4481 4239 gene locus_tag LOCUS_11680 4481 4239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11680 >Feature sequence170 3 1154 gene locus_tag LOCUS_11690 3 1154 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941790.1 protein_id gnl|my_center|LOCUS_11690 1524 1141 gene locus_tag LOCUS_11700 1524 1141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11700 1644 4445 gene locus_tag LOCUS_11710 gene ileS 1644 4445 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943758.1 protein_id gnl|my_center|LOCUS_11710 >Feature sequence171 223 357 gene locus_tag LOCUS_11720 223 357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11720 623 2146 gene locus_tag LOCUS_11730 623 2146 CDS product oligosaccharide flippase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198049.1 protein_id gnl|my_center|LOCUS_11730 2517 3473 gene locus_tag LOCUS_11740 2517 3473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11740 3470 4540 gene locus_tag LOCUS_11750 3470 4540 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387716.1 protein_id gnl|my_center|LOCUS_11750 >Feature sequence172 174 10 gene locus_tag LOCUS_11760 174 10 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11760 481 167 gene locus_tag LOCUS_11770 481 167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393803.1 protein_id gnl|my_center|LOCUS_11770 894 673 gene locus_tag LOCUS_11780 894 673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11780 1798 1720 gene locus_tag LOCUS_t00140 1798 1720 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 2083 2008 gene locus_tag LOCUS_t00150 2083 2008 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 2780 2313 gene locus_tag LOCUS_11790 2780 2313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11790 4107 2740 gene locus_tag LOCUS_11800 4107 2740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11800 >Feature sequence173 <1 1145 gene locus_tag LOCUS_11810 <1 1145 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012583708.1:DegT/DnrJ/EryC1/StrS family aminotransferase 1462 1737 gene locus_tag LOCUS_11820 1462 1737 CDS product HPr family phosphocarrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198013.1 protein_id gnl|my_center|LOCUS_11820 1740 3533 gene locus_tag LOCUS_11830 gene ptsP 1740 3533 CDS product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942526.1 protein_id gnl|my_center|LOCUS_11830 3481 3696 gene locus_tag LOCUS_11840 3481 3696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11840 3714 3917 gene locus_tag LOCUS_11850 3714 3917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11850 4136 4486 gene locus_tag LOCUS_tm00010 4136 4486 tmRNA product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence174 77 1528 gene locus_tag LOCUS_11860 77 1528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11860 1540 2364 gene locus_tag LOCUS_11870 1540 2364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11870 2715 3503 gene locus_tag LOCUS_11880 2715 3503 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941330.1 protein_id gnl|my_center|LOCUS_11880 3518 4450 gene locus_tag LOCUS_11890 3518 4450 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_039643290.1 protein_id gnl|my_center|LOCUS_11890 >Feature sequence175 755 2206 gene locus_tag LOCUS_11900 755 2206 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944025.1 protein_id gnl|my_center|LOCUS_11900 3127 2264 gene locus_tag LOCUS_11910 3127 2264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11910 <4447 3182 gene locus_tag LOCUS_11920 <4447 3182 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003244686.1:long-chain-fatty-acid--CoA ligase LcfB >Feature sequence176 65 673 gene locus_tag LOCUS_11930 65 673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11930 621 1376 gene locus_tag LOCUS_11940 621 1376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11940 1373 2353 gene locus_tag LOCUS_11950 1373 2353 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941971.1 protein_id gnl|my_center|LOCUS_11950 2357 3562 gene locus_tag LOCUS_11960 2357 3562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11960 3569 4129 gene locus_tag LOCUS_11970 3569 4129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11970 4228 4446 gene locus_tag LOCUS_11980 4228 4446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11980 >Feature sequence177 563 66 gene locus_tag LOCUS_11990 563 66 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11990 1357 560 gene locus_tag LOCUS_12000 1357 560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12000 4254 1390 gene locus_tag LOCUS_12010 4254 1390 CDS product Hsp70 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454869.1 protein_id gnl|my_center|LOCUS_12010 >Feature sequence178 193 675 gene locus_tag LOCUS_12020 193 675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12020 966 1610 gene locus_tag LOCUS_12030 966 1610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12030 1802 3529 gene locus_tag LOCUS_12040 1802 3529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12040 >Feature sequence179 812 979 gene locus_tag LOCUS_12050 812 979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12050 1011 1811 gene locus_tag LOCUS_12060 1011 1811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12060 2417 2716 gene locus_tag LOCUS_12070 2417 2716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12070 >Feature sequence180 544 1080 gene locus_tag LOCUS_12080 544 1080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12080 2099 1128 gene locus_tag LOCUS_12090 2099 1128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12090 2297 2650 gene locus_tag LOCUS_12100 2297 2650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12100 2675 3073 gene locus_tag LOCUS_12110 2675 3073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12110 3412 4185 gene locus_tag LOCUS_12120 3412 4185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12120 >Feature sequence181 523 654 gene locus_tag LOCUS_12130 523 654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12130 629 1615 gene locus_tag LOCUS_12140 gene rhuM 629 1615 CDS product RhuM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019212714.1 protein_id gnl|my_center|LOCUS_12140 1900 2631 gene locus_tag LOCUS_12150 1900 2631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12150 2540 2959 gene locus_tag LOCUS_12160 2540 2959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12160 3054 3251 gene locus_tag LOCUS_12170 3054 3251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12170 3379 3717 gene locus_tag LOCUS_12180 3379 3717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12180 >Feature sequence182 <1 988 gene locus_tag LOCUS_12190 <1 988 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011861666.1:thioether cross-link-forming SCIFF peptide maturase 1831 1124 gene locus_tag LOCUS_12200 1831 1124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12200 2496 2086 gene locus_tag LOCUS_12210 2496 2086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12210 3832 2654 gene locus_tag LOCUS_12220 3832 2654 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230809.1 protein_id gnl|my_center|LOCUS_12220 >Feature sequence183 443 102 gene locus_tag LOCUS_12230 443 102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12230 860 666 gene locus_tag LOCUS_12240 860 666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12240 1835 1176 gene locus_tag LOCUS_12250 1835 1176 CDS product RloB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228074.1 protein_id gnl|my_center|LOCUS_12250 3096 1843 gene locus_tag LOCUS_12260 3096 1843 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228075.1 protein_id gnl|my_center|LOCUS_12260 3934 3479 gene locus_tag LOCUS_12270 3934 3479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12270 >Feature sequence184 <1 1846 gene locus_tag LOCUS_12280 <1 1846 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012582994.1:CRISPR-associated helicase/endonuclease Cas3 1913 2305 gene locus_tag LOCUS_12290 1913 2305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12290 2278 2601 gene locus_tag LOCUS_12300 2278 2601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12300 2598 3197 gene locus_tag LOCUS_12310 gene cas4 2598 3197 CDS product CRISPR-associated protein Cas4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879370.1 protein_id gnl|my_center|LOCUS_12310 3266 3559 gene locus_tag LOCUS_12320 3266 3559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12320 3520 3654 gene locus_tag LOCUS_12330 3520 3654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12330 3718 3837 gene locus_tag LOCUS_12340 3718 3837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12340 3833 4302 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq attgaagagaagattccattaaaacaaggattgaaac >Feature sequence185 1739 1056 gene locus_tag LOCUS_12350 1739 1056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12350 2784 1741 gene locus_tag LOCUS_12360 2784 1741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12360 3870 2797 gene locus_tag LOCUS_12370 3870 2797 CDS product DNA cytosine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234063.1 protein_id gnl|my_center|LOCUS_12370 >Feature sequence186 503 288 gene locus_tag LOCUS_12380 503 288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12380 831 457 gene locus_tag LOCUS_12390 831 457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12390 1195 932 gene locus_tag LOCUS_12400 1195 932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12400 2999 1146 gene locus_tag LOCUS_12410 2999 1146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12410 3600 3097 gene locus_tag LOCUS_12420 3600 3097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12420 >Feature sequence187 564 1172 gene locus_tag LOCUS_12430 564 1172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12430 1186 1806 gene locus_tag LOCUS_12440 1186 1806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12440 1895 2938 gene locus_tag LOCUS_12450 1895 2938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12450 3125 3634 gene locus_tag LOCUS_12460 3125 3634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12460 3724 4266 gene locus_tag LOCUS_12470 3724 4266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12470 >Feature sequence188 927 673 gene locus_tag LOCUS_12480 927 673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12480 1797 1165 gene locus_tag LOCUS_12490 1797 1165 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546220.1 protein_id gnl|my_center|LOCUS_12490 3376 1775 gene locus_tag LOCUS_12500 3376 1775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12500 <4286 3550 gene locus_tag LOCUS_12510 <4286 3550 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_201626171.1:phosphate/phosphite/phosphonate ABC transporter substrate-binding protein >Feature sequence189 1368 13 gene locus_tag LOCUS_12520 1368 13 CDS product bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868207.1 protein_id gnl|my_center|LOCUS_12520 2672 1761 gene locus_tag LOCUS_12530 2672 1761 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002673213.1 protein_id gnl|my_center|LOCUS_12530 3286 2669 gene locus_tag LOCUS_12540 3286 2669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12540 4006 3878 gene locus_tag LOCUS_12550 4006 3878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12550 >Feature sequence190 2147 1023 gene locus_tag LOCUS_12560 2147 1023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12560 3168 2305 gene locus_tag LOCUS_12570 3168 2305 CDS product YihY/virulence factor BrkB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963493.1 protein_id gnl|my_center|LOCUS_12570 3870 3400 gene locus_tag LOCUS_12580 3870 3400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12580 >Feature sequence191 <1 604 gene locus_tag LOCUS_12590 <1 604 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000039671.1:RNA polymerase sigma factor WhiG 861 1397 gene locus_tag LOCUS_12600 861 1397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12600 1807 2547 gene locus_tag LOCUS_12610 gene flgF 1807 2547 CDS product flagellar basal-body rod protein FlgF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545861.1 protein_id gnl|my_center|LOCUS_12610 2774 3562 gene locus_tag LOCUS_12620 gene flgG 2774 3562 CDS product flagellar basal-body rod protein FlgG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943676.1 protein_id gnl|my_center|LOCUS_12620 >Feature sequence192 <1 2051 gene locus_tag LOCUS_12630 <1 2051 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011015000.1:glutamine--fructose-6-phosphate transaminase (isomerizing) 2113 2454 gene locus_tag LOCUS_12640 2113 2454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12640 2772 3653 gene locus_tag LOCUS_12650 2772 3653 CDS product Rossmann-like and DUF2520 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391687.1 protein_id gnl|my_center|LOCUS_12650 >Feature sequence193 472 152 gene locus_tag LOCUS_12660 472 152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12660 2445 574 gene locus_tag LOCUS_12670 2445 574 CDS product UvrD-helicase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001289508.1 protein_id gnl|my_center|LOCUS_12670 <4219 2442 gene locus_tag LOCUS_12680 <4219 2442 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003113491.1:ATP-dependent endonuclease >Feature sequence194 594 28 gene locus_tag LOCUS_12690 594 28 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12690 1360 608 gene locus_tag LOCUS_12700 1360 608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12700 2309 1353 gene locus_tag LOCUS_12710 2309 1353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12710 3392 2664 gene locus_tag LOCUS_12720 3392 2664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12720 3809 3651 gene locus_tag LOCUS_12730 3809 3651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12730 >Feature sequence195 1540 326 gene locus_tag LOCUS_12740 1540 326 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003689532.1 protein_id gnl|my_center|LOCUS_12740 2296 1646 gene locus_tag LOCUS_12750 2296 1646 CDS product XTP/dITP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942438.1 protein_id gnl|my_center|LOCUS_12750 2798 3733 gene locus_tag LOCUS_12760 2798 3733 CDS product glycosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022353.1 protein_id gnl|my_center|LOCUS_12760 >Feature sequence196 1459 362 gene locus_tag LOCUS_12770 1459 362 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958440.1 protein_id gnl|my_center|LOCUS_12770 1735 1565 gene locus_tag LOCUS_12780 1735 1565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12780 3818 2709 gene locus_tag LOCUS_12790 3818 2709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12790 >Feature sequence197 715 999 gene locus_tag LOCUS_12800 715 999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12800 1103 1243 gene locus_tag LOCUS_12810 1103 1243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12810 1372 1764 gene locus_tag LOCUS_12820 1372 1764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12820 1905 2246 gene locus_tag LOCUS_12830 1905 2246 CDS product HigA family addiction module antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_110750833.1 protein_id gnl|my_center|LOCUS_12830 2373 2924 gene locus_tag LOCUS_12840 2373 2924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12840 2991 3521 gene locus_tag LOCUS_12850 2991 3521 CDS product NTPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082498.1 protein_id gnl|my_center|LOCUS_12850 >Feature sequence198 1801 92 gene locus_tag LOCUS_12860 1801 92 CDS product YcaO-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939485.1 protein_id gnl|my_center|LOCUS_12860 2336 1968 gene locus_tag LOCUS_12870 2336 1968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12870 2823 3077 gene locus_tag LOCUS_12880 2823 3077 CDS product AbrB/MazE/SpoVT family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680104.1 protein_id gnl|my_center|LOCUS_12880 3071 3394 gene locus_tag LOCUS_12890 3071 3394 CDS product type II toxin-antitoxin system PemK/MazF family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680107.1 protein_id gnl|my_center|LOCUS_12890 >Feature sequence199 103 1398 gene locus_tag LOCUS_12900 103 1398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12900 3465 1543 gene locus_tag LOCUS_12910 gene dnaK 3465 1543 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940711.1 protein_id gnl|my_center|LOCUS_12910 4094 3501 gene locus_tag LOCUS_12920 gene grpE 4094 3501 CDS product nucleotide exchange factor GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816478.1 protein_id gnl|my_center|LOCUS_12920 >Feature sequence200 2554 1481 gene locus_tag LOCUS_12930 2554 1481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12930 2598 2825 gene locus_tag LOCUS_12940 2598 2825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12940 3715 3056 gene locus_tag LOCUS_12950 3715 3056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12950 >Feature sequence201 1217 315 gene locus_tag LOCUS_12960 1217 315 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947933.1 protein_id gnl|my_center|LOCUS_12960 1956 2681 gene locus_tag LOCUS_12970 1956 2681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12970 >Feature sequence202 152 361 gene locus_tag LOCUS_12980 152 361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12980 361 2127 gene locus_tag LOCUS_12990 361 2127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12990 2099 2587 gene locus_tag LOCUS_13000 2099 2587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13000 2603 4096 gene locus_tag LOCUS_13010 gene rng 2603 4096 CDS product ribonuclease G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943853.1 protein_id gnl|my_center|LOCUS_13010 >Feature sequence203 1283 129 gene locus_tag LOCUS_13020 1283 129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13020 1696 1286 gene locus_tag LOCUS_13030 1696 1286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13030 1922 1791 gene locus_tag LOCUS_13040 1922 1791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13040 2380 2610 gene locus_tag LOCUS_13050 2380 2610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13050 2600 3016 gene locus_tag LOCUS_13060 2600 3016 CDS product PIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680499.1 protein_id gnl|my_center|LOCUS_13060 3458 3339 gene locus_tag LOCUS_13070 3458 3339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13070 >Feature sequence204 1266 880 gene locus_tag LOCUS_13080 1266 880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13080 2064 1288 gene locus_tag LOCUS_13090 2064 1288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13090 2671 2189 gene locus_tag LOCUS_13100 2671 2189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13100 3635 2643 gene locus_tag LOCUS_13110 3635 2643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13110 3880 3632 gene locus_tag LOCUS_13120 3880 3632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13120 >Feature sequence205 249 325 gene locus_tag LOCUS_t00160 249 325 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 690 490 gene locus_tag LOCUS_13130 690 490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13130 855 703 gene locus_tag LOCUS_13140 855 703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13140 1761 1126 gene locus_tag LOCUS_13150 gene nth 1761 1126 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005895383.1 protein_id gnl|my_center|LOCUS_13150 1779 2774 gene locus_tag LOCUS_13160 1779 2774 CDS product DUF814 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583848.1 protein_id gnl|my_center|LOCUS_13160 4034 2988 gene locus_tag LOCUS_13170 gene rlmN 4034 2988 CDS product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941772.1 protein_id gnl|my_center|LOCUS_13170 >Feature sequence206 16 555 gene locus_tag LOCUS_13180 16 555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13180 548 1303 gene locus_tag LOCUS_13190 548 1303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13190 1471 1379 gene locus_tag LOCUS_t00170 1471 1379 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 1767 1680 gene locus_tag LOCUS_t00180 1767 1680 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 1932 2390 gene locus_tag LOCUS_13200 1932 2390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13200 2664 4031 gene locus_tag LOCUS_13210 2664 4031 CDS product cytochrome c biogenesis protein ResB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941275.1 protein_id gnl|my_center|LOCUS_13210 >Feature sequence207 1437 433 gene locus_tag LOCUS_13220 1437 433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13220 1834 1481 gene locus_tag LOCUS_13230 gene tnpB 1834 1481 CDS product IS66 family insertion sequence element accessory protein TnpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393820.1 protein_id gnl|my_center|LOCUS_13230 2097 1834 gene locus_tag LOCUS_13240 2097 1834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13240 <4007 3295 gene locus_tag LOCUS_13250 <4007 3295 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014467599.1:RHS repeat-associated core domain-containing protein >Feature sequence208 <1 973 gene locus_tag LOCUS_13260 <1 973 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942277.1:adenylosuccinate lyase 970 1725 gene locus_tag LOCUS_13270 970 1725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13270 1817 2167 gene locus_tag LOCUS_13280 gene yajC 1817 2167 CDS product preprotein translocase subunit YajC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943256.1 protein_id gnl|my_center|LOCUS_13280 >Feature sequence209 <1 1435 gene locus_tag LOCUS_13290 <1 1435 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011266465.1:lipopolysaccharide kinase InaA family protein 2441 1926 gene locus_tag LOCUS_13300 2441 1926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13300 2630 3583 gene locus_tag LOCUS_13310 2630 3583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13310 >Feature sequence210 721 191 gene locus_tag LOCUS_13320 gene hslV 721 191 CDS product ATP-dependent protease subunit HslV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392543.1 protein_id gnl|my_center|LOCUS_13320 1676 741 gene locus_tag LOCUS_13330 gene xerC 1676 741 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941160.1 protein_id gnl|my_center|LOCUS_13330 2253 1927 gene locus_tag LOCUS_13340 2253 1927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13340 <3956 2548 gene locus_tag LOCUS_13350 <3956 2548 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012546673.1:outer membrane protein assembly factor >Feature sequence211 528 1568 gene locus_tag LOCUS_13360 gene hflK 528 1568 CDS product FtsH protease activity modulator HflK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678884.1 protein_id gnl|my_center|LOCUS_13360 1565 2497 gene locus_tag LOCUS_13370 gene hflC 1565 2497 CDS product protease modulator HflC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678885.1 protein_id gnl|my_center|LOCUS_13370 2965 3471 gene locus_tag LOCUS_13380 2965 3471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13380 3626 3898 gene locus_tag LOCUS_13390 3626 3898 CDS product zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545694.1 protein_id gnl|my_center|LOCUS_13390 >Feature sequence212 1772 285 gene locus_tag LOCUS_13400 1772 285 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933195.1 protein_id gnl|my_center|LOCUS_13400 2138 2632 gene locus_tag LOCUS_13410 2138 2632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13410 2635 3600 gene locus_tag LOCUS_13420 2635 3600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13420 >Feature sequence213 <1 1031 gene locus_tag LOCUS_13430 <1 1031 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942906.1:UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase 1015 1461 gene locus_tag LOCUS_13440 gene fabZ 1015 1461 CDS product 3-hydroxyacyl-ACP dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545346.1 protein_id gnl|my_center|LOCUS_13440 1458 2168 gene locus_tag LOCUS_13450 gene lpxA 1458 2168 CDS product acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546244.1 protein_id gnl|my_center|LOCUS_13450 2353 3177 gene locus_tag LOCUS_13460 gene lpxI 2353 3177 CDS product UDP-2,3-diacylglucosamine diphosphatase LpxI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011791912.1 protein_id gnl|my_center|LOCUS_13460 >Feature sequence214 585 1229 gene locus_tag LOCUS_13470 585 1229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13470 1241 1894 gene locus_tag LOCUS_13480 1241 1894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13480 1900 2469 gene locus_tag LOCUS_13490 1900 2469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13490 2642 2953 gene locus_tag LOCUS_13500 2642 2953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13500 3098 3610 gene locus_tag LOCUS_13510 3098 3610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13510 >Feature sequence215 94 588 gene locus_tag LOCUS_13520 94 588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13520 867 2240 gene locus_tag LOCUS_13530 867 2240 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108087.1 protein_id gnl|my_center|LOCUS_13530 2730 2227 gene locus_tag LOCUS_13540 2730 2227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13540 3755 2811 gene locus_tag LOCUS_13550 3755 2811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13550 >Feature sequence216 <1 1154 gene locus_tag LOCUS_13560 <1 1154 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010887533.1:LysM peptidoglycan-binding domain-containing protein 1448 2356 gene locus_tag LOCUS_13570 1448 2356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13570 2603 2740 gene locus_tag LOCUS_13580 2603 2740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13580 2701 2898 gene locus_tag LOCUS_13590 2701 2898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13590 2895 3362 gene locus_tag LOCUS_13600 2895 3362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_13600 >Feature sequence217 882 538 gene locus_tag LOCUS_13610 882 538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13610 1132 839 gene locus_tag LOCUS_13620 1132 839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13620 1505 1236 gene locus_tag LOCUS_13630 1505 1236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13630 2244 1465 gene locus_tag LOCUS_13640 2244 1465 CDS product lpg2370 family Dot/Icm T4SS effector inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948074.1 protein_id gnl|my_center|LOCUS_13640 2738 2397 gene locus_tag LOCUS_13650 2738 2397 CDS product HipA N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681615.1 protein_id gnl|my_center|LOCUS_13650 3027 2728 gene locus_tag LOCUS_13660 3027 2728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13660 <3880 3182 gene locus_tag LOCUS_13670 <3880 3182 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012546601.1:DUF4384 domain-containing protein >Feature sequence218 508 723 gene locus_tag LOCUS_13680 508 723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13680 1320 2294 gene locus_tag LOCUS_13690 1320 2294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13690 2291 3559 gene locus_tag LOCUS_13700 2291 3559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13700 >Feature sequence219 1197 97 gene locus_tag LOCUS_13710 1197 97 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13710 3573 1204 gene locus_tag LOCUS_13720 3573 1204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13720 >Feature sequence220 574 2757 gene locus_tag LOCUS_13730 574 2757 CDS product ATP-dependent RecD-like DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938194.1 protein_id gnl|my_center|LOCUS_13730 3610 2945 gene locus_tag LOCUS_13740 3610 2945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13740 >Feature sequence221 695 862 gene locus_tag LOCUS_13750 695 862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13750 1456 2151 gene locus_tag LOCUS_13760 1456 2151 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071542425.1 protein_id gnl|my_center|LOCUS_13760 >Feature sequence222 767 549 gene locus_tag LOCUS_13770 767 549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13770 1650 754 gene locus_tag LOCUS_13780 1650 754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011791395.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13780 2196 2333 gene locus_tag LOCUS_13790 2196 2333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13790 2330 2749 gene locus_tag LOCUS_13800 2330 2749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13800 3267 3704 gene locus_tag LOCUS_13810 gene tnpA 3267 3704 CDS product IS200/IS605-like element IS1004 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000503164.1 protein_id gnl|my_center|LOCUS_13810 >Feature sequence223 549 16 gene locus_tag LOCUS_13820 549 16 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13820 1031 633 gene locus_tag LOCUS_13830 1031 633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13830 1605 1150 gene locus_tag LOCUS_13840 gene nrdR 1605 1150 CDS product transcriptional regulator NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942330.1 protein_id gnl|my_center|LOCUS_13840 2066 1602 gene locus_tag LOCUS_13850 2066 1602 CDS product cytidine/deoxycytidylate deaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942329.1 protein_id gnl|my_center|LOCUS_13850 3381 2140 gene locus_tag LOCUS_13860 3381 2140 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164924918.1 protein_id gnl|my_center|LOCUS_13860 >Feature sequence224 285 563 gene locus_tag LOCUS_13870 285 563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13870 1190 1594 gene locus_tag LOCUS_13880 1190 1594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13880 1889 2242 gene locus_tag LOCUS_13890 1889 2242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13890 2242 2553 gene locus_tag LOCUS_13900 2242 2553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13900 2631 2945 gene locus_tag LOCUS_13910 2631 2945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13910 >Feature sequence225 60 1508 gene locus_tag LOCUS_13920 60 1508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13920 2300 2725 gene locus_tag LOCUS_13930 2300 2725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13930 2936 3466 gene locus_tag LOCUS_13940 2936 3466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13940 >Feature sequence226 <1 717 gene locus_tag LOCUS_13950 <1 717 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015039748.1:putative DNA binding domain-containing protein 717 1130 gene locus_tag LOCUS_13960 717 1130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13960 1180 1566 gene locus_tag LOCUS_13970 1180 1566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13970 1496 2176 gene locus_tag LOCUS_13980 1496 2176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13980 2308 3105 gene locus_tag LOCUS_13990 2308 3105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13990 >Feature sequence227 504 130 gene locus_tag LOCUS_14000 gene rbfA 504 130 CDS product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288513.1 protein_id gnl|my_center|LOCUS_14000 788 501 gene locus_tag LOCUS_14010 788 501 CDS product DUF503 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257138.1 protein_id gnl|my_center|LOCUS_14010 <3797 1085 gene locus_tag LOCUS_14020 <3797 1085 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942233.1:translation initiation factor IF-2 >Feature sequence228 544 630 gene locus_tag LOCUS_t00190 544 630 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 1121 1993 gene locus_tag LOCUS_14030 1121 1993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14030 2008 2826 gene locus_tag LOCUS_14040 2008 2826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14040 >Feature sequence229 978 565 gene locus_tag LOCUS_14050 978 565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14050 1409 999 gene locus_tag LOCUS_14060 gene umuD 1409 999 CDS product translesion error-prone DNA polymerase V autoproteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403083.1 protein_id gnl|my_center|LOCUS_14060 1860 1672 gene locus_tag LOCUS_14070 1860 1672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14070 3675 2182 gene locus_tag LOCUS_14080 3675 2182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14080 >Feature sequence230 3753 553 gene locus_tag LOCUS_14090 gene mfd 3753 553 CDS product transcription-repair coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940695.1 protein_id gnl|my_center|LOCUS_14090 >Feature sequence231 1498 227 gene locus_tag LOCUS_14100 1498 227 CDS product phosphomannomutase/phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544969.1 protein_id gnl|my_center|LOCUS_14100 2350 1520 gene locus_tag LOCUS_14110 gene uppP 2350 1520 CDS product undecaprenyl-diphosphatase UppP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392108.1 protein_id gnl|my_center|LOCUS_14110 2650 2507 gene locus_tag LOCUS_14120 2650 2507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14120 3144 2656 gene locus_tag LOCUS_14130 3144 2656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14130 3766 3281 gene locus_tag LOCUS_14140 3766 3281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14140 >Feature sequence232 998 42 gene locus_tag LOCUS_14150 998 42 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14150 1751 1020 gene locus_tag LOCUS_14160 1751 1020 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257981.1 protein_id gnl|my_center|LOCUS_14160 2439 1855 gene locus_tag LOCUS_14170 2439 1855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14170 >Feature sequence233 17 1639 gene locus_tag LOCUS_14180 17 1639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14180 1636 2928 gene locus_tag LOCUS_14190 1636 2928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14190 3502 2954 gene locus_tag LOCUS_14200 3502 2954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14200 >Feature sequence234 247 323 gene locus_tag LOCUS_t00200 247 323 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 431 808 gene locus_tag LOCUS_14210 431 808 CDS product DUF1992 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028842486.1 protein_id gnl|my_center|LOCUS_14210 992 1468 gene locus_tag LOCUS_14220 992 1468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14220 1475 2356 gene locus_tag LOCUS_14230 1475 2356 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943691.1 protein_id gnl|my_center|LOCUS_14230 2386 3141 gene locus_tag LOCUS_14240 2386 3141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14240 >Feature sequence235 289 1179 gene locus_tag LOCUS_14250 289 1179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14250 1432 2373 gene locus_tag LOCUS_14260 1432 2373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14260 >Feature sequence236 405 635 gene locus_tag LOCUS_14270 405 635 CDS product KH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938139.1 protein_id gnl|my_center|LOCUS_14270 640 1149 gene locus_tag LOCUS_14280 gene rimM 640 1149 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003699991.1 protein_id gnl|my_center|LOCUS_14280 1146 1937 gene locus_tag LOCUS_14290 gene trmD 1146 1937 CDS product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583884.1 protein_id gnl|my_center|LOCUS_14290 1915 2445 gene locus_tag LOCUS_14300 1915 2445 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941308.1 protein_id gnl|my_center|LOCUS_14300 2484 2831 gene locus_tag LOCUS_14310 gene rplS 2484 2831 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392486.1 protein_id gnl|my_center|LOCUS_14310 2961 3569 gene locus_tag LOCUS_14320 2961 3569 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941310.1 protein_id gnl|my_center|LOCUS_14320 >Feature sequence237 375 704 gene locus_tag LOCUS_14330 375 704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14330 701 1603 gene locus_tag LOCUS_14340 701 1603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14340 1805 2224 gene locus_tag LOCUS_14350 1805 2224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14350 2227 3036 gene locus_tag LOCUS_14360 2227 3036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14360 2969 3232 gene locus_tag LOCUS_14370 2969 3232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14370 >Feature sequence238 370 612 gene locus_tag LOCUS_14380 370 612 CDS product exodeoxyribonuclease VII small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942410.1 protein_id gnl|my_center|LOCUS_14380 605 1516 gene locus_tag LOCUS_14390 605 1516 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942409.1 protein_id gnl|my_center|LOCUS_14390 1708 1965 gene locus_tag LOCUS_14400 1708 1965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14400 1962 2456 gene locus_tag LOCUS_14410 1962 2456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14410 2410 3408 gene locus_tag LOCUS_14420 2410 3408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14420 >Feature sequence239 <1 1110 gene locus_tag LOCUS_14430 <1 1110 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015064474.1:ATP-binding protein 1390 2517 gene locus_tag LOCUS_14440 1390 2517 CDS product PDDEXK nuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766357.1 protein_id gnl|my_center|LOCUS_14440 2534 2908 gene locus_tag LOCUS_14450 2534 2908 CDS product STAS-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928718.1 protein_id gnl|my_center|LOCUS_14450 >Feature sequence240 392 2203 gene locus_tag LOCUS_14460 392 2203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14460 2130 3497 gene locus_tag LOCUS_14470 2130 3497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14470 >Feature sequence241 2203 1652 gene locus_tag LOCUS_14480 2203 1652 CDS product DUF1788 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393726.1 protein_id gnl|my_center|LOCUS_14480 3002 2190 gene locus_tag LOCUS_14490 3002 2190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393727.1 protein_id gnl|my_center|LOCUS_14490 3171 2965 gene locus_tag LOCUS_14500 3171 2965 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932357.1 protein_id gnl|my_center|LOCUS_14500 >Feature sequence242 2 1216 gene locus_tag LOCUS_14510 2 1216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14510 1185 3578 gene locus_tag LOCUS_14520 1185 3578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14520 >Feature sequence243 106 1068 gene locus_tag LOCUS_14530 106 1068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875962.1 protein_id gnl|my_center|LOCUS_14530 1069 1851 gene locus_tag LOCUS_14540 1069 1851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14540 1852 2766 gene locus_tag LOCUS_14550 1852 2766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14550 >Feature sequence244 185 604 gene locus_tag LOCUS_14560 185 604 CDS product DUF3842 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545623.1 protein_id gnl|my_center|LOCUS_14560 617 805 gene locus_tag LOCUS_14570 617 805 CDS product CooT family nickel-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545767.1 protein_id gnl|my_center|LOCUS_14570 1043 1071 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1260 2921 gene locus_tag LOCUS_14580 gene ispH 1260 2921 CDS product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011417689.1 protein_id gnl|my_center|LOCUS_14580 >Feature sequence245 98 1522 gene locus_tag LOCUS_14590 gene selA 98 1522 CDS product L-seryl-tRNA(Sec) selenium transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943980.1 protein_id gnl|my_center|LOCUS_14590 1522 2877 gene locus_tag LOCUS_14600 1522 2877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14600 2874 3443 gene locus_tag LOCUS_14610 2874 3443 CDS product D-sedoheptulose 7-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939175.1 protein_id gnl|my_center|LOCUS_14610 >Feature sequence246 951 214 gene locus_tag LOCUS_14620 951 214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14620 1786 1055 gene locus_tag LOCUS_14630 1786 1055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14630 2828 1845 gene locus_tag LOCUS_14640 2828 1845 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197524122.1 protein_id gnl|my_center|LOCUS_14640 3457 2945 gene locus_tag LOCUS_14650 3457 2945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14650 >Feature sequence247 1995 262 gene locus_tag LOCUS_14660 1995 262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14660 3223 1976 gene locus_tag LOCUS_14670 3223 1976 CDS product FIST N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085074.1 protein_id gnl|my_center|LOCUS_14670 3357 3557 gene locus_tag LOCUS_14680 3357 3557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14680 >Feature sequence248 540 376 gene locus_tag LOCUS_14690 540 376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14690 1055 507 gene locus_tag LOCUS_14700 1055 507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14700 1944 1045 gene locus_tag LOCUS_14710 1944 1045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14710 3071 1941 gene locus_tag LOCUS_14720 3071 1941 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545557.1 protein_id gnl|my_center|LOCUS_14720 >Feature sequence249 <1 1731 gene locus_tag LOCUS_14730 <1 1731 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012583044.1:ABC transporter ATP-binding protein 1721 2980 gene locus_tag LOCUS_14740 1721 2980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_14740 >Feature sequence250 446 1051 gene locus_tag LOCUS_14750 446 1051 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582951.1 protein_id gnl|my_center|LOCUS_14750 1135 1698 gene locus_tag LOCUS_14760 1135 1698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14760 1723 2274 gene locus_tag LOCUS_14770 1723 2274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14770 >Feature sequence251 722 841 gene locus_tag LOCUS_14780 722 841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14780 948 1778 gene locus_tag LOCUS_14790 948 1778 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007339817.1 protein_id gnl|my_center|LOCUS_14790 >Feature sequence252 216 338 gene locus_tag LOCUS_14800 216 338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14800 347 727 gene locus_tag LOCUS_14810 347 727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14810 724 1134 gene locus_tag LOCUS_14820 724 1134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14820 1124 2476 gene locus_tag LOCUS_14830 gene mgtE 1124 2476 CDS product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001829287.1 protein_id gnl|my_center|LOCUS_14830 2480 3178 gene locus_tag LOCUS_14840 2480 3178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14840 >Feature sequence253 580 38 gene locus_tag LOCUS_14850 580 38 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14850 1234 608 gene locus_tag LOCUS_14860 1234 608 CDS product type 4a pilus biogenesis protein PilO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942673.1 protein_id gnl|my_center|LOCUS_14860 1895 1542 gene locus_tag LOCUS_14870 1895 1542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14870 2944 1892 gene locus_tag LOCUS_14880 gene pilM 2944 1892 CDS product type IV pilus assembly protein PilM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942675.1 protein_id gnl|my_center|LOCUS_14880 3153 2956 gene locus_tag LOCUS_14890 3153 2956 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942676.1 protein_id gnl|my_center|LOCUS_14890 >Feature sequence254 2 142 gene locus_tag LOCUS_14900 2 142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14900 139 1230 gene locus_tag LOCUS_14910 139 1230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14910 1917 1378 gene locus_tag LOCUS_14920 1917 1378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14920 2635 1931 gene locus_tag LOCUS_14930 2635 1931 CDS product PspA/IM30 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930705.1 protein_id gnl|my_center|LOCUS_14930 3088 2693 gene locus_tag LOCUS_14940 3088 2693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14940 >Feature sequence255 1085 1768 gene locus_tag LOCUS_14950 1085 1768 CDS product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941396.1 protein_id gnl|my_center|LOCUS_14950 >Feature sequence256 465 1298 gene locus_tag LOCUS_14960 465 1298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14960 3170 1272 gene locus_tag LOCUS_14970 3170 1272 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938364.1 protein_id gnl|my_center|LOCUS_14970 3478 3347 gene locus_tag LOCUS_14980 3478 3347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14980 >Feature sequence257 1458 1087 gene locus_tag LOCUS_14990 1458 1087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14990 <3457 2036 gene locus_tag LOCUS_15000 <3457 2036 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000449938.1:propionyl-CoA:succinate CoA transferase >Feature sequence258 1400 2011 gene locus_tag LOCUS_15010 1400 2011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15010 2125 2628 gene locus_tag LOCUS_15020 2125 2628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15020 >Feature sequence259 333 1619 gene locus_tag LOCUS_15030 333 1619 CDS product IS110 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066867479.1 protein_id gnl|my_center|LOCUS_15030 2255 2587 gene locus_tag LOCUS_15040 2255 2587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15040 >Feature sequence260 799 990 gene locus_tag LOCUS_15050 799 990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15050 1017 1472 gene locus_tag LOCUS_15060 1017 1472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15060 1501 2025 gene locus_tag LOCUS_15070 1501 2025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15070 2179 2652 gene locus_tag LOCUS_15080 gene cysC 2179 2652 CDS product adenylyl-sulfate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140515.1 protein_id gnl|my_center|LOCUS_15080 2589 2777 gene locus_tag LOCUS_15090 2589 2777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15090 2872 3117 gene locus_tag LOCUS_15100 2872 3117 CDS product zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393102.1 protein_id gnl|my_center|LOCUS_15100 >Feature sequence261 847 1806 gene locus_tag LOCUS_15110 847 1806 CDS product L-threonine 3-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680329.1 protein_id gnl|my_center|LOCUS_15110 1803 1925 gene locus_tag LOCUS_15120 1803 1925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15120 2466 2131 gene locus_tag LOCUS_15130 2466 2131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15130 3033 2785 gene locus_tag LOCUS_15140 3033 2785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15140 >Feature sequence262 1 645 gene locus_tag LOCUS_15150 gene rpe 1 645 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943985.1 protein_id gnl|my_center|LOCUS_15150 834 1283 gene locus_tag LOCUS_15160 gene aroQ 834 1283 CDS product type II 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920703.1 protein_id gnl|my_center|LOCUS_15160 1874 1491 gene locus_tag LOCUS_15170 1874 1491 CDS product cytochrome c3 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937572.1 protein_id gnl|my_center|LOCUS_15170 2076 3131 gene locus_tag LOCUS_15180 2076 3131 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940064.1 protein_id gnl|my_center|LOCUS_15180 >Feature sequence263 581 2686 gene locus_tag LOCUS_15190 581 2686 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942299.1 protein_id gnl|my_center|LOCUS_15190 2925 3113 gene locus_tag LOCUS_15200 2925 3113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15200 3142 3360 gene locus_tag LOCUS_15210 3142 3360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15210 >Feature sequence264 1335 658 gene locus_tag LOCUS_15220 1335 658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15220 1900 3021 gene locus_tag LOCUS_15230 1900 3021 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790984.1 protein_id gnl|my_center|LOCUS_15230 >Feature sequence265 911 1258 gene locus_tag LOCUS_15240 911 1258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15240 1323 1958 gene locus_tag LOCUS_15250 1323 1958 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103021216.1 protein_id gnl|my_center|LOCUS_15250 2153 2560 gene locus_tag LOCUS_15260 2153 2560 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326173.1 protein_id gnl|my_center|LOCUS_15260 2564 3235 gene locus_tag LOCUS_15270 2564 3235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15270 >Feature sequence266 <1 1356 gene locus_tag LOCUS_15280 <1 1356 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943442.1:PAS domain S-box protein 1583 1780 gene locus_tag LOCUS_15290 1583 1780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15290 2865 1831 gene locus_tag LOCUS_15300 2865 1831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15300 3281 2916 gene locus_tag LOCUS_15310 3281 2916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15310 >Feature sequence267 25 393 gene locus_tag LOCUS_15320 25 393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15320 1094 399 gene locus_tag LOCUS_15330 1094 399 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002670541.1 protein_id gnl|my_center|LOCUS_15330 3269 1179 gene locus_tag LOCUS_15340 gene fusA 3269 1179 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682356.1 protein_id gnl|my_center|LOCUS_15340 >Feature sequence268 526 2040 gene locus_tag LOCUS_15350 gene tilS 526 2040 CDS product tRNA lysidine(34) synthetase TilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546068.1 protein_id gnl|my_center|LOCUS_15350 >Feature sequence269 866 1378 gene locus_tag LOCUS_15360 866 1378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15360 1689 2042 gene locus_tag LOCUS_15370 1689 2042 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943110.1 protein_id gnl|my_center|LOCUS_15370 2159 2392 gene locus_tag LOCUS_15380 2159 2392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15380 2389 2811 gene locus_tag LOCUS_15390 2389 2811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15390 >Feature sequence270 >Feature sequence271 1915 971 gene locus_tag LOCUS_15400 1915 971 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_149764770.1 protein_id gnl|my_center|LOCUS_15400 3150 1912 gene locus_tag LOCUS_15410 3150 1912 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014497734.1 protein_id gnl|my_center|LOCUS_15410 >Feature sequence272 285 13 gene locus_tag LOCUS_15420 285 13 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15420 1339 278 gene locus_tag LOCUS_15430 1339 278 CDS product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940684.1 protein_id gnl|my_center|LOCUS_15430 2405 1467 gene locus_tag LOCUS_15440 2405 1467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15440 2680 2438 gene locus_tag LOCUS_15450 2680 2438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15450 <3297 2637 gene locus_tag LOCUS_15460 <3297 2637 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010940682.1:DNA gyrase subunit A note possible pseudo, frameshifted >Feature sequence273 1368 484 gene locus_tag LOCUS_15470 1368 484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15470 1612 1361 gene locus_tag LOCUS_15480 1612 1361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15480 2840 1737 gene locus_tag LOCUS_15490 2840 1737 CDS product PDDEXK nuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103420.1 protein_id gnl|my_center|LOCUS_15490 >Feature sequence274 432 980 gene locus_tag LOCUS_15500 432 980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15500 970 2319 gene locus_tag LOCUS_15510 970 2319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15510 2398 3033 gene locus_tag LOCUS_15520 2398 3033 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932717.1 protein_id gnl|my_center|LOCUS_15520 >Feature sequence275 <1 1485 gene locus_tag LOCUS_15530 <1 1485 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010867283.1:class I SAM-dependent DNA methyltransferase 1489 2205 gene locus_tag LOCUS_15540 1489 2205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15540 2809 2381 gene locus_tag LOCUS_15550 2809 2381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15550 >Feature sequence276 <1 553 gene locus_tag LOCUS_15560 <1 553 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941836.1:succinate dehydrogenase cytochrome b subunit 801 682 gene locus_tag LOCUS_15570 801 682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15570 1156 794 gene locus_tag LOCUS_15580 1156 794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15580 1507 1710 gene locus_tag LOCUS_15590 1507 1710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15590 1710 1967 gene locus_tag LOCUS_15600 1710 1967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15600 1967 2461 gene locus_tag LOCUS_15610 1967 2461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15610 >Feature sequence277 919 560 gene locus_tag LOCUS_15620 919 560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15620 1199 1648 gene locus_tag LOCUS_15630 1199 1648 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941206.1 protein_id gnl|my_center|LOCUS_15630 1738 1908 gene locus_tag LOCUS_15640 1738 1908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15640 2138 2530 gene locus_tag LOCUS_15650 2138 2530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15650 <3257 2688 gene locus_tag LOCUS_15660 <3257 2688 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011389025.1:YhaN family protein >Feature sequence278 194 1687 gene locus_tag LOCUS_15670 gene istA 194 1687 CDS product IS21 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974233.1 protein_id gnl|my_center|LOCUS_15670 1684 2442 gene locus_tag LOCUS_15680 gene istB 1684 2442 CDS product IS21-like element helper ATPase IstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974232.1 protein_id gnl|my_center|LOCUS_15680 2992 3189 gene locus_tag LOCUS_15690 2992 3189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15690 >Feature sequence279 1084 323 gene locus_tag LOCUS_15700 1084 323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15700 1166 2335 gene locus_tag LOCUS_15710 1166 2335 CDS product ribonuclease D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941112.1 protein_id gnl|my_center|LOCUS_15710 2358 2819 gene locus_tag LOCUS_15720 2358 2819 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546528.1 protein_id gnl|my_center|LOCUS_15720 3090 2896 gene locus_tag LOCUS_15730 3090 2896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15730 >Feature sequence280 2392 1043 gene locus_tag LOCUS_15740 2392 1043 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941790.1 protein_id gnl|my_center|LOCUS_15740 <3240 2574 gene locus_tag LOCUS_15750 <3240 2574 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013525347.1:response regulator >Feature sequence281 <3231 2366 gene locus_tag LOCUS_15760 <3231 2366 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012582690.1:cation diffusion facilitator family transporter >Feature sequence282 561 355 gene locus_tag LOCUS_15770 561 355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15770 1945 551 gene locus_tag LOCUS_15780 1945 551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15780 2121 1927 gene locus_tag LOCUS_15790 2121 1927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15790 3115 2693 gene locus_tag LOCUS_15800 3115 2693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15800 >Feature sequence283 2882 216 gene locus_tag LOCUS_15810 2882 216 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942688.1 protein_id gnl|my_center|LOCUS_15810 >Feature sequence284 358 1461 gene locus_tag LOCUS_15820 358 1461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15820 1505 2722 gene locus_tag LOCUS_15830 1505 2722 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938527.1 protein_id gnl|my_center|LOCUS_15830 2754 3092 gene locus_tag LOCUS_15840 2754 3092 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942480.1 protein_id gnl|my_center|LOCUS_15840 >Feature sequence285 1348 155 gene locus_tag LOCUS_15850 1348 155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15850 1769 1395 gene locus_tag LOCUS_15860 1769 1395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15860 2731 1772 gene locus_tag LOCUS_15870 gene cas6 2731 1772 CDS product CRISPR system precrRNA processing endoribonuclease RAMP protein Cas6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545643.1 protein_id gnl|my_center|LOCUS_15870 >Feature sequence286 644 985 gene locus_tag LOCUS_15880 644 985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15880 2261 1740 gene locus_tag LOCUS_15890 2261 1740 CDS product DUF3368 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_225807463.1 protein_id gnl|my_center|LOCUS_15890 2442 2248 gene locus_tag LOCUS_15900 2442 2248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15900 3143 2940 gene locus_tag LOCUS_15910 3143 2940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15910 >Feature sequence287 8 784 gene locus_tag LOCUS_15920 gene lgt 8 784 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583316.1 protein_id gnl|my_center|LOCUS_15920 841 2301 gene locus_tag LOCUS_15930 841 2301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15930 2331 2540 gene locus_tag LOCUS_15940 2331 2540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15940 2570 2968 gene locus_tag LOCUS_15950 2570 2968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15950 >Feature sequence288 <1 1876 gene locus_tag LOCUS_15960 <1 1876 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942050.1:DNA polymerase III subunit alpha >Feature sequence289 156 698 gene locus_tag LOCUS_15970 156 698 CDS product heme NO-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072197.1 protein_id gnl|my_center|LOCUS_15970 711 2402 gene locus_tag LOCUS_15980 711 2402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15980 >Feature sequence290 1663 473 gene locus_tag LOCUS_15990 gene tssK 1663 473 CDS product type VI secretion system baseplate subunit TssK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941098.1 protein_id gnl|my_center|LOCUS_15990 1768 1962 gene locus_tag LOCUS_16000 1768 1962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16000 2592 2206 gene locus_tag LOCUS_16010 2592 2206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16010 >Feature sequence291 <1 969 gene locus_tag LOCUS_16020 <1 969 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011392333.1:4Fe-4S dicluster domain-containing protein 1222 2286 gene locus_tag LOCUS_16030 1222 2286 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011791853.1 protein_id gnl|my_center|LOCUS_16030 >Feature sequence292 1699 323 gene locus_tag LOCUS_16040 1699 323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16040 <3150 1693 gene locus_tag LOCUS_16050 <3150 1693 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943492.1:DNA-directed RNA polymerase subunit beta' note possible pseudo, frameshifted >Feature sequence293 <1 563 gene locus_tag LOCUS_16060 <1 563 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_009895184.1:cysteine--tRNA ligase 837 1823 gene locus_tag LOCUS_16070 837 1823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16070 2018 2206 gene locus_tag LOCUS_16080 2018 2206 CDS product ferredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940534.1 protein_id gnl|my_center|LOCUS_16080 >Feature sequence294 80 370 gene locus_tag LOCUS_16090 80 370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16090 363 635 gene locus_tag LOCUS_16100 363 635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16100 651 1145 gene locus_tag LOCUS_16110 651 1145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16110 1167 2345 gene locus_tag LOCUS_16120 gene coaBC 1167 2345 CDS product bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941785.1 protein_id gnl|my_center|LOCUS_16120 2582 2821 gene locus_tag LOCUS_16130 2582 2821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16130 >Feature sequence295 889 2 gene locus_tag LOCUS_16140 889 2 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162493357.1 protein_id gnl|my_center|LOCUS_16140 1126 905 gene locus_tag LOCUS_16150 1126 905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16150 1761 1123 gene locus_tag LOCUS_16160 1761 1123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16160 2199 2579 gene locus_tag LOCUS_16170 2199 2579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_16170 >Feature sequence296 1577 882 gene locus_tag LOCUS_16180 gene ispD 1577 882 CDS product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943979.1 protein_id gnl|my_center|LOCUS_16180 3103 1799 gene locus_tag LOCUS_16190 3103 1799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16190 >Feature sequence297 1079 2386 gene locus_tag LOCUS_16200 1079 2386 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438661.1 protein_id gnl|my_center|LOCUS_16200 2412 2576 gene locus_tag LOCUS_16210 2412 2576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16210 2533 2748 gene locus_tag LOCUS_16220 2533 2748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16220 >Feature sequence298 408 617 gene locus_tag LOCUS_16230 408 617 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681617.1 protein_id gnl|my_center|LOCUS_16230 618 950 gene locus_tag LOCUS_16240 618 950 CDS product HipA N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681615.1 protein_id gnl|my_center|LOCUS_16240 947 1903 gene locus_tag LOCUS_16250 947 1903 CDS product HipA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681613.1 protein_id gnl|my_center|LOCUS_16250 2110 1979 gene locus_tag LOCUS_16260 2110 1979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16260 2315 2848 gene locus_tag LOCUS_16270 2315 2848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16270 >Feature sequence299 1759 1004 gene locus_tag LOCUS_16280 1759 1004 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940782.1 protein_id gnl|my_center|LOCUS_16280 2097 2768 gene locus_tag LOCUS_16290 2097 2768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16290 >Feature sequence300 1102 536 gene locus_tag LOCUS_16300 1102 536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16300 1610 1215 gene locus_tag LOCUS_16310 1610 1215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16310 >Feature sequence301 618 259 gene locus_tag LOCUS_16320 618 259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16320 991 611 gene locus_tag LOCUS_16330 991 611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16330 1461 1225 gene locus_tag LOCUS_16340 1461 1225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16340 1775 1458 gene locus_tag LOCUS_16350 1775 1458 CDS product DUF4258 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393078.1 protein_id gnl|my_center|LOCUS_16350 2693 2559 gene locus_tag LOCUS_16360 2693 2559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16360 >Feature sequence302 578 72 gene locus_tag LOCUS_16370 578 72 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16370 1240 1016 gene locus_tag LOCUS_16380 1240 1016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16380 2894 1527 gene locus_tag LOCUS_16390 2894 1527 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930426.1 protein_id gnl|my_center|LOCUS_16390 >Feature sequence303 86 712 gene locus_tag LOCUS_16400 gene queC 86 712 CDS product 7-cyano-7-deazaguanine synthase QueC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545080.1 protein_id gnl|my_center|LOCUS_16400 963 1544 gene locus_tag LOCUS_16410 963 1544 CDS product winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941288.1 protein_id gnl|my_center|LOCUS_16410 1596 2657 gene locus_tag LOCUS_16420 1596 2657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16420 >Feature sequence304 1287 550 gene locus_tag LOCUS_16430 1287 550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_16430 1901 1284 gene locus_tag LOCUS_16440 1901 1284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_16440 <3050 1937 gene locus_tag LOCUS_16450 <3050 1937 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941262.1:ATP-binding protein >Feature sequence305 1577 882 gene locus_tag LOCUS_16460 gene ispD 1577 882 CDS product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943979.1 protein_id gnl|my_center|LOCUS_16460 3024 1720 gene locus_tag LOCUS_16470 3024 1720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16470 >Feature sequence306 <1 952 gene locus_tag LOCUS_16480 <1 952 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942435.1:ATP-dependent Clp protease ATP-binding subunit ClpX 1123 1410 gene locus_tag LOCUS_16490 1123 1410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16490 >Feature sequence307 173 763 gene locus_tag LOCUS_16500 173 763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16500 >Feature sequence308 124 1740 gene locus_tag LOCUS_16510 gene asnB 124 1740 CDS product asparagine synthase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962690.1 protein_id gnl|my_center|LOCUS_16510 1811 2602 gene locus_tag LOCUS_16520 1811 2602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16520 >Feature sequence309 425 2020 gene locus_tag LOCUS_16530 425 2020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16530 1941 2654 gene locus_tag LOCUS_16540 1941 2654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16540 >Feature sequence310 3 371 gene locus_tag LOCUS_16550 3 371 CDS product four helix bundle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226986800.1 protein_id gnl|my_center|LOCUS_16550 437 1297 gene locus_tag LOCUS_16560 437 1297 CDS product virulence RhuM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167939813.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16560 1631 2536 gene locus_tag LOCUS_16570 gene dinD 1631 2536 CDS product DNA damage-inducible protein D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001350563.1 protein_id gnl|my_center|LOCUS_16570 >Feature sequence311 <1 628 gene locus_tag LOCUS_16580 <1 628 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010940821.1:recombinase RecA >Feature sequence312 263 2968 gene locus_tag LOCUS_16590 263 2968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16590 >Feature sequence313 <1 505 gene locus_tag LOCUS_16600 <1 505 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010876526.1:tyrosine-type recombinase/integrase 1465 845 gene locus_tag LOCUS_16610 1465 845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16610 2144 1443 gene locus_tag LOCUS_16620 2144 1443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16620 >Feature sequence314 535 1920 gene locus_tag LOCUS_16630 535 1920 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545515.1 protein_id gnl|my_center|LOCUS_16630 1920 2462 gene locus_tag LOCUS_16640 1920 2462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16640 >Feature sequence315 517 807 gene locus_tag LOCUS_16650 517 807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16650 804 1550 gene locus_tag LOCUS_16660 804 1550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16660 1667 2101 gene locus_tag LOCUS_16670 1667 2101 CDS product class III cytochrome C family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546815.1 protein_id gnl|my_center|LOCUS_16670 <2942 2322 gene locus_tag LOCUS_16680 <2942 2322 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_041272194.1:hydrogenobyrinic acid a,c-diamide synthase (glutamine-hydrolyzing) >Feature sequence316 1600 428 gene locus_tag LOCUS_16690 1600 428 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870216.1 protein_id gnl|my_center|LOCUS_16690 2028 1684 gene locus_tag LOCUS_16700 2028 1684 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462029.1 protein_id gnl|my_center|LOCUS_16700 >Feature sequence317 667 999 gene locus_tag LOCUS_16710 667 999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16710 1959 1180 gene locus_tag LOCUS_16720 1959 1180 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065531.1 protein_id gnl|my_center|LOCUS_16720 2447 1956 gene locus_tag LOCUS_16730 gene mobB 2447 1956 CDS product molybdopterin-guanine dinucleotide biosynthesis protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393319.1 protein_id gnl|my_center|LOCUS_16730 >Feature sequence318 1701 997 gene locus_tag LOCUS_16740 1701 997 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942909.1 protein_id gnl|my_center|LOCUS_16740 2152 1694 gene locus_tag LOCUS_16750 2152 1694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16750 <2929 2143 gene locus_tag LOCUS_16760 <2929 2143 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942910.1:lipoprotein-releasing ABC transporter permease subunit note possible pseudo, frameshifted >Feature sequence319 309 1508 gene locus_tag LOCUS_16770 309 1508 CDS product ISAzo13 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_218132780.1 protein_id gnl|my_center|LOCUS_16770 1475 2698 gene locus_tag LOCUS_16780 1475 2698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16780 >Feature sequence320 822 1217 gene locus_tag LOCUS_16790 822 1217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_16790 1449 1973 gene locus_tag LOCUS_16800 1449 1973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16800 2012 2488 gene locus_tag LOCUS_16810 gene nuoE 2012 2488 CDS product NADH-quinone oxidoreductase subunit NuoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582933.1 protein_id gnl|my_center|LOCUS_16810 >Feature sequence321 44 322 gene locus_tag LOCUS_16820 44 322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16820 1416 940 gene locus_tag LOCUS_16830 1416 940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16830 2194 1946 gene locus_tag LOCUS_16840 2194 1946 CDS product DUF2442 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226986881.1 protein_id gnl|my_center|LOCUS_16840 2470 2210 gene locus_tag LOCUS_16850 2470 2210 CDS product DUF4160 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808730.1 protein_id gnl|my_center|LOCUS_16850 >Feature sequence322 31 106 gene locus_tag LOCUS_t00210 31 106 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 491 204 gene locus_tag LOCUS_16860 491 204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16860 2177 801 gene locus_tag LOCUS_16870 gene nadB 2177 801 CDS product L-aspartate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942471.1 protein_id gnl|my_center|LOCUS_16870 2842 2189 gene locus_tag LOCUS_16880 2842 2189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16880 >Feature sequence323 >Feature sequence324 1583 639 gene locus_tag LOCUS_16890 1583 639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16890 2153 1752 gene locus_tag LOCUS_16900 gene queF 2153 1752 CDS product preQ(1) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933302.1 protein_id gnl|my_center|LOCUS_16900 >Feature sequence325 582 770 gene locus_tag LOCUS_16910 582 770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16910 755 1159 gene locus_tag LOCUS_16920 755 1159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16920 1433 2836 gene locus_tag LOCUS_16930 1433 2836 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010865165.1 protein_id gnl|my_center|LOCUS_16930 >Feature sequence326 <1 757 gene locus_tag LOCUS_16940 <1 757 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000027249.1:pyrroline-5-carboxylate reductase ProI 1018 761 gene locus_tag LOCUS_16950 1018 761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16950 1002 1472 gene locus_tag LOCUS_16960 1002 1472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16960 1477 1941 gene locus_tag LOCUS_16970 1477 1941 CDS product thioredoxin fold domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881088.1 protein_id gnl|my_center|LOCUS_16970 2377 2177 gene locus_tag LOCUS_16980 2377 2177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16980 >Feature sequence327 361 732 gene locus_tag LOCUS_16990 361 732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16990 716 1168 gene locus_tag LOCUS_17000 716 1168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_17000 1236 1967 gene locus_tag LOCUS_17010 1236 1967 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938961.1 protein_id gnl|my_center|LOCUS_17010 >Feature sequence328 1814 702 gene locus_tag LOCUS_17020 gene trkA 1814 702 CDS product Trk system potassium transporter TrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545959.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17020 2044 1850 gene locus_tag LOCUS_17030 2044 1850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17030 2646 2419 gene locus_tag LOCUS_17040 2646 2419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17040 >Feature sequence329 <1 762 gene locus_tag LOCUS_17050 <1 762 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_027480324.1:isoprenyl transferase 1018 1812 gene locus_tag LOCUS_17060 1018 1812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17060 2362 2437 gene locus_tag LOCUS_t00220 2362 2437 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence330 192 1106 gene locus_tag LOCUS_17070 gene argF 192 1106 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940828.1 protein_id gnl|my_center|LOCUS_17070 1357 2481 gene locus_tag LOCUS_17080 1357 2481 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940829.1 protein_id gnl|my_center|LOCUS_17080 >Feature sequence331 1749 1895 gene locus_tag LOCUS_17090 1749 1895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17090 2731 2435 gene locus_tag LOCUS_17100 2731 2435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17100 >Feature sequence332 862 1593 gene locus_tag LOCUS_17110 862 1593 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004596488.1 protein_id gnl|my_center|LOCUS_17110 1609 2274 gene locus_tag LOCUS_17120 1609 2274 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262244.1 protein_id gnl|my_center|LOCUS_17120 >Feature sequence333 84 524 gene locus_tag LOCUS_17130 gene rplO 84 524 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966393.1 protein_id gnl|my_center|LOCUS_17130 526 1842 gene locus_tag LOCUS_17140 gene secY 526 1842 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943466.1 protein_id gnl|my_center|LOCUS_17140 1844 2599 gene locus_tag LOCUS_17150 gene map 1844 2599 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943464.1 protein_id gnl|my_center|LOCUS_17150 2602 2820 gene locus_tag LOCUS_17160 gene infA 2602 2820 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001040194.1 protein_id gnl|my_center|LOCUS_17160 >Feature sequence334 1229 663 gene locus_tag LOCUS_17170 gene pabA 1229 663 CDS product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392854.1 protein_id gnl|my_center|LOCUS_17170 1731 1390 gene locus_tag LOCUS_17180 1731 1390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17180 2305 1838 gene locus_tag LOCUS_17190 2305 1838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17190 <2815 2296 gene locus_tag LOCUS_17200 <2815 2296 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_118826697.1:anthranilate synthase component I >Feature sequence335 166 1170 gene locus_tag LOCUS_17210 166 1170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17210 1208 1996 gene locus_tag LOCUS_17220 1208 1996 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931583.1 protein_id gnl|my_center|LOCUS_17220 1993 2577 gene locus_tag LOCUS_17230 1993 2577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_17230 >Feature sequence336 352 762 gene locus_tag LOCUS_17240 352 762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17240 1104 2126 gene locus_tag LOCUS_17250 1104 2126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17250 >Feature sequence337 1774 1574 gene locus_tag LOCUS_17260 1774 1574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17260 2101 1811 gene locus_tag LOCUS_17270 2101 1811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17270 2031 2480 gene locus_tag LOCUS_17280 2031 2480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17280 >Feature sequence338 1766 726 gene locus_tag LOCUS_17290 gene flhB 1766 726 CDS product flagellar biosynthesis protein FlhB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392310.1 protein_id gnl|my_center|LOCUS_17290 2626 1919 gene locus_tag LOCUS_17300 gene fliR 2626 1919 CDS product flagellar biosynthetic protein FliR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392309.1 protein_id gnl|my_center|LOCUS_17300 >Feature sequence339 370 173 gene locus_tag LOCUS_17310 370 173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17310 1107 595 gene locus_tag LOCUS_17320 1107 595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17320 1516 1139 gene locus_tag LOCUS_17330 1516 1139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17330 1834 1538 gene locus_tag LOCUS_17340 1834 1538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17340 >Feature sequence340 401 754 gene locus_tag LOCUS_17350 gene rsfS 401 754 CDS product ribosome silencing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392104.1 protein_id gnl|my_center|LOCUS_17350 747 2294 gene locus_tag LOCUS_17360 gene gpmI 747 2294 CDS product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943825.1 protein_id gnl|my_center|LOCUS_17360 2336 2689 gene locus_tag LOCUS_17370 2336 2689 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229267.1 protein_id gnl|my_center|LOCUS_17370 >Feature sequence341 416 862 gene locus_tag LOCUS_17380 416 862 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061215.1 protein_id gnl|my_center|LOCUS_17380 885 1898 gene locus_tag LOCUS_17390 885 1898 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942298.1 protein_id gnl|my_center|LOCUS_17390 <2777 1961 gene locus_tag LOCUS_17400 <2777 1961 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007332193.1:carbon starvation protein A >Feature sequence342 157 294 gene locus_tag LOCUS_17410 157 294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17410 514 1878 gene locus_tag LOCUS_17420 514 1878 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460406.1 protein_id gnl|my_center|LOCUS_17420 >Feature sequence343 637 398 gene locus_tag LOCUS_17430 637 398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_17430 992 558 gene locus_tag LOCUS_17440 992 558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17440 2407 1091 gene locus_tag LOCUS_17450 gene tig 2407 1091 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942437.1 protein_id gnl|my_center|LOCUS_17450 2632 2546 gene locus_tag LOCUS_t00230 2632 2546 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence344 <1 657 gene locus_tag LOCUS_17460 <1 657 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003974682.1:glucosyl-3-phosphoglycerate synthase 892 1551 gene locus_tag LOCUS_17470 892 1551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17470 1601 2359 gene locus_tag LOCUS_17480 1601 2359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17480 2277 2549 gene locus_tag LOCUS_17490 2277 2549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17490 >Feature sequence345 1304 2479 gene locus_tag LOCUS_17500 1304 2479 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226376442.1 protein_id gnl|my_center|LOCUS_17500 >Feature sequence346 1478 87 gene locus_tag LOCUS_17510 1478 87 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808174.1 protein_id gnl|my_center|LOCUS_17510 <2737 1481 gene locus_tag LOCUS_17520 <2737 1481 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164924828.1:sensor histidine kinase >Feature sequence347 265 525 gene locus_tag LOCUS_17530 265 525 CDS product type II toxin-antitoxin system RelB/DinJ family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812625.1 protein_id gnl|my_center|LOCUS_17530 1287 2063 gene locus_tag LOCUS_17540 1287 2063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17540 2053 2553 gene locus_tag LOCUS_17550 2053 2553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17550 >Feature sequence348 974 501 gene locus_tag LOCUS_17560 974 501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17560 2212 974 gene locus_tag LOCUS_17570 gene radA 2212 974 CDS product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940957.1 protein_id gnl|my_center|LOCUS_17570 >Feature sequence349 139 906 gene locus_tag LOCUS_17580 139 906 CDS product A24 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942686.1 protein_id gnl|my_center|LOCUS_17580 963 2339 gene locus_tag LOCUS_17590 963 2339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17590 >Feature sequence350 100 1302 gene locus_tag LOCUS_17600 100 1302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17600 1480 2511 gene locus_tag LOCUS_17610 1480 2511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17610 >Feature sequence351 1434 2615 gene locus_tag LOCUS_17620 1434 2615 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958440.1 protein_id gnl|my_center|LOCUS_17620 >Feature sequence352 163 681 gene locus_tag LOCUS_17630 163 681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_17630 861 1253 gene locus_tag LOCUS_17640 861 1253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17640 1658 1912 gene locus_tag LOCUS_17650 1658 1912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17650 2117 2416 gene locus_tag LOCUS_17660 2117 2416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17660 >Feature sequence353 <1 785 gene locus_tag LOCUS_17670 <1 785 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012545457.1:phosphoribosylaminoimidazolesuccinocarboxamide synthase 985 1644 gene locus_tag LOCUS_17680 985 1644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17680 2151 2399 gene locus_tag LOCUS_17690 2151 2399 CDS product DUF2442 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226986881.1 protein_id gnl|my_center|LOCUS_17690 >Feature sequence354 1707 451 gene locus_tag LOCUS_17700 1707 451 CDS product IS110-like element ISDha10 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461193.1 protein_id gnl|my_center|LOCUS_17700 >Feature sequence355 1795 1346 gene locus_tag LOCUS_17710 1795 1346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17710 <2628 2087 gene locus_tag LOCUS_17720 <2628 2087 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010937922.1:sigma-54 dependent transcriptional regulator >Feature sequence356 970 722 gene locus_tag LOCUS_17730 970 722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17730 1592 1095 gene locus_tag LOCUS_17740 1592 1095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17740 2336 1731 gene locus_tag LOCUS_17750 2336 1731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17750 >Feature sequence357 141 968 gene locus_tag LOCUS_17760 gene dapF 141 968 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881196.1 protein_id gnl|my_center|LOCUS_17760 1205 2374 gene locus_tag LOCUS_17770 1205 2374 CDS product LL-diaminopimelate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392408.1 protein_id gnl|my_center|LOCUS_17770 >Feature sequence358 177 611 gene locus_tag LOCUS_17780 177 611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17780 629 1423 gene locus_tag LOCUS_17790 629 1423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17790 2065 1361 gene locus_tag LOCUS_17800 2065 1361 CDS product Bax inhibitor-1/YccA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939740.1 protein_id gnl|my_center|LOCUS_17800 >Feature sequence359 341 820 gene locus_tag LOCUS_17810 341 820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_17810 817 1074 gene locus_tag LOCUS_17820 817 1074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17820 1169 1393 gene locus_tag LOCUS_17830 1169 1393 CDS product NifU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000431159.1 protein_id gnl|my_center|LOCUS_17830 1528 1761 gene locus_tag LOCUS_17840 1528 1761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17840 1682 1957 gene locus_tag LOCUS_17850 1682 1957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17850 >Feature sequence360 <1 680 gene locus_tag LOCUS_17860 <1 680 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941783.1:HD domain-containing protein 893 1525 gene locus_tag LOCUS_17870 gene tmk 893 1525 CDS product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939417.1 protein_id gnl|my_center|LOCUS_17870 >Feature sequence361 1641 97 gene locus_tag LOCUS_17880 1641 97 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17880 2060 1920 gene locus_tag LOCUS_17890 2060 1920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17890 2254 2412 gene locus_tag LOCUS_17900 2254 2412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17900 >Feature sequence362 738 400 gene locus_tag LOCUS_17910 738 400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17910 1584 1330 gene locus_tag LOCUS_17920 1584 1330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17920 2397 1609 gene locus_tag LOCUS_17930 2397 1609 CDS product HNH endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003706646.1 protein_id gnl|my_center|LOCUS_17930 >Feature sequence363 988 269 gene locus_tag LOCUS_17940 988 269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17940 1483 989 gene locus_tag LOCUS_17950 1483 989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17950 2088 1420 gene locus_tag LOCUS_17960 2088 1420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17960 2315 2187 gene locus_tag LOCUS_17970 2315 2187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17970 2562 2308 gene locus_tag LOCUS_17980 2562 2308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17980 >Feature sequence364 1014 445 gene locus_tag LOCUS_17990 1014 445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17990 2459 1215 gene locus_tag LOCUS_18000 2459 1215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18000 >Feature sequence365 <1 989 gene locus_tag LOCUS_18010 <1 989 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010937853.1:branched-chain amino acid ABC transporter substrate-binding protein 1079 1981 gene locus_tag LOCUS_18020 1079 1981 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937854.1 protein_id gnl|my_center|LOCUS_18020 >Feature sequence366 268 849 gene locus_tag LOCUS_18030 268 849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18030 <2557 1598 gene locus_tag LOCUS_18040 <2557 1598 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005813606.1:beta-N-acetylhexosaminidase >Feature sequence367 1283 99 gene locus_tag LOCUS_18050 1283 99 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888861.1 protein_id gnl|my_center|LOCUS_18050 2371 1352 gene locus_tag LOCUS_18060 2371 1352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18060 >Feature sequence368 <1 810 gene locus_tag LOCUS_18070 <1 810 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012545758.1:radical SAM protein 1254 943 gene locus_tag LOCUS_18080 1254 943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18080 <2544 1256 gene locus_tag LOCUS_18090 <2544 1256 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010947525.1:alanine--tRNA ligase note possible pseudo, frameshifted >Feature sequence369 19 165 gene locus_tag LOCUS_18100 19 165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18100 122 532 gene locus_tag LOCUS_18110 122 532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18110 2418 619 gene locus_tag LOCUS_18120 2418 619 CDS product KamA family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870139.1 protein_id gnl|my_center|LOCUS_18120 >Feature sequence370 1245 2360 gene locus_tag LOCUS_18130 1245 2360 CDS product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942336.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18130 >Feature sequence371 851 1738 gene locus_tag LOCUS_18140 851 1738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18140 1769 1963 gene locus_tag LOCUS_18150 1769 1963 CDS product YwbE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001014309.1 protein_id gnl|my_center|LOCUS_18150 >Feature sequence372 568 717 gene locus_tag LOCUS_18160 568 717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18160 855 1076 gene locus_tag LOCUS_18170 855 1076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18170 1073 1528 gene locus_tag LOCUS_18180 1073 1528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18180 1605 1838 gene locus_tag LOCUS_18190 1605 1838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18190 1842 2078 gene locus_tag LOCUS_18200 1842 2078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18200 >Feature sequence373 413 649 gene locus_tag LOCUS_18210 413 649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18210 843 1838 gene locus_tag LOCUS_18220 843 1838 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941871.1 protein_id gnl|my_center|LOCUS_18220 >Feature sequence374 479 1903 gene locus_tag LOCUS_18230 479 1903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18230 1890 2441 gene locus_tag LOCUS_18240 1890 2441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18240 >Feature sequence375 175 459 gene locus_tag LOCUS_18250 175 459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18250 344 832 gene locus_tag LOCUS_18260 344 832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18260 829 2481 gene locus_tag LOCUS_18270 829 2481 CDS product ribonuclease J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943734.1 protein_id gnl|my_center|LOCUS_18270 >Feature sequence376 <1 1318 gene locus_tag LOCUS_18280 <1 1318 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164927078.1:DUF559 domain-containing protein 1318 2475 gene locus_tag LOCUS_18290 1318 2475 CDS product ImmA/IrrE family metallo-endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705890.1 protein_id gnl|my_center|LOCUS_18290 >Feature sequence377 2257 2388 gene locus_tag LOCUS_18300 2257 2388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18300 >Feature sequence378 1218 607 gene locus_tag LOCUS_18310 1218 607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18310 1949 1230 gene locus_tag LOCUS_18320 1949 1230 CDS product pyridoxine 5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942449.1 protein_id gnl|my_center|LOCUS_18320 >Feature sequence379 1037 141 gene locus_tag LOCUS_18330 gene xerD 1037 141 CDS product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942464.1 protein_id gnl|my_center|LOCUS_18330 2235 1114 gene locus_tag LOCUS_18340 2235 1114 CDS product Xaa-Pro peptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965395.1 protein_id gnl|my_center|LOCUS_18340 >Feature sequence380 796 530 gene locus_tag LOCUS_18350 gene rpsT 796 530 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939182.1 protein_id gnl|my_center|LOCUS_18350 1997 1086 gene locus_tag LOCUS_18360 1997 1086 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246492.1 protein_id gnl|my_center|LOCUS_18360 2297 2019 gene locus_tag LOCUS_18370 2297 2019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18370 >Feature sequence381 <1 956 gene locus_tag LOCUS_18380 <1 956 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010932320.1:Tol-Pal system beta propeller repeat protein TolB 987 1502 gene locus_tag LOCUS_18390 987 1502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18390 >Feature sequence382 1642 1833 gene locus_tag LOCUS_18400 1642 1833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18400 1815 1970 gene locus_tag LOCUS_18410 1815 1970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18410 >Feature sequence383 2197 1787 gene locus_tag LOCUS_18420 2197 1787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18420 >Feature sequence384 676 2070 gene locus_tag LOCUS_18430 gene atpD 676 2070 CDS product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065404.1 protein_id gnl|my_center|LOCUS_18430 >Feature sequence385 333 154 gene locus_tag LOCUS_18440 333 154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18440 1400 768 gene locus_tag LOCUS_18450 1400 768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18450 2428 1397 gene locus_tag LOCUS_18460 2428 1397 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943459.1 protein_id gnl|my_center|LOCUS_18460 >Feature sequence386 867 1178 gene locus_tag LOCUS_18470 867 1178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18470 1256 1720 gene locus_tag LOCUS_18480 1256 1720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18480 1831 2277 gene locus_tag LOCUS_18490 1831 2277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18490 >Feature sequence387 178 254 gene locus_tag LOCUS_t00240 178 254 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 349 510 gene locus_tag LOCUS_18500 349 510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18500 2218 551 gene locus_tag LOCUS_18510 gene gspE 2218 551 CDS product type II secretion system ATPase GspE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000853744.1 protein_id gnl|my_center|LOCUS_18510 >Feature sequence388 2061 748 gene locus_tag LOCUS_18520 2061 748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18520 >Feature sequence389 >Feature sequence390 <1 1369 gene locus_tag LOCUS_18530 <1 1369 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942865.1:ribosome biogenesis GTPase Der <2429 1497 gene locus_tag LOCUS_18540 <2429 1497 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_053055794.1:HD domain-containing protein >Feature sequence391 983 87 gene locus_tag LOCUS_18550 gene rfbD 983 87 CDS product dTDP-4-dehydrorhamnose reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387760.1 protein_id gnl|my_center|LOCUS_18550 1550 1008 gene locus_tag LOCUS_18560 gene rfbC 1550 1008 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143691.1 protein_id gnl|my_center|LOCUS_18560 2407 1547 gene locus_tag LOCUS_18570 gene rfbA 2407 1547 CDS product glucose-1-phosphate thymidylyltransferase RfbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000857520.1 protein_id gnl|my_center|LOCUS_18570 >Feature sequence392 1 939 gene locus_tag LOCUS_18580 1 939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18580 1149 1550 gene locus_tag LOCUS_18590 1149 1550 CDS product nucleotidyltransferase substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258723.1 protein_id gnl|my_center|LOCUS_18590 1552 1866 gene locus_tag LOCUS_18600 1552 1866 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258722.1 protein_id gnl|my_center|LOCUS_18600 1863 2120 gene locus_tag LOCUS_18610 1863 2120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792913.1 protein_id gnl|my_center|LOCUS_18610 >Feature sequence393 15 326 gene locus_tag LOCUS_18620 15 326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18620 298 2061 gene locus_tag LOCUS_18630 298 2061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18630 >Feature sequence394 798 625 gene locus_tag LOCUS_18640 798 625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18640 1381 758 gene locus_tag LOCUS_18650 1381 758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18650 1788 1378 gene locus_tag LOCUS_18660 1788 1378 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010633018.1 protein_id gnl|my_center|LOCUS_18660 <2416 1785 gene locus_tag LOCUS_18670 <2416 1785 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005069550.1:MotA/TolQ/ExbB proton channel family protein >Feature sequence395 339 1601 gene locus_tag LOCUS_18680 339 1601 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037226281.1 protein_id gnl|my_center|LOCUS_18680 >Feature sequence396 138 2099 gene locus_tag LOCUS_18690 gene dnaK 138 2099 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940711.1 protein_id gnl|my_center|LOCUS_18690 >Feature sequence397 1220 2398 gene locus_tag LOCUS_18700 gene argJ 1220 2398 CDS product bifunctional glutamate N-acetyltransferase/amino-acid acetyltransferase ArgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942692.1 protein_id gnl|my_center|LOCUS_18700 >Feature sequence398 39 233 gene locus_tag LOCUS_18710 39 233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18710 762 253 gene locus_tag LOCUS_18720 762 253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18720 1349 750 gene locus_tag LOCUS_18730 1349 750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18730 2382 1357 gene locus_tag LOCUS_18740 2382 1357 CDS product NAD-dependent epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942881.1 protein_id gnl|my_center|LOCUS_18740 >Feature sequence399 1027 56 gene locus_tag LOCUS_18750 1027 56 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545566.1 protein_id gnl|my_center|LOCUS_18750 1460 1293 gene locus_tag LOCUS_18760 1460 1293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18760 <2393 1613 gene locus_tag LOCUS_18770 <2393 1613 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963427.1:nucleotide sugar dehydrogenase >Feature sequence400 904 167 gene locus_tag LOCUS_18780 904 167 CDS product PmeII family type II restriction endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_044233708.1 protein_id gnl|my_center|LOCUS_18780 1745 786 gene locus_tag LOCUS_18790 1745 786 CDS product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008193633.1 protein_id gnl|my_center|LOCUS_18790 >Feature sequence401 >Feature sequence402 1557 670 gene locus_tag LOCUS_18800 1557 670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18800 >Feature sequence403 798 445 gene locus_tag LOCUS_18810 798 445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18810 1106 795 gene locus_tag LOCUS_18820 1106 795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18820 2043 1792 gene locus_tag LOCUS_18830 2043 1792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18830 >Feature sequence404 707 372 gene locus_tag LOCUS_18840 707 372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18840 1043 1945 gene locus_tag LOCUS_18850 1043 1945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18850 >Feature sequence405 965 528 gene locus_tag LOCUS_18860 965 528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18860 1409 966 gene locus_tag LOCUS_18870 1409 966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18870 1835 2191 gene locus_tag LOCUS_18880 1835 2191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18880 >Feature sequence406 89 499 gene locus_tag LOCUS_18890 89 499 CDS product chemotaxis response regulator CheY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546608.1 protein_id gnl|my_center|LOCUS_18890 655 1242 gene locus_tag LOCUS_18900 655 1242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_18900 1361 1759 gene locus_tag LOCUS_18910 1361 1759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18910 >Feature sequence407 864 52 gene locus_tag LOCUS_18920 gene cas6 864 52 CDS product CRISPR-associated endoribonuclease Cas6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877586.1 protein_id gnl|my_center|LOCUS_18920 1016 876 gene locus_tag LOCUS_18930 1016 876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18930 1345 1064 gene locus_tag LOCUS_18940 1345 1064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18940 2172 1705 gene locus_tag LOCUS_18950 2172 1705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18950 >Feature sequence408 439 221 gene locus_tag LOCUS_18960 439 221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18960 1335 562 gene locus_tag LOCUS_18970 1335 562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18970 <2339 1538 gene locus_tag LOCUS_18980 <2339 1538 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941236.1:zinc-dependent alcohol dehydrogenase family protein note possible pseudo, frameshifted >Feature sequence409 1275 364 gene locus_tag LOCUS_18990 1275 364 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942409.1 protein_id gnl|my_center|LOCUS_18990 1510 1268 gene locus_tag LOCUS_19000 1510 1268 CDS product exodeoxyribonuclease VII small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942410.1 protein_id gnl|my_center|LOCUS_19000 1930 1667 gene locus_tag LOCUS_19010 1930 1667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19010 >Feature sequence410 797 1954 gene locus_tag LOCUS_19020 797 1954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19020 >Feature sequence411 <1 528 gene locus_tag LOCUS_19030 <1 528 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012545470.1:S-layer homology domain-containing protein 1017 1799 gene locus_tag LOCUS_19040 1017 1799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19040 2331 2038 gene locus_tag LOCUS_19050 2331 2038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19050 >Feature sequence412 2309 345 gene locus_tag LOCUS_19060 gene pilB 2309 345 CDS product type IV-A pilus assembly ATPase PilB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546013.1 protein_id gnl|my_center|LOCUS_19060 >Feature sequence413 <1 758 gene locus_tag LOCUS_19070 <1 758 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010938321.1:ABC transporter ATP-binding protein 746 1921 gene locus_tag LOCUS_19080 746 1921 CDS product SufD family Fe-S cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938320.1 protein_id gnl|my_center|LOCUS_19080 >Feature sequence414 1713 124 gene locus_tag LOCUS_19090 1713 124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19090 <2322 1737 gene locus_tag LOCUS_19100 <2322 1737 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011121802.1:glycosyltransferase family 4 protein note possible pseudo, frameshifted >Feature sequence415 326 643 gene locus_tag LOCUS_19110 326 643 CDS product TusE/DsrC/DsvC family sulfur relay protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940042.1 protein_id gnl|my_center|LOCUS_19110 727 1122 gene locus_tag LOCUS_19120 727 1122 CDS product secondary thiamine-phosphate synthase enzyme YjbQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545896.1 protein_id gnl|my_center|LOCUS_19120 1137 1592 gene locus_tag LOCUS_19130 gene ahbA 1137 1592 CDS product siroheme decarboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938154.1 protein_id gnl|my_center|LOCUS_19130 >Feature sequence416 1729 1172 gene locus_tag LOCUS_19140 gene gmhB 1729 1172 CDS product D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259582.1 protein_id gnl|my_center|LOCUS_19140 >Feature sequence417 1270 809 gene locus_tag LOCUS_19150 1270 809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19150 2099 1170 gene locus_tag LOCUS_19160 2099 1170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19160 >Feature sequence418 255 485 gene locus_tag LOCUS_19170 255 485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19170 538 978 gene locus_tag LOCUS_19180 538 978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19180 2214 1366 gene locus_tag LOCUS_19190 2214 1366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19190 >Feature sequence419 2050 464 gene locus_tag LOCUS_19200 2050 464 CDS product NAD+ synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392090.1 protein_id gnl|my_center|LOCUS_19200 >Feature sequence420 1350 694 gene locus_tag LOCUS_19210 1350 694 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004523383.1 protein_id gnl|my_center|LOCUS_19210 2263 1316 gene locus_tag LOCUS_19220 2263 1316 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205740.1 protein_id gnl|my_center|LOCUS_19220 >Feature sequence421 2027 1053 gene locus_tag LOCUS_19230 2027 1053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19230 >Feature sequence422 265 86 gene locus_tag LOCUS_19240 265 86 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19240 525 211 gene locus_tag LOCUS_19250 525 211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19250 1925 1050 gene locus_tag LOCUS_19260 1925 1050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19260 >Feature sequence423 664 1905 gene locus_tag LOCUS_19270 664 1905 CDS product competence/damage-inducible protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940819.1 protein_id gnl|my_center|LOCUS_19270 >Feature sequence424 >Feature sequence425 1754 672 gene locus_tag LOCUS_19280 1754 672 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813006.1 protein_id gnl|my_center|LOCUS_19280 2077 1919 gene locus_tag LOCUS_19290 2077 1919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19290 >Feature sequence426 792 2228 gene locus_tag LOCUS_19300 gene cdaA 792 2228 CDS product diadenylate cyclase CdaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941532.1 protein_id gnl|my_center|LOCUS_19300 >Feature sequence427 2035 1523 gene locus_tag LOCUS_19310 2035 1523 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941955.1 protein_id gnl|my_center|LOCUS_19310 >Feature sequence428 <1 630 gene locus_tag LOCUS_19320 <1 630 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010937857.1:ABC transporter ATP-binding protein 799 1587 gene locus_tag LOCUS_19330 799 1587 CDS product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022504.1 protein_id gnl|my_center|LOCUS_19330 1969 2208 gene locus_tag LOCUS_19340 1969 2208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19340 >Feature sequence429 747 46 gene locus_tag LOCUS_19350 747 46 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19350 793 1065 gene locus_tag LOCUS_19360 793 1065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19360 1150 2016 gene locus_tag LOCUS_19370 1150 2016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19370 >Feature sequence430 1242 10 gene locus_tag LOCUS_19380 gene serS 1242 10 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000884181.1 protein_id gnl|my_center|LOCUS_19380 1531 2088 gene locus_tag LOCUS_19390 1531 2088 CDS product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986919.1 protein_id gnl|my_center|LOCUS_19390 >Feature sequence431 244 624 gene locus_tag LOCUS_19400 244 624 CDS product four helix bundle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405056.1 protein_id gnl|my_center|LOCUS_19400 1153 1626 gene locus_tag LOCUS_19410 1153 1626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19410 >Feature sequence432 >Feature sequence433 >Feature sequence434 2113 1073 gene locus_tag LOCUS_19420 gene secF 2113 1073 CDS product protein translocase subunit SecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939105.1 protein_id gnl|my_center|LOCUS_19420 >Feature sequence435 381 968 gene locus_tag LOCUS_19430 381 968 CDS product TIGR00730 family Rossman fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938821.1 protein_id gnl|my_center|LOCUS_19430 970 1563 gene locus_tag LOCUS_19440 970 1563 CDS product lytic transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942470.1 protein_id gnl|my_center|LOCUS_19440 1690 1914 gene locus_tag LOCUS_19450 1690 1914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19450 >Feature sequence436 863 1867 gene locus_tag LOCUS_19460 863 1867 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943066.1 protein_id gnl|my_center|LOCUS_19460 >Feature sequence437 823 5 gene locus_tag LOCUS_19470 823 5 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19470 2039 810 gene locus_tag LOCUS_19480 2039 810 CDS product DUF2062 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964347.1 protein_id gnl|my_center|LOCUS_19480 >Feature sequence438 180 40 gene locus_tag LOCUS_19490 180 40 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19490 387 704 gene locus_tag LOCUS_19500 387 704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19500 817 1086 gene locus_tag LOCUS_19510 gene hupB 817 1086 CDS product DNA-binding protein HU-beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006081127.1 protein_id gnl|my_center|LOCUS_19510 1219 1479 gene locus_tag LOCUS_19520 1219 1479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19520 >Feature sequence439 434 880 gene locus_tag LOCUS_19530 gene mraZ 434 880 CDS product division/cell wall cluster transcriptional repressor MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723756.1 protein_id gnl|my_center|LOCUS_19530 1145 1990 gene locus_tag LOCUS_19540 gene rsmH 1145 1990 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965431.1 protein_id gnl|my_center|LOCUS_19540 >Feature sequence440 1800 763 gene locus_tag LOCUS_19550 1800 763 CDS product DUF3524 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257632.1 protein_id gnl|my_center|LOCUS_19550 >Feature sequence441 1520 390 gene locus_tag LOCUS_19560 1520 390 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927265.1 protein_id gnl|my_center|LOCUS_19560 1945 1661 gene locus_tag LOCUS_19570 1945 1661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19570 >Feature sequence442 556 89 gene locus_tag LOCUS_19580 556 89 CDS product Mut7-C RNAse domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978170.1 protein_id gnl|my_center|LOCUS_19580 >Feature sequence443 380 192 gene locus_tag LOCUS_19590 380 192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19590 545 1327 gene locus_tag LOCUS_19600 545 1327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19600 1545 2039 gene locus_tag LOCUS_19610 gene cas4 1545 2039 CDS product CRISPR-associated protein Cas4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930592.1 protein_id gnl|my_center|LOCUS_19610 >Feature sequence444 1276 917 gene locus_tag LOCUS_19620 1276 917 CDS product DUF6516 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048053649.1 protein_id gnl|my_center|LOCUS_19620 1569 1264 gene locus_tag LOCUS_19630 1569 1264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19630 1754 1611 gene locus_tag LOCUS_19640 1754 1611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19640 1877 2005 gene locus_tag LOCUS_19650 1877 2005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19650 >Feature sequence445 1756 551 gene locus_tag LOCUS_19660 1756 551 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940829.1 protein_id gnl|my_center|LOCUS_19660 >Feature sequence446 <1 694 gene locus_tag LOCUS_19670 <1 694 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_144956692.1:DDE-type integrase/transposase/recombinase note possible pseudo, frameshifted 769 1227 gene locus_tag LOCUS_19680 769 1227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19680 1224 1628 gene locus_tag LOCUS_19690 1224 1628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19690 1748 1924 gene locus_tag LOCUS_19700 1748 1924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19700 >Feature sequence447 722 1330 gene locus_tag LOCUS_19710 722 1330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19710 1294 1779 gene locus_tag LOCUS_19720 1294 1779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19720 >Feature sequence448 <1 1685 gene locus_tag LOCUS_19730 <1 1685 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010947070.1:flagellin >Feature sequence449 1885 227 gene locus_tag LOCUS_19740 1885 227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19740 >Feature sequence450 617 297 gene locus_tag LOCUS_19750 617 297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19750 1205 1387 gene locus_tag LOCUS_19760 1205 1387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19760 1763 1473 gene locus_tag LOCUS_19770 1763 1473 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000221356.1 protein_id gnl|my_center|LOCUS_19770 2007 1753 gene locus_tag LOCUS_19780 2007 1753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19780 >Feature sequence451 62 2023 gene locus_tag LOCUS_19790 62 2023 CDS product PBP1A family penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545662.1 protein_id gnl|my_center|LOCUS_19790 >Feature sequence452 2 1393 gene locus_tag LOCUS_19800 2 1393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19800 1477 1935 gene locus_tag LOCUS_19810 1477 1935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19810 >Feature sequence453 277 68 gene locus_tag LOCUS_19820 277 68 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19820 785 246 gene locus_tag LOCUS_19830 785 246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19830 966 847 gene locus_tag LOCUS_19840 966 847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19840 >Feature sequence454 >Feature sequence455 629 18 gene locus_tag LOCUS_19850 629 18 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19850 962 1038 gene locus_tag LOCUS_t00250 962 1038 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 1901 1113 gene locus_tag LOCUS_19860 1901 1113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19860 >Feature sequence456 203 1204 gene locus_tag LOCUS_19870 203 1204 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941622.1 protein_id gnl|my_center|LOCUS_19870 1337 1585 gene locus_tag LOCUS_19880 1337 1585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19880 1626 2117 gene locus_tag LOCUS_19890 1626 2117 CDS product DUF1456 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037422212.1 protein_id gnl|my_center|LOCUS_19890 >Feature sequence457 488 231 gene locus_tag LOCUS_19900 488 231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19900 943 485 gene locus_tag LOCUS_19910 943 485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19910 1555 1824 gene locus_tag LOCUS_19920 1555 1824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19920 >Feature sequence458 1240 692 gene locus_tag LOCUS_19930 1240 692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19930 1481 1194 gene locus_tag LOCUS_19940 1481 1194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19940 1765 1517 gene locus_tag LOCUS_19950 1765 1517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19950 >Feature sequence459 1079 765 gene locus_tag LOCUS_19960 1079 765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19960 1388 1164 gene locus_tag LOCUS_19970 1388 1164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19970 1825 1385 gene locus_tag LOCUS_19980 1825 1385 CDS product zeta toxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766449.1 protein_id gnl|my_center|LOCUS_19980 >Feature sequence460 185 1603 gene locus_tag LOCUS_19990 gene trkA 185 1603 CDS product Trk system potassium transporter TrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545959.1 protein_id gnl|my_center|LOCUS_19990 >Feature sequence461 >Feature sequence462 <2037 1122 gene locus_tag LOCUS_20000 <2037 1122 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011020760.1:FmdE family protein >Feature sequence463 1330 314 gene locus_tag LOCUS_20010 1330 314 CDS product IS110-like element ISGsu4 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941629.1 protein_id gnl|my_center|LOCUS_20010 >Feature sequence464 17 550 gene locus_tag LOCUS_20020 17 550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20020 >Feature sequence465 1027 416 gene locus_tag LOCUS_20030 1027 416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20030 >Feature sequence466 339 64 gene locus_tag LOCUS_20040 339 64 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20040 1769 870 gene locus_tag LOCUS_20050 1769 870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20050