>Feature sequence001 264 590 gene locus_tag LOCUS_00010 264 590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00010 621 1295 gene locus_tag LOCUS_00020 621 1295 CDS product ADP-ribosylation factor-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887499.1 protein_id gnl|my_center|LOCUS_00020 1292 2698 gene locus_tag LOCUS_00030 1292 2698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00030 2691 3641 gene locus_tag LOCUS_00040 2691 3641 CDS product thiamine-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973432.1 protein_id gnl|my_center|LOCUS_00040 4804 3629 gene locus_tag LOCUS_00050 4804 3629 CDS product DUF1343 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545899.1 protein_id gnl|my_center|LOCUS_00050 5754 4801 gene locus_tag LOCUS_00060 5754 4801 CDS product aspartate carbamoyltransferase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531794.1 protein_id gnl|my_center|LOCUS_00060 6283 5798 gene locus_tag LOCUS_00070 6283 5798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00070 7034 6261 gene locus_tag LOCUS_00080 7034 6261 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257740.1 protein_id gnl|my_center|LOCUS_00080 7833 7036 gene locus_tag LOCUS_00090 7833 7036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00090 7832 9109 gene locus_tag LOCUS_00100 7832 9109 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986780.1 protein_id gnl|my_center|LOCUS_00100 9381 10019 gene locus_tag LOCUS_00110 9381 10019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00110 10038 11090 gene locus_tag LOCUS_00120 10038 11090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00120 11917 11105 gene locus_tag LOCUS_00130 11917 11105 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941482.1 protein_id gnl|my_center|LOCUS_00130 12765 11917 gene locus_tag LOCUS_00140 12765 11917 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388167.1 protein_id gnl|my_center|LOCUS_00140 13916 12798 gene locus_tag LOCUS_00150 gene alr 13916 12798 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941268.1 protein_id gnl|my_center|LOCUS_00150 14029 14928 gene locus_tag LOCUS_00160 14029 14928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00160 15764 14895 gene locus_tag LOCUS_00170 15764 14895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00170 15851 16051 gene locus_tag LOCUS_00180 15851 16051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_00180 16052 16849 gene locus_tag LOCUS_00190 16052 16849 CDS product thiazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941251.1 protein_id gnl|my_center|LOCUS_00190 16860 17498 gene locus_tag LOCUS_00200 gene thiE 16860 17498 CDS product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880880.1 protein_id gnl|my_center|LOCUS_00200 17507 18133 gene locus_tag LOCUS_00210 17507 18133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00210 18204 18899 gene locus_tag LOCUS_00220 gene purQ 18204 18899 CDS product phosphoribosylformylglycinamidine synthase subunit PurQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475857.1 protein_id gnl|my_center|LOCUS_00220 18896 21178 gene locus_tag LOCUS_00230 gene purL 18896 21178 CDS product phosphoribosylformylglycinamidine synthase subunit PurL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388466.1 protein_id gnl|my_center|LOCUS_00230 22460 21171 gene locus_tag LOCUS_00240 22460 21171 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405033.1 protein_id gnl|my_center|LOCUS_00240 26157 22561 gene locus_tag LOCUS_00250 gene smc 26157 22561 CDS product chromosome segregation protein SMC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941791.1 protein_id gnl|my_center|LOCUS_00250 27064 26315 gene locus_tag LOCUS_00260 27064 26315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00260 28560 27061 gene locus_tag LOCUS_00270 gene glpK 28560 27061 CDS product glycerol kinase GlpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943390.1 protein_id gnl|my_center|LOCUS_00270 29701 28604 gene locus_tag LOCUS_00280 29701 28604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00280 30668 29703 gene locus_tag LOCUS_00290 30668 29703 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867427.1 protein_id gnl|my_center|LOCUS_00290 30827 33151 gene locus_tag LOCUS_00300 30827 33151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00300 34007 33144 gene locus_tag LOCUS_00310 34007 33144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00310 34504 34019 gene locus_tag LOCUS_00320 34504 34019 CDS product YajQ family cyclic di-GMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944407.1 protein_id gnl|my_center|LOCUS_00320 36034 34529 gene locus_tag LOCUS_00330 36034 34529 CDS product short-chain fatty acyl-CoA regulator family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390069.1 protein_id gnl|my_center|LOCUS_00330 36270 38276 gene locus_tag LOCUS_00340 36270 38276 CDS product protein meaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030947.1 protein_id gnl|my_center|LOCUS_00340 38263 39270 gene locus_tag LOCUS_00350 38263 39270 CDS product ATP/GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390694.1 protein_id gnl|my_center|LOCUS_00350 39278 40498 gene locus_tag LOCUS_00360 gene ccrA 39278 40498 CDS product crotonyl-CoA carboxylase/reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721248.1 protein_id gnl|my_center|LOCUS_00360 40507 42120 gene locus_tag LOCUS_00370 40507 42120 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390812.1 protein_id gnl|my_center|LOCUS_00370 42154 43899 gene locus_tag LOCUS_00380 42154 43899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00380 44157 44008 gene locus_tag LOCUS_00390 44157 44008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00390 44120 45913 gene locus_tag LOCUS_00400 44120 45913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00400 48038 45876 gene locus_tag LOCUS_00410 48038 45876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00410 48055 48621 gene locus_tag LOCUS_00420 48055 48621 CDS product DUF938 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525148.1 protein_id gnl|my_center|LOCUS_00420 49577 48618 gene locus_tag LOCUS_00430 49577 48618 CDS product calcium/sodium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_181711559.1 protein_id gnl|my_center|LOCUS_00430 49773 50534 gene locus_tag LOCUS_00440 49773 50534 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087987.1 protein_id gnl|my_center|LOCUS_00440 50548 54981 gene locus_tag LOCUS_00450 50548 54981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00450 54974 59647 gene locus_tag LOCUS_00460 54974 59647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00460 59652 60245 gene locus_tag LOCUS_00470 59652 60245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00470 60242 60805 gene locus_tag LOCUS_00480 60242 60805 CDS product nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003699801.1 protein_id gnl|my_center|LOCUS_00480 60802 61599 gene locus_tag LOCUS_00490 60802 61599 CDS product DUF2520 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230459.1 protein_id gnl|my_center|LOCUS_00490 64023 61609 gene locus_tag LOCUS_00500 64023 61609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00500 64193 64729 gene locus_tag LOCUS_00510 64193 64729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00510 64733 65734 gene locus_tag LOCUS_00520 gene holA 64733 65734 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392113.1 protein_id gnl|my_center|LOCUS_00520 66031 65765 gene locus_tag LOCUS_00530 gene rpsT 66031 65765 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001273615.1 protein_id gnl|my_center|LOCUS_00530 66204 68450 gene locus_tag LOCUS_00540 66204 68450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00540 69696 68620 gene locus_tag LOCUS_00550 69696 68620 CDS product isocitrate/isopropylmalate dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025774414.1 protein_id gnl|my_center|LOCUS_00550 69714 70574 gene locus_tag LOCUS_00560 gene hslO 69714 70574 CDS product Hsp33 family molecular chaperone HslO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428049.1 protein_id gnl|my_center|LOCUS_00560 70626 72218 gene locus_tag LOCUS_00570 gene murJ 70626 72218 CDS product murein biosynthesis integral membrane protein MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941832.1 protein_id gnl|my_center|LOCUS_00570 72246 72869 gene locus_tag LOCUS_00580 gene yihA 72246 72869 CDS product ribosome biogenesis GTP-binding protein YihA/YsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002915299.1 protein_id gnl|my_center|LOCUS_00580 74466 72877 gene locus_tag LOCUS_00590 74466 72877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00590 74765 74484 gene locus_tag LOCUS_00600 74765 74484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00600 75055 75369 gene locus_tag LOCUS_00610 75055 75369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00610 75412 76647 gene locus_tag LOCUS_00620 75412 76647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00620 76644 77183 gene locus_tag LOCUS_00630 76644 77183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00630 77180 77779 gene locus_tag LOCUS_00640 77180 77779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00640 77776 78315 gene locus_tag LOCUS_00650 77776 78315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00650 78312 78701 gene locus_tag LOCUS_00660 78312 78701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00660 78767 79249 gene locus_tag LOCUS_00670 78767 79249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00670 79266 80030 gene locus_tag LOCUS_00680 79266 80030 CDS product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230868.1 protein_id gnl|my_center|LOCUS_00680 80877 80062 gene locus_tag LOCUS_00690 80877 80062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00690 81791 80820 gene locus_tag LOCUS_00700 81791 80820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00700 >Feature sequence002 528 1130 gene locus_tag LOCUS_00710 528 1130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00710 1141 2028 gene locus_tag LOCUS_00720 1141 2028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00720 3676 2006 gene locus_tag LOCUS_00730 gene hflX 3676 2006 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941674.1 protein_id gnl|my_center|LOCUS_00730 4769 3684 gene locus_tag LOCUS_00740 4769 3684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00740 5004 5390 gene locus_tag LOCUS_00750 5004 5390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00750 5362 6126 gene locus_tag LOCUS_00760 5362 6126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00760 7495 6152 gene locus_tag LOCUS_00770 7495 6152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00770 7544 8092 gene locus_tag LOCUS_00780 7544 8092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00780 8089 8595 gene locus_tag LOCUS_00790 8089 8595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00790 8596 9360 gene locus_tag LOCUS_00800 8596 9360 CDS product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942579.1 protein_id gnl|my_center|LOCUS_00800 10069 9413 gene locus_tag LOCUS_00810 10069 9413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00810 10201 11793 gene locus_tag LOCUS_00820 10201 11793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00820 13193 11796 gene locus_tag LOCUS_00830 13193 11796 CDS product DegQ family serine endoprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940757.1 protein_id gnl|my_center|LOCUS_00830 14981 13293 gene locus_tag LOCUS_00840 14981 13293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00840 16325 14985 gene locus_tag LOCUS_00850 16325 14985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00850 16386 17210 gene locus_tag LOCUS_00860 gene murI 16386 17210 CDS product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943554.1 protein_id gnl|my_center|LOCUS_00860 17255 18571 gene locus_tag LOCUS_00870 17255 18571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00870 18593 19090 gene locus_tag LOCUS_00880 18593 19090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00880 19340 19047 gene locus_tag LOCUS_00890 19340 19047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00890 19676 19353 gene locus_tag LOCUS_00900 19676 19353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00900 20255 19725 gene locus_tag LOCUS_00910 20255 19725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943551.1 protein_id gnl|my_center|LOCUS_00910 20326 21363 gene locus_tag LOCUS_00920 20326 21363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00920 21360 22001 gene locus_tag LOCUS_00930 21360 22001 CDS product DUF501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080407.1 protein_id gnl|my_center|LOCUS_00930 21982 22425 gene locus_tag LOCUS_00940 21982 22425 CDS product DUF2752 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615711.1 protein_id gnl|my_center|LOCUS_00940 23294 22422 gene locus_tag LOCUS_00950 23294 22422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00950 23646 23344 gene locus_tag LOCUS_00960 23646 23344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00960 23737 24741 gene locus_tag LOCUS_00970 23737 24741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00970 24792 24866 gene locus_tag LOCUS_t00010 24792 24866 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 24930 25481 gene locus_tag LOCUS_00980 24930 25481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00980 26970 25489 gene locus_tag LOCUS_00990 26970 25489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00990 27179 29401 gene locus_tag LOCUS_01000 27179 29401 CDS product heterodisulfide reductase-related iron-sulfur binding cluster inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459849.1 protein_id gnl|my_center|LOCUS_01000 29463 31256 gene locus_tag LOCUS_01010 29463 31256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01010 31506 31712 gene locus_tag LOCUS_01020 31506 31712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01020 32287 31760 gene locus_tag LOCUS_01030 32287 31760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01030 33554 32376 gene locus_tag LOCUS_01040 gene atuD 33554 32376 CDS product citronellyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101733.1 protein_id gnl|my_center|LOCUS_01040 34585 33641 gene locus_tag LOCUS_01050 34585 33641 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359517.1 protein_id gnl|my_center|LOCUS_01050 35479 34619 gene locus_tag LOCUS_01060 35479 34619 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192762.1 protein_id gnl|my_center|LOCUS_01060 36591 35476 gene locus_tag LOCUS_01070 gene thiO 36591 35476 CDS product glycine oxidase ThiO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205421597.1 protein_id gnl|my_center|LOCUS_01070 37682 36630 gene locus_tag LOCUS_01080 gene rseP 37682 36630 CDS product RIP metalloprotease RseP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392556.1 protein_id gnl|my_center|LOCUS_01080 37896 38708 gene locus_tag LOCUS_01090 37896 38708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01090 40011 38596 gene locus_tag LOCUS_01100 gene glmU 40011 38596 CDS product bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391623.1 protein_id gnl|my_center|LOCUS_01100 41163 40021 gene locus_tag LOCUS_01110 41163 40021 CDS product ArsA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731107.1 protein_id gnl|my_center|LOCUS_01110 41292 41681 gene locus_tag LOCUS_01120 41292 41681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01120 42643 41663 gene locus_tag LOCUS_01130 gene hemC 42643 41663 CDS product hydroxymethylbilane synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943896.1 protein_id gnl|my_center|LOCUS_01130 43998 42640 gene locus_tag LOCUS_01140 gene hemA 43998 42640 CDS product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943895.1 protein_id gnl|my_center|LOCUS_01140 44798 43998 gene locus_tag LOCUS_01150 gene ccsB 44798 43998 CDS product c-type cytochrome biogenesis protein CcsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943894.1 protein_id gnl|my_center|LOCUS_01150 44950 45279 gene locus_tag LOCUS_01160 gene trxA 44950 45279 CDS product thioredoxin TrxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001280776.1 protein_id gnl|my_center|LOCUS_01160 45722 45276 gene locus_tag LOCUS_01170 gene dut 45722 45276 CDS product dUTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083581.1 protein_id gnl|my_center|LOCUS_01170 <47702 45783 gene locus_tag LOCUS_01180 <47702 45783 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_041914012.1:polyribonucleotide nucleotidyltransferase >Feature sequence003 1319 732 gene locus_tag LOCUS_01190 1319 732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01190 2887 1430 gene locus_tag LOCUS_01200 2887 1430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01200 3141 2887 gene locus_tag LOCUS_01210 3141 2887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01210 4430 3138 gene locus_tag LOCUS_01220 4430 3138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01220 8260 4430 gene locus_tag LOCUS_01230 8260 4430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01230 10650 8257 gene locus_tag LOCUS_01240 10650 8257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01240 11360 10650 gene locus_tag LOCUS_01250 11360 10650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01250 11611 12198 gene locus_tag LOCUS_01260 gene sbrI 11611 12198 CDS product ECF family RNA polymerase sigma factor SbrI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119848.1 protein_id gnl|my_center|LOCUS_01260 12188 13114 gene locus_tag LOCUS_01270 12188 13114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01270 13941 13126 gene locus_tag LOCUS_01280 13941 13126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01280 14004 15401 gene locus_tag LOCUS_01290 14004 15401 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546604.1 protein_id gnl|my_center|LOCUS_01290 15398 15742 gene locus_tag LOCUS_01300 15398 15742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01300 17128 15779 gene locus_tag LOCUS_01310 17128 15779 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941790.1 protein_id gnl|my_center|LOCUS_01310 18488 17190 gene locus_tag LOCUS_01320 18488 17190 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460968.1 protein_id gnl|my_center|LOCUS_01320 20007 18511 gene locus_tag LOCUS_01330 20007 18511 CDS product peptide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939361.1 protein_id gnl|my_center|LOCUS_01330 20032 21471 gene locus_tag LOCUS_01340 gene dacB 20032 21471 CDS product D-alanyl-D-alanine carboxypeptidase/D-alanyl-D-alanine-endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399303.1 protein_id gnl|my_center|LOCUS_01340 21539 23653 gene locus_tag LOCUS_01350 21539 23653 CDS product oligopeptidase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140133.1 protein_id gnl|my_center|LOCUS_01350 24915 24136 gene locus_tag LOCUS_01360 24915 24136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01360 26372 25023 gene locus_tag LOCUS_01370 26372 25023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01370 27363 28766 gene locus_tag LOCUS_01380 27363 28766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01380 28841 29413 gene locus_tag LOCUS_01390 28841 29413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01390 30022 29414 gene locus_tag LOCUS_01400 30022 29414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01400 31515 30019 gene locus_tag LOCUS_01410 31515 30019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01410 32255 31512 gene locus_tag LOCUS_01420 32255 31512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01420 32986 32252 gene locus_tag LOCUS_01430 32986 32252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01430 33134 34066 gene locus_tag LOCUS_01440 33134 34066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01440 34684 34067 gene locus_tag LOCUS_01450 gene trmB 34684 34067 CDS product tRNA (guanosine(46)-N7)-methyltransferase TrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057818.1 protein_id gnl|my_center|LOCUS_01450 34803 35606 gene locus_tag LOCUS_01460 34803 35606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01460 35648 38329 gene locus_tag LOCUS_01470 35648 38329 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942688.1 protein_id gnl|my_center|LOCUS_01470 38394 39800 gene locus_tag LOCUS_01480 38394 39800 CDS product UbiA family prenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267578.1 protein_id gnl|my_center|LOCUS_01480 40350 39802 gene locus_tag LOCUS_01490 40350 39802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01490 >Feature sequence004 404 880 gene locus_tag LOCUS_01500 404 880 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117780.1 protein_id gnl|my_center|LOCUS_01500 957 1211 gene locus_tag LOCUS_01510 957 1211 CDS product BolA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056719.1 protein_id gnl|my_center|LOCUS_01510 1214 1534 gene locus_tag LOCUS_01520 gene grxD 1214 1534 CDS product Grx4 family monothiol glutaredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720111.1 protein_id gnl|my_center|LOCUS_01520 1547 2593 gene locus_tag LOCUS_01530 1547 2593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01530 3184 2624 gene locus_tag LOCUS_01540 3184 2624 CDS product VTT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272454.1 protein_id gnl|my_center|LOCUS_01540 5209 3257 gene locus_tag LOCUS_01550 5209 3257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01550 6225 5212 gene locus_tag LOCUS_01560 6225 5212 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242543.1 protein_id gnl|my_center|LOCUS_01560 8436 6259 gene locus_tag LOCUS_01570 8436 6259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01570 9737 8433 gene locus_tag LOCUS_01580 9737 8433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01580 9875 10840 gene locus_tag LOCUS_01590 9875 10840 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838671.1 protein_id gnl|my_center|LOCUS_01590 10837 11547 gene locus_tag LOCUS_01600 10837 11547 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838670.1 protein_id gnl|my_center|LOCUS_01600 11551 13260 gene locus_tag LOCUS_01610 11551 13260 CDS product Gldg family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404001.1 protein_id gnl|my_center|LOCUS_01610 13279 14361 gene locus_tag LOCUS_01620 13279 14361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01620 14783 14367 gene locus_tag LOCUS_01630 14783 14367 CDS product DUF423 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269203.1 protein_id gnl|my_center|LOCUS_01630 14873 17731 gene locus_tag LOCUS_01640 14873 17731 CDS product 2-oxoglutarate dehydrogenase E1 component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007338417.1 protein_id gnl|my_center|LOCUS_01640 18223 17810 gene locus_tag LOCUS_01650 18223 17810 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258972.1 protein_id gnl|my_center|LOCUS_01650 18395 18874 gene locus_tag LOCUS_01660 18395 18874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01660 18914 19624 gene locus_tag LOCUS_01670 18914 19624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01670 19629 20087 gene locus_tag LOCUS_01680 19629 20087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01680 20131 21888 gene locus_tag LOCUS_01690 20131 21888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01690 22030 23178 gene locus_tag LOCUS_01700 22030 23178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01700 23184 25634 gene locus_tag LOCUS_01710 gene rnr 23184 25634 CDS product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942131.1 protein_id gnl|my_center|LOCUS_01710 25634 26965 gene locus_tag LOCUS_01720 25634 26965 CDS product pyrimidine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583823.1 protein_id gnl|my_center|LOCUS_01720 28220 26943 gene locus_tag LOCUS_01730 28220 26943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01730 28591 28836 gene locus_tag LOCUS_01740 28591 28836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01740 28931 29773 gene locus_tag LOCUS_01750 28931 29773 CDS product DUF692 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444160.1 protein_id gnl|my_center|LOCUS_01750 29763 30500 gene locus_tag LOCUS_01760 29763 30500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01760 31833 30676 gene locus_tag LOCUS_01770 31833 30676 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103930.1 protein_id gnl|my_center|LOCUS_01770 36122 31932 gene locus_tag LOCUS_01780 gene rpoC 36122 31932 CDS product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943492.1 protein_id gnl|my_center|LOCUS_01780 <38655 36126 gene locus_tag LOCUS_01790 <38655 36126 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943493.1:DNA-directed RNA polymerase subunit beta >Feature sequence005 2361 658 gene locus_tag LOCUS_01800 2361 658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01800 2841 2365 gene locus_tag LOCUS_01810 2841 2365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01810 3745 2906 gene locus_tag LOCUS_01820 3745 2906 CDS product DUF547 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404636.1 protein_id gnl|my_center|LOCUS_01820 3825 4196 gene locus_tag LOCUS_01830 gene arsC 3825 4196 CDS product arsenate reductase (glutaredoxin) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098232.1 protein_id gnl|my_center|LOCUS_01830 4954 4193 gene locus_tag LOCUS_01840 4954 4193 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404382.1 protein_id gnl|my_center|LOCUS_01840 4947 5639 gene locus_tag LOCUS_01850 4947 5639 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000372459.1 protein_id gnl|my_center|LOCUS_01850 5666 6508 gene locus_tag LOCUS_01860 5666 6508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01860 7055 6525 gene locus_tag LOCUS_01870 7055 6525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01870 8888 7128 gene locus_tag LOCUS_01880 8888 7128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01880 9030 10157 gene locus_tag LOCUS_01890 9030 10157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01890 10249 10896 gene locus_tag LOCUS_01900 10249 10896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000345920.1 protein_id gnl|my_center|LOCUS_01900 10905 12836 gene locus_tag LOCUS_01910 10905 12836 CDS product fumarate reductase/succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257750.1 protein_id gnl|my_center|LOCUS_01910 12848 13633 gene locus_tag LOCUS_01920 12848 13633 CDS product succinate dehydrogenase/fumarate reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257749.1 protein_id gnl|my_center|LOCUS_01920 14241 13630 gene locus_tag LOCUS_01930 14241 13630 CDS product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205421523.1 protein_id gnl|my_center|LOCUS_01930 14343 15161 gene locus_tag LOCUS_01940 14343 15161 CDS product SirB1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142488.1 protein_id gnl|my_center|LOCUS_01940 15199 16320 gene locus_tag LOCUS_01950 gene hisC 15199 16320 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881362.1 protein_id gnl|my_center|LOCUS_01950 16324 17250 gene locus_tag LOCUS_01960 16324 17250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01960 18376 17252 gene locus_tag LOCUS_01970 18376 17252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01970 18845 18450 gene locus_tag LOCUS_01980 18845 18450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01980 20309 19092 gene locus_tag LOCUS_01990 gene ftsZ 20309 19092 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094113.1 protein_id gnl|my_center|LOCUS_01990 21548 20319 gene locus_tag LOCUS_02000 gene ftsA 21548 20319 CDS product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943689.1 protein_id gnl|my_center|LOCUS_02000 22764 21682 gene locus_tag LOCUS_02010 22764 21682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02010 24134 22761 gene locus_tag LOCUS_02020 gene murC 24134 22761 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943693.1 protein_id gnl|my_center|LOCUS_02020 25418 24141 gene locus_tag LOCUS_02030 gene murG 25418 24141 CDS product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943694.1 protein_id gnl|my_center|LOCUS_02030 26611 25415 gene locus_tag LOCUS_02040 gene ftsW 26611 25415 CDS product putative lipid II flippase FtsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943695.1 protein_id gnl|my_center|LOCUS_02040 27966 26608 gene locus_tag LOCUS_02050 gene murD 27966 26608 CDS product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943696.1 protein_id gnl|my_center|LOCUS_02050 29090 27963 gene locus_tag LOCUS_02060 gene mraY 29090 27963 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388708.1 protein_id gnl|my_center|LOCUS_02060 30493 29087 gene locus_tag LOCUS_02070 30493 29087 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943698.1 protein_id gnl|my_center|LOCUS_02070 32019 30493 gene locus_tag LOCUS_02080 32019 30493 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943699.1 protein_id gnl|my_center|LOCUS_02080 34063 32009 gene locus_tag LOCUS_02090 34063 32009 CDS product penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943700.1 protein_id gnl|my_center|LOCUS_02090 34365 34060 gene locus_tag LOCUS_02100 34365 34060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02100 35252 34362 gene locus_tag LOCUS_02110 gene rsmH 35252 34362 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256657.1 protein_id gnl|my_center|LOCUS_02110 35701 35249 gene locus_tag LOCUS_02120 gene mraZ 35701 35249 CDS product division/cell wall cluster transcriptional repressor MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172625480.1 protein_id gnl|my_center|LOCUS_02120 >Feature sequence006 652 80 gene locus_tag LOCUS_02130 652 80 CDS product tRNA-(ms[2]io[6]A)-hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119755.1 protein_id gnl|my_center|LOCUS_02130 1298 660 gene locus_tag LOCUS_02140 gene hisG 1298 660 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943722.1 protein_id gnl|my_center|LOCUS_02140 1620 1291 gene locus_tag LOCUS_02150 1620 1291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02150 2501 1620 gene locus_tag LOCUS_02160 2501 1620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02160 3193 2540 gene locus_tag LOCUS_02170 3193 2540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02170 4125 3190 gene locus_tag LOCUS_02180 4125 3190 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142866.1 protein_id gnl|my_center|LOCUS_02180 4733 4122 gene locus_tag LOCUS_02190 4733 4122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02190 5682 4771 gene locus_tag LOCUS_02200 5682 4771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02200 6366 5719 gene locus_tag LOCUS_02210 gene fsa 6366 5719 CDS product fructose-6-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403055.1 protein_id gnl|my_center|LOCUS_02210 6675 7916 gene locus_tag LOCUS_02220 6675 7916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02220 8086 7913 gene locus_tag LOCUS_02230 8086 7913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02230 9072 8089 gene locus_tag LOCUS_02240 9072 8089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02240 9533 9078 gene locus_tag LOCUS_02250 9533 9078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02250 9689 10543 gene locus_tag LOCUS_02260 gene era 9689 10543 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230051.1 protein_id gnl|my_center|LOCUS_02260 10540 11916 gene locus_tag LOCUS_02270 gene der 10540 11916 CDS product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392835.1 protein_id gnl|my_center|LOCUS_02270 12427 11990 gene locus_tag LOCUS_02280 12427 11990 CDS product PaaI family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921473.1 protein_id gnl|my_center|LOCUS_02280 12903 12424 gene locus_tag LOCUS_02290 12903 12424 CDS product PaaI family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337309.1 protein_id gnl|my_center|LOCUS_02290 13319 12906 gene locus_tag LOCUS_02300 13319 12906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02300 13383 14402 gene locus_tag LOCUS_02310 13383 14402 CDS product medium chain dehydrogenase/reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003409570.1 protein_id gnl|my_center|LOCUS_02310 14471 14887 gene locus_tag LOCUS_02320 14471 14887 CDS product low molecular weight protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004557108.1 protein_id gnl|my_center|LOCUS_02320 14884 15744 gene locus_tag LOCUS_02330 14884 15744 CDS product fructosamine kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838346.1 protein_id gnl|my_center|LOCUS_02330 15806 16234 gene locus_tag LOCUS_02340 15806 16234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02340 17190 16231 gene locus_tag LOCUS_02350 17190 16231 CDS product NADPH:quinone oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105383.1 protein_id gnl|my_center|LOCUS_02350 17286 18296 gene locus_tag LOCUS_02360 17286 18296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02360 18881 18297 gene locus_tag LOCUS_02370 18881 18297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02370 21075 18886 gene locus_tag LOCUS_02380 21075 18886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02380 21035 21220 gene locus_tag LOCUS_02390 21035 21220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02390 23295 21304 gene locus_tag LOCUS_02400 23295 21304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02400 24063 23344 gene locus_tag LOCUS_02410 24063 23344 CDS product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809442.1 protein_id gnl|my_center|LOCUS_02410 24920 24060 gene locus_tag LOCUS_02420 gene prmA 24920 24060 CDS product 50S ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941115.1 protein_id gnl|my_center|LOCUS_02420 25156 24920 gene locus_tag LOCUS_02430 25156 24920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02430 26091 25237 gene locus_tag LOCUS_02440 26091 25237 CDS product sucrase ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404642.1 protein_id gnl|my_center|LOCUS_02440 27975 26365 gene locus_tag LOCUS_02450 27975 26365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02450 28872 28003 gene locus_tag LOCUS_02460 gene atpG 28872 28003 CDS product ATP synthase F1 subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940788.1 protein_id gnl|my_center|LOCUS_02460 30534 28879 gene locus_tag LOCUS_02470 gene atpA 30534 28879 CDS product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933688.1 protein_id gnl|my_center|LOCUS_02470 31109 30561 gene locus_tag LOCUS_02480 31109 30561 CDS product F0F1 ATP synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383727.1 protein_id gnl|my_center|LOCUS_02480 31765 31106 gene locus_tag LOCUS_02490 31765 31106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02490 32232 31765 gene locus_tag LOCUS_02500 32232 31765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02500 33041 32400 gene locus_tag LOCUS_02510 33041 32400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02510 >Feature sequence007 752 87 gene locus_tag LOCUS_02520 752 87 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02520 1267 821 gene locus_tag LOCUS_02530 1267 821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02530 1332 2387 gene locus_tag LOCUS_02540 1332 2387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02540 3031 2384 gene locus_tag LOCUS_02550 3031 2384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02550 6617 3015 gene locus_tag LOCUS_02560 gene mfd 6617 3015 CDS product transcription-repair coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940695.1 protein_id gnl|my_center|LOCUS_02560 5562 5473 gene locus_tag LOCUS_t00020 5562 5473 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 7881 6607 gene locus_tag LOCUS_02570 7881 6607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02570 8034 9176 gene locus_tag LOCUS_02580 8034 9176 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003134747.1 protein_id gnl|my_center|LOCUS_02580 9297 9653 gene locus_tag LOCUS_02590 9297 9653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02590 10944 9937 gene locus_tag LOCUS_02600 10944 9937 CDS product TIGR04024 family LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902973.1 protein_id gnl|my_center|LOCUS_02600 11825 11043 gene locus_tag LOCUS_02610 11825 11043 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085567.1 protein_id gnl|my_center|LOCUS_02610 12804 11866 gene locus_tag LOCUS_02620 12804 11866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02620 13745 12804 gene locus_tag LOCUS_02630 13745 12804 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970085.1 protein_id gnl|my_center|LOCUS_02630 14185 13793 gene locus_tag LOCUS_02640 14185 13793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02640 15062 14247 gene locus_tag LOCUS_02650 15062 14247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02650 16797 15190 gene locus_tag LOCUS_02660 16797 15190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02660 17540 16794 gene locus_tag LOCUS_02670 17540 16794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02670 18712 17654 gene locus_tag LOCUS_02680 18712 17654 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839879.1 protein_id gnl|my_center|LOCUS_02680 19821 18709 gene locus_tag LOCUS_02690 19821 18709 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933926.1 protein_id gnl|my_center|LOCUS_02690 20735 19818 gene locus_tag LOCUS_02700 20735 19818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02700 21643 20756 gene locus_tag LOCUS_02710 21643 20756 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205421555.1 protein_id gnl|my_center|LOCUS_02710 22699 21656 gene locus_tag LOCUS_02720 22699 21656 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404896.1 protein_id gnl|my_center|LOCUS_02720 26259 22945 gene locus_tag LOCUS_02730 26259 22945 CDS product carboxypeptidase regulatory-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941924.1 protein_id gnl|my_center|LOCUS_02730 26694 27977 gene locus_tag LOCUS_02740 gene hemL 26694 27977 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392758.1 protein_id gnl|my_center|LOCUS_02740 >Feature sequence008 <1 1389 gene locus_tag LOCUS_02750 <1 1389 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943733.1:DNA translocase FtsK 1386 2651 gene locus_tag LOCUS_02760 1386 2651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02760 2567 3991 gene locus_tag LOCUS_02770 2567 3991 CDS product adenosylmethionine--8-amino-7-oxononanoate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266413.1 protein_id gnl|my_center|LOCUS_02770 3988 5532 gene locus_tag LOCUS_02780 gene lnt 3988 5532 CDS product apolipoprotein N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545206.1 protein_id gnl|my_center|LOCUS_02780 7195 5504 gene locus_tag LOCUS_02790 7195 5504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02790 7701 7204 gene locus_tag LOCUS_02800 7701 7204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02800 9611 7608 gene locus_tag LOCUS_02810 9611 7608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02810 10184 9738 gene locus_tag LOCUS_02820 10184 9738 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011174003.1 protein_id gnl|my_center|LOCUS_02820 10509 10330 gene locus_tag LOCUS_02830 10509 10330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02830 10465 11046 gene locus_tag LOCUS_02840 10465 11046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02840 12317 11043 gene locus_tag LOCUS_02850 12317 11043 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967298.1 protein_id gnl|my_center|LOCUS_02850 13684 12314 gene locus_tag LOCUS_02860 13684 12314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02860 13790 14188 gene locus_tag LOCUS_02870 13790 14188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02870 14237 15691 gene locus_tag LOCUS_02880 gene gltX 14237 15691 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941876.1 protein_id gnl|my_center|LOCUS_02880 15728 17263 gene locus_tag LOCUS_02890 15728 17263 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405140.1 protein_id gnl|my_center|LOCUS_02890 17982 17188 gene locus_tag LOCUS_02900 17982 17188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02900 18068 18814 gene locus_tag LOCUS_02910 18068 18814 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941735.1 protein_id gnl|my_center|LOCUS_02910 18822 19307 gene locus_tag LOCUS_02920 gene ruvC 18822 19307 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084351.1 protein_id gnl|my_center|LOCUS_02920 19372 20016 gene locus_tag LOCUS_02930 gene ruvA 19372 20016 CDS product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814226.1 protein_id gnl|my_center|LOCUS_02930 20013 21050 gene locus_tag LOCUS_02940 gene ruvB 20013 21050 CDS product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941738.1 protein_id gnl|my_center|LOCUS_02940 21107 22660 gene locus_tag LOCUS_02950 21107 22660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02950 23661 22657 gene locus_tag LOCUS_02960 23661 22657 CDS product HupE/UreJ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046116578.1 protein_id gnl|my_center|LOCUS_02960 24539 23661 gene locus_tag LOCUS_02970 24539 23661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02970 26593 24539 gene locus_tag LOCUS_02980 26593 24539 CDS product DUF3604 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_081158863.1 protein_id gnl|my_center|LOCUS_02980 27463 26636 gene locus_tag LOCUS_02990 gene dapF 27463 26636 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058127.1 protein_id gnl|my_center|LOCUS_02990 >Feature sequence009 665 327 gene locus_tag LOCUS_03000 665 327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03000 857 1081 gene locus_tag LOCUS_03010 857 1081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03010 1029 2816 gene locus_tag LOCUS_03020 gene tkt 1029 2816 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403054.1 protein_id gnl|my_center|LOCUS_03020 3471 2974 gene locus_tag LOCUS_03030 gene tpx 3471 2974 CDS product thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402767.1 protein_id gnl|my_center|LOCUS_03030 3570 3809 gene locus_tag LOCUS_03040 3570 3809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03040 3806 5974 gene locus_tag LOCUS_03050 gene feoB 3806 5974 CDS product ferrous iron transport protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931750.1 protein_id gnl|my_center|LOCUS_03050 6174 7166 gene locus_tag LOCUS_03060 6174 7166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03060 8143 7196 gene locus_tag LOCUS_03070 gene trxB 8143 7196 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000940581.1 protein_id gnl|my_center|LOCUS_03070 9309 8197 gene locus_tag LOCUS_03080 9309 8197 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089845.1 protein_id gnl|my_center|LOCUS_03080 11691 9319 gene locus_tag LOCUS_03090 11691 9319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03090 11991 11788 gene locus_tag LOCUS_03100 11991 11788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03100 13711 11996 gene locus_tag LOCUS_03110 13711 11996 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942106.1 protein_id gnl|my_center|LOCUS_03110 15109 13874 gene locus_tag LOCUS_03120 15109 13874 CDS product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920947.1 protein_id gnl|my_center|LOCUS_03120 16475 15132 gene locus_tag LOCUS_03130 16475 15132 CDS product 3-hydroxyacyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001206943.1 protein_id gnl|my_center|LOCUS_03130 16677 17714 gene locus_tag LOCUS_03140 16677 17714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03140 17738 18157 gene locus_tag LOCUS_03150 17738 18157 CDS product GatB/YqeY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858625.1 protein_id gnl|my_center|LOCUS_03150 19391 18162 gene locus_tag LOCUS_03160 19391 18162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03160 20476 19418 gene locus_tag LOCUS_03170 20476 19418 CDS product Rieske 2Fe-2S domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104216.1 protein_id gnl|my_center|LOCUS_03170 20562 21203 gene locus_tag LOCUS_03180 20562 21203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03180 21515 21336 gene locus_tag LOCUS_03190 21515 21336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03190 21435 22418 gene locus_tag LOCUS_03200 21435 22418 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001202093.1 protein_id gnl|my_center|LOCUS_03200 22535 23848 gene locus_tag LOCUS_03210 22535 23848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03210 23812 24411 gene locus_tag LOCUS_03220 23812 24411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03220 25316 24408 gene locus_tag LOCUS_03230 gene rsgA 25316 24408 CDS product ribosome small subunit-dependent GTPase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257131.1 protein_id gnl|my_center|LOCUS_03230 25609 25319 gene locus_tag LOCUS_03240 25609 25319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03240 25547 25720 gene locus_tag LOCUS_03250 25547 25720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03250 >Feature sequence010 <1 699 gene locus_tag LOCUS_03260 <1 699 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942138.1:type IV pilus twitching motility protein PilT 821 1729 gene locus_tag LOCUS_03270 821 1729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03270 1729 3321 gene locus_tag LOCUS_03280 1729 3321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03280 3426 4637 gene locus_tag LOCUS_03290 3426 4637 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942139.1 protein_id gnl|my_center|LOCUS_03290 4634 6349 gene locus_tag LOCUS_03300 4634 6349 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942140.1 protein_id gnl|my_center|LOCUS_03300 7091 6294 gene locus_tag LOCUS_03310 gene trpC 7091 6294 CDS product indole-3-glycerol phosphate synthase TrpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005057938.1 protein_id gnl|my_center|LOCUS_03310 8104 7088 gene locus_tag LOCUS_03320 gene trpD 8104 7088 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943017.1 protein_id gnl|my_center|LOCUS_03320 8637 8101 gene locus_tag LOCUS_03330 gene pabA 8637 8101 CDS product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000602287.1 protein_id gnl|my_center|LOCUS_03330 9568 8672 gene locus_tag LOCUS_03340 9568 8672 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197535735.1 protein_id gnl|my_center|LOCUS_03340 9656 10777 gene locus_tag LOCUS_03350 9656 10777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03350 11016 11786 gene locus_tag LOCUS_03360 11016 11786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03360 12551 11775 gene locus_tag LOCUS_03370 12551 11775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03370 13413 12613 gene locus_tag LOCUS_03380 13413 12613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03380 14335 13547 gene locus_tag LOCUS_03390 14335 13547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03390 15783 14365 gene locus_tag LOCUS_03400 15783 14365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03400 15839 16648 gene locus_tag LOCUS_03410 15839 16648 CDS product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869232.1 protein_id gnl|my_center|LOCUS_03410 16664 17740 gene locus_tag LOCUS_03420 16664 17740 CDS product mannose-1-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403343.1 protein_id gnl|my_center|LOCUS_03420 17745 19100 gene locus_tag LOCUS_03430 17745 19100 CDS product phosphomannomutase/phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937988.1 protein_id gnl|my_center|LOCUS_03430 19481 19071 gene locus_tag LOCUS_03440 19481 19071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03440 19527 19784 gene locus_tag LOCUS_03450 19527 19784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03450 19781 19978 gene locus_tag LOCUS_03460 19781 19978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03460 20448 20750 gene locus_tag LOCUS_03470 20448 20750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03470 21575 20799 gene locus_tag LOCUS_03480 gene hisF 21575 20799 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943716.1 protein_id gnl|my_center|LOCUS_03480 22294 21575 gene locus_tag LOCUS_03490 gene hisA 22294 21575 CDS product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino]imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010927224.1 protein_id gnl|my_center|LOCUS_03490 22914 22285 gene locus_tag LOCUS_03500 gene hisH 22914 22285 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943718.1 protein_id gnl|my_center|LOCUS_03500 23504 22911 gene locus_tag LOCUS_03510 gene hisB 23504 22911 CDS product imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391344.1 protein_id gnl|my_center|LOCUS_03510 24032 23547 gene locus_tag LOCUS_03520 24032 23547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03520 26198 24033 gene locus_tag LOCUS_03530 26198 24033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03530 >Feature sequence011 <1 753 gene locus_tag LOCUS_03540 <1 753 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008769934.1:NADH:flavin oxidoreductase note possible pseudo, frameshifted 723 935 gene locus_tag LOCUS_03550 723 935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03550 935 1675 gene locus_tag LOCUS_03560 935 1675 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816058.1 protein_id gnl|my_center|LOCUS_03560 1712 2461 gene locus_tag LOCUS_03570 1712 2461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03570 2433 3668 gene locus_tag LOCUS_03580 2433 3668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03580 3703 4227 gene locus_tag LOCUS_03590 3703 4227 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259574.1 protein_id gnl|my_center|LOCUS_03590 4224 4922 gene locus_tag LOCUS_03600 4224 4922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03600 4980 6317 gene locus_tag LOCUS_03610 4980 6317 CDS product glutamine synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947961.1 protein_id gnl|my_center|LOCUS_03610 6327 8021 gene locus_tag LOCUS_03620 6327 8021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03620 8018 8953 gene locus_tag LOCUS_03630 8018 8953 CDS product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460199.1 protein_id gnl|my_center|LOCUS_03630 8997 10061 gene locus_tag LOCUS_03640 8997 10061 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192588.1 protein_id gnl|my_center|LOCUS_03640 10054 10530 gene locus_tag LOCUS_03650 10054 10530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03650 10897 10574 gene locus_tag LOCUS_03660 10897 10574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03660 11738 10938 gene locus_tag LOCUS_03670 gene trpA 11738 10938 CDS product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943006.1 protein_id gnl|my_center|LOCUS_03670 12955 11744 gene locus_tag LOCUS_03680 gene trpB 12955 11744 CDS product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943010.1 protein_id gnl|my_center|LOCUS_03680 12971 13807 gene locus_tag LOCUS_03690 12971 13807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03690 13831 14385 gene locus_tag LOCUS_03700 13831 14385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03700 14391 15947 gene locus_tag LOCUS_03710 14391 15947 CDS product GMC family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010950408.1 protein_id gnl|my_center|LOCUS_03710 16361 15948 gene locus_tag LOCUS_03720 16361 15948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03720 17052 16444 gene locus_tag LOCUS_03730 17052 16444 CDS product phosphoribosylanthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943014.1 protein_id gnl|my_center|LOCUS_03730 17199 19076 gene locus_tag LOCUS_03740 17199 19076 CDS product 2-oxoacid:acceptor oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222472.1 protein_id gnl|my_center|LOCUS_03740 19073 20086 gene locus_tag LOCUS_03750 19073 20086 CDS product 2-oxoacid:ferredoxin oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838141.1 protein_id gnl|my_center|LOCUS_03750 20779 20042 gene locus_tag LOCUS_03760 20779 20042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03760 21159 20785 gene locus_tag LOCUS_03770 21159 20785 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942852.1 protein_id gnl|my_center|LOCUS_03770 22284 21208 gene locus_tag LOCUS_03780 22284 21208 CDS product chemotaxis response regulator protein-glutamate methylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942854.1 protein_id gnl|my_center|LOCUS_03780 23166 22285 gene locus_tag LOCUS_03790 23166 22285 CDS product protein-glutamate O-methyltransferase CheR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942855.1 protein_id gnl|my_center|LOCUS_03790 25189 23168 gene locus_tag LOCUS_03800 25189 23168 CDS product HEAT repeat domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942856.1 protein_id gnl|my_center|LOCUS_03800 >Feature sequence012 1435 125 gene locus_tag LOCUS_03810 1435 125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03810 4205 1533 gene locus_tag LOCUS_03820 gene ppdK 4205 1533 CDS product pyruvate, phosphate dikinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640245.1 protein_id gnl|my_center|LOCUS_03820 6291 4183 gene locus_tag LOCUS_03830 gene glyS 6291 4183 CDS product glycine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941242.1 protein_id gnl|my_center|LOCUS_03830 7290 6352 gene locus_tag LOCUS_03840 gene glyQ 7290 6352 CDS product glycine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941241.1 protein_id gnl|my_center|LOCUS_03840 8066 7287 gene locus_tag LOCUS_03850 8066 7287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03850 8989 8063 gene locus_tag LOCUS_03860 8989 8063 CDS product segregation/condensation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942476.1 protein_id gnl|my_center|LOCUS_03860 9513 9043 gene locus_tag LOCUS_03870 gene bcp 9513 9043 CDS product thioredoxin-dependent thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582794.1 protein_id gnl|my_center|LOCUS_03870 9607 10284 gene locus_tag LOCUS_03880 9607 10284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03880 10290 10646 gene locus_tag LOCUS_03890 10290 10646 CDS product Rieske 2Fe-2S domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391321.1 protein_id gnl|my_center|LOCUS_03890 11626 10769 gene locus_tag LOCUS_03900 gene map 11626 10769 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947446.1 protein_id gnl|my_center|LOCUS_03900 11722 12000 gene locus_tag LOCUS_03910 11722 12000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03910 12233 12054 gene locus_tag LOCUS_03920 12233 12054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03920 12385 13155 gene locus_tag LOCUS_03930 12385 13155 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722150.1 protein_id gnl|my_center|LOCUS_03930 13155 14003 gene locus_tag LOCUS_03940 13155 14003 CDS product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528737.1 protein_id gnl|my_center|LOCUS_03940 14881 14030 gene locus_tag LOCUS_03950 gene folD 14881 14030 CDS product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393025.1 protein_id gnl|my_center|LOCUS_03950 14969 18172 gene locus_tag LOCUS_03960 gene ileS 14969 18172 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083434976.1 protein_id gnl|my_center|LOCUS_03960 18850 18182 gene locus_tag LOCUS_03970 18850 18182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03970 18974 19525 gene locus_tag LOCUS_03980 18974 19525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03980 19518 19769 gene locus_tag LOCUS_03990 19518 19769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03990 20398 19844 gene locus_tag LOCUS_04000 20398 19844 CDS product DUF2062 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532587.1 protein_id gnl|my_center|LOCUS_04000 21822 20395 gene locus_tag LOCUS_04010 21822 20395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04010 23803 21710 gene locus_tag LOCUS_04020 23803 21710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04020 24206 25051 gene locus_tag LOCUS_04030 24206 25051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04030 25048 25305 gene locus_tag LOCUS_04040 25048 25305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04040 >Feature sequence013 283 1284 gene locus_tag LOCUS_04050 283 1284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04050 1294 2292 gene locus_tag LOCUS_04060 1294 2292 CDS product agmatine deiminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141680.1 protein_id gnl|my_center|LOCUS_04060 2289 3152 gene locus_tag LOCUS_04070 gene aguB 2289 3152 CDS product N-carbamoylputrescine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141681.1 protein_id gnl|my_center|LOCUS_04070 3145 3720 gene locus_tag LOCUS_04080 gene thiE 3145 3720 CDS product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256280.1 protein_id gnl|my_center|LOCUS_04080 4480 3725 gene locus_tag LOCUS_04090 4480 3725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04090 5130 4579 gene locus_tag LOCUS_04100 5130 4579 CDS product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258358.1 protein_id gnl|my_center|LOCUS_04100 6641 5127 gene locus_tag LOCUS_04110 6641 5127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04110 7231 6638 gene locus_tag LOCUS_04120 7231 6638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04120 8844 7228 gene locus_tag LOCUS_04130 8844 7228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04130 9769 8855 gene locus_tag LOCUS_04140 9769 8855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04140 11115 9859 gene locus_tag LOCUS_04150 11115 9859 CDS product Glu/Leu/Phe/Val dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257936.1 protein_id gnl|my_center|LOCUS_04150 11337 12467 gene locus_tag LOCUS_04160 11337 12467 CDS product hydrogenase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940799.1 protein_id gnl|my_center|LOCUS_04160 12464 14170 gene locus_tag LOCUS_04170 12464 14170 CDS product nickel-dependent hydrogenase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940798.1 protein_id gnl|my_center|LOCUS_04170 14167 14907 gene locus_tag LOCUS_04180 gene cybH 14167 14907 CDS product Ni/Fe-hydrogenase, b-type cytochrome subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940797.1 protein_id gnl|my_center|LOCUS_04180 14900 15445 gene locus_tag LOCUS_04190 14900 15445 CDS product HyaD/HybD family hydrogenase maturation endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940796.1 protein_id gnl|my_center|LOCUS_04190 15396 15794 gene locus_tag LOCUS_04200 15396 15794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04200 15794 18070 gene locus_tag LOCUS_04210 gene hypF 15794 18070 CDS product carbamoyltransferase HypF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940975.1 protein_id gnl|my_center|LOCUS_04210 18090 18413 gene locus_tag LOCUS_04220 18090 18413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04220 18400 19548 gene locus_tag LOCUS_04230 gene hypD 18400 19548 CDS product hydrogenase formation protein HypD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876696.1 protein_id gnl|my_center|LOCUS_04230 19545 20585 gene locus_tag LOCUS_04240 gene hypE 19545 20585 CDS product hydrogenase expression/formation protein HypE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060768.1 protein_id gnl|my_center|LOCUS_04240 20589 21440 gene locus_tag LOCUS_04250 gene paaG 20589 21440 CDS product 2-(1,2-epoxy-1,2-dihydrophenyl)acetyl-CoA isomerase PaaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206400.1 protein_id gnl|my_center|LOCUS_04250 21444 21791 gene locus_tag LOCUS_04260 gene hypA 21444 21791 CDS product hydrogenase maturation nickel metallochaperone HypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072153.1 protein_id gnl|my_center|LOCUS_04260 21784 22530 gene locus_tag LOCUS_04270 gene hypB 21784 22530 CDS product hydrogenase nickel incorporation protein HypB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880399.1 protein_id gnl|my_center|LOCUS_04270 22490 23170 gene locus_tag LOCUS_04280 22490 23170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918209.1 protein_id gnl|my_center|LOCUS_04280 23223 24050 gene locus_tag LOCUS_04290 23223 24050 CDS product prohibitin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256218.1 protein_id gnl|my_center|LOCUS_04290 24887 24051 gene locus_tag LOCUS_04300 24887 24051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04300 >Feature sequence014 44 1213 gene locus_tag LOCUS_04310 44 1213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04310 1275 1664 gene locus_tag LOCUS_04320 1275 1664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04320 1661 4360 gene locus_tag LOCUS_04330 1661 4360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04330 4370 6562 gene locus_tag LOCUS_04340 gene mutS 4370 6562 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942467.1 protein_id gnl|my_center|LOCUS_04340 6567 6866 gene locus_tag LOCUS_04350 6567 6866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04350 6920 7987 gene locus_tag LOCUS_04360 gene pheA 6920 7987 CDS product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943245.1 protein_id gnl|my_center|LOCUS_04360 7997 9097 gene locus_tag LOCUS_04370 gene hisC 7997 9097 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392052.1 protein_id gnl|my_center|LOCUS_04370 9090 10451 gene locus_tag LOCUS_04380 gene aroA 9090 10451 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943243.1 protein_id gnl|my_center|LOCUS_04380 10448 11125 gene locus_tag LOCUS_04390 gene cmk 10448 11125 CDS product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106707.1 protein_id gnl|my_center|LOCUS_04390 11696 13108 gene locus_tag LOCUS_04400 11696 13108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04400 14316 13561 gene locus_tag LOCUS_04410 14316 13561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04410 14469 15860 gene locus_tag LOCUS_04420 14469 15860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04420 15857 16657 gene locus_tag LOCUS_04430 15857 16657 CDS product queuosine precursor transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839717.1 protein_id gnl|my_center|LOCUS_04430 17063 16557 gene locus_tag LOCUS_04440 17063 16557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04440 17844 17068 gene locus_tag LOCUS_04450 gene tpiA 17844 17068 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259656.1 protein_id gnl|my_center|LOCUS_04450 19028 17841 gene locus_tag LOCUS_04460 19028 17841 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272149.1 protein_id gnl|my_center|LOCUS_04460 20043 19033 gene locus_tag LOCUS_04470 gene gap 20043 19033 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942274.1 protein_id gnl|my_center|LOCUS_04470 20377 20186 gene locus_tag LOCUS_04480 20377 20186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04480 21012 20620 gene locus_tag LOCUS_04490 21012 20620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04490 20965 21228 gene locus_tag LOCUS_04500 20965 21228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04500 21309 21896 gene locus_tag LOCUS_04510 21309 21896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04510 <24511 21926 gene locus_tag LOCUS_04520 <24511 21926 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942416.1:S41 family peptidase >Feature sequence015 3 467 gene locus_tag LOCUS_04530 3 467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04530 2182 464 gene locus_tag LOCUS_04540 gene ggt 2182 464 CDS product gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703698.1 protein_id gnl|my_center|LOCUS_04540 2222 3175 gene locus_tag LOCUS_04550 gene gshB 2222 3175 CDS product glutathione synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391437.1 protein_id gnl|my_center|LOCUS_04550 3538 3185 gene locus_tag LOCUS_04560 3538 3185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04560 4487 3555 gene locus_tag LOCUS_04570 4487 3555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04570 5473 4484 gene locus_tag LOCUS_04580 gene mvaD 5473 4484 CDS product diphosphomevalonate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101527.1 protein_id gnl|my_center|LOCUS_04580 6366 5470 gene locus_tag LOCUS_04590 6366 5470 CDS product mevalonate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867665.1 protein_id gnl|my_center|LOCUS_04590 7388 6366 gene locus_tag LOCUS_04600 7388 6366 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224198.1 protein_id gnl|my_center|LOCUS_04600 7465 8505 gene locus_tag LOCUS_04610 gene fni 7465 8505 CDS product type 2 isopentenyl-diphosphate Delta-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875688.1 protein_id gnl|my_center|LOCUS_04610 9456 8506 gene locus_tag LOCUS_04620 9456 8506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04620 13970 9456 gene locus_tag LOCUS_04630 13970 9456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04630 15430 13970 gene locus_tag LOCUS_04640 15430 13970 CDS product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012843245.1 protein_id gnl|my_center|LOCUS_04640 16797 15457 gene locus_tag LOCUS_04650 gene trkA 16797 15457 CDS product Trk system potassium transporter TrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459869.1 protein_id gnl|my_center|LOCUS_04650 17936 16794 gene locus_tag LOCUS_04660 17936 16794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04660 17952 18086 gene locus_tag LOCUS_04670 17952 18086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04670 18888 18223 gene locus_tag LOCUS_04680 18888 18223 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005084765.1 protein_id gnl|my_center|LOCUS_04680 19059 20063 gene locus_tag LOCUS_04690 gene lipA 19059 20063 CDS product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011174105.1 protein_id gnl|my_center|LOCUS_04690 20140 21171 gene locus_tag LOCUS_04700 gene mutY 20140 21171 CDS product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404847.1 protein_id gnl|my_center|LOCUS_04700 21262 22152 gene locus_tag LOCUS_04710 21262 22152 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024245.1 protein_id gnl|my_center|LOCUS_04710 >Feature sequence016 2 916 gene locus_tag LOCUS_04720 2 916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04720 913 1908 gene locus_tag LOCUS_04730 913 1908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04730 3023 1968 gene locus_tag LOCUS_04740 3023 1968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04740 3087 3731 gene locus_tag LOCUS_04750 3087 3731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04750 4213 3728 gene locus_tag LOCUS_04760 4213 3728 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256436.1 protein_id gnl|my_center|LOCUS_04760 4339 5544 gene locus_tag LOCUS_04770 4339 5544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04770 5541 6326 gene locus_tag LOCUS_04780 5541 6326 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121358.1 protein_id gnl|my_center|LOCUS_04780 7199 6303 gene locus_tag LOCUS_04790 7199 6303 CDS product dipeptide epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722599.1 protein_id gnl|my_center|LOCUS_04790 8258 7296 gene locus_tag LOCUS_04800 8258 7296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04800 8467 10827 gene locus_tag LOCUS_04810 8467 10827 CDS product thioredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023630.1 protein_id gnl|my_center|LOCUS_04810 10827 11450 gene locus_tag LOCUS_04820 gene rdgB 10827 11450 CDS product RdgB/HAM1 family non-canonical purine NTP pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391387.1 protein_id gnl|my_center|LOCUS_04820 12756 11434 gene locus_tag LOCUS_04830 12756 11434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04830 12852 13619 gene locus_tag LOCUS_04840 12852 13619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04840 14834 13584 gene locus_tag LOCUS_04850 14834 13584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04850 14992 15423 gene locus_tag LOCUS_04860 14992 15423 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869023.1 protein_id gnl|my_center|LOCUS_04860 15492 20084 gene locus_tag LOCUS_04870 gene gltB 15492 20084 CDS product glutamate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120560.1 protein_id gnl|my_center|LOCUS_04870 20276 20779 gene locus_tag LOCUS_04880 20276 20779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04880 20704 21441 gene locus_tag LOCUS_04890 20704 21441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04890 22159 21680 gene locus_tag LOCUS_04900 22159 21680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04900 22886 22197 gene locus_tag LOCUS_04910 22886 22197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04910 >Feature sequence017 1069 110 gene locus_tag LOCUS_04920 gene hprK 1069 110 CDS product HPr(Ser) kinase/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942530.1 protein_id gnl|my_center|LOCUS_04920 1618 1151 gene locus_tag LOCUS_04930 gene ptsN 1618 1151 CDS product PTS IIA-like nitrogen regulatory protein PtsN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921423.1 protein_id gnl|my_center|LOCUS_04930 1968 1642 gene locus_tag LOCUS_04940 1968 1642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04940 3404 1983 gene locus_tag LOCUS_04950 gene rpoN 3404 1983 CDS product RNA polymerase factor sigma-54 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942532.1 protein_id gnl|my_center|LOCUS_04950 3621 4553 gene locus_tag LOCUS_04960 3621 4553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04960 4909 4550 gene locus_tag LOCUS_04970 4909 4550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04970 4969 5406 gene locus_tag LOCUS_04980 4969 5406 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398668.1 protein_id gnl|my_center|LOCUS_04980 6125 6484 gene locus_tag LOCUS_04990 6125 6484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04990 6921 6520 gene locus_tag LOCUS_05000 6921 6520 CDS product (deoxy)nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941534.1 protein_id gnl|my_center|LOCUS_05000 7272 6955 gene locus_tag LOCUS_05010 7272 6955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05010 7453 8388 gene locus_tag LOCUS_05020 7453 8388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05020 8422 9138 gene locus_tag LOCUS_05030 8422 9138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05030 9135 10070 gene locus_tag LOCUS_05040 9135 10070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05040 10737 10048 gene locus_tag LOCUS_05050 10737 10048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05050 10837 11745 gene locus_tag LOCUS_05060 10837 11745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05060 12853 11723 gene locus_tag LOCUS_05070 12853 11723 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005616381.1 protein_id gnl|my_center|LOCUS_05070 13807 12875 gene locus_tag LOCUS_05080 13807 12875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05080 13926 14699 gene locus_tag LOCUS_05090 13926 14699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05090 15512 14607 gene locus_tag LOCUS_05100 15512 14607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05100 15587 16597 gene locus_tag LOCUS_05110 15587 16597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05110 17346 16588 gene locus_tag LOCUS_05120 gene rluA 17346 16588 CDS product bifunctional tRNA pseudouridine(32) synthase/23S rRNA pseudouridine(746) synthase RluA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261089.1 protein_id gnl|my_center|LOCUS_05120 19984 17339 gene locus_tag LOCUS_05130 19984 17339 CDS product PEP/pyruvate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272585.1 protein_id gnl|my_center|LOCUS_05130 20022 21473 gene locus_tag LOCUS_05140 gene purF 20022 21473 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942281.1 protein_id gnl|my_center|LOCUS_05140 >Feature sequence018 <1 754 gene locus_tag LOCUS_05150 <1 754 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_103037676.1:NAD(P)-binding domain-containing protein 1238 726 gene locus_tag LOCUS_05160 1238 726 CDS product macro domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482857.1 protein_id gnl|my_center|LOCUS_05160 1647 1228 gene locus_tag LOCUS_05170 1647 1228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05170 1795 4218 gene locus_tag LOCUS_05180 1795 4218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05180 4330 4403 gene locus_tag LOCUS_t00030 4330 4403 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 4470 5498 gene locus_tag LOCUS_05190 gene meaB 4470 5498 CDS product methylmalonyl Co-A mutase-associated GTPase MeaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942224.1 protein_id gnl|my_center|LOCUS_05190 5552 6328 gene locus_tag LOCUS_05200 5552 6328 CDS product short-chain-enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965999.1 protein_id gnl|my_center|LOCUS_05200 8683 6338 gene locus_tag LOCUS_05210 8683 6338 CDS product M1 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038275.1 protein_id gnl|my_center|LOCUS_05210 9136 9924 gene locus_tag LOCUS_05220 9136 9924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05220 10816 10046 gene locus_tag LOCUS_05230 gene xth 10816 10046 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140144.1 protein_id gnl|my_center|LOCUS_05230 10841 11233 gene locus_tag LOCUS_05240 10841 11233 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124713.1 protein_id gnl|my_center|LOCUS_05240 12517 11237 gene locus_tag LOCUS_05250 12517 11237 CDS product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943920.1 protein_id gnl|my_center|LOCUS_05250 13710 12514 gene locus_tag LOCUS_05260 13710 12514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05260 15445 13856 gene locus_tag LOCUS_05270 gene serA 15445 13856 CDS product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090136.1 protein_id gnl|my_center|LOCUS_05270 17440 15533 gene locus_tag LOCUS_05280 17440 15533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05280 17904 18542 gene locus_tag LOCUS_05290 17904 18542 CDS product cytochrome c3 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404835.1 protein_id gnl|my_center|LOCUS_05290 >Feature sequence019 633 202 gene locus_tag LOCUS_05300 633 202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05300 691 1281 gene locus_tag LOCUS_05310 691 1281 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941308.1 protein_id gnl|my_center|LOCUS_05310 1565 1380 gene locus_tag LOCUS_05320 1565 1380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05320 2194 1688 gene locus_tag LOCUS_05330 2194 1688 CDS product Mov34/MPN/PAD-1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106151.1 protein_id gnl|my_center|LOCUS_05330 3107 2184 gene locus_tag LOCUS_05340 3107 2184 CDS product cysteine synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140767.1 protein_id gnl|my_center|LOCUS_05340 3472 3107 gene locus_tag LOCUS_05350 3472 3107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05350 3750 3469 gene locus_tag LOCUS_05360 3750 3469 CDS product MoaD/ThiS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024015101.1 protein_id gnl|my_center|LOCUS_05360 4497 3790 gene locus_tag LOCUS_05370 gene thiF 4497 3790 CDS product thiazole biosynthesis adenylyltransferase ThiF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003821634.1 protein_id gnl|my_center|LOCUS_05370 5420 4494 gene locus_tag LOCUS_05380 gene cysK 5420 4494 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941203.1 protein_id gnl|my_center|LOCUS_05380 5896 5420 gene locus_tag LOCUS_05390 5896 5420 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941202.1 protein_id gnl|my_center|LOCUS_05390 6946 5951 gene locus_tag LOCUS_05400 6946 5951 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546449.1 protein_id gnl|my_center|LOCUS_05400 7376 8848 gene locus_tag LOCUS_05410 7376 8848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05410 9076 9774 gene locus_tag LOCUS_05420 9076 9774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05420 10979 9771 gene locus_tag LOCUS_05430 10979 9771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05430 11092 12321 gene locus_tag LOCUS_05440 11092 12321 CDS product hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257960.1 protein_id gnl|my_center|LOCUS_05440 12318 13358 gene locus_tag LOCUS_05450 12318 13358 CDS product cysteine desulfurase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943206.1 protein_id gnl|my_center|LOCUS_05450 13523 14584 gene locus_tag LOCUS_05460 gene mnmA 13523 14584 CDS product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943205.1 protein_id gnl|my_center|LOCUS_05460 14565 15146 gene locus_tag LOCUS_05470 14565 15146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05470 15149 16405 gene locus_tag LOCUS_05480 gene rlmD 15149 16405 CDS product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482575.1 protein_id gnl|my_center|LOCUS_05480 16460 16909 gene locus_tag LOCUS_05490 gene nrdR 16460 16909 CDS product transcriptional regulator NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942330.1 protein_id gnl|my_center|LOCUS_05490 16911 18014 gene locus_tag LOCUS_05500 gene ribD 16911 18014 CDS product bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392432.1 protein_id gnl|my_center|LOCUS_05500 18015 18620 gene locus_tag LOCUS_05510 18015 18620 CDS product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338466.1 protein_id gnl|my_center|LOCUS_05510 18677 19834 gene locus_tag LOCUS_05520 18677 19834 CDS product bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942333.1 protein_id gnl|my_center|LOCUS_05520 19831 20337 gene locus_tag LOCUS_05530 gene ribE 19831 20337 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002119264.1 protein_id gnl|my_center|LOCUS_05530 20312 20731 gene locus_tag LOCUS_05540 gene nusB 20312 20731 CDS product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942335.1 protein_id gnl|my_center|LOCUS_05540 >Feature sequence020 2350 1091 gene locus_tag LOCUS_05550 2350 1091 CDS product competence/damage-inducible protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940819.1 protein_id gnl|my_center|LOCUS_05550 2465 3841 gene locus_tag LOCUS_05560 2465 3841 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197530044.1 protein_id gnl|my_center|LOCUS_05560 3844 4392 gene locus_tag LOCUS_05570 3844 4392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05570 4416 5267 gene locus_tag LOCUS_05580 4416 5267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05580 5277 7109 gene locus_tag LOCUS_05590 gene glmS 5277 7109 CDS product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940943.1 protein_id gnl|my_center|LOCUS_05590 7122 8216 gene locus_tag LOCUS_05600 7122 8216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05600 8844 8206 gene locus_tag LOCUS_05610 gene lolA 8844 8206 CDS product outer membrane lipoprotein chaperone LolA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005767395.1 protein_id gnl|my_center|LOCUS_05610 9097 9291 gene locus_tag LOCUS_05620 9097 9291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05620 9946 10995 gene locus_tag LOCUS_05630 9946 10995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05630 12050 10998 gene locus_tag LOCUS_05640 12050 10998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05640 13237 12047 gene locus_tag LOCUS_05650 gene argJ 13237 12047 CDS product bifunctional glutamate N-acetyltransferase/amino-acid acetyltransferase ArgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942692.1 protein_id gnl|my_center|LOCUS_05650 16391 13308 gene locus_tag LOCUS_05660 16391 13308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05660 17921 16434 gene locus_tag LOCUS_05670 17921 16434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05670 17977 18435 gene locus_tag LOCUS_05680 17977 18435 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942028.1 protein_id gnl|my_center|LOCUS_05680 <19597 18463 gene locus_tag LOCUS_05690 <19597 18463 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_072773675.1:acyl-CoA dehydrogenase >Feature sequence021 <1 1071 gene locus_tag LOCUS_05700 <1 1071 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005113162.1:acyl-CoA dehydrogenase family protein 1156 1866 gene locus_tag LOCUS_05710 1156 1866 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225241.1 protein_id gnl|my_center|LOCUS_05710 2741 1749 gene locus_tag LOCUS_05720 2741 1749 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582482.1 protein_id gnl|my_center|LOCUS_05720 2904 3947 gene locus_tag LOCUS_05730 2904 3947 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226841.1 protein_id gnl|my_center|LOCUS_05730 3955 4611 gene locus_tag LOCUS_05740 gene npdG 3955 4611 CDS product NADPH-dependent F420 reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028232.1 protein_id gnl|my_center|LOCUS_05740 4608 5423 gene locus_tag LOCUS_05750 gene cofE 4608 5423 CDS product coenzyme F420-0:L-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876650.1 protein_id gnl|my_center|LOCUS_05750 5420 6352 gene locus_tag LOCUS_05760 gene cofD 5420 6352 CDS product 2-phospho-L-lactate transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256113.1 protein_id gnl|my_center|LOCUS_05760 6352 6948 gene locus_tag LOCUS_05770 6352 6948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05770 7754 6945 gene locus_tag LOCUS_05780 7754 6945 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225423.1 protein_id gnl|my_center|LOCUS_05780 8898 7795 gene locus_tag LOCUS_05790 gene cofH 8898 7795 CDS product 5-amino-6-(D-ribitylamino)uracil--L-tyrosine 4-hydroxyphenyl transferase CofH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060905.1 protein_id gnl|my_center|LOCUS_05790 10073 8928 gene locus_tag LOCUS_05800 10073 8928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05800 10945 10070 gene locus_tag LOCUS_05810 10945 10070 CDS product TIGR03619 family F420-dependent LLM class oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228576.1 protein_id gnl|my_center|LOCUS_05810 12241 10973 gene locus_tag LOCUS_05820 12241 10973 CDS product EstA family serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208246.1 protein_id gnl|my_center|LOCUS_05820 15615 12241 gene locus_tag LOCUS_05830 gene metH 15615 12241 CDS product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972100.1 protein_id gnl|my_center|LOCUS_05830 15508 15723 gene locus_tag LOCUS_05840 15508 15723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05840 15854 16846 gene locus_tag LOCUS_05850 15854 16846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05850 16850 17698 gene locus_tag LOCUS_05860 16850 17698 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065121.1 protein_id gnl|my_center|LOCUS_05860 18002 17682 gene locus_tag LOCUS_05870 18002 17682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05870 18931 18050 gene locus_tag LOCUS_05880 18931 18050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05880 19353 18934 gene locus_tag LOCUS_05890 19353 18934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05890 >Feature sequence022 1257 382 gene locus_tag LOCUS_05900 1257 382 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902170.1 protein_id gnl|my_center|LOCUS_05900 1990 1262 gene locus_tag LOCUS_05910 1990 1262 CDS product GTPase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940776.1 protein_id gnl|my_center|LOCUS_05910 4197 2050 gene locus_tag LOCUS_05920 gene recG 4197 2050 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063863.1 protein_id gnl|my_center|LOCUS_05920 4648 4178 gene locus_tag LOCUS_05930 gene greA 4648 4178 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390637.1 protein_id gnl|my_center|LOCUS_05930 8050 4691 gene locus_tag LOCUS_05940 gene carB 8050 4691 CDS product carbamoyl-phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941931.1 protein_id gnl|my_center|LOCUS_05940 8593 8132 gene locus_tag LOCUS_05950 gene tsaE 8593 8132 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393647.1 protein_id gnl|my_center|LOCUS_05950 12856 8651 gene locus_tag LOCUS_05960 12856 8651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05960 18647 12789 gene locus_tag LOCUS_05970 18647 12789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05970 >Feature sequence023 650 847 gene locus_tag LOCUS_05980 650 847 CDS product cold shock domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326931.1 protein_id gnl|my_center|LOCUS_05980 918 1856 gene locus_tag LOCUS_05990 918 1856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05990 1894 2406 gene locus_tag LOCUS_06000 1894 2406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06000 2624 4204 gene locus_tag LOCUS_06010 2624 4204 CDS product carboxylesterase/lipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889250.1 protein_id gnl|my_center|LOCUS_06010 4726 4241 gene locus_tag LOCUS_06020 4726 4241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06020 6166 4784 gene locus_tag LOCUS_06030 gene mgtE 6166 4784 CDS product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228410.1 protein_id gnl|my_center|LOCUS_06030 6932 6216 gene locus_tag LOCUS_06040 6932 6216 CDS product TerC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404948.1 protein_id gnl|my_center|LOCUS_06040 7075 7662 gene locus_tag LOCUS_06050 7075 7662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06050 9197 7659 gene locus_tag LOCUS_06060 9197 7659 CDS product SpoVR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228236.1 protein_id gnl|my_center|LOCUS_06060 10310 9201 gene locus_tag LOCUS_06070 10310 9201 CDS product DUF444 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_044233828.1 protein_id gnl|my_center|LOCUS_06070 12359 10314 gene locus_tag LOCUS_06080 12359 10314 CDS product serine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256854.1 protein_id gnl|my_center|LOCUS_06080 13172 12411 gene locus_tag LOCUS_06090 13172 12411 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083192.1 protein_id gnl|my_center|LOCUS_06090 13233 14573 gene locus_tag LOCUS_06100 13233 14573 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942511.1 protein_id gnl|my_center|LOCUS_06100 14776 15789 gene locus_tag LOCUS_06110 14776 15789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06110 16175 15681 gene locus_tag LOCUS_06120 gene coaD 16175 15681 CDS product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000200601.1 protein_id gnl|my_center|LOCUS_06120 16759 16172 gene locus_tag LOCUS_06130 gene rsmD 16759 16172 CDS product 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775870.1 protein_id gnl|my_center|LOCUS_06130 16858 18258 gene locus_tag LOCUS_06140 16858 18258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06140 18240 18452 gene locus_tag LOCUS_06150 18240 18452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06150 >Feature sequence024 2132 828 gene locus_tag LOCUS_06160 gene xseA 2132 828 CDS product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000953156.1 protein_id gnl|my_center|LOCUS_06160 2031 2255 gene locus_tag LOCUS_06170 2031 2255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06170 2270 3103 gene locus_tag LOCUS_06180 2270 3103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06180 3183 5255 gene locus_tag LOCUS_06190 3183 5255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06190 5937 5224 gene locus_tag LOCUS_06200 5937 5224 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258849.1 protein_id gnl|my_center|LOCUS_06200 5999 7948 gene locus_tag LOCUS_06210 5999 7948 CDS product ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192700.1 protein_id gnl|my_center|LOCUS_06210 7945 9699 gene locus_tag LOCUS_06220 7945 9699 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005079800.1 protein_id gnl|my_center|LOCUS_06220 10133 9696 gene locus_tag LOCUS_06230 10133 9696 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004528650.1 protein_id gnl|my_center|LOCUS_06230 11106 10177 gene locus_tag LOCUS_06240 11106 10177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06240 12166 11099 gene locus_tag LOCUS_06250 12166 11099 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807055.1 protein_id gnl|my_center|LOCUS_06250 12243 12491 gene locus_tag LOCUS_06260 12243 12491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06260 12551 13798 gene locus_tag LOCUS_06270 12551 13798 CDS product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114804.1 protein_id gnl|my_center|LOCUS_06270 13909 14874 gene locus_tag LOCUS_06280 13909 14874 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257736.1 protein_id gnl|my_center|LOCUS_06280 14929 15882 gene locus_tag LOCUS_06290 14929 15882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06290 15879 18041 gene locus_tag LOCUS_06300 15879 18041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06300 18306 18031 gene locus_tag LOCUS_06310 18306 18031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06310 >Feature sequence025 503 1075 gene locus_tag LOCUS_06320 503 1075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06320 1219 1770 gene locus_tag LOCUS_06330 1219 1770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06330 1730 4159 gene locus_tag LOCUS_06340 1730 4159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06340 4156 5709 gene locus_tag LOCUS_06350 4156 5709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06350 5747 6778 gene locus_tag LOCUS_06360 5747 6778 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007335040.1 protein_id gnl|my_center|LOCUS_06360 6775 7650 gene locus_tag LOCUS_06370 6775 7650 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922127.1 protein_id gnl|my_center|LOCUS_06370 7654 9609 gene locus_tag LOCUS_06380 7654 9609 CDS product BatA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117947.1 protein_id gnl|my_center|LOCUS_06380 10448 9591 gene locus_tag LOCUS_06390 gene prmC 10448 9591 CDS product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943724.1 protein_id gnl|my_center|LOCUS_06390 11351 10455 gene locus_tag LOCUS_06400 11351 10455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06400 11603 12592 gene locus_tag LOCUS_06410 11603 12592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06410 12526 13218 gene locus_tag LOCUS_06420 12526 13218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06420 13434 13616 gene locus_tag LOCUS_06430 13434 13616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06430 13660 14964 gene locus_tag LOCUS_06440 13660 14964 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941927.1 protein_id gnl|my_center|LOCUS_06440 14961 15941 gene locus_tag LOCUS_06450 gene carA 14961 15941 CDS product glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053104362.1 protein_id gnl|my_center|LOCUS_06450 15916 16392 gene locus_tag LOCUS_06460 15916 16392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06460 16769 17977 gene locus_tag LOCUS_06470 16769 17977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06470 >Feature sequence026 712 1806 gene locus_tag LOCUS_06480 gene dnaJ 712 1806 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940712.1 protein_id gnl|my_center|LOCUS_06480 1853 2530 gene locus_tag LOCUS_06490 1853 2530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06490 3561 2644 gene locus_tag LOCUS_06500 gene recF 3561 2644 CDS product DNA replication/repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142400.1 protein_id gnl|my_center|LOCUS_06500 4754 3618 gene locus_tag LOCUS_06510 gene dnaN 4754 3618 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940679.1 protein_id gnl|my_center|LOCUS_06510 6406 5132 gene locus_tag LOCUS_06520 gene dnaA 6406 5132 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582428.1 protein_id gnl|my_center|LOCUS_06520 6991 7863 gene locus_tag LOCUS_06530 6991 7863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06530 8689 7895 gene locus_tag LOCUS_06540 8689 7895 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229094.1 protein_id gnl|my_center|LOCUS_06540 9498 8740 gene locus_tag LOCUS_06550 9498 8740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06550 11884 9428 gene locus_tag LOCUS_06560 11884 9428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06560 12984 11881 gene locus_tag LOCUS_06570 12984 11881 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929017.1 protein_id gnl|my_center|LOCUS_06570 14122 13076 gene locus_tag LOCUS_06580 14122 13076 CDS product MaoC/PaaZ C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005085500.1 protein_id gnl|my_center|LOCUS_06580 14091 15326 gene locus_tag LOCUS_06590 14091 15326 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037198907.1 protein_id gnl|my_center|LOCUS_06590 15570 15343 gene locus_tag LOCUS_06600 15570 15343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06600 <17773 15685 gene locus_tag LOCUS_06610 <17773 15685 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_064253835.1:ATP-dependent chaperone ClpB >Feature sequence027 458 1225 gene locus_tag LOCUS_06620 458 1225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06620 1244 2188 gene locus_tag LOCUS_06630 1244 2188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06630 2185 2625 gene locus_tag LOCUS_06640 2185 2625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06640 2591 2920 gene locus_tag LOCUS_06650 2591 2920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06650 2978 3892 gene locus_tag LOCUS_06660 2978 3892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06660 4138 4836 gene locus_tag LOCUS_06670 4138 4836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06670 4772 5362 gene locus_tag LOCUS_06680 4772 5362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06680 5931 5314 gene locus_tag LOCUS_06690 5931 5314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06690 6199 7662 gene locus_tag LOCUS_06700 6199 7662 CDS product Na+/H+ antiporter NhaC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838696.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06700 9162 7633 gene locus_tag LOCUS_06710 9162 7633 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_031160740.1 protein_id gnl|my_center|LOCUS_06710 9227 10213 gene locus_tag LOCUS_06720 9227 10213 CDS product NAD(P)H-quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404056.1 protein_id gnl|my_center|LOCUS_06720 11083 10244 gene locus_tag LOCUS_06730 gene speE 11083 10244 CDS product spermidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000424691.1 protein_id gnl|my_center|LOCUS_06730 11735 11094 gene locus_tag LOCUS_06740 11735 11094 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048403.1 protein_id gnl|my_center|LOCUS_06740 11816 12859 gene locus_tag LOCUS_06750 11816 12859 CDS product ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121766.1 protein_id gnl|my_center|LOCUS_06750 13664 12870 gene locus_tag LOCUS_06760 13664 12870 CDS product crotonase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085734.1 protein_id gnl|my_center|LOCUS_06760 14534 13674 gene locus_tag LOCUS_06770 gene purU 14534 13674 CDS product formyltetrahydrofolate deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228594.1 protein_id gnl|my_center|LOCUS_06770 15815 14577 gene locus_tag LOCUS_06780 15815 14577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230417.1 protein_id gnl|my_center|LOCUS_06780 16372 15842 gene locus_tag LOCUS_06790 16372 15842 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080176.1 protein_id gnl|my_center|LOCUS_06790 >Feature sequence028 115 1437 gene locus_tag LOCUS_06800 115 1437 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111176.1 protein_id gnl|my_center|LOCUS_06800 1836 1498 gene locus_tag LOCUS_06810 1836 1498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06810 3052 1973 gene locus_tag LOCUS_06820 3052 1973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06820 3826 3449 gene locus_tag LOCUS_06830 3826 3449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06830 4970 4059 gene locus_tag LOCUS_06840 4970 4059 CDS product DUF547 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255958.1 protein_id gnl|my_center|LOCUS_06840 7040 5004 gene locus_tag LOCUS_06850 7040 5004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06850 7496 8302 gene locus_tag LOCUS_06860 7496 8302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06860 8313 8858 gene locus_tag LOCUS_06870 8313 8858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06870 9000 9347 gene locus_tag LOCUS_06880 9000 9347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06880 9349 11598 gene locus_tag LOCUS_06890 9349 11598 CDS product serine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256854.1 protein_id gnl|my_center|LOCUS_06890 11745 13610 gene locus_tag LOCUS_06900 11745 13610 CDS product DUF3604 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_081158863.1 protein_id gnl|my_center|LOCUS_06900 14606 13629 gene locus_tag LOCUS_06910 gene ppk2 14606 13629 CDS product polyphosphate kinase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852184.1 protein_id gnl|my_center|LOCUS_06910 15433 14627 gene locus_tag LOCUS_06920 15433 14627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06920 15900 15439 gene locus_tag LOCUS_06930 15900 15439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06930 15947 16975 gene locus_tag LOCUS_06940 15947 16975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06940 17053 17388 gene locus_tag LOCUS_06950 17053 17388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06950 >Feature sequence029 971 633 gene locus_tag LOCUS_06960 971 633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06960 1122 3269 gene locus_tag LOCUS_06970 1122 3269 CDS product bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942876.1 protein_id gnl|my_center|LOCUS_06970 4113 3286 gene locus_tag LOCUS_06980 4113 3286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06980 4204 6330 gene locus_tag LOCUS_06990 4204 6330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06990 6837 6346 gene locus_tag LOCUS_07000 6837 6346 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001247259.1 protein_id gnl|my_center|LOCUS_07000 6910 7872 gene locus_tag LOCUS_07010 gene trpS 6910 7872 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016366.1 protein_id gnl|my_center|LOCUS_07010 8383 7874 gene locus_tag LOCUS_07020 8383 7874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07020 10963 8420 gene locus_tag LOCUS_07030 10963 8420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07030 11181 11816 gene locus_tag LOCUS_07040 11181 11816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07040 11919 13760 gene locus_tag LOCUS_07050 11919 13760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07050 13757 14557 gene locus_tag LOCUS_07060 13757 14557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07060 15384 14554 gene locus_tag LOCUS_07070 15384 14554 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895546.1 protein_id gnl|my_center|LOCUS_07070 15818 15429 gene locus_tag LOCUS_07080 15818 15429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07080 15966 16484 gene locus_tag LOCUS_07090 15966 16484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07090 >Feature sequence030 375 154 gene locus_tag LOCUS_07100 375 154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07100 1390 317 gene locus_tag LOCUS_07110 1390 317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07110 2160 1390 gene locus_tag LOCUS_07120 2160 1390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07120 3600 2230 gene locus_tag LOCUS_07130 gene nadB 3600 2230 CDS product L-aspartate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942471.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07130 4777 3878 gene locus_tag LOCUS_07140 4777 3878 CDS product S-adenosylmethionine decarboxylase SpeD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071983.1 protein_id gnl|my_center|LOCUS_07140 4966 5571 gene locus_tag LOCUS_07150 4966 5571 CDS product lytic transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942470.1 protein_id gnl|my_center|LOCUS_07150 5575 6480 gene locus_tag LOCUS_07160 5575 6480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07160 7790 6468 gene locus_tag LOCUS_07170 7790 6468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07170 7895 9001 gene locus_tag LOCUS_07180 gene apbC 7895 9001 CDS product iron-sulfur cluster carrier protein ApbC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257064.1 protein_id gnl|my_center|LOCUS_07180 9016 10365 gene locus_tag LOCUS_07190 9016 10365 CDS product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942709.1 protein_id gnl|my_center|LOCUS_07190 11023 10316 gene locus_tag LOCUS_07200 11023 10316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07200 11937 11050 gene locus_tag LOCUS_07210 11937 11050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07210 13126 11978 gene locus_tag LOCUS_07220 13126 11978 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000393538.1 protein_id gnl|my_center|LOCUS_07220 13599 13270 gene locus_tag LOCUS_07230 13599 13270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07230 14275 13610 gene locus_tag LOCUS_07240 gene ccsA 14275 13610 CDS product cytochrome c biogenesis protein CcsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938346.1 protein_id gnl|my_center|LOCUS_07240 14431 15354 gene locus_tag LOCUS_07250 14431 15354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07250 >Feature sequence031 3 782 gene locus_tag LOCUS_07260 gene epmA 3 782 CDS product EF-P lysine aminoacylase EpmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942397.1 protein_id gnl|my_center|LOCUS_07260 1556 813 gene locus_tag LOCUS_07270 gene mazG 1556 813 CDS product nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941834.1 protein_id gnl|my_center|LOCUS_07270 1587 2264 gene locus_tag LOCUS_07280 1587 2264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07280 2261 3244 gene locus_tag LOCUS_07290 gene holB 2261 3244 CDS product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942870.1 protein_id gnl|my_center|LOCUS_07290 3445 5079 gene locus_tag LOCUS_07300 gene metG 3445 5079 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942872.1 protein_id gnl|my_center|LOCUS_07300 5076 6086 gene locus_tag LOCUS_07310 5076 6086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07310 6099 6878 gene locus_tag LOCUS_07320 6099 6878 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294001.1 protein_id gnl|my_center|LOCUS_07320 6966 7691 gene locus_tag LOCUS_07330 gene rplC 6966 7691 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854292.1 protein_id gnl|my_center|LOCUS_07330 7791 8282 gene locus_tag LOCUS_07340 7791 8282 CDS product RlmE family RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939535.1 protein_id gnl|my_center|LOCUS_07340 9276 8272 gene locus_tag LOCUS_07350 9276 8272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07350 11963 9273 gene locus_tag LOCUS_07360 gene glnD 11963 9273 CDS product [protein-PII] uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942465.1 protein_id gnl|my_center|LOCUS_07360 12673 12011 gene locus_tag LOCUS_07370 12673 12011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07370 12602 13141 gene locus_tag LOCUS_07380 12602 13141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07380 13276 14235 gene locus_tag LOCUS_07390 gene purM 13276 14235 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029628894.1 protein_id gnl|my_center|LOCUS_07390 14202 14831 gene locus_tag LOCUS_07400 gene purN 14202 14831 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393541.1 protein_id gnl|my_center|LOCUS_07400 >Feature sequence032 <1 733 gene locus_tag LOCUS_07410 <1 733 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000784821.1:cytochrome c peroxidase 759 1391 gene locus_tag LOCUS_07420 759 1391 CDS product heme-binding beta-barrel domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084100.1 protein_id gnl|my_center|LOCUS_07420 1884 1450 gene locus_tag LOCUS_07430 1884 1450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07430 3608 1965 gene locus_tag LOCUS_07440 3608 1965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07440 3706 3632 gene locus_tag LOCUS_t00040 3706 3632 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 3814 6489 gene locus_tag LOCUS_07450 gene acnA 3814 6489 CDS product aconitate hydratase AcnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259000.1 protein_id gnl|my_center|LOCUS_07450 6508 7500 gene locus_tag LOCUS_07460 6508 7500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07460 8272 7490 gene locus_tag LOCUS_07470 8272 7490 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479631.1 protein_id gnl|my_center|LOCUS_07470 8474 8292 gene locus_tag LOCUS_07480 8474 8292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07480 8980 8495 gene locus_tag LOCUS_07490 8980 8495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07490 9043 9291 gene locus_tag LOCUS_07500 9043 9291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07500 10038 9295 gene locus_tag LOCUS_07510 10038 9295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07510 10129 11259 gene locus_tag LOCUS_07520 10129 11259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07520 11256 12050 gene locus_tag LOCUS_07530 11256 12050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07530 12249 13859 gene locus_tag LOCUS_07540 12249 13859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07540 14820 13819 gene locus_tag LOCUS_07550 14820 13819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07550 >Feature sequence033 537 46 gene locus_tag LOCUS_07560 537 46 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07560 1773 937 gene locus_tag LOCUS_07570 1773 937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07570 3198 1828 gene locus_tag LOCUS_07580 3198 1828 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546604.1 protein_id gnl|my_center|LOCUS_07580 5004 3229 gene locus_tag LOCUS_07590 5004 3229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07590 5398 6996 gene locus_tag LOCUS_07600 5398 6996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07600 8430 7000 gene locus_tag LOCUS_07610 gene atoC 8430 7000 CDS product acetoacetate metabolism transcriptional regulator AtoC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000125282.1 protein_id gnl|my_center|LOCUS_07610 9146 8484 gene locus_tag LOCUS_07620 9146 8484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07620 9318 10820 gene locus_tag LOCUS_07630 9318 10820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07630 12202 10775 gene locus_tag LOCUS_07640 12202 10775 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939092.1 protein_id gnl|my_center|LOCUS_07640 12411 12335 gene locus_tag LOCUS_t00050 12411 12335 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 12506 13657 gene locus_tag LOCUS_07650 12506 13657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07650 13657 14187 gene locus_tag LOCUS_07660 13657 14187 CDS product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092662.1 protein_id gnl|my_center|LOCUS_07660 <14876 14190 gene locus_tag LOCUS_07670 <14876 14190 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005763493.1:DNA polymerase I >Feature sequence034 2456 1140 gene locus_tag LOCUS_07680 2456 1140 CDS product nitronate monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225238.1 protein_id gnl|my_center|LOCUS_07680 3217 2453 gene locus_tag LOCUS_07690 3217 2453 CDS product CoA-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730967.1 protein_id gnl|my_center|LOCUS_07690 4059 3214 gene locus_tag LOCUS_07700 4059 3214 CDS product CoA transferase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225236.1 protein_id gnl|my_center|LOCUS_07700 4830 4069 gene locus_tag LOCUS_07710 4830 4069 CDS product enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897402.1 protein_id gnl|my_center|LOCUS_07710 5379 4897 gene locus_tag LOCUS_07720 5379 4897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07720 5551 7116 gene locus_tag LOCUS_07730 gene fadD3 5551 7116 CDS product 3-((3aS,4S,7aS)-7a-methyl-1,5-dioxo-octahydro-1H-inden-4-yl)propanoate--CoA ligase FadD3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900098.1 protein_id gnl|my_center|LOCUS_07730 7109 7873 gene locus_tag LOCUS_07740 7109 7873 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141114.1 protein_id gnl|my_center|LOCUS_07740 7870 9543 gene locus_tag LOCUS_07750 7870 9543 CDS product class I adenylate-forming enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919198.1 protein_id gnl|my_center|LOCUS_07750 9547 10767 gene locus_tag LOCUS_07760 9547 10767 CDS product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975732.1 protein_id gnl|my_center|LOCUS_07760 10803 12662 gene locus_tag LOCUS_07770 10803 12662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07770 12659 13441 gene locus_tag LOCUS_07780 12659 13441 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225233.1 protein_id gnl|my_center|LOCUS_07780 13383 14585 gene locus_tag LOCUS_07790 13383 14585 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225715.1 protein_id gnl|my_center|LOCUS_07790 >Feature sequence035 1939 233 gene locus_tag LOCUS_07800 gene recD 1939 233 CDS product exodeoxyribonuclease V subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932748.1 protein_id gnl|my_center|LOCUS_07800 5411 1926 gene locus_tag LOCUS_07810 gene recB 5411 1926 CDS product exodeoxyribonuclease V subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932747.1 protein_id gnl|my_center|LOCUS_07810 8575 5408 gene locus_tag LOCUS_07820 gene recC 8575 5408 CDS product exodeoxyribonuclease V subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932746.1 protein_id gnl|my_center|LOCUS_07820 9092 8580 gene locus_tag LOCUS_07830 9092 8580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07830 10281 9130 gene locus_tag LOCUS_07840 gene nspC 10281 9130 CDS product carboxynorspermidine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943174.1 protein_id gnl|my_center|LOCUS_07840 11468 10281 gene locus_tag LOCUS_07850 11468 10281 CDS product saccharopine dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937725.1 protein_id gnl|my_center|LOCUS_07850 11660 12841 gene locus_tag LOCUS_07860 11660 12841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07860 12838 14442 gene locus_tag LOCUS_07870 12838 14442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07870 >Feature sequence036 43 687 gene locus_tag LOCUS_07880 43 687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07880 724 2133 gene locus_tag LOCUS_07890 gene pyk 724 2133 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258979.1 protein_id gnl|my_center|LOCUS_07890 2187 3419 gene locus_tag LOCUS_07900 2187 3419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07900 3709 3416 gene locus_tag LOCUS_07910 3709 3416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07910 4474 3761 gene locus_tag LOCUS_07920 4474 3761 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922324.1 protein_id gnl|my_center|LOCUS_07920 5389 4481 gene locus_tag LOCUS_07930 gene cysK 5389 4481 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937966.1 protein_id gnl|my_center|LOCUS_07930 6279 5416 gene locus_tag LOCUS_07940 6279 5416 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545286.1 protein_id gnl|my_center|LOCUS_07940 7643 6465 gene locus_tag LOCUS_07950 7643 6465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07950 8463 7585 gene locus_tag LOCUS_07960 8463 7585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07960 9227 8520 gene locus_tag LOCUS_07970 9227 8520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07970 10082 9282 gene locus_tag LOCUS_07980 10082 9282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07980 10677 10150 gene locus_tag LOCUS_07990 10677 10150 CDS product YqgE/AlgH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383411.1 protein_id gnl|my_center|LOCUS_07990 10781 11530 gene locus_tag LOCUS_08000 10781 11530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08000 11607 13241 gene locus_tag LOCUS_08010 11607 13241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08010 >Feature sequence037 1123 269 gene locus_tag LOCUS_08020 gene fbp 1123 269 CDS product class 1 fructose-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932050.1 protein_id gnl|my_center|LOCUS_08020 1010 1246 gene locus_tag LOCUS_08030 1010 1246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08030 1404 2201 gene locus_tag LOCUS_08040 1404 2201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08040 3849 2212 gene locus_tag LOCUS_08050 3849 2212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08050 4086 4730 gene locus_tag LOCUS_08060 4086 4730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08060 4760 5323 gene locus_tag LOCUS_08070 4760 5323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08070 5916 5320 gene locus_tag LOCUS_08080 5916 5320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08080 6750 5926 gene locus_tag LOCUS_08090 gene cysQ 6750 5926 CDS product 3'(2'),5'-bisphosphate nucleotidase CysQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206818748.1 protein_id gnl|my_center|LOCUS_08090 7562 6789 gene locus_tag LOCUS_08100 gene otsB 7562 6789 CDS product trehalose-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029558.1 protein_id gnl|my_center|LOCUS_08100 8950 7559 gene locus_tag LOCUS_08110 8950 7559 CDS product trehalose-6-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392880.1 protein_id gnl|my_center|LOCUS_08110 8979 9473 gene locus_tag LOCUS_08120 8979 9473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08120 9483 10091 gene locus_tag LOCUS_08130 9483 10091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08130 10776 10096 gene locus_tag LOCUS_08140 10776 10096 CDS product heme exporter protein CcmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065118.1 protein_id gnl|my_center|LOCUS_08140 11429 10773 gene locus_tag LOCUS_08150 11429 10773 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021446.1 protein_id gnl|my_center|LOCUS_08150 12595 11441 gene locus_tag LOCUS_08160 gene hemW 12595 11441 CDS product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968537.1 protein_id gnl|my_center|LOCUS_08160 12645 13562 gene locus_tag LOCUS_08170 12645 13562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08170 13613 13996 gene locus_tag LOCUS_08180 13613 13996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08180 >Feature sequence038 1779 454 gene locus_tag LOCUS_08190 1779 454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08190 2441 1776 gene locus_tag LOCUS_08200 2441 1776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08200 2596 3384 gene locus_tag LOCUS_08210 2596 3384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08210 3381 4490 gene locus_tag LOCUS_08220 3381 4490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08220 5374 4487 gene locus_tag LOCUS_08230 5374 4487 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878366.1 protein_id gnl|my_center|LOCUS_08230 5586 5386 gene locus_tag LOCUS_08240 5586 5386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08240 5616 7010 gene locus_tag LOCUS_08250 5616 7010 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942416.1 protein_id gnl|my_center|LOCUS_08250 7556 7059 gene locus_tag LOCUS_08260 7556 7059 CDS product dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189313.1 protein_id gnl|my_center|LOCUS_08260 8395 7553 gene locus_tag LOCUS_08270 gene thyA 8395 7553 CDS product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208311.1 protein_id gnl|my_center|LOCUS_08270 9527 8400 gene locus_tag LOCUS_08280 9527 8400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08280 10321 9548 gene locus_tag LOCUS_08290 10321 9548 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405214.1 protein_id gnl|my_center|LOCUS_08290 10372 11001 gene locus_tag LOCUS_08300 10372 11001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08300 11491 10973 gene locus_tag LOCUS_08310 11491 10973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08310 11531 12208 gene locus_tag LOCUS_08320 11531 12208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08320 12205 13572 gene locus_tag LOCUS_08330 gene nuoF 12205 13572 CDS product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227700.1 protein_id gnl|my_center|LOCUS_08330 13569 14072 gene locus_tag LOCUS_08340 13569 14072 CDS product NADH-quinone oxidoreductase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888135.1 protein_id gnl|my_center|LOCUS_08340 >Feature sequence039 1481 714 gene locus_tag LOCUS_08350 1481 714 CDS product 3',5'-cyclic-nucleotide phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546308.1 protein_id gnl|my_center|LOCUS_08350 2107 1481 gene locus_tag LOCUS_08360 2107 1481 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_175285932.1 protein_id gnl|my_center|LOCUS_08360 2185 3645 gene locus_tag LOCUS_08370 gene cls 2185 3645 CDS product cardiolipin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034050559.1 protein_id gnl|my_center|LOCUS_08370 4307 3636 gene locus_tag LOCUS_08380 4307 3636 CDS product TIGR04282 family arsenosugar biosynthesis glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792164.1 protein_id gnl|my_center|LOCUS_08380 4984 4298 gene locus_tag LOCUS_08390 4984 4298 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205421621.1 protein_id gnl|my_center|LOCUS_08390 5694 5107 gene locus_tag LOCUS_08400 gene rpsD 5694 5107 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933816.1 protein_id gnl|my_center|LOCUS_08400 5889 7172 gene locus_tag LOCUS_08410 gene rimO 5889 7172 CDS product 30S ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943823.1 protein_id gnl|my_center|LOCUS_08410 7214 7897 gene locus_tag LOCUS_08420 7214 7897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08420 8458 7901 gene locus_tag LOCUS_08430 8458 7901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08430 8626 10416 gene locus_tag LOCUS_08440 gene aspS 8626 10416 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289105.1 protein_id gnl|my_center|LOCUS_08440 10804 10484 gene locus_tag LOCUS_08450 10804 10484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08450 10691 11014 gene locus_tag LOCUS_08460 10691 11014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08460 12135 11044 gene locus_tag LOCUS_08470 gene dapE 12135 11044 CDS product succinyl-diaminopimelate desuccinylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406235.1 protein_id gnl|my_center|LOCUS_08470 12704 12171 gene locus_tag LOCUS_08480 12704 12171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08480 13184 12762 gene locus_tag LOCUS_08490 13184 12762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08490 >Feature sequence040 3775 1616 gene locus_tag LOCUS_08500 3775 1616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08500 4482 3772 gene locus_tag LOCUS_08510 4482 3772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08510 4575 5531 gene locus_tag LOCUS_08520 4575 5531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08520 7389 5518 gene locus_tag LOCUS_08530 gene asnB 7389 5518 CDS product asparagine synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119978.1 protein_id gnl|my_center|LOCUS_08530 9757 7394 gene locus_tag LOCUS_08540 9757 7394 CDS product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402856.1 protein_id gnl|my_center|LOCUS_08540 9820 10995 gene locus_tag LOCUS_08550 9820 10995 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265617.1 protein_id gnl|my_center|LOCUS_08550 11864 10992 gene locus_tag LOCUS_08560 11864 10992 CDS product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189208.1 protein_id gnl|my_center|LOCUS_08560 11989 12588 gene locus_tag LOCUS_08570 gene thrH 11989 12588 CDS product bifunctional phosphoserine phosphatase/homoserine phosphotransferase ThrH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267421.1 protein_id gnl|my_center|LOCUS_08570 13508 12585 gene locus_tag LOCUS_08580 13508 12585 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732701.1 protein_id gnl|my_center|LOCUS_08580 <14109 13510 gene locus_tag LOCUS_08590 <14109 13510 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011013807.1:ABC transporter ATP-binding protein >Feature sequence041 3185 366 gene locus_tag LOCUS_08600 gene lacZ 3185 366 CDS product beta-galactosidase LacZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080135.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08600 4745 3261 gene locus_tag LOCUS_08610 4745 3261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08610 5628 4747 gene locus_tag LOCUS_08620 gene ftsX 5628 4747 CDS product permease-like cell division protein FtsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074182.1 protein_id gnl|my_center|LOCUS_08620 6139 5633 gene locus_tag LOCUS_08630 6139 5633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08630 6513 7298 gene locus_tag LOCUS_08640 6513 7298 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227837.1 protein_id gnl|my_center|LOCUS_08640 7303 8412 gene locus_tag LOCUS_08650 7303 8412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08650 8412 9656 gene locus_tag LOCUS_08660 8412 9656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08660 9818 10693 gene locus_tag LOCUS_08670 gene panB 9818 10693 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391669.1 protein_id gnl|my_center|LOCUS_08670 10690 11547 gene locus_tag LOCUS_08680 gene panC 10690 11547 CDS product pantoate--beta-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084897.1 protein_id gnl|my_center|LOCUS_08680 11746 12123 gene locus_tag LOCUS_08690 11746 12123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08690 13021 12173 gene locus_tag LOCUS_08700 13021 12173 CDS product pyruvate, water dikinase regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941117.1 protein_id gnl|my_center|LOCUS_08700 13167 13033 gene locus_tag LOCUS_08710 13167 13033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08710 <13986 13270 gene locus_tag LOCUS_08720 <13986 13270 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011388956.1:MaoC family dehydratase >Feature sequence042 286 450 gene locus_tag LOCUS_08730 286 450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08730 466 651 gene locus_tag LOCUS_08740 466 651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08740 663 1208 gene locus_tag LOCUS_08750 663 1208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08750 1205 1996 gene locus_tag LOCUS_08760 1205 1996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08760 1996 3201 gene locus_tag LOCUS_08770 1996 3201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08770 3209 3742 gene locus_tag LOCUS_08780 3209 3742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08780 3726 4598 gene locus_tag LOCUS_08790 3726 4598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08790 4615 5376 gene locus_tag LOCUS_08800 4615 5376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08800 5378 6529 gene locus_tag LOCUS_08810 5378 6529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08810 6526 8109 gene locus_tag LOCUS_08820 6526 8109 CDS product ATPase, T2SS/T4P/T4SS family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064053.1 protein_id gnl|my_center|LOCUS_08820 8106 8966 gene locus_tag LOCUS_08830 8106 8966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08830 8963 9877 gene locus_tag LOCUS_08840 8963 9877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08840 9874 10425 gene locus_tag LOCUS_08850 9874 10425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08850 10487 11059 gene locus_tag LOCUS_08860 10487 11059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08860 11056 12054 gene locus_tag LOCUS_08870 11056 12054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08870 12051 12671 gene locus_tag LOCUS_08880 12051 12671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08880 13282 12710 gene locus_tag LOCUS_08890 13282 12710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08890 >Feature sequence043 1154 633 gene locus_tag LOCUS_08900 1154 633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08900 1350 1093 gene locus_tag LOCUS_08910 1350 1093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08910 1892 1347 gene locus_tag LOCUS_08920 1892 1347 CDS product NADH-quinone oxidoreductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000524416.1 protein_id gnl|my_center|LOCUS_08920 2239 1880 gene locus_tag LOCUS_08930 2239 1880 CDS product NADH-quinone oxidoreductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941006.1 protein_id gnl|my_center|LOCUS_08930 2411 4027 gene locus_tag LOCUS_08940 2411 4027 CDS product alanine/glycine:cation symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189099273.1 protein_id gnl|my_center|LOCUS_08940 4044 5339 gene locus_tag LOCUS_08950 gene pepP 4044 5339 CDS product Xaa-Pro aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114045.1 protein_id gnl|my_center|LOCUS_08950 5401 6234 gene locus_tag LOCUS_08960 gene proC 5401 6234 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943177.1 protein_id gnl|my_center|LOCUS_08960 6923 6231 gene locus_tag LOCUS_08970 6923 6231 CDS product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943180.1 protein_id gnl|my_center|LOCUS_08970 7378 6914 gene locus_tag LOCUS_08980 7378 6914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08980 9063 7510 gene locus_tag LOCUS_08990 9063 7510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08990 9332 9117 gene locus_tag LOCUS_09000 9332 9117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09000 9465 11576 gene locus_tag LOCUS_09010 9465 11576 CDS product ATP-dependent RecD-like DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256716.1 protein_id gnl|my_center|LOCUS_09010 12676 11573 gene locus_tag LOCUS_09020 12676 11573 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031746.1 protein_id gnl|my_center|LOCUS_09020 12728 13714 gene locus_tag LOCUS_09030 gene truD 12728 13714 CDS product tRNA pseudouridine(13) synthase TruD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479835.1 protein_id gnl|my_center|LOCUS_09030 >Feature sequence044 7439 5229 gene locus_tag LOCUS_09040 7439 5229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922195.1 protein_id gnl|my_center|LOCUS_09040 8234 7449 gene locus_tag LOCUS_09050 8234 7449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09050 8311 9405 gene locus_tag LOCUS_09060 8311 9405 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897671.1 protein_id gnl|my_center|LOCUS_09060 10580 9423 gene locus_tag LOCUS_09070 10580 9423 CDS product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058225.1 protein_id gnl|my_center|LOCUS_09070 10868 10608 gene locus_tag LOCUS_09080 10868 10608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09080 11398 10949 gene locus_tag LOCUS_09090 11398 10949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09090 12183 11512 gene locus_tag LOCUS_09100 gene deoC 12183 11512 CDS product deoxyribose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436656.1 protein_id gnl|my_center|LOCUS_09100 >Feature sequence045 43 2043 gene locus_tag LOCUS_09110 43 2043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09110 2051 2896 gene locus_tag LOCUS_09120 2051 2896 CDS product N-formylglutamate amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368433.1 protein_id gnl|my_center|LOCUS_09120 3144 2878 gene locus_tag LOCUS_09130 3144 2878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09130 3373 4182 gene locus_tag LOCUS_09140 3373 4182 CDS product RNA polymerase factor sigma-32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720768.1 protein_id gnl|my_center|LOCUS_09140 4241 5353 gene locus_tag LOCUS_09150 4241 5353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09150 5353 6165 gene locus_tag LOCUS_09160 5353 6165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09160 6206 7180 gene locus_tag LOCUS_09170 6206 7180 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001034325.1 protein_id gnl|my_center|LOCUS_09170 7177 8154 gene locus_tag LOCUS_09180 7177 8154 CDS product dipeptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172559.1 protein_id gnl|my_center|LOCUS_09180 8194 8847 gene locus_tag LOCUS_09190 8194 8847 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000013857.1 protein_id gnl|my_center|LOCUS_09190 8897 9175 gene locus_tag LOCUS_09200 8897 9175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09200 9385 9681 gene locus_tag LOCUS_09210 9385 9681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09210 9678 10169 gene locus_tag LOCUS_09220 9678 10169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09220 10085 10843 gene locus_tag LOCUS_09230 gene recO 10085 10843 CDS product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941240.1 protein_id gnl|my_center|LOCUS_09230 10996 11385 gene locus_tag LOCUS_09240 10996 11385 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942863.1 protein_id gnl|my_center|LOCUS_09240 11382 13454 gene locus_tag LOCUS_09250 11382 13454 CDS product chemotaxis protein CheA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942862.1 protein_id gnl|my_center|LOCUS_09250 >Feature sequence046 1 1095 gene locus_tag LOCUS_09260 1 1095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09260 1567 1100 gene locus_tag LOCUS_09270 1567 1100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09270 2088 1477 gene locus_tag LOCUS_09280 2088 1477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09280 2527 2117 gene locus_tag LOCUS_09290 2527 2117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09290 2630 4093 gene locus_tag LOCUS_09300 gene gatB 2630 4093 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943991.1 protein_id gnl|my_center|LOCUS_09300 4090 5166 gene locus_tag LOCUS_09310 gene mtnA 4090 5166 CDS product S-methyl-5-thioribose-1-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943990.1 protein_id gnl|my_center|LOCUS_09310 6240 5182 gene locus_tag LOCUS_09320 6240 5182 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033447294.1 protein_id gnl|my_center|LOCUS_09320 6818 6237 gene locus_tag LOCUS_09330 6818 6237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09330 7518 6733 gene locus_tag LOCUS_09340 7518 6733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09340 8919 7528 gene locus_tag LOCUS_09350 gene argH 8919 7528 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227830.1 protein_id gnl|my_center|LOCUS_09350 11089 8933 gene locus_tag LOCUS_09360 11089 8933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09360 11157 12548 gene locus_tag LOCUS_09370 gene fumC 11157 12548 CDS product class II fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958006.1 protein_id gnl|my_center|LOCUS_09370 12545 12832 gene locus_tag LOCUS_09380 12545 12832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09380 12829 13662 gene locus_tag LOCUS_09390 12829 13662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09390 >Feature sequence047 1675 671 gene locus_tag LOCUS_09400 1675 671 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088171.1 protein_id gnl|my_center|LOCUS_09400 1747 2409 gene locus_tag LOCUS_09410 1747 2409 CDS product beta-phosphoglucomutase family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927183.1 protein_id gnl|my_center|LOCUS_09410 2406 3389 gene locus_tag LOCUS_09420 2406 3389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09420 3462 4412 gene locus_tag LOCUS_09430 3462 4412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09430 4474 5997 gene locus_tag LOCUS_09440 4474 5997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09440 6826 6002 gene locus_tag LOCUS_09450 6826 6002 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967051.1 protein_id gnl|my_center|LOCUS_09450 6905 8770 gene locus_tag LOCUS_09460 6905 8770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09460 8799 9872 gene locus_tag LOCUS_09470 8799 9872 CDS product sulfotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205704.1 protein_id gnl|my_center|LOCUS_09470 10139 9882 gene locus_tag LOCUS_09480 10139 9882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09480 10789 10031 gene locus_tag LOCUS_09490 10789 10031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09490 11236 10841 gene locus_tag LOCUS_09500 11236 10841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09500 11366 11220 gene locus_tag LOCUS_09510 11366 11220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09510 12254 11409 gene locus_tag LOCUS_09520 12254 11409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09520 <13459 12262 gene locus_tag LOCUS_09530 <13459 12262 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010967587.1:HlyD family efflux transporter periplasmic adaptor subunit >Feature sequence048 757 317 gene locus_tag LOCUS_09540 757 317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09540 2130 1111 gene locus_tag LOCUS_09550 2130 1111 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_218938748.1 protein_id gnl|my_center|LOCUS_09550 2808 2134 gene locus_tag LOCUS_09560 2808 2134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09560 4000 2837 gene locus_tag LOCUS_09570 4000 2837 CDS product ferredoxin--NADP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014876727.1 protein_id gnl|my_center|LOCUS_09570 4680 3997 gene locus_tag LOCUS_09580 4680 3997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09580 4714 6306 gene locus_tag LOCUS_09590 4714 6306 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230761.1 protein_id gnl|my_center|LOCUS_09590 6306 7889 gene locus_tag LOCUS_09600 6306 7889 CDS product GMC family oxidoreductase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230760.1 protein_id gnl|my_center|LOCUS_09600 7961 8956 gene locus_tag LOCUS_09610 7961 8956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09610 9829 8993 gene locus_tag LOCUS_09620 9829 8993 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224394.1 protein_id gnl|my_center|LOCUS_09620 10490 9891 gene locus_tag LOCUS_09630 10490 9891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09630 10756 10487 gene locus_tag LOCUS_09640 10756 10487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09640 10792 11493 gene locus_tag LOCUS_09650 10792 11493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09650 <12815 11490 gene locus_tag LOCUS_09660 <12815 11490 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011266740.1:FAD-dependent oxidoreductase >Feature sequence049 2551 212 gene locus_tag LOCUS_09670 2551 212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09670 3635 2592 gene locus_tag LOCUS_09680 3635 2592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09680 3739 4080 gene locus_tag LOCUS_09690 3739 4080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09690 4663 4136 gene locus_tag LOCUS_09700 4663 4136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09700 5246 4686 gene locus_tag LOCUS_09710 5246 4686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09710 5537 6319 gene locus_tag LOCUS_09720 5537 6319 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939732.1 protein_id gnl|my_center|LOCUS_09720 6342 8030 gene locus_tag LOCUS_09730 6342 8030 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975889.1 protein_id gnl|my_center|LOCUS_09730 8027 9028 gene locus_tag LOCUS_09740 8027 9028 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002723881.1 protein_id gnl|my_center|LOCUS_09740 9810 9025 gene locus_tag LOCUS_09750 9810 9025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09750 10451 9807 gene locus_tag LOCUS_09760 gene pgsA 10451 9807 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459962.1 protein_id gnl|my_center|LOCUS_09760 10737 10507 gene locus_tag LOCUS_09770 10737 10507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09770 11327 10737 gene locus_tag LOCUS_09780 11327 10737 CDS product heme-copper oxidase subunit III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014948.1 protein_id gnl|my_center|LOCUS_09780 11777 11346 gene locus_tag LOCUS_09790 11777 11346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09790 12368 11790 gene locus_tag LOCUS_09800 12368 11790 CDS product cytochrome c oxidase subunit 3 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404826.1 protein_id gnl|my_center|LOCUS_09800 >Feature sequence050 855 184 gene locus_tag LOCUS_09810 855 184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09810 3119 852 gene locus_tag LOCUS_09820 3119 852 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085445.1 protein_id gnl|my_center|LOCUS_09820 3188 4690 gene locus_tag LOCUS_09830 3188 4690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09830 5241 4687 gene locus_tag LOCUS_09840 5241 4687 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259300.1 protein_id gnl|my_center|LOCUS_09840 6185 5238 gene locus_tag LOCUS_09850 gene fmt 6185 5238 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940806.1 protein_id gnl|my_center|LOCUS_09850 6707 6192 gene locus_tag LOCUS_09860 gene def 6707 6192 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948295.1 protein_id gnl|my_center|LOCUS_09860 6865 8577 gene locus_tag LOCUS_09870 6865 8577 CDS product FAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256282.1 protein_id gnl|my_center|LOCUS_09870 10981 8696 gene locus_tag LOCUS_09880 gene priA 10981 8696 CDS product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940804.1 protein_id gnl|my_center|LOCUS_09880 12065 10989 gene locus_tag LOCUS_09890 gene tsaD 12065 10989 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942510.1 protein_id gnl|my_center|LOCUS_09890 >Feature sequence051 52 534 gene locus_tag LOCUS_09900 52 534 CDS product roadblock/LC7 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940775.1 protein_id gnl|my_center|LOCUS_09900 554 1147 gene locus_tag LOCUS_09910 554 1147 CDS product GTPase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940776.1 protein_id gnl|my_center|LOCUS_09910 1251 1901 gene locus_tag LOCUS_09920 1251 1901 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387744.1 protein_id gnl|my_center|LOCUS_09920 4420 1973 gene locus_tag LOCUS_09930 gene leuS 4420 1973 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001108730.1 protein_id gnl|my_center|LOCUS_09930 5546 4458 gene locus_tag LOCUS_09940 5546 4458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09940 6461 5712 gene locus_tag LOCUS_09950 6461 5712 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066671.1 protein_id gnl|my_center|LOCUS_09950 7468 6458 gene locus_tag LOCUS_09960 7468 6458 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228993.1 protein_id gnl|my_center|LOCUS_09960 8724 7465 gene locus_tag LOCUS_09970 8724 7465 CDS product sulfotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005094688.1 protein_id gnl|my_center|LOCUS_09970 9179 8721 gene locus_tag LOCUS_09980 9179 8721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09980 10024 9230 gene locus_tag LOCUS_09990 10024 9230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09990 9948 10130 gene locus_tag LOCUS_10000 9948 10130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10000 10761 11405 gene locus_tag LOCUS_10010 10761 11405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10010 11509 11862 gene locus_tag LOCUS_10020 11509 11862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10020 11886 12245 gene locus_tag LOCUS_10030 11886 12245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10030 >Feature sequence052 2247 31 gene locus_tag LOCUS_10040 2247 31 CDS product UvrD-helicase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944022.1 protein_id gnl|my_center|LOCUS_10040 2591 2908 gene locus_tag LOCUS_10050 2591 2908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10050 2911 3441 gene locus_tag LOCUS_10060 2911 3441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10060 3438 3950 gene locus_tag LOCUS_10070 3438 3950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10070 3951 4667 gene locus_tag LOCUS_10080 3951 4667 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838449.1 protein_id gnl|my_center|LOCUS_10080 4713 7163 gene locus_tag LOCUS_10090 4713 7163 CDS product PBP1A family penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943755.1 protein_id gnl|my_center|LOCUS_10090 7160 8755 gene locus_tag LOCUS_10100 7160 8755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10100 9964 8774 gene locus_tag LOCUS_10110 9964 8774 CDS product NnrS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970958.1 protein_id gnl|my_center|LOCUS_10110 11431 10094 gene locus_tag LOCUS_10120 11431 10094 CDS product sigma 54-interacting transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940636.1 protein_id gnl|my_center|LOCUS_10120 <12411 11428 gene locus_tag LOCUS_10130 <12411 11428 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003113915.1:two-component system sensor histidine kinase CbrA >Feature sequence053 <1 1566 gene locus_tag LOCUS_10140 <1 1566 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011228080.1:tetratricopeptide repeat protein 1972 1574 gene locus_tag LOCUS_10150 1972 1574 CDS product cytidine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009564559.1 protein_id gnl|my_center|LOCUS_10150 2778 1972 gene locus_tag LOCUS_10160 2778 1972 CDS product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986426.1 protein_id gnl|my_center|LOCUS_10160 2662 3465 gene locus_tag LOCUS_10170 2662 3465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10170 3462 4766 gene locus_tag LOCUS_10180 3462 4766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10180 4883 5194 gene locus_tag LOCUS_10190 gene rplU 4883 5194 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392094.1 protein_id gnl|my_center|LOCUS_10190 5204 5464 gene locus_tag LOCUS_10200 gene rpmA 5204 5464 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545975.1 protein_id gnl|my_center|LOCUS_10200 5473 7029 gene locus_tag LOCUS_10210 5473 7029 CDS product 5' nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010945856.1 protein_id gnl|my_center|LOCUS_10210 7529 7456 gene locus_tag LOCUS_t00060 7529 7456 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 7623 9116 gene locus_tag LOCUS_10220 7623 9116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10220 9492 9142 gene locus_tag LOCUS_10230 9492 9142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10230 10254 9538 gene locus_tag LOCUS_10240 10254 9538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10240 11216 10245 gene locus_tag LOCUS_10250 11216 10245 CDS product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404517.1 protein_id gnl|my_center|LOCUS_10250 11297 11572 gene locus_tag LOCUS_10260 gene xseB 11297 11572 CDS product exodeoxyribonuclease VII small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005418105.1 protein_id gnl|my_center|LOCUS_10260 >Feature sequence054 713 976 gene locus_tag LOCUS_10270 713 976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10270 2586 973 gene locus_tag LOCUS_10280 2586 973 CDS product carboxyl transferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466887.1 protein_id gnl|my_center|LOCUS_10280 4182 2668 gene locus_tag LOCUS_10290 4182 2668 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051618874.1 protein_id gnl|my_center|LOCUS_10290 4389 5702 gene locus_tag LOCUS_10300 4389 5702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10300 6696 5707 gene locus_tag LOCUS_10310 6696 5707 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223398.1 protein_id gnl|my_center|LOCUS_10310 7010 6693 gene locus_tag LOCUS_10320 7010 6693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10320 8137 7058 gene locus_tag LOCUS_10330 8137 7058 CDS product ArsA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419740.1 protein_id gnl|my_center|LOCUS_10330 9060 8134 gene locus_tag LOCUS_10340 9060 8134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10340 9086 9967 gene locus_tag LOCUS_10350 9086 9967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10350 10695 9964 gene locus_tag LOCUS_10360 10695 9964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10360 11651 10692 gene locus_tag LOCUS_10370 11651 10692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10370 12064 11648 gene locus_tag LOCUS_10380 12064 11648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_10380 >Feature sequence055 2479 134 gene locus_tag LOCUS_10390 2479 134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10390 2602 4686 gene locus_tag LOCUS_10400 gene ligA 2602 4686 CDS product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869864.1 protein_id gnl|my_center|LOCUS_10400 5832 4690 gene locus_tag LOCUS_10410 5832 4690 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108945.1 protein_id gnl|my_center|LOCUS_10410 5973 6491 gene locus_tag LOCUS_10420 5973 6491 CDS product glycine cleavage system protein R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084789.1 protein_id gnl|my_center|LOCUS_10420 7847 6408 gene locus_tag LOCUS_10430 7847 6408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10430 7904 8437 gene locus_tag LOCUS_10440 7904 8437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10440 8508 11405 gene locus_tag LOCUS_10450 8508 11405 CDS product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005079291.1 protein_id gnl|my_center|LOCUS_10450 >Feature sequence056 304 1539 gene locus_tag LOCUS_10460 304 1539 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207044.1 protein_id gnl|my_center|LOCUS_10460 1583 2338 gene locus_tag LOCUS_10470 1583 2338 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122195.1 protein_id gnl|my_center|LOCUS_10470 3833 2346 gene locus_tag LOCUS_10480 3833 2346 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051618874.1 protein_id gnl|my_center|LOCUS_10480 4624 3866 gene locus_tag LOCUS_10490 4624 3866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10490 5155 4724 gene locus_tag LOCUS_10500 5155 4724 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005762782.1 protein_id gnl|my_center|LOCUS_10500 5268 5948 gene locus_tag LOCUS_10510 5268 5948 CDS product crotonase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087759.1 protein_id gnl|my_center|LOCUS_10510 6236 5949 gene locus_tag LOCUS_10520 6236 5949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10520 6989 6687 gene locus_tag LOCUS_10530 6989 6687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10530 7873 6992 gene locus_tag LOCUS_10540 7873 6992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10540 8318 7929 gene locus_tag LOCUS_10550 8318 7929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10550 9814 8525 gene locus_tag LOCUS_10560 9814 8525 CDS product ATP-dependent 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000448293.1 protein_id gnl|my_center|LOCUS_10560 9904 10647 gene locus_tag LOCUS_10570 9904 10647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10570 <11896 10696 gene locus_tag LOCUS_10580 <11896 10696 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164921326.1:peroxidase family protein >Feature sequence057 550 1332 gene locus_tag LOCUS_10590 550 1332 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000167663.1 protein_id gnl|my_center|LOCUS_10590 1329 2018 gene locus_tag LOCUS_10600 1329 2018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10600 3229 2021 gene locus_tag LOCUS_10610 3229 2021 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190545.1 protein_id gnl|my_center|LOCUS_10610 3248 5107 gene locus_tag LOCUS_10620 3248 5107 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266447.1 protein_id gnl|my_center|LOCUS_10620 5245 6102 gene locus_tag LOCUS_10630 5245 6102 CDS product 3-keto-5-aminohexanoate cleavage protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083805.1 protein_id gnl|my_center|LOCUS_10630 6124 6831 gene locus_tag LOCUS_10640 6124 6831 CDS product CoA transferase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089830.1 protein_id gnl|my_center|LOCUS_10640 6842 7489 gene locus_tag LOCUS_10650 6842 7489 CDS product 3-oxoacid CoA-transferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089829.1 protein_id gnl|my_center|LOCUS_10650 8781 7486 gene locus_tag LOCUS_10660 8781 7486 CDS product short-chain fatty acid transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015878.1 protein_id gnl|my_center|LOCUS_10660 8819 9757 gene locus_tag LOCUS_10670 8819 9757 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030552.1 protein_id gnl|my_center|LOCUS_10670 10697 9891 gene locus_tag LOCUS_10680 10697 9891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10680 11488 10694 gene locus_tag LOCUS_10690 11488 10694 CDS product serine/threonine-protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329162.1 protein_id gnl|my_center|LOCUS_10690 >Feature sequence058 479 988 gene locus_tag LOCUS_10700 479 988 CDS product CarD family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938863.1 protein_id gnl|my_center|LOCUS_10700 996 2510 gene locus_tag LOCUS_10710 gene rng 996 2510 CDS product ribonuclease G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943853.1 protein_id gnl|my_center|LOCUS_10710 2518 2847 gene locus_tag LOCUS_10720 2518 2847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10720 3828 2878 gene locus_tag LOCUS_10730 3828 2878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10730 3960 6845 gene locus_tag LOCUS_10740 3960 6845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10740 7399 6842 gene locus_tag LOCUS_10750 gene frr 7399 6842 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466739.1 protein_id gnl|my_center|LOCUS_10750 8152 7424 gene locus_tag LOCUS_10760 gene pyrH 8152 7424 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942564.1 protein_id gnl|my_center|LOCUS_10760 8830 8156 gene locus_tag LOCUS_10770 gene tsf 8830 8156 CDS product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460416.1 protein_id gnl|my_center|LOCUS_10770 9708 8830 gene locus_tag LOCUS_10780 gene rpsB 9708 8830 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938173.1 protein_id gnl|my_center|LOCUS_10780 10603 10016 gene locus_tag LOCUS_10790 10603 10016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10790 <11720 10605 gene locus_tag LOCUS_10800 <11720 10605 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_162275477.1:phospholipase D-like domain-containing protein >Feature sequence059 <1 1183 gene locus_tag LOCUS_10810 <1 1183 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004079958.1:endonuclease MutS2 2082 1204 gene locus_tag LOCUS_10820 gene lgt 2082 1204 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880125.1 protein_id gnl|my_center|LOCUS_10820 2137 3414 gene locus_tag LOCUS_10830 gene eno 2137 3414 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389638.1 protein_id gnl|my_center|LOCUS_10830 4570 3428 gene locus_tag LOCUS_10840 4570 3428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10840 4654 5097 gene locus_tag LOCUS_10850 4654 5097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10850 5488 5802 gene locus_tag LOCUS_10860 5488 5802 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957599.1 protein_id gnl|my_center|LOCUS_10860 7121 5841 gene locus_tag LOCUS_10870 7121 5841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10870 7191 8573 gene locus_tag LOCUS_10880 7191 8573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10880 9564 8551 gene locus_tag LOCUS_10890 9564 8551 CDS product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391425.1 protein_id gnl|my_center|LOCUS_10890 10541 9630 gene locus_tag LOCUS_10900 10541 9630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10900 10465 10737 gene locus_tag LOCUS_10910 10465 10737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10910 10754 11254 gene locus_tag LOCUS_10920 gene rimP 10754 11254 CDS product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460396.1 protein_id gnl|my_center|LOCUS_10920 >Feature sequence060 1346 2401 gene locus_tag LOCUS_10930 gene tyrA 1346 2401 CDS product bifunctional chorismate mutase/prephenate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000257629.1 protein_id gnl|my_center|LOCUS_10930 2481 3251 gene locus_tag LOCUS_10940 gene dapB 2481 3251 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400159.1 protein_id gnl|my_center|LOCUS_10940 3595 3876 gene locus_tag LOCUS_10950 3595 3876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10950 3869 5779 gene locus_tag LOCUS_10960 3869 5779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10960 5780 6823 gene locus_tag LOCUS_10970 gene queA 5780 6823 CDS product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064321.1 protein_id gnl|my_center|LOCUS_10970 6820 7965 gene locus_tag LOCUS_10980 gene tgt 6820 7965 CDS product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393196.1 protein_id gnl|my_center|LOCUS_10980 8012 9562 gene locus_tag LOCUS_10990 gene purH 8012 9562 CDS product bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941271.1 protein_id gnl|my_center|LOCUS_10990 9562 10983 gene locus_tag LOCUS_11000 gene purD 9562 10983 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941272.1 protein_id gnl|my_center|LOCUS_11000 >Feature sequence061 1275 64 gene locus_tag LOCUS_11010 1275 64 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003089998.1 protein_id gnl|my_center|LOCUS_11010 1414 2388 gene locus_tag LOCUS_11020 1414 2388 CDS product phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918188.1 protein_id gnl|my_center|LOCUS_11020 2575 2627 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2733 4034 gene locus_tag LOCUS_11030 gene purB 2733 4034 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088436.1 protein_id gnl|my_center|LOCUS_11030 4036 5007 gene locus_tag LOCUS_11040 4036 5007 CDS product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404262.1 protein_id gnl|my_center|LOCUS_11040 5004 5168 gene locus_tag LOCUS_11050 gene purS 5004 5168 CDS product phosphoribosylformylglycinamidine synthase subunit PurS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000278823.1 protein_id gnl|my_center|LOCUS_11050 5366 5899 gene locus_tag LOCUS_11060 5366 5899 CDS product CoA pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943780.1 protein_id gnl|my_center|LOCUS_11060 5935 6225 gene locus_tag LOCUS_11070 5935 6225 CDS product oxidative damage protection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_044233591.1 protein_id gnl|my_center|LOCUS_11070 6833 6255 gene locus_tag LOCUS_11080 6833 6255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11080 7511 6843 gene locus_tag LOCUS_11090 7511 6843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11090 7998 7591 gene locus_tag LOCUS_11100 7998 7591 CDS product thiol-disulfide oxidoreductase DCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921412.1 protein_id gnl|my_center|LOCUS_11100 8164 10437 gene locus_tag LOCUS_11110 8164 10437 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005084710.1 protein_id gnl|my_center|LOCUS_11110 10834 10439 gene locus_tag LOCUS_11120 10834 10439 CDS product DUF302 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946746.1 protein_id gnl|my_center|LOCUS_11120 >Feature sequence062 <1 1673 gene locus_tag LOCUS_11130 <1 1673 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011101649.1:single-stranded-DNA-specific exonuclease RecJ 2469 1690 gene locus_tag LOCUS_11140 2469 1690 CDS product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088784.1 protein_id gnl|my_center|LOCUS_11140 2616 3038 gene locus_tag LOCUS_11150 2616 3038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11150 3091 4053 gene locus_tag LOCUS_11160 3091 4053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11160 4132 6078 gene locus_tag LOCUS_11170 gene ftsH 4132 6078 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_200858940.1 protein_id gnl|my_center|LOCUS_11170 6094 6936 gene locus_tag LOCUS_11180 gene folP 6094 6936 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057362.1 protein_id gnl|my_center|LOCUS_11180 6933 7760 gene locus_tag LOCUS_11190 6933 7760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11190 7757 8707 gene locus_tag LOCUS_11200 7757 8707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11200 10071 8704 gene locus_tag LOCUS_11210 gene glmM 10071 8704 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942450.1 protein_id gnl|my_center|LOCUS_11210 >Feature sequence063 496 26 gene locus_tag LOCUS_11220 gene rpsG 496 26 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385326.1 protein_id gnl|my_center|LOCUS_11220 903 505 gene locus_tag LOCUS_11230 gene rpsL 903 505 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943491.1 protein_id gnl|my_center|LOCUS_11230 2008 1136 gene locus_tag LOCUS_11240 2008 1136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11240 3844 2063 gene locus_tag LOCUS_11250 gene pknB 3844 2063 CDS product Stk1 family PASTA domain-containing Ser/Thr kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256390.1 protein_id gnl|my_center|LOCUS_11250 5232 3895 gene locus_tag LOCUS_11260 5232 3895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11260 5293 6615 gene locus_tag LOCUS_11270 gene pabB 5293 6615 CDS product aminodeoxychorismate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009314634.1 protein_id gnl|my_center|LOCUS_11270 6608 7210 gene locus_tag LOCUS_11280 6608 7210 CDS product DUF924 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706410.1 protein_id gnl|my_center|LOCUS_11280 7315 8454 gene locus_tag LOCUS_11290 7315 8454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11290 8451 9818 gene locus_tag LOCUS_11300 8451 9818 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546471.1 protein_id gnl|my_center|LOCUS_11300 9833 10699 gene locus_tag LOCUS_11310 9833 10699 CDS product acetoacetate decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886798.1 protein_id gnl|my_center|LOCUS_11310 >Feature sequence064 1231 20 gene locus_tag LOCUS_11320 1231 20 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942781.1 protein_id gnl|my_center|LOCUS_11320 2561 1221 gene locus_tag LOCUS_11330 2561 1221 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201245837.1 protein_id gnl|my_center|LOCUS_11330 3056 2688 gene locus_tag LOCUS_11340 3056 2688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11340 3129 4238 gene locus_tag LOCUS_11350 3129 4238 CDS product S-(hydroxymethyl)glutathione dehydrogenase/class III alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144408.1 protein_id gnl|my_center|LOCUS_11350 4240 4833 gene locus_tag LOCUS_11360 4240 4833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11360 5454 4900 gene locus_tag LOCUS_11370 5454 4900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11370 6304 5471 gene locus_tag LOCUS_11380 6304 5471 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206171.1 protein_id gnl|my_center|LOCUS_11380 6432 7463 gene locus_tag LOCUS_11390 6432 7463 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963619.1 protein_id gnl|my_center|LOCUS_11390 8380 7472 gene locus_tag LOCUS_11400 8380 7472 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005080850.1 protein_id gnl|my_center|LOCUS_11400 8451 9863 gene locus_tag LOCUS_11410 8451 9863 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010908420.1 protein_id gnl|my_center|LOCUS_11410 <10766 9860 gene locus_tag LOCUS_11420 <10766 9860 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000042779.1:glycerophosphodiester phosphodiesterase >Feature sequence065 1603 680 gene locus_tag LOCUS_11430 1603 680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11430 2660 1593 gene locus_tag LOCUS_11440 2660 1593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11440 3558 2722 gene locus_tag LOCUS_11450 gene nhaR 3558 2722 CDS product transcriptional activator NhaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104144.1 protein_id gnl|my_center|LOCUS_11450 3705 5387 gene locus_tag LOCUS_11460 3705 5387 CDS product SulP family inorganic anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444186.1 protein_id gnl|my_center|LOCUS_11460 5284 5919 gene locus_tag LOCUS_11470 5284 5919 CDS product carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947903.1 protein_id gnl|my_center|LOCUS_11470 6428 5940 gene locus_tag LOCUS_11480 6428 5940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11480 8673 7177 gene locus_tag LOCUS_11490 8673 7177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11490 8851 9795 gene locus_tag LOCUS_11500 8851 9795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11500 >Feature sequence066 1545 151 gene locus_tag LOCUS_11510 1545 151 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947960.1 protein_id gnl|my_center|LOCUS_11510 3528 1600 gene locus_tag LOCUS_11520 3528 1600 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000587238.1 protein_id gnl|my_center|LOCUS_11520 4139 3531 gene locus_tag LOCUS_11530 4139 3531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11530 4466 4227 gene locus_tag LOCUS_11540 4466 4227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11540 5928 4813 gene locus_tag LOCUS_11550 5928 4813 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030873148.1 protein_id gnl|my_center|LOCUS_11550 6030 6614 gene locus_tag LOCUS_11560 6030 6614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11560 7026 6586 gene locus_tag LOCUS_11570 7026 6586 CDS product PaaI family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087727.1 protein_id gnl|my_center|LOCUS_11570 8771 7026 gene locus_tag LOCUS_11580 8771 7026 CDS product long-chain-acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090509.1 protein_id gnl|my_center|LOCUS_11580 8887 9309 gene locus_tag LOCUS_11590 8887 9309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11590 9311 9685 gene locus_tag LOCUS_11600 9311 9685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11600 >Feature sequence067 2327 1611 gene locus_tag LOCUS_11610 2327 1611 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942909.1 protein_id gnl|my_center|LOCUS_11610 4409 2358 gene locus_tag LOCUS_11620 4409 2358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11620 6013 4406 gene locus_tag LOCUS_11630 gene lysS 6013 4406 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942911.1 protein_id gnl|my_center|LOCUS_11630 7000 6017 gene locus_tag LOCUS_11640 gene prfB 7000 6017 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942918.1 protein_id gnl|my_center|LOCUS_11640 7357 8238 gene locus_tag LOCUS_11650 7357 8238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11650 8258 8590 gene locus_tag LOCUS_11660 8258 8590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11660 9247 8591 gene locus_tag LOCUS_11670 9247 8591 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094072.1 protein_id gnl|my_center|LOCUS_11670 10169 9333 gene locus_tag LOCUS_11680 10169 9333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11680 >Feature sequence068 3105 1078 gene locus_tag LOCUS_11690 3105 1078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11690 3387 3118 gene locus_tag LOCUS_11700 3387 3118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11700 4674 3397 gene locus_tag LOCUS_11710 4674 3397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11710 8291 4674 gene locus_tag LOCUS_11720 8291 4674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11720 9913 8279 gene locus_tag LOCUS_11730 9913 8279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11730 >Feature sequence069 664 2799 gene locus_tag LOCUS_11740 664 2799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11740 3737 2745 gene locus_tag LOCUS_11750 3737 2745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11750 3766 4275 gene locus_tag LOCUS_11760 3766 4275 CDS product tRNA (cytidine(34)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941854.1 protein_id gnl|my_center|LOCUS_11760 4320 5261 gene locus_tag LOCUS_11770 4320 5261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11770 6046 5258 gene locus_tag LOCUS_11780 6046 5258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11780 5942 6418 gene locus_tag LOCUS_11790 5942 6418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11790 7106 6411 gene locus_tag LOCUS_11800 7106 6411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11800 7014 8249 gene locus_tag LOCUS_11810 7014 8249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11810 8381 9286 gene locus_tag LOCUS_11820 8381 9286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11820 9315 9956 gene locus_tag LOCUS_11830 9315 9956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11830 >Feature sequence070 1469 441 gene locus_tag LOCUS_11840 1469 441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11840 1975 1466 gene locus_tag LOCUS_11850 1975 1466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11850 2297 1875 gene locus_tag LOCUS_11860 2297 1875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11860 2821 2330 gene locus_tag LOCUS_11870 2821 2330 CDS product FxsA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941471.1 protein_id gnl|my_center|LOCUS_11870 2991 3938 gene locus_tag LOCUS_11880 2991 3938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11880 6253 3950 gene locus_tag LOCUS_11890 6253 3950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11890 6354 8270 gene locus_tag LOCUS_11900 gene speA 6354 8270 CDS product biosynthetic arginine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144058.1 protein_id gnl|my_center|LOCUS_11900 8436 9089 gene locus_tag LOCUS_11910 8436 9089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11910 <10141 9078 gene locus_tag LOCUS_11920 <10141 9078 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011028356.1:AMP-binding protein >Feature sequence071 83 688 gene locus_tag LOCUS_11930 83 688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11930 720 1928 gene locus_tag LOCUS_11940 720 1928 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545898.1 protein_id gnl|my_center|LOCUS_11940 2970 1960 gene locus_tag LOCUS_11950 2970 1960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11950 2990 4087 gene locus_tag LOCUS_11960 gene bioB 2990 4087 CDS product biotin synthase BioB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705387.1 protein_id gnl|my_center|LOCUS_11960 4458 5330 gene locus_tag LOCUS_11970 4458 5330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11970 5327 6550 gene locus_tag LOCUS_11980 5327 6550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11980 6583 7563 gene locus_tag LOCUS_11990 6583 7563 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941347.1 protein_id gnl|my_center|LOCUS_11990 7913 8170 gene locus_tag LOCUS_12000 7913 8170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12000 8091 8522 gene locus_tag LOCUS_12010 8091 8522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12010 8775 8536 gene locus_tag LOCUS_12020 8775 8536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12020 8893 10122 gene locus_tag LOCUS_12030 8893 10122 CDS product pyridoxal phosphate-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_084205626.1 protein_id gnl|my_center|LOCUS_12030 >Feature sequence072 545 1711 gene locus_tag LOCUS_12040 545 1711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12040 1772 2149 gene locus_tag LOCUS_12050 1772 2149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12050 2146 3690 gene locus_tag LOCUS_12060 2146 3690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12060 3581 4000 gene locus_tag LOCUS_12070 3581 4000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12070 4002 4229 gene locus_tag LOCUS_12080 4002 4229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12080 4237 4818 gene locus_tag LOCUS_12090 4237 4818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12090 4821 5726 gene locus_tag LOCUS_12100 4821 5726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12100 5723 6052 gene locus_tag LOCUS_12110 5723 6052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12110 6049 7785 gene locus_tag LOCUS_12120 6049 7785 CDS product ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876586.1 protein_id gnl|my_center|LOCUS_12120 7782 9191 gene locus_tag LOCUS_12130 7782 9191 CDS product V-type ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173333.1 protein_id gnl|my_center|LOCUS_12130 9188 9823 gene locus_tag LOCUS_12140 9188 9823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12140 >Feature sequence073 <1 661 gene locus_tag LOCUS_12150 <1 661 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003977344.1:quinone-dependent dihydroorotate dehydrogenase 757 1614 gene locus_tag LOCUS_12160 757 1614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12160 4835 2322 gene locus_tag LOCUS_12170 4835 2322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12170 7367 4851 gene locus_tag LOCUS_12180 7367 4851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12180 8197 7901 gene locus_tag LOCUS_12190 8197 7901 CDS product HigA family addiction module antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039258.1 protein_id gnl|my_center|LOCUS_12190 8487 8209 gene locus_tag LOCUS_12200 8487 8209 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389773.1 protein_id gnl|my_center|LOCUS_12200 8711 8544 gene locus_tag LOCUS_12210 8711 8544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12210 9013 9297 gene locus_tag LOCUS_12220 9013 9297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12220 9400 9753 gene locus_tag LOCUS_12230 9400 9753 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003410811.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12230 >Feature sequence074 614 168 gene locus_tag LOCUS_12240 614 168 CDS product SUF system NifU family Fe-S cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946342.1 protein_id gnl|my_center|LOCUS_12240 1870 614 gene locus_tag LOCUS_12250 1870 614 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141373.1 protein_id gnl|my_center|LOCUS_12250 3084 1867 gene locus_tag LOCUS_12260 gene sufD 3084 1867 CDS product Fe-S cluster assembly protein SufD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946340.1 protein_id gnl|my_center|LOCUS_12260 5210 3081 gene locus_tag LOCUS_12270 5210 3081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12270 5697 5224 gene locus_tag LOCUS_12280 5697 5224 CDS product SUF system Fe-S cluster assembly regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141369.1 protein_id gnl|my_center|LOCUS_12280 5796 6350 gene locus_tag LOCUS_12290 5796 6350 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977253.1 protein_id gnl|my_center|LOCUS_12290 7295 6324 gene locus_tag LOCUS_12300 7295 6324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12300 7322 8527 gene locus_tag LOCUS_12310 7322 8527 CDS product IscS subfamily cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144367.1 protein_id gnl|my_center|LOCUS_12310 8577 8921 gene locus_tag LOCUS_12320 gene iscA 8577 8921 CDS product iron-sulfur cluster assembly protein IscA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072278.1 protein_id gnl|my_center|LOCUS_12320 >Feature sequence075 837 1532 gene locus_tag LOCUS_12330 837 1532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12330 2981 1554 gene locus_tag LOCUS_12340 2981 1554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12340 3711 2971 gene locus_tag LOCUS_12350 gene asd 3711 2971 CDS product archaetidylserine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063853.1 protein_id gnl|my_center|LOCUS_12350 4321 3983 gene locus_tag LOCUS_12360 4321 3983 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942480.1 protein_id gnl|my_center|LOCUS_12360 4873 4466 gene locus_tag LOCUS_12370 4873 4466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12370 4930 6573 gene locus_tag LOCUS_12380 4930 6573 CDS product AarF/UbiB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941749.1 protein_id gnl|my_center|LOCUS_12380 6898 6575 gene locus_tag LOCUS_12390 gene crcB 6898 6575 CDS product fluoride efflux transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971646.1 protein_id gnl|my_center|LOCUS_12390 7018 8094 gene locus_tag LOCUS_12400 7018 8094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12400 8237 8488 gene locus_tag LOCUS_12410 8237 8488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12410 8485 8643 gene locus_tag LOCUS_12420 8485 8643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12420 8714 8956 gene locus_tag LOCUS_12430 8714 8956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12430 >Feature sequence076 226 1632 gene locus_tag LOCUS_12440 gene lpdA 226 1632 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903648.1 protein_id gnl|my_center|LOCUS_12440 1641 2309 gene locus_tag LOCUS_12450 gene lipB 1641 2309 CDS product lipoyl(octanoyl) transferase LipB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405264.1 protein_id gnl|my_center|LOCUS_12450 3351 2299 gene locus_tag LOCUS_12460 3351 2299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12460 3422 4573 gene locus_tag LOCUS_12470 3422 4573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12470 4615 7371 gene locus_tag LOCUS_12480 4615 7371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12480 7368 7982 gene locus_tag LOCUS_12490 7368 7982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12490 <9447 7972 gene locus_tag LOCUS_12500 <9447 7972 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003974200.1:glycerol-3-phosphate dehydrogenase/oxidase >Feature sequence077 589 1521 gene locus_tag LOCUS_12510 589 1521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12510 3932 1518 gene locus_tag LOCUS_12520 3932 1518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12520 4135 3962 gene locus_tag LOCUS_12530 4135 3962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12530 4280 5122 gene locus_tag LOCUS_12540 gene rsmA 4280 5122 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000651552.1 protein_id gnl|my_center|LOCUS_12540 5124 7022 gene locus_tag LOCUS_12550 5124 7022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12550 7662 7033 gene locus_tag LOCUS_12560 gene ppaX 7662 7033 CDS product pyrophosphatase PpaX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001222403.1 protein_id gnl|my_center|LOCUS_12560 8664 7765 gene locus_tag LOCUS_12570 8664 7765 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940694.1 protein_id gnl|my_center|LOCUS_12570 >Feature sequence078 1672 1070 gene locus_tag LOCUS_12580 1672 1070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12580 3470 1755 gene locus_tag LOCUS_12590 3470 1755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12590 4905 3658 gene locus_tag LOCUS_12600 4905 3658 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937602.1 protein_id gnl|my_center|LOCUS_12600 5839 4907 gene locus_tag LOCUS_12610 gene truB 5839 4907 CDS product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037642.1 protein_id gnl|my_center|LOCUS_12610 6836 5832 gene locus_tag LOCUS_12620 6836 5832 CDS product DHHA1 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327113.1 protein_id gnl|my_center|LOCUS_12620 7222 6833 gene locus_tag LOCUS_12630 7222 6833 CDS product ribosome-binding factor A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769039.1 protein_id gnl|my_center|LOCUS_12630 <9330 7285 gene locus_tag LOCUS_12640 <9330 7285 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942233.1:translation initiation factor IF-2 >Feature sequence079 411 758 gene locus_tag LOCUS_12650 411 758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12650 697 1854 gene locus_tag LOCUS_12660 697 1854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12660 1851 2909 gene locus_tag LOCUS_12670 gene queG 1851 2909 CDS product tRNA epoxyqueuosine(34) reductase QueG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037446.1 protein_id gnl|my_center|LOCUS_12670 3618 2881 gene locus_tag LOCUS_12680 3618 2881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12680 3565 3978 gene locus_tag LOCUS_12690 3565 3978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12690 3972 5096 gene locus_tag LOCUS_12700 3972 5096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12700 5181 7427 gene locus_tag LOCUS_12710 5181 7427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12710 >Feature sequence080 49 972 gene locus_tag LOCUS_12720 49 972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12720 977 1990 gene locus_tag LOCUS_12730 977 1990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12730 2808 2077 gene locus_tag LOCUS_12740 2808 2077 CDS product competence/damage-inducible protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006314364.1 protein_id gnl|my_center|LOCUS_12740 3940 2810 gene locus_tag LOCUS_12750 3940 2810 CDS product ATP-dependent 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393239.1 protein_id gnl|my_center|LOCUS_12750 4664 3930 gene locus_tag LOCUS_12760 gene rlmB 4664 3930 CDS product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804884.1 protein_id gnl|my_center|LOCUS_12760 5368 4661 gene locus_tag LOCUS_12770 gene pyrF 5368 4661 CDS product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_156274057.1 protein_id gnl|my_center|LOCUS_12770 6129 5398 gene locus_tag LOCUS_12780 6129 5398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12780 6335 8008 gene locus_tag LOCUS_12790 6335 8008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12790 8012 9088 gene locus_tag LOCUS_12800 8012 9088 CDS product type IV pilus twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546105.1 protein_id gnl|my_center|LOCUS_12800 >Feature sequence081 561 1247 gene locus_tag LOCUS_12810 561 1247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12810 1308 1739 gene locus_tag LOCUS_12820 1308 1739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12820 1805 2671 gene locus_tag LOCUS_12830 1805 2671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12830 4787 2658 gene locus_tag LOCUS_12840 4787 2658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12840 5261 7834 gene locus_tag LOCUS_12850 5261 7834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12850 7901 8371 gene locus_tag LOCUS_12860 7901 8371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12860 8802 8431 gene locus_tag LOCUS_12870 8802 8431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12870 >Feature sequence082 1205 414 gene locus_tag LOCUS_12880 1205 414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12880 1805 2154 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq ttccccgacaccgtgctgttgatcag 5563 4211 gene locus_tag LOCUS_12890 5563 4211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12890 5819 5577 gene locus_tag LOCUS_12900 5819 5577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12900 6833 6399 gene locus_tag LOCUS_12910 6833 6399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12910 6994 8364 gene locus_tag LOCUS_12920 6994 8364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12920 >Feature sequence083 939 1235 gene locus_tag LOCUS_12930 939 1235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12930 1163 1795 gene locus_tag LOCUS_12940 gene radC 1163 1795 CDS product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259440.1 protein_id gnl|my_center|LOCUS_12940 1953 2345 gene locus_tag LOCUS_12950 gene rnpA 1953 2345 CDS product ribonuclease P protein component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944077.1 protein_id gnl|my_center|LOCUS_12950 2586 3962 gene locus_tag LOCUS_12960 2586 3962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12960 3935 4294 gene locus_tag LOCUS_12970 3935 4294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12970 4281 4823 gene locus_tag LOCUS_12980 4281 4823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12980 5467 4859 gene locus_tag LOCUS_12990 5467 4859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12990 6303 5464 gene locus_tag LOCUS_13000 6303 5464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13000 6367 7434 gene locus_tag LOCUS_13010 6367 7434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13010 8418 8933 gene locus_tag LOCUS_13020 8418 8933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13020 >Feature sequence084 569 2476 gene locus_tag LOCUS_13030 gene dnaK 569 2476 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000516135.1 protein_id gnl|my_center|LOCUS_13030 2656 2402 gene locus_tag LOCUS_13040 2656 2402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13040 2607 5201 gene locus_tag LOCUS_13050 2607 5201 CDS product heme lyase CcmF/NrfE family subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886991.1 protein_id gnl|my_center|LOCUS_13050 5201 5566 gene locus_tag LOCUS_13060 5201 5566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13060 5566 6756 gene locus_tag LOCUS_13070 5566 6756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13070 6816 7280 gene locus_tag LOCUS_13080 6816 7280 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037865.1 protein_id gnl|my_center|LOCUS_13080 7802 7305 gene locus_tag LOCUS_13090 7802 7305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13090 7689 8609 gene locus_tag LOCUS_13100 7689 8609 CDS product TlyA family rRNA (cytidine-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942068.1 protein_id gnl|my_center|LOCUS_13100 >Feature sequence085 <1 790 gene locus_tag LOCUS_13110 <1 790 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011143858.1:mechanosensitive ion channel family protein 953 2014 gene locus_tag LOCUS_13120 gene msrB 953 2014 CDS product peptide-methionine (R)-S-oxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262910.1 protein_id gnl|my_center|LOCUS_13120 2047 2478 gene locus_tag LOCUS_13130 2047 2478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13130 2478 3578 gene locus_tag LOCUS_13140 2478 3578 CDS product TIGR04053 family radical SAM/SPASM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001046898.1 protein_id gnl|my_center|LOCUS_13140 4732 3608 gene locus_tag LOCUS_13150 4732 3608 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085913.1 protein_id gnl|my_center|LOCUS_13150 6024 4759 gene locus_tag LOCUS_13160 6024 4759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13160 6110 6823 gene locus_tag LOCUS_13170 6110 6823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13170 6997 7944 gene locus_tag LOCUS_13180 6997 7944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13180 8449 7835 gene locus_tag LOCUS_13190 8449 7835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_13190 <8964 8446 gene locus_tag LOCUS_13200 <8964 8446 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011948368.1:DEAD/DEAH box helicase note possible pseudo, frameshifted >Feature sequence086 32 1366 gene locus_tag LOCUS_13210 gene accC 32 1366 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942662.1 protein_id gnl|my_center|LOCUS_13210 1443 3614 gene locus_tag LOCUS_13220 1443 3614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13220 3790 5781 gene locus_tag LOCUS_13230 3790 5781 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112075.1 protein_id gnl|my_center|LOCUS_13230 6959 5778 gene locus_tag LOCUS_13240 6959 5778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13240 7379 8023 gene locus_tag LOCUS_13250 7379 8023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13250 8267 8340 gene locus_tag LOCUS_t00070 8267 8340 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence087 1925 1002 gene locus_tag LOCUS_13260 1925 1002 CDS product glycyl-radical enzyme activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015848914.1 protein_id gnl|my_center|LOCUS_13260 4935 1927 gene locus_tag LOCUS_13270 4935 1927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13270 5584 4946 gene locus_tag LOCUS_13280 5584 4946 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920954.1 protein_id gnl|my_center|LOCUS_13280 7198 5693 gene locus_tag LOCUS_13290 7198 5693 CDS product nitrate/nitrite transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113773.1 protein_id gnl|my_center|LOCUS_13290 8890 7202 gene locus_tag LOCUS_13300 8890 7202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13300 >Feature sequence088 384 1307 gene locus_tag LOCUS_13310 384 1307 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004568579.1 protein_id gnl|my_center|LOCUS_13310 1304 2122 gene locus_tag LOCUS_13320 1304 2122 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545091.1 protein_id gnl|my_center|LOCUS_13320 2169 4679 gene locus_tag LOCUS_13330 gene gyrB 2169 4679 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000070020.1 protein_id gnl|my_center|LOCUS_13330 6879 4732 gene locus_tag LOCUS_13340 6879 4732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13340 7739 6912 gene locus_tag LOCUS_13350 7739 6912 CDS product inositol monophosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141322.1 protein_id gnl|my_center|LOCUS_13350 8020 8427 gene locus_tag LOCUS_13360 8020 8427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13360 >Feature sequence089 1073 558 gene locus_tag LOCUS_13370 1073 558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13370 1818 1420 gene locus_tag LOCUS_13380 1818 1420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13380 2039 3190 gene locus_tag LOCUS_13390 gene argE 2039 3190 CDS product acetylornithine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114054.1 protein_id gnl|my_center|LOCUS_13390 3187 4506 gene locus_tag LOCUS_13400 gene argA 3187 4506 CDS product amino-acid N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706389.1 protein_id gnl|my_center|LOCUS_13400 4622 7009 gene locus_tag LOCUS_13410 4622 7009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13410 >Feature sequence090 336 1712 gene locus_tag LOCUS_13420 336 1712 CDS product TldD/PmbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532347.1 protein_id gnl|my_center|LOCUS_13420 2844 1786 gene locus_tag LOCUS_13430 2844 1786 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103036621.1 protein_id gnl|my_center|LOCUS_13430 3464 2844 gene locus_tag LOCUS_13440 gene coaE 3464 2844 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398928.1 protein_id gnl|my_center|LOCUS_13440 3531 3980 gene locus_tag LOCUS_13450 gene dtd 3531 3980 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080996.1 protein_id gnl|my_center|LOCUS_13450 4258 4070 gene locus_tag LOCUS_13460 4258 4070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13460 4648 4352 gene locus_tag LOCUS_13470 4648 4352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13470 4882 6237 gene locus_tag LOCUS_13480 4882 6237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13480 6379 8058 gene locus_tag LOCUS_13490 6379 8058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13490 8055 8255 gene locus_tag LOCUS_13500 8055 8255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13500 >Feature sequence091 395 2935 gene locus_tag LOCUS_13510 395 2935 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_075123474.1 protein_id gnl|my_center|LOCUS_13510 4299 2962 gene locus_tag LOCUS_13520 gene rmuC 4299 2962 CDS product DNA recombination protein RmuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460041.1 protein_id gnl|my_center|LOCUS_13520 4357 5286 gene locus_tag LOCUS_13530 4357 5286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13530 6066 5302 gene locus_tag LOCUS_13540 gene arsM 6066 5302 CDS product arsenite methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023683.1 protein_id gnl|my_center|LOCUS_13540 6165 6602 gene locus_tag LOCUS_13550 6165 6602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13550 6503 6808 gene locus_tag LOCUS_13560 6503 6808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13560 8259 6928 gene locus_tag LOCUS_13570 8259 6928 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943546.1 protein_id gnl|my_center|LOCUS_13570 >Feature sequence092 683 69 gene locus_tag LOCUS_13580 683 69 CDS product DNA-3-methyladenine glycosylase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974604.1 protein_id gnl|my_center|LOCUS_13580 920 729 gene locus_tag LOCUS_13590 920 729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13590 1345 947 gene locus_tag LOCUS_13600 1345 947 CDS product group II truncated hemoglobin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526443.1 protein_id gnl|my_center|LOCUS_13600 2291 1236 gene locus_tag LOCUS_13610 2291 1236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13610 3068 2706 gene locus_tag LOCUS_13620 3068 2706 CDS product antibiotic biosynthesis monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887091.1 protein_id gnl|my_center|LOCUS_13620 3146 4813 gene locus_tag LOCUS_13630 gene gpmI 3146 4813 CDS product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001973414.1 protein_id gnl|my_center|LOCUS_13630 5469 4804 gene locus_tag LOCUS_13640 5469 4804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13640 6464 5466 gene locus_tag LOCUS_13650 6464 5466 CDS product alpha/beta hydrolase-fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932879.1 protein_id gnl|my_center|LOCUS_13650 8282 6522 gene locus_tag LOCUS_13660 gene argS 8282 6522 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225071.1 protein_id gnl|my_center|LOCUS_13660 >Feature sequence093 <1 600 gene locus_tag LOCUS_13670 <1 600 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010972091.1:amino acid permease 622 1107 gene locus_tag LOCUS_13680 622 1107 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943199.1 protein_id gnl|my_center|LOCUS_13680 3147 1120 gene locus_tag LOCUS_13690 3147 1120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13690 3028 3315 gene locus_tag LOCUS_13700 3028 3315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13700 3539 3297 gene locus_tag LOCUS_13710 3539 3297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13710 3684 4736 gene locus_tag LOCUS_13720 gene hrcA 3684 4736 CDS product heat-inducible transcriptional repressor HrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940709.1 protein_id gnl|my_center|LOCUS_13720 4766 5377 gene locus_tag LOCUS_13730 gene grpE 4766 5377 CDS product nucleotide exchange factor GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392121.1 protein_id gnl|my_center|LOCUS_13730 5434 6696 gene locus_tag LOCUS_13740 5434 6696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13740 6578 7222 gene locus_tag LOCUS_13750 6578 7222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13750 7219 8460 gene locus_tag LOCUS_13760 7219 8460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13760 >Feature sequence094 386 6 gene locus_tag LOCUS_13770 386 6 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13770 491 3757 gene locus_tag LOCUS_13780 491 3757 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403251.1 protein_id gnl|my_center|LOCUS_13780 3844 5508 gene locus_tag LOCUS_13790 3844 5508 CDS product DUF1588 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615747.1 protein_id gnl|my_center|LOCUS_13790 5505 6860 gene locus_tag LOCUS_13800 5505 6860 CDS product DUF1552 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008664582.1 protein_id gnl|my_center|LOCUS_13800 7005 7736 gene locus_tag LOCUS_13810 7005 7736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13810 >Feature sequence095 62 1978 gene locus_tag LOCUS_13820 62 1978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13820 2010 2462 gene locus_tag LOCUS_13830 2010 2462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13830 2484 3542 gene locus_tag LOCUS_13840 2484 3542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13840 3609 5324 gene locus_tag LOCUS_13850 3609 5324 CDS product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327432.1 protein_id gnl|my_center|LOCUS_13850 5331 6509 gene locus_tag LOCUS_13860 5331 6509 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005086678.1 protein_id gnl|my_center|LOCUS_13860 6837 6433 gene locus_tag LOCUS_13870 6837 6433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13870 6891 8045 gene locus_tag LOCUS_13880 6891 8045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13880 8395 8042 gene locus_tag LOCUS_13890 8395 8042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13890 >Feature sequence096 110 1264 gene locus_tag LOCUS_13900 110 1264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13900 1299 2084 gene locus_tag LOCUS_13910 1299 2084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13910 2086 2643 gene locus_tag LOCUS_13920 2086 2643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13920 4168 2648 gene locus_tag LOCUS_13930 4168 2648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13930 5219 4299 gene locus_tag LOCUS_13940 5219 4299 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545051.1 protein_id gnl|my_center|LOCUS_13940 5276 7171 gene locus_tag LOCUS_13950 5276 7171 CDS product glycoside hydrolase family 15 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403165.1 protein_id gnl|my_center|LOCUS_13950 7173 8219 gene locus_tag LOCUS_13960 7173 8219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13960 >Feature sequence097 <1 889 gene locus_tag LOCUS_13970 <1 889 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011118209.1:poly-gamma-glutamate system protein note possible pseudo, frameshifted 844 1188 gene locus_tag LOCUS_13980 844 1188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13980 1239 1874 gene locus_tag LOCUS_13990 1239 1874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13990 3325 1877 gene locus_tag LOCUS_14000 3325 1877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14000 3389 4324 gene locus_tag LOCUS_14010 3389 4324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14010 5174 4260 gene locus_tag LOCUS_14020 5174 4260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14020 5205 5945 gene locus_tag LOCUS_14030 5205 5945 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969479.1 protein_id gnl|my_center|LOCUS_14030 7299 5935 gene locus_tag LOCUS_14040 7299 5935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14040 7487 7903 gene locus_tag LOCUS_14050 7487 7903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14050 7852 8097 gene locus_tag LOCUS_14060 7852 8097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14060 >Feature sequence098 457 1260 gene locus_tag LOCUS_14070 457 1260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14070 2248 1262 gene locus_tag LOCUS_14080 2248 1262 CDS product Rieske 2Fe-2S domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189457038.1 protein_id gnl|my_center|LOCUS_14080 2442 2251 gene locus_tag LOCUS_14090 2442 2251 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897265.1 protein_id gnl|my_center|LOCUS_14090 2558 3190 gene locus_tag LOCUS_14100 2558 3190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14100 3187 4590 gene locus_tag LOCUS_14110 3187 4590 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897264.1 protein_id gnl|my_center|LOCUS_14110 4571 5176 gene locus_tag LOCUS_14120 4571 5176 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403887.1 protein_id gnl|my_center|LOCUS_14120 5181 5990 gene locus_tag LOCUS_14130 5181 5990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14130 6023 7120 gene locus_tag LOCUS_14140 6023 7120 CDS product dihydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005064221.1 protein_id gnl|my_center|LOCUS_14140 >Feature sequence099 984 550 gene locus_tag LOCUS_14150 984 550 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262101.1 protein_id gnl|my_center|LOCUS_14150 2404 1178 gene locus_tag LOCUS_14160 gene nqrF 2404 1178 CDS product NADH:ubiquinone reductase (Na(+)-transporting) subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010951261.1 protein_id gnl|my_center|LOCUS_14160 3040 2417 gene locus_tag LOCUS_14170 gene nqrE 3040 2417 CDS product NADH:ubiquinone reductase (Na(+)-transporting) subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091182.1 protein_id gnl|my_center|LOCUS_14170 3687 3040 gene locus_tag LOCUS_14180 3687 3040 CDS product NADH:ubiquinone reductase (Na(+)-transporting) subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328967.1 protein_id gnl|my_center|LOCUS_14180 4484 3684 gene locus_tag LOCUS_14190 4484 3684 CDS product Na(+)-translocating NADH-quinone reductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456526.1 protein_id gnl|my_center|LOCUS_14190 5691 4477 gene locus_tag LOCUS_14200 5691 4477 CDS product NADH:ubiquinone reductase (Na(+)-transporting) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003109478.1 protein_id gnl|my_center|LOCUS_14200 7016 5691 gene locus_tag LOCUS_14210 7016 5691 CDS product Na(+)-translocating NADH-quinone reductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113983.1 protein_id gnl|my_center|LOCUS_14210 7176 7736 gene locus_tag LOCUS_14220 7176 7736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14220 >Feature sequence100 639 7 gene locus_tag LOCUS_14230 639 7 CDS product DJ-1/PfpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031152.1 protein_id gnl|my_center|LOCUS_14230 2410 677 gene locus_tag LOCUS_14240 2410 677 CDS product NAD-dependent malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172599.1 protein_id gnl|my_center|LOCUS_14240 3500 2424 gene locus_tag LOCUS_14250 gene leuB 3500 2424 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328413.1 protein_id gnl|my_center|LOCUS_14250 5185 3557 gene locus_tag LOCUS_14260 gene cimA 5185 3557 CDS product citramalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393734.1 protein_id gnl|my_center|LOCUS_14260 5768 5166 gene locus_tag LOCUS_14270 gene leuD 5768 5166 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256079.1 protein_id gnl|my_center|LOCUS_14270 7174 5765 gene locus_tag LOCUS_14280 gene leuC 7174 5765 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256078.1 protein_id gnl|my_center|LOCUS_14280 7494 7183 gene locus_tag LOCUS_14290 7494 7183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14290 <8036 7449 gene locus_tag LOCUS_14300 <8036 7449 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000116258.1:2-isopropylmalate synthase >Feature sequence101 41 1564 gene locus_tag LOCUS_14310 41 1564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14310 2048 1635 gene locus_tag LOCUS_14320 2048 1635 CDS product cobalamin B12-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942223.1 protein_id gnl|my_center|LOCUS_14320 2134 3066 gene locus_tag LOCUS_14330 2134 3066 CDS product kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920748.1 protein_id gnl|my_center|LOCUS_14330 3731 3063 gene locus_tag LOCUS_14340 3731 3063 CDS product transglutaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098789.1 protein_id gnl|my_center|LOCUS_14340 4846 3788 gene locus_tag LOCUS_14350 gene arsS 4846 3788 CDS product arsenosugar biosynthesis radical SAM protein ArsS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257184.1 protein_id gnl|my_center|LOCUS_14350 6160 4940 gene locus_tag LOCUS_14360 6160 4940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14360 7904 6141 gene locus_tag LOCUS_14370 7904 6141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14370 >Feature sequence102 1819 1355 gene locus_tag LOCUS_14380 gene hslV 1819 1355 CDS product ATP-dependent protease subunit HslV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003521197.1 protein_id gnl|my_center|LOCUS_14380 2895 1948 gene locus_tag LOCUS_14390 gene xerC 2895 1948 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941160.1 protein_id gnl|my_center|LOCUS_14390 4207 2831 gene locus_tag LOCUS_14400 gene trmFO 4207 2831 CDS product methylenetetrahydrofolate--tRNA-(uracil(54)-C(5))-methyltransferase (FADH(2)-oxidizing) TrmFO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943183.1 protein_id gnl|my_center|LOCUS_14400 6595 4217 gene locus_tag LOCUS_14410 gene topA 6595 4217 CDS product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_203473432.1 protein_id gnl|my_center|LOCUS_14410 7270 7626 gene locus_tag LOCUS_14420 7270 7626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14420 >Feature sequence103 448 254 gene locus_tag LOCUS_14430 448 254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14430 1584 364 gene locus_tag LOCUS_14440 1584 364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14440 1913 1611 gene locus_tag LOCUS_14450 1913 1611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14450 3829 1811 gene locus_tag LOCUS_14460 3829 1811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14460 5955 3919 gene locus_tag LOCUS_14470 gene uvrB 5955 3919 CDS product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943874.1 protein_id gnl|my_center|LOCUS_14470 6010 6726 gene locus_tag LOCUS_14480 6010 6726 CDS product glutathione S-transferase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206620.1 protein_id gnl|my_center|LOCUS_14480 7842 6754 gene locus_tag LOCUS_14490 gene serC 7842 6754 CDS product 3-phosphoserine/phosphohydroxythreonine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233234.1 protein_id gnl|my_center|LOCUS_14490 7989 7915 gene locus_tag LOCUS_t00080 7989 7915 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence104 715 5 gene locus_tag LOCUS_14500 715 5 CDS product N-formylglutamate amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529202.1 protein_id gnl|my_center|LOCUS_14500 790 1245 gene locus_tag LOCUS_14510 790 1245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14510 2965 1253 gene locus_tag LOCUS_14520 2965 1253 CDS product methylmalonyl-CoA mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879704.1 protein_id gnl|my_center|LOCUS_14520 3496 2978 gene locus_tag LOCUS_14530 3496 2978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14530 3824 3507 gene locus_tag LOCUS_14540 3824 3507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14540 5204 3837 gene locus_tag LOCUS_14550 5204 3837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14550 5369 5950 gene locus_tag LOCUS_14560 5369 5950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14560 5954 6898 gene locus_tag LOCUS_14570 5954 6898 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940759.1 protein_id gnl|my_center|LOCUS_14570 7599 6895 gene locus_tag LOCUS_14580 7599 6895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14580 7876 7613 gene locus_tag LOCUS_14590 7876 7613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14590 >Feature sequence105 2475 391 gene locus_tag LOCUS_14600 gene cerN 2475 391 CDS product ceramidase CerN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114226.1 protein_id gnl|my_center|LOCUS_14600 2564 2839 gene locus_tag LOCUS_14610 2564 2839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14610 2842 3363 gene locus_tag LOCUS_14620 2842 3363 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004533965.1 protein_id gnl|my_center|LOCUS_14620 3762 3379 gene locus_tag LOCUS_14630 3762 3379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14630 4423 3806 gene locus_tag LOCUS_14640 4423 3806 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003118644.1 protein_id gnl|my_center|LOCUS_14640 5502 4447 gene locus_tag LOCUS_14650 5502 4447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14650 5525 6673 gene locus_tag LOCUS_14660 5525 6673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14660 >Feature sequence106 226 1407 gene locus_tag LOCUS_14670 226 1407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14670 2831 1404 gene locus_tag LOCUS_14680 gene atoC 2831 1404 CDS product acetoacetate metabolism transcriptional regulator AtoC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000125283.1 protein_id gnl|my_center|LOCUS_14680 3152 2880 gene locus_tag LOCUS_14690 3152 2880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14690 3490 3996 gene locus_tag LOCUS_14700 3490 3996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14700 4111 3944 gene locus_tag LOCUS_14710 4111 3944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14710 4282 4728 gene locus_tag LOCUS_14720 4282 4728 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705622.1 protein_id gnl|my_center|LOCUS_14720 4759 5655 gene locus_tag LOCUS_14730 4759 5655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14730 7199 5664 gene locus_tag LOCUS_14740 7199 5664 CDS product bifunctional aminoglycoside phosphotransferase/ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546491.1 protein_id gnl|my_center|LOCUS_14740 >Feature sequence107 2161 1274 gene locus_tag LOCUS_14750 2161 1274 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099262600.1 protein_id gnl|my_center|LOCUS_14750 2807 2199 gene locus_tag LOCUS_14760 2807 2199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14760 2860 4389 gene locus_tag LOCUS_14770 2860 4389 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257549.1 protein_id gnl|my_center|LOCUS_14770 4759 4370 gene locus_tag LOCUS_14780 4759 4370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14780 6464 4788 gene locus_tag LOCUS_14790 6464 4788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14790 7289 6495 gene locus_tag LOCUS_14800 7289 6495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14800 <7859 7286 gene locus_tag LOCUS_14810 <7859 7286 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005813193.1:signal recognition particle protein >Feature sequence108 163 1428 gene locus_tag LOCUS_14820 163 1428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14820 1438 2301 gene locus_tag LOCUS_14830 1438 2301 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730403.1 protein_id gnl|my_center|LOCUS_14830 3040 2312 gene locus_tag LOCUS_14840 3040 2312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14840 3227 4294 gene locus_tag LOCUS_14850 3227 4294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14850 4182 4466 gene locus_tag LOCUS_14860 4182 4466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14860 4538 6244 gene locus_tag LOCUS_14870 4538 6244 CDS product homoserine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922133.1 protein_id gnl|my_center|LOCUS_14870 7290 6241 gene locus_tag LOCUS_14880 7290 6241 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728259.1 protein_id gnl|my_center|LOCUS_14880 >Feature sequence109 1258 2448 gene locus_tag LOCUS_14890 1258 2448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14890 2461 3087 gene locus_tag LOCUS_14900 2461 3087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14900 3461 4474 gene locus_tag LOCUS_14910 3461 4474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14910 5063 4500 gene locus_tag LOCUS_14920 5063 4500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14920 >Feature sequence110 1062 403 gene locus_tag LOCUS_14930 1062 403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14930 1590 1177 gene locus_tag LOCUS_14940 1590 1177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14940 1799 1503 gene locus_tag LOCUS_14950 1799 1503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14950 2478 2209 gene locus_tag LOCUS_14960 2478 2209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14960 2374 3405 gene locus_tag LOCUS_14970 2374 3405 CDS product sulfotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005094688.1 protein_id gnl|my_center|LOCUS_14970 5084 3441 gene locus_tag LOCUS_14980 5084 3441 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203365.1 protein_id gnl|my_center|LOCUS_14980 6100 5270 gene locus_tag LOCUS_14990 6100 5270 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103932.1 protein_id gnl|my_center|LOCUS_14990 >Feature sequence111 533 102 gene locus_tag LOCUS_15000 533 102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15000 598 1149 gene locus_tag LOCUS_15010 598 1149 CDS product ArsR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496869.1 protein_id gnl|my_center|LOCUS_15010 1191 1331 gene locus_tag LOCUS_15020 1191 1331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15020 1328 1915 gene locus_tag LOCUS_15030 1328 1915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15030 2130 2381 gene locus_tag LOCUS_15040 2130 2381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15040 3412 2378 gene locus_tag LOCUS_15050 3412 2378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15050 3575 3925 gene locus_tag LOCUS_15060 3575 3925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15060 4907 3939 gene locus_tag LOCUS_15070 4907 3939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15070 5533 5135 gene locus_tag LOCUS_15080 5533 5135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15080 5956 5708 gene locus_tag LOCUS_15090 5956 5708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15090 >Feature sequence112 1026 34 gene locus_tag LOCUS_15100 1026 34 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275143.1 protein_id gnl|my_center|LOCUS_15100 1577 1023 gene locus_tag LOCUS_15110 1577 1023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15110 2533 1580 gene locus_tag LOCUS_15120 2533 1580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15120 3420 2530 gene locus_tag LOCUS_15130 3420 2530 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071875.1 protein_id gnl|my_center|LOCUS_15130 4444 3428 gene locus_tag LOCUS_15140 4444 3428 CDS product 3-oxoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035468.1 protein_id gnl|my_center|LOCUS_15140 4730 4515 gene locus_tag LOCUS_15150 4730 4515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15150 4904 5203 gene locus_tag LOCUS_15160 4904 5203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15160 5752 6384 gene locus_tag LOCUS_15170 5752 6384 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249655.1 protein_id gnl|my_center|LOCUS_15170 7007 6522 gene locus_tag LOCUS_15180 7007 6522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15180 7186 6986 gene locus_tag LOCUS_15190 7186 6986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15190 >Feature sequence113 262 1179 gene locus_tag LOCUS_15200 262 1179 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902223.1 protein_id gnl|my_center|LOCUS_15200 2004 1180 gene locus_tag LOCUS_15210 2004 1180 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902034.1 protein_id gnl|my_center|LOCUS_15210 2516 2001 gene locus_tag LOCUS_15220 2516 2001 CDS product Rab family GTPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257121.1 protein_id gnl|my_center|LOCUS_15220 2596 3861 gene locus_tag LOCUS_15230 2596 3861 CDS product delta(24(24(1)))-sterol reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958072.1 protein_id gnl|my_center|LOCUS_15230 3885 4763 gene locus_tag LOCUS_15240 gene fdhD 3885 4763 CDS product formate dehydrogenase accessory sulfurtransferase FdhD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003891497.1 protein_id gnl|my_center|LOCUS_15240 4763 6988 gene locus_tag LOCUS_15250 4763 6988 CDS product FdhF/YdeP family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028088.1 protein_id gnl|my_center|LOCUS_15250 <7718 6985 gene locus_tag LOCUS_15260 <7718 6985 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013225339.1:FAD-dependent oxidoreductase >Feature sequence114 329 1108 gene locus_tag LOCUS_15270 329 1108 CDS product succinate dehydrogenase/fumarate reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726931.1 protein_id gnl|my_center|LOCUS_15270 1105 1608 gene locus_tag LOCUS_15280 1105 1608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15280 1636 2055 gene locus_tag LOCUS_15290 1636 2055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15290 5139 2065 gene locus_tag LOCUS_15300 5139 2065 CDS product error-prone DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267744.1 protein_id gnl|my_center|LOCUS_15300 6687 5140 gene locus_tag LOCUS_15310 6687 5140 CDS product DNA polymerase Y family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537423.1 protein_id gnl|my_center|LOCUS_15310 7277 6645 gene locus_tag LOCUS_15320 7277 6645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15320 >Feature sequence115 482 75 gene locus_tag LOCUS_15330 482 75 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15330 577 1482 gene locus_tag LOCUS_15340 577 1482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15340 1545 2465 gene locus_tag LOCUS_15350 1545 2465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15350 2857 2531 gene locus_tag LOCUS_15360 2857 2531 CDS product divalent-cation tolerance protein CutA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206819377.1 protein_id gnl|my_center|LOCUS_15360 3641 2871 gene locus_tag LOCUS_15370 3641 2871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15370 3881 4774 gene locus_tag LOCUS_15380 gene xerD 3881 4774 CDS product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942464.1 protein_id gnl|my_center|LOCUS_15380 4855 5517 gene locus_tag LOCUS_15390 4855 5517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15390 5523 6044 gene locus_tag LOCUS_15400 5523 6044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15400 6531 7241 gene locus_tag LOCUS_15410 6531 7241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15410 >Feature sequence116 <1 509 gene locus_tag LOCUS_15420 <1 509 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012258845.1:VOC family protein 626 883 gene locus_tag LOCUS_15430 626 883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15430 880 1692 gene locus_tag LOCUS_15440 880 1692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15440 1791 2786 gene locus_tag LOCUS_15450 1791 2786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15450 3582 3022 gene locus_tag LOCUS_15460 3582 3022 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966328.1 protein_id gnl|my_center|LOCUS_15460 3686 4354 gene locus_tag LOCUS_15470 3686 4354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15470 4414 5364 gene locus_tag LOCUS_15480 4414 5364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15480 5366 6043 gene locus_tag LOCUS_15490 5366 6043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15490 5934 6254 gene locus_tag LOCUS_15500 5934 6254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15500 7466 6432 gene locus_tag LOCUS_15510 7466 6432 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899194.1 protein_id gnl|my_center|LOCUS_15510 >Feature sequence117 1993 848 gene locus_tag LOCUS_15520 1993 848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15520 2630 1878 gene locus_tag LOCUS_15530 2630 1878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15530 2762 3430 gene locus_tag LOCUS_15540 2762 3430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15540 3438 4286 gene locus_tag LOCUS_15550 gene nadC 3438 4286 CDS product carboxylating nicotinate-nucleotide diphosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942581.1 protein_id gnl|my_center|LOCUS_15550 4290 5072 gene locus_tag LOCUS_15560 4290 5072 CDS product biotin--[acetyl-CoA-carboxylase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403305.1 protein_id gnl|my_center|LOCUS_15560 5117 6043 gene locus_tag LOCUS_15570 5117 6043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15570 6111 6434 gene locus_tag LOCUS_15580 gene erpA 6111 6434 CDS product iron-sulfur cluster insertion protein ErpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035737.1 protein_id gnl|my_center|LOCUS_15580 6528 7388 gene locus_tag LOCUS_15590 gene rpoH 6528 7388 CDS product RNA polymerase sigma factor RpoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006314928.1 protein_id gnl|my_center|LOCUS_15590 >Feature sequence118 1 732 gene locus_tag LOCUS_15600 1 732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15600 2648 852 gene locus_tag LOCUS_15610 gene lepA 2648 852 CDS product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938004.1 protein_id gnl|my_center|LOCUS_15610 2891 2697 gene locus_tag LOCUS_15620 2891 2697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15620 3134 3718 gene locus_tag LOCUS_15630 3134 3718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15630 3715 4392 gene locus_tag LOCUS_15640 3715 4392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15640 4455 5210 gene locus_tag LOCUS_15650 4455 5210 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942052.1 protein_id gnl|my_center|LOCUS_15650 7560 5167 gene locus_tag LOCUS_15660 7560 5167 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705254.1 protein_id gnl|my_center|LOCUS_15660 >Feature sequence119 170 1177 gene locus_tag LOCUS_15670 170 1177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15670 1812 1282 gene locus_tag LOCUS_15680 gene apt 1812 1282 CDS product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000206218.1 protein_id gnl|my_center|LOCUS_15680 2573 1809 gene locus_tag LOCUS_15690 gene surE 2573 1809 CDS product 5'/3'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889023.1 protein_id gnl|my_center|LOCUS_15690 3240 2785 gene locus_tag LOCUS_15700 3240 2785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15700 3417 3250 gene locus_tag LOCUS_15710 3417 3250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15710 5115 3553 gene locus_tag LOCUS_15720 5115 3553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15720 5909 5061 gene locus_tag LOCUS_15730 5909 5061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15730 6343 5918 gene locus_tag LOCUS_15740 6343 5918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15740 6965 6246 gene locus_tag LOCUS_15750 6965 6246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15750 7327 6983 gene locus_tag LOCUS_15760 gene rplT 7327 6983 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004727974.1 protein_id gnl|my_center|LOCUS_15760 >Feature sequence120 281 1741 gene locus_tag LOCUS_15770 gene nrfD 281 1741 CDS product polysulfide reductase NrfD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404833.1 protein_id gnl|my_center|LOCUS_15770 1750 2328 gene locus_tag LOCUS_15780 1750 2328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15780 2328 2948 gene locus_tag LOCUS_15790 2328 2948 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205421545.1 protein_id gnl|my_center|LOCUS_15790 2945 4324 gene locus_tag LOCUS_15800 2945 4324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15800 4335 4976 gene locus_tag LOCUS_15810 4335 4976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15810 4979 5635 gene locus_tag LOCUS_15820 4979 5635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15820 5781 6521 gene locus_tag LOCUS_15830 5781 6521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15830 >Feature sequence121 5660 3516 gene locus_tag LOCUS_15840 5660 3516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15840 5752 7149 gene locus_tag LOCUS_15850 gene miaB 5752 7149 CDS product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024503457.1 protein_id gnl|my_center|LOCUS_15850 >Feature sequence122 123 1547 gene locus_tag LOCUS_15860 123 1547 CDS product Glu/Leu/Phe/Val dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118827171.1 protein_id gnl|my_center|LOCUS_15860 2462 1560 gene locus_tag LOCUS_15870 2462 1560 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206170.1 protein_id gnl|my_center|LOCUS_15870 2581 3591 gene locus_tag LOCUS_15880 2581 3591 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114843.1 protein_id gnl|my_center|LOCUS_15880 5146 3614 gene locus_tag LOCUS_15890 5146 3614 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867265.1 protein_id gnl|my_center|LOCUS_15890 5324 5938 gene locus_tag LOCUS_15900 5324 5938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15900 5984 6802 gene locus_tag LOCUS_15910 5984 6802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15910 <7376 6806 gene locus_tag LOCUS_15920 <7376 6806 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000426795.1:DUF3604 domain-containing protein >Feature sequence123 384 905 gene locus_tag LOCUS_15930 384 905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15930 902 1180 gene locus_tag LOCUS_15940 902 1180 CDS product HPr family phosphocarrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946224.1 protein_id gnl|my_center|LOCUS_15940 1177 2877 gene locus_tag LOCUS_15950 gene ptsP 1177 2877 CDS product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942526.1 protein_id gnl|my_center|LOCUS_15950 3419 2874 gene locus_tag LOCUS_15960 3419 2874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15960 3754 3416 gene locus_tag LOCUS_15970 3754 3416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15970 3644 4306 gene locus_tag LOCUS_15980 3644 4306 CDS product TIGR02757 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941192.1 protein_id gnl|my_center|LOCUS_15980 6882 4321 gene locus_tag LOCUS_15990 gene plsB 6882 4321 CDS product glycerol-3-phosphate 1-O-acyltransferase PlsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001909395.1 protein_id gnl|my_center|LOCUS_15990 >Feature sequence124 886 599 gene locus_tag LOCUS_16000 gene groES 886 599 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975851.1 protein_id gnl|my_center|LOCUS_16000 1071 1316 gene locus_tag LOCUS_16010 1071 1316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16010 1382 2197 gene locus_tag LOCUS_16020 1382 2197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16020 2197 2985 gene locus_tag LOCUS_16030 2197 2985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16030 3035 3991 gene locus_tag LOCUS_16040 3035 3991 CDS product acetyl-CoA carboxylase carboxyltransferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036549.1 protein_id gnl|my_center|LOCUS_16040 4038 4841 gene locus_tag LOCUS_16050 4038 4841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16050 4838 5908 gene locus_tag LOCUS_16060 4838 5908 CDS product LysM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041914065.1 protein_id gnl|my_center|LOCUS_16060 5966 6328 gene locus_tag LOCUS_16070 5966 6328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16070 >Feature sequence125 2911 350 gene locus_tag LOCUS_16080 2911 350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16080 5416 3005 gene locus_tag LOCUS_16090 5416 3005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16090 5424 6005 gene locus_tag LOCUS_16100 5424 6005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16100 >Feature sequence126 678 1871 gene locus_tag LOCUS_16110 678 1871 CDS product EstA family serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208246.1 protein_id gnl|my_center|LOCUS_16110 1903 2526 gene locus_tag LOCUS_16120 1903 2526 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223605.1 protein_id gnl|my_center|LOCUS_16120 2557 4146 gene locus_tag LOCUS_16130 2557 4146 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899716.1 protein_id gnl|my_center|LOCUS_16130 4168 5388 gene locus_tag LOCUS_16140 4168 5388 CDS product DUF445 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230416.1 protein_id gnl|my_center|LOCUS_16140 5408 5719 gene locus_tag LOCUS_16150 5408 5719 CDS product YfhL family 4Fe-4S dicluster ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084462.1 protein_id gnl|my_center|LOCUS_16150 5755 6987 gene locus_tag LOCUS_16160 5755 6987 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005125735.1 protein_id gnl|my_center|LOCUS_16160 >Feature sequence127 3523 872 gene locus_tag LOCUS_16170 3523 872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16170 4496 3597 gene locus_tag LOCUS_16180 4496 3597 CDS product Fpg/Nei family DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730610.1 protein_id gnl|my_center|LOCUS_16180 5317 4499 gene locus_tag LOCUS_16190 5317 4499 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939732.1 protein_id gnl|my_center|LOCUS_16190 6258 5314 gene locus_tag LOCUS_16200 6258 5314 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228608.1 protein_id gnl|my_center|LOCUS_16200 6747 6313 gene locus_tag LOCUS_16210 6747 6313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16210 >Feature sequence128 961 143 gene locus_tag LOCUS_16220 961 143 CDS product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016351298.1 protein_id gnl|my_center|LOCUS_16220 2095 1187 gene locus_tag LOCUS_16230 2095 1187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16230 2342 3244 gene locus_tag LOCUS_16240 2342 3244 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099262600.1 protein_id gnl|my_center|LOCUS_16240 3460 5904 gene locus_tag LOCUS_16250 gene lon 3460 5904 CDS product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583909.1 protein_id gnl|my_center|LOCUS_16250 5978 6988 gene locus_tag LOCUS_16260 5978 6988 CDS product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940684.1 protein_id gnl|my_center|LOCUS_16260 >Feature sequence129 2802 1486 gene locus_tag LOCUS_16270 gene tolB 2802 1486 CDS product Tol-Pal system beta propeller repeat protein TolB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940703.1 protein_id gnl|my_center|LOCUS_16270 3629 2811 gene locus_tag LOCUS_16280 3629 2811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16280 4058 3633 gene locus_tag LOCUS_16290 gene tolR 4058 3633 CDS product protein TolR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940705.1 protein_id gnl|my_center|LOCUS_16290 4781 4062 gene locus_tag LOCUS_16300 gene tolQ 4781 4062 CDS product protein TolQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940706.1 protein_id gnl|my_center|LOCUS_16300 5318 4818 gene locus_tag LOCUS_16310 gene pal 5318 4818 CDS product peptidoglycan-associated lipoprotein Pal inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003111417.1 protein_id gnl|my_center|LOCUS_16310 5828 5553 gene locus_tag LOCUS_16320 5828 5553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16320 5751 6215 gene locus_tag LOCUS_16330 5751 6215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16330 <7059 6217 gene locus_tag LOCUS_16340 <7059 6217 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005135561.1:TauD/TfdA family dioxygenase >Feature sequence130 3240 136 gene locus_tag LOCUS_16350 3240 136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16350 4157 3219 gene locus_tag LOCUS_16360 4157 3219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16360 4975 4154 gene locus_tag LOCUS_16370 4975 4154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16370 5798 5250 gene locus_tag LOCUS_16380 5798 5250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16380 >Feature sequence131 728 3385 gene locus_tag LOCUS_16390 728 3385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16390 3382 4677 gene locus_tag LOCUS_16400 3382 4677 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020733.1 protein_id gnl|my_center|LOCUS_16400 4674 6041 gene locus_tag LOCUS_16410 4674 6041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16410 >Feature sequence132 1567 86 gene locus_tag LOCUS_16420 gene trpE 1567 86 CDS product anthranilate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943019.1 protein_id gnl|my_center|LOCUS_16420 1638 2891 gene locus_tag LOCUS_16430 1638 2891 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230479.1 protein_id gnl|my_center|LOCUS_16430 3003 4235 gene locus_tag LOCUS_16440 gene coaBC 3003 4235 CDS product bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460556.1 protein_id gnl|my_center|LOCUS_16440 4248 4799 gene locus_tag LOCUS_16450 4248 4799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16450 5399 4800 gene locus_tag LOCUS_16460 5399 4800 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942241.1 protein_id gnl|my_center|LOCUS_16460 5494 5994 gene locus_tag LOCUS_16470 5494 5994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16470 6434 6030 gene locus_tag LOCUS_16480 gene apaG 6434 6030 CDS product Co2+/Mg2+ efflux protein ApaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085085.1 protein_id gnl|my_center|LOCUS_16480 <7009 6431 gene locus_tag LOCUS_16490 <7009 6431 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011969898.1:DNA-3-methyladenine glycosylase >Feature sequence133 3799 1919 gene locus_tag LOCUS_16500 3799 1919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16500 4823 3825 gene locus_tag LOCUS_16510 gene nirJ2 4823 3825 CDS product putative heme d1 biosynthesis radical SAM protein NirJ2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460177.1 protein_id gnl|my_center|LOCUS_16510 5629 4883 gene locus_tag LOCUS_16520 5629 4883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16520 5665 6978 gene locus_tag LOCUS_16530 5665 6978 CDS product inositol-3-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762240.1 protein_id gnl|my_center|LOCUS_16530 >Feature sequence134 573 818 gene locus_tag LOCUS_16540 573 818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16540 802 1452 gene locus_tag LOCUS_16550 802 1452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16550 1442 2332 gene locus_tag LOCUS_16560 1442 2332 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680301.1 protein_id gnl|my_center|LOCUS_16560 2313 2768 gene locus_tag LOCUS_16570 2313 2768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16570 2765 3478 gene locus_tag LOCUS_16580 2765 3478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16580 3505 4152 gene locus_tag LOCUS_16590 3505 4152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16590 4224 5738 gene locus_tag LOCUS_16600 4224 5738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16600 5917 6342 gene locus_tag LOCUS_16610 5917 6342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16610 >Feature sequence135 2651 789 gene locus_tag LOCUS_16620 gene mrdA 2651 789 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942721.1 protein_id gnl|my_center|LOCUS_16620 3163 2648 gene locus_tag LOCUS_16630 3163 2648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16630 4021 3173 gene locus_tag LOCUS_16640 gene mreC 4021 3173 CDS product rod shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392075.1 protein_id gnl|my_center|LOCUS_16640 4928 4044 gene locus_tag LOCUS_16650 4928 4044 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942731.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16650 5106 4849 gene locus_tag LOCUS_16660 5106 4849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16660 5232 5933 gene locus_tag LOCUS_16670 5232 5933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16670 >Feature sequence136 361 1263 gene locus_tag LOCUS_16680 361 1263 CDS product YihY/virulence factor BrkB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929456.1 protein_id gnl|my_center|LOCUS_16680 2273 1230 gene locus_tag LOCUS_16690 2273 1230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16690 3843 2302 gene locus_tag LOCUS_16700 3843 2302 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230761.1 protein_id gnl|my_center|LOCUS_16700 4277 6661 gene locus_tag LOCUS_16710 4277 6661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16710 >Feature sequence137 67 636 gene locus_tag LOCUS_16720 67 636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16720 729 520 gene locus_tag LOCUS_16730 729 520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16730 2124 1252 gene locus_tag LOCUS_16740 2124 1252 CDS product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388043.1 protein_id gnl|my_center|LOCUS_16740 4065 2239 gene locus_tag LOCUS_16750 gene cysN 4065 2239 CDS product sulfate adenylyltransferase subunit CysN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003110029.1 protein_id gnl|my_center|LOCUS_16750 5010 4096 gene locus_tag LOCUS_16760 gene cysD 5010 4096 CDS product sulfate adenylyltransferase subunit CysD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000140408.1 protein_id gnl|my_center|LOCUS_16760 5136 5681 gene locus_tag LOCUS_16770 gene orn 5136 5681 CDS product oligoribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813303.1 protein_id gnl|my_center|LOCUS_16770 5678 6574 gene locus_tag LOCUS_16780 5678 6574 CDS product ChaN family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012164238.1 protein_id gnl|my_center|LOCUS_16780 >Feature sequence138 1461 889 gene locus_tag LOCUS_16790 1461 889 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582951.1 protein_id gnl|my_center|LOCUS_16790 4060 1583 gene locus_tag LOCUS_16800 4060 1583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16800 4154 4534 gene locus_tag LOCUS_16810 4154 4534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16810 4813 6042 gene locus_tag LOCUS_16820 4813 6042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16820 >Feature sequence139 41 892 gene locus_tag LOCUS_16830 41 892 CDS product electron transfer flavoprotein subunit beta/FixA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084195.1 protein_id gnl|my_center|LOCUS_16830 923 1885 gene locus_tag LOCUS_16840 923 1885 CDS product FAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084196.1 protein_id gnl|my_center|LOCUS_16840 2066 2497 gene locus_tag LOCUS_16850 2066 2497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16850 2664 4256 gene locus_tag LOCUS_16860 2664 4256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16860 5602 4253 gene locus_tag LOCUS_16870 5602 4253 CDS product leucyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941000.1 protein_id gnl|my_center|LOCUS_16870 5808 6023 gene locus_tag LOCUS_16880 5808 6023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16880 6023 6331 gene locus_tag LOCUS_16890 6023 6331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16890 >Feature sequence140 83 2 gene locus_tag LOCUS_t00090 83 2 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 509 102 gene locus_tag LOCUS_16900 509 102 CDS product aspartate 1-decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887363.1 protein_id gnl|my_center|LOCUS_16900 971 633 gene locus_tag LOCUS_16910 971 633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16910 1228 1662 gene locus_tag LOCUS_16920 1228 1662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16920 2649 1666 gene locus_tag LOCUS_16930 2649 1666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16930 2745 3416 gene locus_tag LOCUS_16940 2745 3416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16940 4759 3413 gene locus_tag LOCUS_16950 4759 3413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16950 5874 4729 gene locus_tag LOCUS_16960 5874 4729 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227831.1 protein_id gnl|my_center|LOCUS_16960 6527 5946 gene locus_tag LOCUS_16970 6527 5946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16970 >Feature sequence141 305 964 gene locus_tag LOCUS_16980 305 964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16980 1081 2559 gene locus_tag LOCUS_16990 1081 2559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16990 2569 3153 gene locus_tag LOCUS_17000 2569 3153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17000 3359 3652 gene locus_tag LOCUS_17010 3359 3652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17010 5354 3630 gene locus_tag LOCUS_17020 5354 3630 CDS product phospho-sugar mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482641.1 protein_id gnl|my_center|LOCUS_17020 6709 5351 gene locus_tag LOCUS_17030 6709 5351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17030 >Feature sequence142 1102 38 gene locus_tag LOCUS_17040 1102 38 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17040 2337 1099 gene locus_tag LOCUS_17050 2337 1099 CDS product acetylornithine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003408163.1 protein_id gnl|my_center|LOCUS_17050 3913 2501 gene locus_tag LOCUS_17060 3913 2501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17060 5273 4071 gene locus_tag LOCUS_17070 5273 4071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17070 5758 5273 gene locus_tag LOCUS_17080 5758 5273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17080 >Feature sequence143 2145 3332 gene locus_tag LOCUS_17090 2145 3332 CDS product PLP-dependent aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257342.1 protein_id gnl|my_center|LOCUS_17090 3502 3813 gene locus_tag LOCUS_17100 3502 3813 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942391.1 protein_id gnl|my_center|LOCUS_17100 3823 5046 gene locus_tag LOCUS_17110 gene tyrS 3823 5046 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941800.1 protein_id gnl|my_center|LOCUS_17110 5180 5782 gene locus_tag LOCUS_17120 5180 5782 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085691.1 protein_id gnl|my_center|LOCUS_17120 >Feature sequence144 707 306 gene locus_tag LOCUS_17130 707 306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17130 1722 700 gene locus_tag LOCUS_17140 1722 700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17140 2180 1692 gene locus_tag LOCUS_17150 2180 1692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17150 2668 2186 gene locus_tag LOCUS_17160 2668 2186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17160 2864 3799 gene locus_tag LOCUS_17170 2864 3799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17170 3839 4648 gene locus_tag LOCUS_17180 3839 4648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17180 5171 4665 gene locus_tag LOCUS_17190 5171 4665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17190 6020 5253 gene locus_tag LOCUS_17200 6020 5253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17200 >Feature sequence145 452 1174 gene locus_tag LOCUS_17210 452 1174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17210 1060 1635 gene locus_tag LOCUS_17220 1060 1635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17220 2303 1632 gene locus_tag LOCUS_17230 gene moaD 2303 1632 CDS product molybdopterin converting factor subunit 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417290.1 protein_id gnl|my_center|LOCUS_17230 2373 3203 gene locus_tag LOCUS_17240 2373 3203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17240 3223 4002 gene locus_tag LOCUS_17250 gene pssA 3223 4002 CDS product CDP-diacylglycerol--serine O-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_072696843.1 protein_id gnl|my_center|LOCUS_17250 5636 3999 gene locus_tag LOCUS_17260 5636 3999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17260 6567 5629 gene locus_tag LOCUS_17270 6567 5629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17270 >Feature sequence146 1683 268 gene locus_tag LOCUS_17280 1683 268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112117.1 protein_id gnl|my_center|LOCUS_17280 3410 1680 gene locus_tag LOCUS_17290 3410 1680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17290 3579 4157 gene locus_tag LOCUS_17300 3579 4157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17300 5320 4154 gene locus_tag LOCUS_17310 gene moeB 5320 4154 CDS product molybdopterin-synthase adenylyltransferase MoeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970838.1 protein_id gnl|my_center|LOCUS_17310 5964 5431 gene locus_tag LOCUS_17320 5964 5431 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858163.1 protein_id gnl|my_center|LOCUS_17320 >Feature sequence147 477 1499 gene locus_tag LOCUS_17330 477 1499 CDS product sodium:calcium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615893.1 protein_id gnl|my_center|LOCUS_17330 3133 1496 gene locus_tag LOCUS_17340 3133 1496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17340 4157 3099 gene locus_tag LOCUS_17350 4157 3099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17350 4777 4154 gene locus_tag LOCUS_17360 4777 4154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17360 >Feature sequence148 3025 263 gene locus_tag LOCUS_17370 gene uvrA 3025 263 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391799.1 protein_id gnl|my_center|LOCUS_17370 4038 3022 gene locus_tag LOCUS_17380 gene pdxA 4038 3022 CDS product 4-hydroxythreonine-4-phosphate dehydrogenase PdxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392248.1 protein_id gnl|my_center|LOCUS_17380 4715 4038 gene locus_tag LOCUS_17390 4715 4038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17390 4771 6120 gene locus_tag LOCUS_17400 4771 6120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17400 >Feature sequence149 971 1483 gene locus_tag LOCUS_17410 971 1483 CDS product protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615927.1 protein_id gnl|my_center|LOCUS_17410 2355 1480 gene locus_tag LOCUS_17420 2355 1480 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728691.1 protein_id gnl|my_center|LOCUS_17420 2373 3167 gene locus_tag LOCUS_17430 2373 3167 CDS product acetoacetate decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419190.1 protein_id gnl|my_center|LOCUS_17430 6274 3164 gene locus_tag LOCUS_17440 6274 3164 CDS product CusA/CzcA family heavy metal efflux RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115707.1 protein_id gnl|my_center|LOCUS_17440 >Feature sequence150 1 1413 gene locus_tag LOCUS_17450 1 1413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17450 1461 2156 gene locus_tag LOCUS_17460 1461 2156 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942524.1 protein_id gnl|my_center|LOCUS_17460 2368 2823 gene locus_tag LOCUS_17470 2368 2823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17470 2820 4484 gene locus_tag LOCUS_17480 2820 4484 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272339.1 protein_id gnl|my_center|LOCUS_17480 >Feature sequence151 2141 552 gene locus_tag LOCUS_17490 2141 552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17490 3247 2189 gene locus_tag LOCUS_17500 3247 2189 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118840078.1 protein_id gnl|my_center|LOCUS_17500 3457 4137 gene locus_tag LOCUS_17510 3457 4137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17510 4374 4162 gene locus_tag LOCUS_17520 4374 4162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17520 4835 4302 gene locus_tag LOCUS_17530 4835 4302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17530 5440 4937 gene locus_tag LOCUS_17540 5440 4937 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172509.1 protein_id gnl|my_center|LOCUS_17540 5520 6161 gene locus_tag LOCUS_17550 5520 6161 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085806.1 protein_id gnl|my_center|LOCUS_17550 >Feature sequence152 1552 764 gene locus_tag LOCUS_17560 gene ttcA 1552 764 CDS product tRNA 2-thiocytidine(32) synthetase TtcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268597.1 protein_id gnl|my_center|LOCUS_17560 2820 1549 gene locus_tag LOCUS_17570 gene hisD 2820 1549 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880475.1 protein_id gnl|my_center|LOCUS_17570 2904 4403 gene locus_tag LOCUS_17580 gene cysS 2904 4403 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943976.1 protein_id gnl|my_center|LOCUS_17580 4569 6155 gene locus_tag LOCUS_17590 4569 6155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17590 >Feature sequence153 960 2720 gene locus_tag LOCUS_17600 gene sppA 960 2720 CDS product signal peptide peptidase SppA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765466.1 protein_id gnl|my_center|LOCUS_17600 3400 2717 gene locus_tag LOCUS_17610 3400 2717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17610 5040 3466 gene locus_tag LOCUS_17620 5040 3466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17620 <6263 5076 gene locus_tag LOCUS_17630 <6263 5076 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003114575.1:type 4a pilus secretin PilQ >Feature sequence154 50 2662 gene locus_tag LOCUS_17640 gene nuoL 50 2662 CDS product NADH-quinone oxidoreductase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941017.1 protein_id gnl|my_center|LOCUS_17640 2659 4287 gene locus_tag LOCUS_17650 2659 4287 CDS product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941018.1 protein_id gnl|my_center|LOCUS_17650 4284 5765 gene locus_tag LOCUS_17660 4284 5765 CDS product NADH-quinone oxidoreductase subunit N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941019.1 protein_id gnl|my_center|LOCUS_17660 <6251 5707 gene locus_tag LOCUS_17670 <6251 5707 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_027480009.1:radical SAM protein >Feature sequence155 1960 317 gene locus_tag LOCUS_17680 1960 317 CDS product glutamate synthase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730646.1 protein_id gnl|my_center|LOCUS_17680 3298 2036 gene locus_tag LOCUS_17690 3298 2036 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705373.1 protein_id gnl|my_center|LOCUS_17690 5211 3301 gene locus_tag LOCUS_17700 5211 3301 CDS product thiamine pyrophosphate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730645.1 protein_id gnl|my_center|LOCUS_17700 5918 5286 gene locus_tag LOCUS_17710 5918 5286 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228644.1 protein_id gnl|my_center|LOCUS_17710 >Feature sequence156 56 1201 gene locus_tag LOCUS_17720 56 1201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17720 3169 1238 gene locus_tag LOCUS_17730 gene uvrC 3169 1238 CDS product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943890.1 protein_id gnl|my_center|LOCUS_17730 3815 3213 gene locus_tag LOCUS_17740 3815 3213 CDS product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393630.1 protein_id gnl|my_center|LOCUS_17740 4129 3812 gene locus_tag LOCUS_17750 4129 3812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17750 >Feature sequence157 680 1105 gene locus_tag LOCUS_17760 680 1105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17760 1142 2011 gene locus_tag LOCUS_17770 1142 2011 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114721.1 protein_id gnl|my_center|LOCUS_17770 2034 3494 gene locus_tag LOCUS_17780 gene abfD 2034 3494 CDS product 4-hydroxybutyryl-CoA dehydratase/vinylacetyl-CoA-Delta-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430738.1 protein_id gnl|my_center|LOCUS_17780 3934 3500 gene locus_tag LOCUS_17790 3934 3500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17790 4513 5637 gene locus_tag LOCUS_17800 4513 5637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17800 >Feature sequence158 2318 369 gene locus_tag LOCUS_17810 gene fusA 2318 369 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261294.1 protein_id gnl|my_center|LOCUS_17810 2483 3460 gene locus_tag LOCUS_17820 2483 3460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728645.1 protein_id gnl|my_center|LOCUS_17820 3474 3503 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3746 3525 gene locus_tag LOCUS_17830 3746 3525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17830 3910 3764 gene locus_tag LOCUS_17840 3910 3764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17840 4332 3907 gene locus_tag LOCUS_17850 4332 3907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17850 4529 4269 gene locus_tag LOCUS_17860 4529 4269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17860 4936 4541 gene locus_tag LOCUS_17870 4936 4541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17870 5697 4900 gene locus_tag LOCUS_17880 5697 4900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17880 >Feature sequence159 2803 845 gene locus_tag LOCUS_17890 2803 845 CDS product DUF3604 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_081158863.1 protein_id gnl|my_center|LOCUS_17890 3843 2800 gene locus_tag LOCUS_17900 3843 2800 CDS product HupE/UreJ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046116578.1 protein_id gnl|my_center|LOCUS_17900 4592 3840 gene locus_tag LOCUS_17910 4592 3840 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046116577.1 protein_id gnl|my_center|LOCUS_17910 4854 5939 gene locus_tag LOCUS_17920 4854 5939 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730401.1 protein_id gnl|my_center|LOCUS_17920 >Feature sequence160 <1 928 gene locus_tag LOCUS_17930 <1 928 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012258670.1:ATP-binding protein 1764 931 gene locus_tag LOCUS_17940 gene rsmI 1764 931 CDS product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391594.1 protein_id gnl|my_center|LOCUS_17940 2794 1808 gene locus_tag LOCUS_17950 2794 1808 CDS product RNA polymerase factor sigma-32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938875.1 protein_id gnl|my_center|LOCUS_17950 3812 2856 gene locus_tag LOCUS_17960 3812 2856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17960 4385 3816 gene locus_tag LOCUS_17970 4385 3816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17970 5820 4387 gene locus_tag LOCUS_17980 5820 4387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17980 >Feature sequence161 112 38 gene locus_tag LOCUS_t00100 112 38 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 162 932 gene locus_tag LOCUS_17990 162 932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17990 1649 975 gene locus_tag LOCUS_18000 gene bioD 1649 975 CDS product dethiobiotin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942228.1 protein_id gnl|my_center|LOCUS_18000 2824 1661 gene locus_tag LOCUS_18010 gene bioF 2824 1661 CDS product 8-amino-7-oxononanoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943267.1 protein_id gnl|my_center|LOCUS_18010 3900 2941 gene locus_tag LOCUS_18020 3900 2941 CDS product J domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007334279.1 protein_id gnl|my_center|LOCUS_18020 4090 4866 gene locus_tag LOCUS_18030 4090 4866 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839293.1 protein_id gnl|my_center|LOCUS_18030 4863 5708 gene locus_tag LOCUS_18040 4863 5708 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259407.1 protein_id gnl|my_center|LOCUS_18040 >Feature sequence162 827 558 gene locus_tag LOCUS_18050 gene rpsO 827 558 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808855.1 protein_id gnl|my_center|LOCUS_18050 992 1429 gene locus_tag LOCUS_18060 gene trxC 992 1429 CDS product thioredoxin TrxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036377.1 protein_id gnl|my_center|LOCUS_18060 1528 1947 gene locus_tag LOCUS_18070 1528 1947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18070 2021 2290 gene locus_tag LOCUS_18080 2021 2290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18080 3166 2378 gene locus_tag LOCUS_18090 3166 2378 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728601.1 protein_id gnl|my_center|LOCUS_18090 4163 3417 gene locus_tag LOCUS_18100 4163 3417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088487.1 protein_id gnl|my_center|LOCUS_18100 5675 4233 gene locus_tag LOCUS_18110 5675 4233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18110 >Feature sequence163 85 1155 gene locus_tag LOCUS_18120 85 1155 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037866.1 protein_id gnl|my_center|LOCUS_18120 1180 2394 gene locus_tag LOCUS_18130 1180 2394 CDS product hydroxymethylglutaryl-CoA reductase, degradative inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012966033.1 protein_id gnl|my_center|LOCUS_18130 2391 3122 gene locus_tag LOCUS_18140 gene ubiE 2391 3122 CDS product bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941531.1 protein_id gnl|my_center|LOCUS_18140 3119 4486 gene locus_tag LOCUS_18150 3119 4486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18150 >Feature sequence164 <1 558 gene locus_tag LOCUS_18160 <1 558 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011141570.1:nitrate reductase note possible pseudo, frameshifted 561 785 gene locus_tag LOCUS_18170 561 785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18170 1670 810 gene locus_tag LOCUS_18180 1670 810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18180 1884 2429 gene locus_tag LOCUS_18190 gene pdxH 1884 2429 CDS product pyridoxamine 5'-phosphate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096909.1 protein_id gnl|my_center|LOCUS_18190 2507 3664 gene locus_tag LOCUS_18200 2507 3664 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545010.1 protein_id gnl|my_center|LOCUS_18200 4685 3690 gene locus_tag LOCUS_18210 4685 3690 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927122.1 protein_id gnl|my_center|LOCUS_18210 4996 4802 gene locus_tag LOCUS_18220 4996 4802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18220 5192 5581 gene locus_tag LOCUS_18230 5192 5581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18230 >Feature sequence165 3469 1337 gene locus_tag LOCUS_18240 gene rlmKL 3469 1337 CDS product bifunctional 23S rRNA (guanine(2069)-N(7))-methyltransferase RlmK/23S rRNA (guanine(2445)-N(2))-methyltransferase RlmL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113961.1 protein_id gnl|my_center|LOCUS_18240 4086 3508 gene locus_tag LOCUS_18250 gene kstR 4086 3508 CDS product cholesterol catabolism transcriptional regulator KstR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224372.1 protein_id gnl|my_center|LOCUS_18250 5063 4089 gene locus_tag LOCUS_18260 5063 4089 CDS product Rieske 2Fe-2S domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728642.1 protein_id gnl|my_center|LOCUS_18260 <5930 5085 gene locus_tag LOCUS_18270 <5930 5085 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_176742163.1:acyl-CoA synthetase >Feature sequence166 <1 903 gene locus_tag LOCUS_18280 <1 903 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_044233703.1:SDR family oxidoreductase 2387 894 gene locus_tag LOCUS_18290 2387 894 CDS product GMC family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004523287.1 protein_id gnl|my_center|LOCUS_18290 3024 2410 gene locus_tag LOCUS_18300 gene fadR 3024 2410 CDS product fatty acid metabolism transcriptional regulator FadR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229547.1 protein_id gnl|my_center|LOCUS_18300 3645 3067 gene locus_tag LOCUS_18310 gene plsY 3645 3067 CDS product glycerol-3-phosphate 1-O-acyltransferase PlsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880403.1 protein_id gnl|my_center|LOCUS_18310 3729 4097 gene locus_tag LOCUS_18320 3729 4097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18320 4139 5386 gene locus_tag LOCUS_18330 4139 5386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18330 5396 5809 gene locus_tag LOCUS_18340 5396 5809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18340 >Feature sequence167 <1 1576 gene locus_tag LOCUS_18350 <1 1576 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005478902.1:efflux RND transporter permease subunit VmeI 1647 3743 gene locus_tag LOCUS_18360 1647 3743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18360 5346 3712 gene locus_tag LOCUS_18370 5346 3712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18370 >Feature sequence168 551 2089 gene locus_tag LOCUS_18380 551 2089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18380 2799 2086 gene locus_tag LOCUS_18390 2799 2086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18390 3314 2796 gene locus_tag LOCUS_18400 3314 2796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18400 5288 3318 gene locus_tag LOCUS_18410 5288 3318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18410 >Feature sequence169 776 27 gene locus_tag LOCUS_18420 776 27 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087749.1 protein_id gnl|my_center|LOCUS_18420 657 866 gene locus_tag LOCUS_18430 657 866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18430 1112 1438 gene locus_tag LOCUS_18440 1112 1438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18440 1392 1637 gene locus_tag LOCUS_18450 1392 1637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18450 1660 2418 gene locus_tag LOCUS_18460 1660 2418 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192152.1 protein_id gnl|my_center|LOCUS_18460 2430 3653 gene locus_tag LOCUS_18470 2430 3653 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186626.1 protein_id gnl|my_center|LOCUS_18470 3650 4687 gene locus_tag LOCUS_18480 3650 4687 CDS product phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085728.1 protein_id gnl|my_center|LOCUS_18480 4697 5107 gene locus_tag LOCUS_18490 4697 5107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18490 >Feature sequence170 239 856 gene locus_tag LOCUS_18500 239 856 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976592.1 protein_id gnl|my_center|LOCUS_18500 856 1890 gene locus_tag LOCUS_18510 856 1890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18510 1927 3072 gene locus_tag LOCUS_18520 gene rnd 1927 3072 CDS product ribonuclease D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532283.1 protein_id gnl|my_center|LOCUS_18520 3092 4153 gene locus_tag LOCUS_18530 3092 4153 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072825.1 protein_id gnl|my_center|LOCUS_18530 5138 4140 gene locus_tag LOCUS_18540 gene meaB 5138 4140 CDS product methylmalonyl Co-A mutase-associated GTPase MeaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390231.1 protein_id gnl|my_center|LOCUS_18540 <5830 5135 gene locus_tag LOCUS_18550 <5830 5135 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013222826.1:methylmalonyl-CoA mutase >Feature sequence171 438 1052 gene locus_tag LOCUS_18560 438 1052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18560 974 1543 gene locus_tag LOCUS_18570 974 1543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_18570 1681 2496 gene locus_tag LOCUS_18580 1681 2496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18580 2904 3719 gene locus_tag LOCUS_18590 2904 3719 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224179.1 protein_id gnl|my_center|LOCUS_18590 3723 4763 gene locus_tag LOCUS_18600 3723 4763 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015614.1 protein_id gnl|my_center|LOCUS_18600 5540 4773 gene locus_tag LOCUS_18610 5540 4773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18610 >Feature sequence172 534 818 gene locus_tag LOCUS_18620 534 818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18620 1240 848 gene locus_tag LOCUS_18630 1240 848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18630 1551 1889 gene locus_tag LOCUS_18640 1551 1889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18640 2700 2191 gene locus_tag LOCUS_18650 2700 2191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18650 2858 3361 gene locus_tag LOCUS_18660 2858 3361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18660 3608 4267 gene locus_tag LOCUS_18670 3608 4267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18670 4260 5630 gene locus_tag LOCUS_18680 4260 5630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18680 >Feature sequence173 656 2401 gene locus_tag LOCUS_18690 656 2401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18690 2346 2615 gene locus_tag LOCUS_18700 2346 2615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18700 >Feature sequence174 2545 1667 gene locus_tag LOCUS_18710 gene ilvE 2545 1667 CDS product branched-chain-amino-acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870345.1 protein_id gnl|my_center|LOCUS_18710 4990 2549 gene locus_tag LOCUS_18720 4990 2549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18720 >Feature sequence175 329 757 gene locus_tag LOCUS_18730 329 757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18730 1506 658 gene locus_tag LOCUS_18740 1506 658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18740 1844 1581 gene locus_tag LOCUS_18750 1844 1581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18750 1919 2905 gene locus_tag LOCUS_18760 1919 2905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18760 3572 2910 gene locus_tag LOCUS_18770 3572 2910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18770 3882 3670 gene locus_tag LOCUS_18780 3882 3670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18780 4185 4715 gene locus_tag LOCUS_18790 4185 4715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18790 >Feature sequence176 618 94 gene locus_tag LOCUS_18800 618 94 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18800 1047 619 gene locus_tag LOCUS_18810 1047 619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18810 1186 2355 gene locus_tag LOCUS_18820 1186 2355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18820 2359 3375 gene locus_tag LOCUS_18830 2359 3375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18830 3372 5351 gene locus_tag LOCUS_18840 3372 5351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18840 >Feature sequence177 <1 683 gene locus_tag LOCUS_18850 <1 683 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164926008.1:penicillin acylase family protein 622 1647 gene locus_tag LOCUS_18860 622 1647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18860 2431 1649 gene locus_tag LOCUS_18870 2431 1649 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225423.1 protein_id gnl|my_center|LOCUS_18870 3357 2443 gene locus_tag LOCUS_18880 3357 2443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18880 4079 3339 gene locus_tag LOCUS_18890 4079 3339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18890 4153 5034 gene locus_tag LOCUS_18900 gene gluQRS 4153 5034 CDS product tRNA glutamyl-Q(34) synthetase GluQRS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792234.1 protein_id gnl|my_center|LOCUS_18900 >Feature sequence178 4672 2291 gene locus_tag LOCUS_18910 4672 2291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18910 5337 4669 gene locus_tag LOCUS_18920 5337 4669 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971949.1 protein_id gnl|my_center|LOCUS_18920 >Feature sequence179 1126 746 gene locus_tag LOCUS_18930 gene rplL 1126 746 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390506.1 protein_id gnl|my_center|LOCUS_18930 1747 1178 gene locus_tag LOCUS_18940 gene rplJ 1747 1178 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001832306.1 protein_id gnl|my_center|LOCUS_18940 2448 1750 gene locus_tag LOCUS_18950 gene rplA 2448 1750 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943496.1 protein_id gnl|my_center|LOCUS_18950 2958 2536 gene locus_tag LOCUS_18960 gene rplK 2958 2536 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966425.1 protein_id gnl|my_center|LOCUS_18960 3680 3156 gene locus_tag LOCUS_18970 gene nusG 3680 3156 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943498.1 protein_id gnl|my_center|LOCUS_18970 4111 3686 gene locus_tag LOCUS_18980 4111 3686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18980 5300 4389 gene locus_tag LOCUS_18990 gene tuf 5300 4389 CDS product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000031644.1 protein_id gnl|my_center|LOCUS_18990 >Feature sequence180 332 1876 gene locus_tag LOCUS_19000 332 1876 CDS product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963871.1 protein_id gnl|my_center|LOCUS_19000 1873 2142 gene locus_tag LOCUS_19010 1873 2142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19010 2180 2440 gene locus_tag LOCUS_19020 2180 2440 CDS product acylphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868779.1 protein_id gnl|my_center|LOCUS_19020 3325 2453 gene locus_tag LOCUS_19030 3325 2453 CDS product sterol desaturase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057754.1 protein_id gnl|my_center|LOCUS_19030 3518 4453 gene locus_tag LOCUS_19040 3518 4453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19040 4887 4537 gene locus_tag LOCUS_19050 4887 4537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19050 >Feature sequence181 350 1672 gene locus_tag LOCUS_19060 gene nhaA 350 1672 CDS product Na+/H+ antiporter NhaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119453.1 protein_id gnl|my_center|LOCUS_19060 1672 2313 gene locus_tag LOCUS_19070 1672 2313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19070 2310 2522 gene locus_tag LOCUS_19080 2310 2522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19080 3456 2530 gene locus_tag LOCUS_19090 3456 2530 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229548.1 protein_id gnl|my_center|LOCUS_19090 3593 4246 gene locus_tag LOCUS_19100 3593 4246 CDS product CDGSH iron-sulfur domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528606.1 protein_id gnl|my_center|LOCUS_19100 >Feature sequence182 777 322 gene locus_tag LOCUS_19110 gene aroQ 777 322 CDS product type II 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142437.1 protein_id gnl|my_center|LOCUS_19110 1138 782 gene locus_tag LOCUS_19120 1138 782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19120 2597 1209 gene locus_tag LOCUS_19130 2597 1209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19130 3112 2594 gene locus_tag LOCUS_19140 gene mtrA 3112 2594 CDS product MtrAB system response regulator MtrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929974.1 protein_id gnl|my_center|LOCUS_19140 3635 3195 gene locus_tag LOCUS_19150 3635 3195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19150 3734 4543 gene locus_tag LOCUS_19160 3734 4543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19160 4621 5067 gene locus_tag LOCUS_19170 4621 5067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19170 >Feature sequence183 293 3046 gene locus_tag LOCUS_19180 293 3046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19180 3298 3053 gene locus_tag LOCUS_19190 3298 3053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19190 4296 3907 gene locus_tag LOCUS_19200 4296 3907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19200 4802 4557 gene locus_tag LOCUS_19210 4802 4557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19210 >Feature sequence184 2156 201 gene locus_tag LOCUS_19220 gene nadE 2156 201 CDS product NAD(+) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001192277.1 protein_id gnl|my_center|LOCUS_19220 2465 2235 gene locus_tag LOCUS_19230 2465 2235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19230 2563 3882 gene locus_tag LOCUS_19240 2563 3882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19240 4945 3884 gene locus_tag LOCUS_19250 4945 3884 CDS product cytochrome-c peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941134.1 protein_id gnl|my_center|LOCUS_19250 >Feature sequence185 424 1047 gene locus_tag LOCUS_19260 424 1047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19260 1717 2871 gene locus_tag LOCUS_19270 1717 2871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19270 2896 2823 gene locus_tag LOCUS_t00110 2896 2823 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 3228 4520 gene locus_tag LOCUS_19280 3228 4520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19280 >Feature sequence186 2169 1087 gene locus_tag LOCUS_19290 2169 1087 CDS product mechanosensitive ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021055.1 protein_id gnl|my_center|LOCUS_19290 2298 4388 gene locus_tag LOCUS_19300 gene pta 2298 4388 CDS product phosphate acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940288.1 protein_id gnl|my_center|LOCUS_19300 >Feature sequence187 1334 1849 gene locus_tag LOCUS_19310 1334 1849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19310 1936 2667 gene locus_tag LOCUS_19320 1936 2667 CDS product MlaE family lipid ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920880.1 protein_id gnl|my_center|LOCUS_19320 2684 3001 gene locus_tag LOCUS_19330 2684 3001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19330 2998 4806 gene locus_tag LOCUS_19340 2998 4806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19340 4817 5056 gene locus_tag LOCUS_19350 4817 5056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19350 >Feature sequence188 1317 1757 gene locus_tag LOCUS_19360 1317 1757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19360 2044 1754 gene locus_tag LOCUS_19370 2044 1754 CDS product DUF167 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041914001.1 protein_id gnl|my_center|LOCUS_19370 2099 3100 gene locus_tag LOCUS_19380 2099 3100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19380 4027 3107 gene locus_tag LOCUS_19390 4027 3107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19390 <5076 4024 gene locus_tag LOCUS_19400 <5076 4024 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012584135.1:serine/threonine-protein kinase >Feature sequence189 154 555 gene locus_tag LOCUS_19410 154 555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19410 559 1359 gene locus_tag LOCUS_19420 559 1359 CDS product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941002.1 protein_id gnl|my_center|LOCUS_19420 1400 1720 gene locus_tag LOCUS_19430 gene atpE 1400 1720 CDS product ATP synthase F0 subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792634.1 protein_id gnl|my_center|LOCUS_19430 1797 2306 gene locus_tag LOCUS_19440 1797 2306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19440 2796 2380 gene locus_tag LOCUS_19450 2796 2380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19450 >Feature sequence190 802 149 gene locus_tag LOCUS_19460 802 149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19460 1047 781 gene locus_tag LOCUS_19470 1047 781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19470 1802 1470 gene locus_tag LOCUS_19480 1802 1470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19480 2484 1885 gene locus_tag LOCUS_19490 2484 1885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19490 3179 2484 gene locus_tag LOCUS_19500 3179 2484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19500 4748 3456 gene locus_tag LOCUS_19510 4748 3456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19510 >Feature sequence191 414 2672 gene locus_tag LOCUS_19520 414 2672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19520 2581 2976 gene locus_tag LOCUS_19530 2581 2976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19530 2973 3782 gene locus_tag LOCUS_19540 2973 3782 CDS product outer membrane lipoprotein-sorting protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679769.1 protein_id gnl|my_center|LOCUS_19540 >Feature sequence192 1599 793 gene locus_tag LOCUS_19550 gene thiD 1599 793 CDS product bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228119.1 protein_id gnl|my_center|LOCUS_19550 1696 2517 gene locus_tag LOCUS_19560 1696 2517 CDS product haloalkane dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003413363.1 protein_id gnl|my_center|LOCUS_19560 3287 2472 gene locus_tag LOCUS_19570 3287 2472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19570 2609 2619 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3286 4290 gene locus_tag LOCUS_19580 gene hemB 3286 4290 CDS product porphobilinogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389590.1 protein_id gnl|my_center|LOCUS_19580 4445 4645 gene locus_tag LOCUS_19590 4445 4645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19590 >Feature sequence193 235 1914 gene locus_tag LOCUS_19600 235 1914 CDS product thiamine pyrophosphate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972394.1 protein_id gnl|my_center|LOCUS_19600 1920 3665 gene locus_tag LOCUS_19610 1920 3665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19610 4062 3646 gene locus_tag LOCUS_19620 4062 3646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19620 4690 3956 gene locus_tag LOCUS_19630 4690 3956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19630 >Feature sequence194 676 1572 gene locus_tag LOCUS_19640 676 1572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19640 1577 2017 gene locus_tag LOCUS_19650 1577 2017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19650 2625 2023 gene locus_tag LOCUS_19660 2625 2023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19660 4279 2687 gene locus_tag LOCUS_19670 4279 2687 CDS product peptide chain release factor 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048268.1 protein_id gnl|my_center|LOCUS_19670 >Feature sequence195 184 987 gene locus_tag LOCUS_19680 184 987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19680 984 1271 gene locus_tag LOCUS_19690 984 1271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19690 1797 1480 gene locus_tag LOCUS_19700 1797 1480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19700 2120 2494 gene locus_tag LOCUS_19710 2120 2494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19710 2666 3754 gene locus_tag LOCUS_19720 2666 3754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_19720 3708 4637 gene locus_tag LOCUS_19730 3708 4637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19730 >Feature sequence196 999 7 gene locus_tag LOCUS_19740 999 7 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19740 1893 1108 gene locus_tag LOCUS_19750 1893 1108 CDS product 2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963740.1 protein_id gnl|my_center|LOCUS_19750 2316 1897 gene locus_tag LOCUS_19760 gene ndk 2316 1897 CDS product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939606.1 protein_id gnl|my_center|LOCUS_19760 3297 2407 gene locus_tag LOCUS_19770 3297 2407 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259370.1 protein_id gnl|my_center|LOCUS_19770 4313 3330 gene locus_tag LOCUS_19780 4313 3330 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406301.1 protein_id gnl|my_center|LOCUS_19780 <4888 4341 gene locus_tag LOCUS_19790 <4888 4341 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003238566.1:succinate--CoA ligase subunit alpha >Feature sequence197 1986 1504 gene locus_tag LOCUS_19800 1986 1504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19800 3406 2048 gene locus_tag LOCUS_19810 3406 2048 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942684.1 protein_id gnl|my_center|LOCUS_19810 >Feature sequence198 3044 2250 gene locus_tag LOCUS_19820 3044 2250 CDS product 3-oxo-5-alpha-steroid 4-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002667090.1 protein_id gnl|my_center|LOCUS_19820 3086 3637 gene locus_tag LOCUS_19830 3086 3637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19830 3777 4094 gene locus_tag LOCUS_19840 3777 4094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19840 >Feature sequence199 1432 407 gene locus_tag LOCUS_19850 1432 407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19850 2897 1437 gene locus_tag LOCUS_19860 2897 1437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19860 3432 3208 gene locus_tag LOCUS_19870 3432 3208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19870 3553 4491 gene locus_tag LOCUS_19880 3553 4491 CDS product NADP-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978080.1 protein_id gnl|my_center|LOCUS_19880 >Feature sequence200 316 726 gene locus_tag LOCUS_19890 316 726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19890 836 1936 gene locus_tag LOCUS_19900 836 1936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19900 1933 2316 gene locus_tag LOCUS_19910 1933 2316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19910 2424 3647 gene locus_tag LOCUS_19920 2424 3647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19920 3644 4756 gene locus_tag LOCUS_19930 3644 4756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19930 >Feature sequence201 77 1 gene locus_tag LOCUS_t00120 77 1 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 1428 2813 gene locus_tag LOCUS_19940 1428 2813 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080975.1 protein_id gnl|my_center|LOCUS_19940 4729 2831 gene locus_tag LOCUS_19950 4729 2831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19950 >Feature sequence202 324 1712 gene locus_tag LOCUS_19960 324 1712 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228965.1 protein_id gnl|my_center|LOCUS_19960 3747 2272 gene locus_tag LOCUS_19970 3747 2272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19970 4065 3766 gene locus_tag LOCUS_19980 4065 3766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19980 <4730 4092 gene locus_tag LOCUS_19990 <4730 4092 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011339387.1:NAD(P)/FAD-dependent oxidoreductase >Feature sequence203 <1 735 gene locus_tag LOCUS_20000 <1 735 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011103736.1:alpha/beta hydrolase 796 1707 gene locus_tag LOCUS_20010 796 1707 CDS product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922183.1 protein_id gnl|my_center|LOCUS_20010 4080 1711 gene locus_tag LOCUS_20020 4080 1711 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090710.1 protein_id gnl|my_center|LOCUS_20020 4676 4167 gene locus_tag LOCUS_20030 4676 4167 CDS product DUF4442 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003122604.1 protein_id gnl|my_center|LOCUS_20030 >Feature sequence204 417 791 gene locus_tag LOCUS_20040 417 791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20040 834 2168 gene locus_tag LOCUS_20050 834 2168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20050 2658 2200 gene locus_tag LOCUS_20060 2658 2200 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193539.1 protein_id gnl|my_center|LOCUS_20060 2777 3895 gene locus_tag LOCUS_20070 2777 3895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20070 4056 3898 gene locus_tag LOCUS_20080 4056 3898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20080 4012 4536 gene locus_tag LOCUS_20090 4012 4536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20090 >Feature sequence205 468 620 gene locus_tag LOCUS_20100 468 620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20100 604 2628 gene locus_tag LOCUS_20110 604 2628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20110 2642 3940 gene locus_tag LOCUS_20120 2642 3940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20120 >Feature sequence206 336 983 gene locus_tag LOCUS_20130 336 983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20130 1926 2597 gene locus_tag LOCUS_20140 1926 2597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20140 <4688 2631 gene locus_tag LOCUS_20150 <4688 2631 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013223208.1:glycoside hydrolase family 2 >Feature sequence207 1103 486 gene locus_tag LOCUS_20160 1103 486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20160 1192 1896 gene locus_tag LOCUS_20170 1192 1896 CDS product DUF2071 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120331.1 protein_id gnl|my_center|LOCUS_20170 3499 1931 gene locus_tag LOCUS_20180 3499 1931 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478508.1 protein_id gnl|my_center|LOCUS_20180 3574 4458 gene locus_tag LOCUS_20190 3574 4458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20190 >Feature sequence208 534 1 gene locus_tag LOCUS_20200 534 1 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20200 1160 603 gene locus_tag LOCUS_20210 1160 603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20210 1805 1173 gene locus_tag LOCUS_20220 1805 1173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20220 2234 2884 gene locus_tag LOCUS_20230 2234 2884 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103021216.1 protein_id gnl|my_center|LOCUS_20230 2893 3384 gene locus_tag LOCUS_20240 2893 3384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20240 3394 3930 gene locus_tag LOCUS_20250 3394 3930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20250 >Feature sequence209 395 2431 gene locus_tag LOCUS_20260 395 2431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20260 3600 2428 gene locus_tag LOCUS_20270 3600 2428 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898036.1 protein_id gnl|my_center|LOCUS_20270 4185 3643 gene locus_tag LOCUS_20280 gene purE 4185 3643 CDS product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942943.1 protein_id gnl|my_center|LOCUS_20280 >Feature sequence210 1346 621 gene locus_tag LOCUS_20290 1346 621 CDS product PaaX family transcriptional regulator C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004202847.1 protein_id gnl|my_center|LOCUS_20290 1443 2183 gene locus_tag LOCUS_20300 1443 2183 CDS product pyridoxine 5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760838.1 protein_id gnl|my_center|LOCUS_20300 2217 3230 gene locus_tag LOCUS_20310 2217 3230 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_112902643.1 protein_id gnl|my_center|LOCUS_20310 3240 4340 gene locus_tag LOCUS_20320 3240 4340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20320 >Feature sequence211 <1 568 gene locus_tag LOCUS_20330 <1 568 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257134.1:aldo/keto reductase 1302 517 gene locus_tag LOCUS_20340 1302 517 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106828.1 protein_id gnl|my_center|LOCUS_20340 2263 1289 gene locus_tag LOCUS_20350 2263 1289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20350 2880 2263 gene locus_tag LOCUS_20360 2880 2263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20360 3932 2988 gene locus_tag LOCUS_20370 3932 2988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20370 4267 4019 gene locus_tag LOCUS_20380 4267 4019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_20380 >Feature sequence212 1276 902 gene locus_tag LOCUS_20390 1276 902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_20390 2172 1273 gene locus_tag LOCUS_20400 gene pstA 2172 1273 CDS product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962534.1 protein_id gnl|my_center|LOCUS_20400 3215 2169 gene locus_tag LOCUS_20410 3215 2169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20410 3568 3212 gene locus_tag LOCUS_20420 3568 3212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20420 4019 3555 gene locus_tag LOCUS_20430 4019 3555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20430 4149 4427 gene locus_tag LOCUS_20440 4149 4427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20440 >Feature sequence213 2379 706 gene locus_tag LOCUS_20450 gene mutL 2379 706 CDS product DNA mismatch repair endonuclease MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957996.1 protein_id gnl|my_center|LOCUS_20450 2595 4046 gene locus_tag LOCUS_20460 2595 4046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20460 >Feature sequence214 2828 894 gene locus_tag LOCUS_20470 2828 894 CDS product nucleoside-diphosphate sugar epimerase/dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272023.1 protein_id gnl|my_center|LOCUS_20470 3805 2825 gene locus_tag LOCUS_20480 3805 2825 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259096.1 protein_id gnl|my_center|LOCUS_20480 >Feature sequence215 <1 910 gene locus_tag LOCUS_20490 <1 910 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013529857.1:choline dehydrogenase 907 1368 gene locus_tag LOCUS_20500 907 1368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20500 1544 1365 gene locus_tag LOCUS_20510 1544 1365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20510 1959 1603 gene locus_tag LOCUS_20520 1959 1603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20520 3916 1964 gene locus_tag LOCUS_20530 3916 1964 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005489375.1 protein_id gnl|my_center|LOCUS_20530 4426 3920 gene locus_tag LOCUS_20540 4426 3920 CDS product LemA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477566.1 protein_id gnl|my_center|LOCUS_20540 >Feature sequence216 928 1128 gene locus_tag LOCUS_20550 928 1128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20550 1606 1169 gene locus_tag LOCUS_20560 1606 1169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20560 2447 1650 gene locus_tag LOCUS_20570 2447 1650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_20570 2482 2886 gene locus_tag LOCUS_20580 2482 2886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20580 3053 3697 gene locus_tag LOCUS_20590 3053 3697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20590 <4415 3699 gene locus_tag LOCUS_20600 <4415 3699 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003114821.1:AraC family transcriptional regulator >Feature sequence217 356 844 gene locus_tag LOCUS_20610 356 844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20610 851 1159 gene locus_tag LOCUS_20620 851 1159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20620 1186 1455 gene locus_tag LOCUS_20630 1186 1455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20630 1482 3074 gene locus_tag LOCUS_20640 1482 3074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20640 3819 3028 gene locus_tag LOCUS_20650 3819 3028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20650 >Feature sequence218 824 117 gene locus_tag LOCUS_20660 824 117 CDS product DUF2490 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010945798.1 protein_id gnl|my_center|LOCUS_20660 1480 860 gene locus_tag LOCUS_20670 1480 860 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224350.1 protein_id gnl|my_center|LOCUS_20670 2672 1494 gene locus_tag LOCUS_20680 2672 1494 CDS product lipid-transfer protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414142.1 protein_id gnl|my_center|LOCUS_20680 <4411 2703 gene locus_tag LOCUS_20690 <4411 2703 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_030871467.1:MaoC/PaaZ C-terminal domain-containing protein >Feature sequence219 2502 133 gene locus_tag LOCUS_20700 2502 133 CDS product FtsX-like permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932893.1 protein_id gnl|my_center|LOCUS_20700 3227 2496 gene locus_tag LOCUS_20710 3227 2496 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015445444.1 protein_id gnl|my_center|LOCUS_20710 3323 3670 gene locus_tag LOCUS_20720 3323 3670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20720 3661 4101 gene locus_tag LOCUS_20730 3661 4101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20730 >Feature sequence220 1061 375 gene locus_tag LOCUS_20740 1061 375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20740 1523 1245 gene locus_tag LOCUS_20750 1523 1245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20750 1659 2663 gene locus_tag LOCUS_20760 1659 2663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20760 2684 4057 gene locus_tag LOCUS_20770 2684 4057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20770 >Feature sequence221 <1 996 gene locus_tag LOCUS_20780 <1 996 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010973292.1:FAD-binding dehydrogenase 1000 2709 gene locus_tag LOCUS_20790 1000 2709 CDS product acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012296656.1 protein_id gnl|my_center|LOCUS_20790 2718 3332 gene locus_tag LOCUS_20800 2718 3332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20800 3329 3898 gene locus_tag LOCUS_20810 gene yajL 3329 3898 CDS product protein deglycase YajL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367984.1 protein_id gnl|my_center|LOCUS_20810 >Feature sequence222 1923 805 gene locus_tag LOCUS_20820 1923 805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20820 2924 2046 gene locus_tag LOCUS_20830 2924 2046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_20830 3697 2930 gene locus_tag LOCUS_20840 3697 2930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_20840 >Feature sequence223 2 1099 gene locus_tag LOCUS_20850 gene secY 2 1099 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943466.1 protein_id gnl|my_center|LOCUS_20850 1099 1749 gene locus_tag LOCUS_20860 1099 1749 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546790.1 protein_id gnl|my_center|LOCUS_20860 1758 1970 gene locus_tag LOCUS_20870 gene infA 1758 1970 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008633373.1 protein_id gnl|my_center|LOCUS_20870 2088 2456 gene locus_tag LOCUS_20880 gene rpsM 2088 2456 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390416.1 protein_id gnl|my_center|LOCUS_20880 2461 2862 gene locus_tag LOCUS_20890 gene rpsK 2461 2862 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943461.1 protein_id gnl|my_center|LOCUS_20890 2881 3588 gene locus_tag LOCUS_20900 2881 3588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_20900 3585 3866 gene locus_tag LOCUS_20910 3585 3866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_20910 3921 4340 gene locus_tag LOCUS_20920 gene rplQ 3921 4340 CDS product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002894521.1 protein_id gnl|my_center|LOCUS_20920 >Feature sequence224 <1 726 gene locus_tag LOCUS_20930 <1 726 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012259334.1:glycine cleavage system aminomethyltransferase GcvT 729 1121 gene locus_tag LOCUS_20940 gene gcvH 729 1121 CDS product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203673.1 protein_id gnl|my_center|LOCUS_20940 1137 2483 gene locus_tag LOCUS_20950 gene gcvPA 1137 2483 CDS product aminomethyl-transferring glycine dehydrogenase subunit GcvPA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010990102.1 protein_id gnl|my_center|LOCUS_20950 2782 3063 gene locus_tag LOCUS_20960 2782 3063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20960 3594 3094 gene locus_tag LOCUS_20970 3594 3094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20970 4037 3654 gene locus_tag LOCUS_20980 4037 3654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20980 >Feature sequence225 <1 788 gene locus_tag LOCUS_20990 <1 788 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943912.1:biotin carboxylase N-terminal domain-containing protein 1779 886 gene locus_tag LOCUS_21000 1779 886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_21000 2056 2781 gene locus_tag LOCUS_21010 2056 2781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21010 2675 2914 gene locus_tag LOCUS_21020 2675 2914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21020 2911 3897 gene locus_tag LOCUS_21030 2911 3897 CDS product pyruvate dehydrogenase complex E1 component subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000279894.1 protein_id gnl|my_center|LOCUS_21030 3901 4329 gene locus_tag LOCUS_21040 3901 4329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21040 >Feature sequence226 <1 1739 gene locus_tag LOCUS_21050 <1 1739 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011144207.1:alkaline phosphatase family protein 1736 2923 gene locus_tag LOCUS_21060 1736 2923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21060 >Feature sequence227 533 1060 gene locus_tag LOCUS_21070 533 1060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21070 1057 1656 gene locus_tag LOCUS_21080 1057 1656 CDS product YeeE/YedE thiosulfate transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086307.1 protein_id gnl|my_center|LOCUS_21080 1656 2312 gene locus_tag LOCUS_21090 1656 2312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21090 2820 2338 gene locus_tag LOCUS_21100 2820 2338 CDS product DUF2141 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932889.1 protein_id gnl|my_center|LOCUS_21100 3054 3638 gene locus_tag LOCUS_21110 3054 3638 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189774.1 protein_id gnl|my_center|LOCUS_21110 >Feature sequence228 933 1481 gene locus_tag LOCUS_21120 933 1481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21120 2208 1471 gene locus_tag LOCUS_21130 2208 1471 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931863.1 protein_id gnl|my_center|LOCUS_21130 3538 2210 gene locus_tag LOCUS_21140 3538 2210 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931864.1 protein_id gnl|my_center|LOCUS_21140 <4180 3574 gene locus_tag LOCUS_21150 <4180 3574 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011817040.1:methionine adenosyltransferase >Feature sequence229 >Feature sequence230 1234 365 gene locus_tag LOCUS_21160 1234 365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21160 2073 1231 gene locus_tag LOCUS_21170 gene htpX 2073 1231 CDS product protease HtpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037436.1 protein_id gnl|my_center|LOCUS_21170 2718 2161 gene locus_tag LOCUS_21180 2718 2161 CDS product DUF3501 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980453.1 protein_id gnl|my_center|LOCUS_21180 3732 2731 gene locus_tag LOCUS_21190 3732 2731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21190 3940 3638 gene locus_tag LOCUS_21200 3940 3638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21200 >Feature sequence231 587 147 gene locus_tag LOCUS_21210 587 147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21210 807 1034 gene locus_tag LOCUS_21220 807 1034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21220 1036 1350 gene locus_tag LOCUS_21230 1036 1350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21230 2261 1566 gene locus_tag LOCUS_21240 2261 1566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21240 2690 3175 gene locus_tag LOCUS_21250 2690 3175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21250 3117 3473 gene locus_tag LOCUS_21260 3117 3473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21260 >Feature sequence232 1937 153 gene locus_tag LOCUS_21270 1937 153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21270 2559 1993 gene locus_tag LOCUS_21280 2559 1993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21280 3412 2564 gene locus_tag LOCUS_21290 3412 2564 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402848.1 protein_id gnl|my_center|LOCUS_21290 3485 3997 gene locus_tag LOCUS_21300 3485 3997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21300 >Feature sequence233 1771 1250 gene locus_tag LOCUS_21310 1771 1250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21310 2350 1805 gene locus_tag LOCUS_21320 2350 1805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21320 2430 2699 gene locus_tag LOCUS_21330 2430 2699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21330 3648 2806 gene locus_tag LOCUS_21340 3648 2806 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003433818.1 protein_id gnl|my_center|LOCUS_21340 >Feature sequence234 120 1367 gene locus_tag LOCUS_21350 120 1367 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224376.1 protein_id gnl|my_center|LOCUS_21350 2417 1374 gene locus_tag LOCUS_21360 2417 1374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21360 2762 2556 gene locus_tag LOCUS_21370 2762 2556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21370 3401 2793 gene locus_tag LOCUS_21380 3401 2793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21380 >Feature sequence235 628 2445 gene locus_tag LOCUS_21390 628 2445 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267570.1 protein_id gnl|my_center|LOCUS_21390 <4079 2630 gene locus_tag LOCUS_21400 <4079 2630 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012639873.1:3-hydroxyacyl-CoA dehydrogenase NAD-binding domain-containing protein note possible pseudo, frameshifted >Feature sequence236 <1 535 gene locus_tag LOCUS_21410 <1 535 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011393276.1:4-hydroxy-2-oxovalerate aldolase note possible pseudo, frameshifted 433 786 gene locus_tag LOCUS_21420 433 786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_21420 791 1990 gene locus_tag LOCUS_21430 791 1990 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083841.1 protein_id gnl|my_center|LOCUS_21430 1987 3132 gene locus_tag LOCUS_21440 1987 3132 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083842.1 protein_id gnl|my_center|LOCUS_21440 3161 3913 gene locus_tag LOCUS_21450 3161 3913 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016326803.1 protein_id gnl|my_center|LOCUS_21450 >Feature sequence237 1555 950 gene locus_tag LOCUS_21460 1555 950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21460 2550 2744 gene locus_tag LOCUS_21470 2550 2744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21470 <4062 2759 gene locus_tag LOCUS_21480 <4062 2759 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005479507.1:fatty acid oxidation complex subunit alpha FadJ >Feature sequence238 <1 598 gene locus_tag LOCUS_21490 <1 598 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003722740.1:50S ribosomal protein L25/general stress protein Ctc 613 1182 gene locus_tag LOCUS_21500 gene pth 613 1182 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941324.1 protein_id gnl|my_center|LOCUS_21500 1269 2018 gene locus_tag LOCUS_21510 1269 2018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21510 2022 2285 gene locus_tag LOCUS_21520 gene rpsR 2022 2285 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143052.1 protein_id gnl|my_center|LOCUS_21520 2293 2757 gene locus_tag LOCUS_21530 gene rplI 2293 2757 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015544.1 protein_id gnl|my_center|LOCUS_21530 >Feature sequence239 152 1201 gene locus_tag LOCUS_21540 gene pilM 152 1201 CDS product type IV pilus assembly protein PilM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_181416674.1 protein_id gnl|my_center|LOCUS_21540 1201 1872 gene locus_tag LOCUS_21550 1201 1872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21550 1872 2471 gene locus_tag LOCUS_21560 1872 2471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21560 2478 3101 gene locus_tag LOCUS_21570 2478 3101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21570 >Feature sequence240 <1 700 gene locus_tag LOCUS_21580 <1 700 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000990075.1:NADH-quinone oxidoreductase subunit D 704 2083 gene locus_tag LOCUS_21590 704 2083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21590 2058 2276 gene locus_tag LOCUS_21600 2058 2276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21600 2326 3114 gene locus_tag LOCUS_21610 2326 3114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_21610 3196 3504 gene locus_tag LOCUS_21620 3196 3504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_21620 >Feature sequence241 1018 2145 gene locus_tag LOCUS_21630 1018 2145 CDS product flavin-dependent monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224393.1 protein_id gnl|my_center|LOCUS_21630 2148 2906 gene locus_tag LOCUS_21640 2148 2906 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393278.1 protein_id gnl|my_center|LOCUS_21640 2919 3815 gene locus_tag LOCUS_21650 2919 3815 CDS product acetaldehyde dehydrogenase (acetylating) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005064835.1 protein_id gnl|my_center|LOCUS_21650 >Feature sequence242 1346 168 gene locus_tag LOCUS_21660 gene dusB 1346 168 CDS product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028387.1 protein_id gnl|my_center|LOCUS_21660 2186 1392 gene locus_tag LOCUS_21670 2186 1392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21670 2286 3635 gene locus_tag LOCUS_21680 gene accC 2286 3635 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057645.1 protein_id gnl|my_center|LOCUS_21680 >Feature sequence243 134 1399 gene locus_tag LOCUS_21690 134 1399 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879310.1 protein_id gnl|my_center|LOCUS_21690 1399 2295 gene locus_tag LOCUS_21700 1399 2295 CDS product DUF6206 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973137.1 protein_id gnl|my_center|LOCUS_21700 2741 2328 gene locus_tag LOCUS_21710 2741 2328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21710 3396 2767 gene locus_tag LOCUS_21720 3396 2767 CDS product protein-L-isoaspartate(D-aspartate) O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545748.1 protein_id gnl|my_center|LOCUS_21720 >Feature sequence244 83 1879 gene locus_tag LOCUS_21730 83 1879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21730 2010 3827 gene locus_tag LOCUS_21740 2010 3827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21740 >Feature sequence245 1253 579 gene locus_tag LOCUS_21750 1253 579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21750 >Feature sequence246 687 902 gene locus_tag LOCUS_21760 687 902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_21760 912 1646 gene locus_tag LOCUS_21770 912 1646 CDS product tRNA pseudouridine(65) synthase TruC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235044922.1 protein_id gnl|my_center|LOCUS_21770 2488 1640 gene locus_tag LOCUS_21780 2488 1640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21780 <3925 2485 gene locus_tag LOCUS_21790 <3925 2485 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012256205.1:right-handed parallel beta-helix repeat-containing protein >Feature sequence247 <1 1402 gene locus_tag LOCUS_21800 <1 1402 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011461820.1:radical SAM protein 1399 2574 gene locus_tag LOCUS_21810 1399 2574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21810 3749 2571 gene locus_tag LOCUS_21820 3749 2571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545363.1 protein_id gnl|my_center|LOCUS_21820 >Feature sequence248 1385 102 gene locus_tag LOCUS_21830 1385 102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21830 1520 1873 gene locus_tag LOCUS_21840 1520 1873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21840 1870 2742 gene locus_tag LOCUS_21850 gene mtnP 1870 2742 CDS product S-methyl-5'-thioadenosine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941773.1 protein_id gnl|my_center|LOCUS_21850 2751 3644 gene locus_tag LOCUS_21860 2751 3644 CDS product PfkB family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932656.1 protein_id gnl|my_center|LOCUS_21860 >Feature sequence249 548 333 gene locus_tag LOCUS_21870 548 333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21870 1132 551 gene locus_tag LOCUS_21880 1132 551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21880 1476 1129 gene locus_tag LOCUS_21890 1476 1129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21890 1920 1543 gene locus_tag LOCUS_21900 1920 1543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21900 2513 2037 gene locus_tag LOCUS_21910 2513 2037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21910 2704 2543 gene locus_tag LOCUS_21920 2704 2543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21920 3650 2883 gene locus_tag LOCUS_21930 3650 2883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21930 >Feature sequence250 1178 507 gene locus_tag LOCUS_21940 1178 507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21940 3417 1186 gene locus_tag LOCUS_21950 gene ppk1 3417 1186 CDS product polyphosphate kinase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943936.1 protein_id gnl|my_center|LOCUS_21950 >Feature sequence251 <1 1947 gene locus_tag LOCUS_21960 <1 1947 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000466031.1:alpha-glucosidase 2030 2992 gene locus_tag LOCUS_21970 2030 2992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21970 2992 3603 gene locus_tag LOCUS_21980 2992 3603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21980 >Feature sequence252 682 14 gene locus_tag LOCUS_21990 682 14 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21990 2135 714 gene locus_tag LOCUS_22000 2135 714 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941480.1 protein_id gnl|my_center|LOCUS_22000 2729 2181 gene locus_tag LOCUS_22010 2729 2181 CDS product OmpH family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545058.1 protein_id gnl|my_center|LOCUS_22010 <3833 2823 gene locus_tag LOCUS_22020 <3833 2823 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012546857.1:outer membrane protein assembly factor BamA >Feature sequence253 81 1160 gene locus_tag LOCUS_22030 81 1160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_22030 1117 1431 gene locus_tag LOCUS_22040 1117 1431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22040 1852 1442 gene locus_tag LOCUS_22050 1852 1442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_22050 2335 1856 gene locus_tag LOCUS_22060 2335 1856 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707183.1 protein_id gnl|my_center|LOCUS_22060 2536 2997 gene locus_tag LOCUS_22070 2536 2997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22070 3030 3737 gene locus_tag LOCUS_22080 3030 3737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22080 >Feature sequence254 1967 1224 gene locus_tag LOCUS_22090 1967 1224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22090 2691 1873 gene locus_tag LOCUS_22100 2691 1873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22100 <3816 2667 gene locus_tag LOCUS_22110 <3816 2667 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011339387.1:NAD(P)/FAD-dependent oxidoreductase >Feature sequence255 59 904 gene locus_tag LOCUS_22120 59 904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22120 938 1909 gene locus_tag LOCUS_22130 938 1909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22130 2239 1937 gene locus_tag LOCUS_22140 2239 1937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22140 3774 2230 gene locus_tag LOCUS_22150 gene guaA 3774 2230 CDS product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545424.1 protein_id gnl|my_center|LOCUS_22150 >Feature sequence256 303 1439 gene locus_tag LOCUS_22160 gene pimD 303 1439 CDS product pimeloyl-CoA dehydrogenase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090541.1 protein_id gnl|my_center|LOCUS_22160 2208 1444 gene locus_tag LOCUS_22170 2208 1444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22170 3806 2205 gene locus_tag LOCUS_22180 3806 2205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22180 >Feature sequence257 930 1799 gene locus_tag LOCUS_22190 930 1799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22190 1930 2325 gene locus_tag LOCUS_22200 1930 2325 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977738.1 protein_id gnl|my_center|LOCUS_22200 2388 2672 gene locus_tag LOCUS_22210 2388 2672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22210 2701 3546 gene locus_tag LOCUS_22220 2701 3546 CDS product crotonase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898463.1 protein_id gnl|my_center|LOCUS_22220 >Feature sequence258 >Feature sequence259 80 355 gene locus_tag LOCUS_22230 80 355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_22230 292 1311 gene locus_tag LOCUS_22240 gene gorA 292 1311 CDS product glutathione-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100366.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_22240 1456 2136 gene locus_tag LOCUS_22250 gene cysH 1456 2136 CDS product phosphoadenosine phosphosulfate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000080392.1 protein_id gnl|my_center|LOCUS_22250 2230 3504 gene locus_tag LOCUS_22260 2230 3504 CDS product UDP-2,3-diacylglucosamine diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258565.1 protein_id gnl|my_center|LOCUS_22260 >Feature sequence260 <1 954 gene locus_tag LOCUS_22270 <1 954 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013224376.1:alpha/beta hydrolase 1351 3129 gene locus_tag LOCUS_22280 1351 3129 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546592.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_22280 3134 3688 gene locus_tag LOCUS_22290 3134 3688 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545481.1 protein_id gnl|my_center|LOCUS_22290 >Feature sequence261 2209 116 gene locus_tag LOCUS_22300 2209 116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22300 3195 2683 gene locus_tag LOCUS_22310 3195 2683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22310 >Feature sequence262 1503 145 gene locus_tag LOCUS_22320 1503 145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22320 1704 3158 gene locus_tag LOCUS_22330 1704 3158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22330 >Feature sequence263 <1 974 gene locus_tag LOCUS_22340 <1 974 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005094688.1:sulfotransferase 1101 2414 gene locus_tag LOCUS_22350 1101 2414 CDS product NupC/NupG family nucleoside CNT transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003356704.1 protein_id gnl|my_center|LOCUS_22350 2485 2937 gene locus_tag LOCUS_22360 2485 2937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22360 >Feature sequence264 2795 321 gene locus_tag LOCUS_22370 2795 321 CDS product glycyl radical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459062.1 protein_id gnl|my_center|LOCUS_22370 2888 3673 gene locus_tag LOCUS_22380 2888 3673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22380 >Feature sequence265 1402 404 gene locus_tag LOCUS_22390 1402 404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22390 2954 1530 gene locus_tag LOCUS_22400 2954 1530 CDS product DUF1254 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967310.1 protein_id gnl|my_center|LOCUS_22400 >Feature sequence266 <1 1849 gene locus_tag LOCUS_22410 <1 1849 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007336886.1:HAD family hydrolase >Feature sequence267 935 396 gene locus_tag LOCUS_22420 935 396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22420 1087 968 gene locus_tag LOCUS_22430 1087 968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22430 1611 1168 gene locus_tag LOCUS_22440 1611 1168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22440 3321 1627 gene locus_tag LOCUS_22450 3321 1627 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878005.1 protein_id gnl|my_center|LOCUS_22450 >Feature sequence268 1272 160 gene locus_tag LOCUS_22460 1272 160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22460 1385 2128 gene locus_tag LOCUS_22470 1385 2128 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943147.1 protein_id gnl|my_center|LOCUS_22470 2125 3153 gene locus_tag LOCUS_22480 2125 3153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22480 >Feature sequence269 458 1261 gene locus_tag LOCUS_22490 458 1261 CDS product acyl-CoA thioesterase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028576.1 protein_id gnl|my_center|LOCUS_22490 1258 3354 gene locus_tag LOCUS_22500 1258 3354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22500 >Feature sequence270 458 1480 gene locus_tag LOCUS_22510 458 1480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22510 1553 2545 gene locus_tag LOCUS_22520 1553 2545 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005763555.1 protein_id gnl|my_center|LOCUS_22520 >Feature sequence271 1070 636 gene locus_tag LOCUS_22530 1070 636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_22530 1284 1709 gene locus_tag LOCUS_22540 1284 1709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22540 >Feature sequence272 886 374 gene locus_tag LOCUS_22550 886 374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22550 1468 953 gene locus_tag LOCUS_22560 1468 953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22560 1536 2894 gene locus_tag LOCUS_22570 1536 2894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22570 >Feature sequence273 831 2300 gene locus_tag LOCUS_22580 831 2300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22580 2785 2303 gene locus_tag LOCUS_22590 gene moaC 2785 2303 CDS product cyclic pyranopterin monophosphate synthase MoaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093030.1 protein_id gnl|my_center|LOCUS_22590 3120 2785 gene locus_tag LOCUS_22600 3120 2785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22600 >Feature sequence274 1018 551 gene locus_tag LOCUS_22610 1018 551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22610 1164 2525 gene locus_tag LOCUS_22620 1164 2525 CDS product NAD-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933237.1 protein_id gnl|my_center|LOCUS_22620 >Feature sequence275 1086 412 gene locus_tag LOCUS_22630 1086 412 CDS product TIGR00153 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479163.1 protein_id gnl|my_center|LOCUS_22630 1168 1857 gene locus_tag LOCUS_22640 1168 1857 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941763.1 protein_id gnl|my_center|LOCUS_22640 1894 3264 gene locus_tag LOCUS_22650 1894 3264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22650 >Feature sequence276 <1 1318 gene locus_tag LOCUS_22660 <1 1318 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011403201.1:2-oxoacid:acceptor oxidoreductase subunit alpha 1321 2277 gene locus_tag LOCUS_22670 1321 2277 CDS product 2-oxoacid:ferredoxin oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256841.1 protein_id gnl|my_center|LOCUS_22670 2474 2262 gene locus_tag LOCUS_22680 2474 2262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22680 >Feature sequence277 585 2624 gene locus_tag LOCUS_22690 585 2624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22690 2968 2621 gene locus_tag LOCUS_22700 2968 2621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22700 >Feature sequence278 1118 1465 gene locus_tag LOCUS_22710 1118 1465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22710 1478 2731 gene locus_tag LOCUS_22720 1478 2731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_22720 2822 3034 gene locus_tag LOCUS_22730 2822 3034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140805.1 protein_id gnl|my_center|LOCUS_22730 3570 3079 gene locus_tag LOCUS_22740 3570 3079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22740 >Feature sequence279 <1 1576 gene locus_tag LOCUS_22750 <1 1576 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011088552.1:PAS domain-containing protein 1573 2691 gene locus_tag LOCUS_22760 1573 2691 CDS product DNA adenine methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015931.1 protein_id gnl|my_center|LOCUS_22760 2666 3100 gene locus_tag LOCUS_22770 2666 3100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013221985.1 protein_id gnl|my_center|LOCUS_22770 3566 3201 gene locus_tag LOCUS_22780 3566 3201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22780 >Feature sequence280 265 68 gene locus_tag LOCUS_22790 265 68 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22790 765 280 gene locus_tag LOCUS_22800 765 280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22800 1462 863 gene locus_tag LOCUS_22810 gene recR 1462 863 CDS product recombination protein RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003225425.1 protein_id gnl|my_center|LOCUS_22810 1786 1466 gene locus_tag LOCUS_22820 1786 1466 CDS product YbaB/EbfC family nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359499.1 protein_id gnl|my_center|LOCUS_22820 3556 1796 gene locus_tag LOCUS_22830 gene dnaX 3556 1796 CDS product DNA polymerase III subunit gamma/tau inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940771.1 protein_id gnl|my_center|LOCUS_22830 >Feature sequence281 1924 497 gene locus_tag LOCUS_22840 1924 497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22840 2853 1993 gene locus_tag LOCUS_22850 gene argF 2853 1993 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940828.1 protein_id gnl|my_center|LOCUS_22850 <3550 2850 gene locus_tag LOCUS_22860 <3550 2850 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010940827.1:acetylornithine transaminase 3255 3273 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence282 3463 1355 gene locus_tag LOCUS_22870 3463 1355 CDS product methylmalonyl-CoA mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390233.1 protein_id gnl|my_center|LOCUS_22870 >Feature sequence283 1795 779 gene locus_tag LOCUS_22880 1795 779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405629.1 protein_id gnl|my_center|LOCUS_22880 3228 1816 gene locus_tag LOCUS_22890 3228 1816 CDS product coniferyl aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919715.1 protein_id gnl|my_center|LOCUS_22890 >Feature sequence284 22 1428 gene locus_tag LOCUS_22900 22 1428 CDS product DASS family sodium-coupled anion symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_096456532.1 protein_id gnl|my_center|LOCUS_22900 >Feature sequence285 536 1318 gene locus_tag LOCUS_22910 536 1318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22910 1311 2450 gene locus_tag LOCUS_22920 1311 2450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22920 3216 2455 gene locus_tag LOCUS_22930 3216 2455 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460483.1 protein_id gnl|my_center|LOCUS_22930 >Feature sequence286 451 143 gene locus_tag LOCUS_22940 451 143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22940 1540 461 gene locus_tag LOCUS_22950 1540 461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22950 <3488 1631 gene locus_tag LOCUS_22960 <3488 1631 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007330711.1:DNA topoisomerase IV subunit B >Feature sequence287 60 1307 gene locus_tag LOCUS_22970 60 1307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22970 1439 1738 gene locus_tag LOCUS_22980 1439 1738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22980 3453 1630 gene locus_tag LOCUS_22990 3453 1630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22990 >Feature sequence288 >Feature sequence289 1692 919 gene locus_tag LOCUS_23000 1692 919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23000 1992 2447 gene locus_tag LOCUS_23010 1992 2447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23010 3379 2438 gene locus_tag LOCUS_23020 3379 2438 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454103.1 protein_id gnl|my_center|LOCUS_23020 >Feature sequence290 280 313 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 754 1533 gene locus_tag LOCUS_23030 754 1533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_23030 1545 2750 gene locus_tag LOCUS_23040 1545 2750 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095742.1 protein_id gnl|my_center|LOCUS_23040 2762 3175 gene locus_tag LOCUS_23050 2762 3175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23050 >Feature sequence291 167 766 gene locus_tag LOCUS_23060 167 766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23060 1413 790 gene locus_tag LOCUS_23070 1413 790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23070 2990 1410 gene locus_tag LOCUS_23080 2990 1410 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640166.1 protein_id gnl|my_center|LOCUS_23080 2956 3108 gene locus_tag LOCUS_23090 2956 3108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23090 >Feature sequence292 90 749 gene locus_tag LOCUS_23100 90 749 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124862.1 protein_id gnl|my_center|LOCUS_23100 782 1798 gene locus_tag LOCUS_23110 782 1798 CDS product putative zinc-binding metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090184.1 protein_id gnl|my_center|LOCUS_23110 1783 2835 gene locus_tag LOCUS_23120 1783 2835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23120 3205 2717 gene locus_tag LOCUS_23130 3205 2717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23130 >Feature sequence293 2302 1415 gene locus_tag LOCUS_23140 2302 1415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23140 >Feature sequence294 102 287 gene locus_tag LOCUS_23150 102 287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23150 358 1623 gene locus_tag LOCUS_23160 358 1623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23160 1734 1991 gene locus_tag LOCUS_23170 1734 1991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23170 1976 3400 gene locus_tag LOCUS_23180 1976 3400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23180 >Feature sequence295 1429 248 gene locus_tag LOCUS_23190 1429 248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23190 2143 1499 gene locus_tag LOCUS_23200 2143 1499 CDS product RES family NAD+ phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531904.1 protein_id gnl|my_center|LOCUS_23200 2615 2238 gene locus_tag LOCUS_23210 2615 2238 CDS product MbcA/ParS/Xre antitoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971193.1 protein_id gnl|my_center|LOCUS_23210 <3418 2774 gene locus_tag LOCUS_23220 <3418 2774 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011459063.1:glycyl-radical enzyme activating protein >Feature sequence296 431 952 gene locus_tag LOCUS_23230 431 952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23230 1329 958 gene locus_tag LOCUS_23240 1329 958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197530034.1 protein_id gnl|my_center|LOCUS_23240 1768 1406 gene locus_tag LOCUS_23250 1768 1406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23250 2124 1765 gene locus_tag LOCUS_23260 2124 1765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23260 2899 2072 gene locus_tag LOCUS_23270 2899 2072 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902591.1 protein_id gnl|my_center|LOCUS_23270 >Feature sequence297 1017 1877 gene locus_tag LOCUS_23280 1017 1877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23280 1909 3192 gene locus_tag LOCUS_23290 1909 3192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23290 >Feature sequence298 >Feature sequence299 379 594 gene locus_tag LOCUS_23300 379 594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_23300 749 1030 gene locus_tag LOCUS_23310 749 1030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23310 1027 1443 gene locus_tag LOCUS_23320 1027 1443 CDS product secondary thiamine-phosphate synthase enzyme YjbQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958049.1 protein_id gnl|my_center|LOCUS_23320 3268 1481 gene locus_tag LOCUS_23330 3268 1481 CDS product AMP-dependent synthetase/ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090652.1 protein_id gnl|my_center|LOCUS_23330 >Feature sequence300 1775 627 gene locus_tag LOCUS_23340 1775 627 CDS product thiolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224426.1 protein_id gnl|my_center|LOCUS_23340 2728 1775 gene locus_tag LOCUS_23350 2728 1775 CDS product thiolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878491.1 protein_id gnl|my_center|LOCUS_23350 >Feature sequence301 81 377 gene locus_tag LOCUS_23360 81 377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23360 442 675 gene locus_tag LOCUS_23370 442 675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23370 678 1772 gene locus_tag LOCUS_23380 678 1772 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258472.1 protein_id gnl|my_center|LOCUS_23380 1949 2101 gene locus_tag LOCUS_23390 1949 2101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23390 2827 2132 gene locus_tag LOCUS_23400 2827 2132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23400 3042 2824 gene locus_tag LOCUS_23410 3042 2824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23410 >Feature sequence302 218 538 gene locus_tag LOCUS_23420 218 538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23420 538 1011 gene locus_tag LOCUS_23430 538 1011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_23430 900 1337 gene locus_tag LOCUS_23440 900 1337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_23440 1723 1340 gene locus_tag LOCUS_23450 1723 1340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23450 3015 1783 gene locus_tag LOCUS_23460 3015 1783 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000872256.1 protein_id gnl|my_center|LOCUS_23460 >Feature sequence303 438 1169 gene locus_tag LOCUS_23470 438 1169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_23470 1181 2089 gene locus_tag LOCUS_23480 1181 2089 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090525.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_23480 2468 2887 gene locus_tag LOCUS_23490 2468 2887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23490 >Feature sequence304 831 1499 gene locus_tag LOCUS_23500 831 1499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23500 3120 1474 gene locus_tag LOCUS_23510 3120 1474 CDS product GMC family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222688.1 protein_id gnl|my_center|LOCUS_23510 >Feature sequence305 863 1375 gene locus_tag LOCUS_23520 863 1375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23520 1386 2261 gene locus_tag LOCUS_23530 1386 2261 CDS product YicC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942879.1 protein_id gnl|my_center|LOCUS_23530 2307 2936 gene locus_tag LOCUS_23540 gene gmk 2307 2936 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942878.1 protein_id gnl|my_center|LOCUS_23540 >Feature sequence306 232 777 gene locus_tag LOCUS_23550 232 777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_23550 743 1396 gene locus_tag LOCUS_23560 743 1396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_23560 1468 1830 gene locus_tag LOCUS_23570 1468 1830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23570 2254 2475 gene locus_tag LOCUS_23580 2254 2475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_23580 <3288 2491 gene locus_tag LOCUS_23590 <3288 2491 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004902067.1:YgiQ family radical SAM protein >Feature sequence307 <1 593 gene locus_tag LOCUS_23600 <1 593 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010937382.1:DNA polymerase IV 715 2370 gene locus_tag LOCUS_23610 715 2370 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942540.1 protein_id gnl|my_center|LOCUS_23610 >Feature sequence308 1396 1058 gene locus_tag LOCUS_23620 1396 1058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23620 1722 1393 gene locus_tag LOCUS_23630 1722 1393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23630 2152 2460 gene locus_tag LOCUS_23640 2152 2460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23640 >Feature sequence309 102 953 gene locus_tag LOCUS_23650 102 953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23650 963 2405 gene locus_tag LOCUS_23660 963 2405 CDS product DUF1254 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965879.1 protein_id gnl|my_center|LOCUS_23660 3086 2415 gene locus_tag LOCUS_23670 3086 2415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23670 3161 3234 gene locus_tag LOCUS_t00130 3161 3234 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence310 1191 499 gene locus_tag LOCUS_23680 1191 499 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528184.1 protein_id gnl|my_center|LOCUS_23680 1382 1227 gene locus_tag LOCUS_23690 1382 1227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23690 1944 1405 gene locus_tag LOCUS_23700 1944 1405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_23700 >Feature sequence311 800 165 gene locus_tag LOCUS_23710 800 165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23710 1600 800 gene locus_tag LOCUS_23720 1600 800 CDS product crotonase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224429.1 protein_id gnl|my_center|LOCUS_23720 1760 2836 gene locus_tag LOCUS_23730 1760 2836 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896630.1 protein_id gnl|my_center|LOCUS_23730 >Feature sequence312 1699 2598 gene locus_tag LOCUS_23740 1699 2598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23740 3238 2585 gene locus_tag LOCUS_23750 3238 2585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23750 >Feature sequence313 432 1769 gene locus_tag LOCUS_23760 gene glgA 432 1769 CDS product glycogen synthase GlgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262948.1 protein_id gnl|my_center|LOCUS_23760 2453 1752 gene locus_tag LOCUS_23770 gene tsaB 2453 1752 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393646.1 protein_id gnl|my_center|LOCUS_23770 >Feature sequence314 695 2017 gene locus_tag LOCUS_23780 gene serS 695 2017 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869753.1 protein_id gnl|my_center|LOCUS_23780 2028 2471 gene locus_tag LOCUS_23790 2028 2471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_23790 2715 2434 gene locus_tag LOCUS_23800 2715 2434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23800 2641 2982 gene locus_tag LOCUS_23810 2641 2982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_23810 >Feature sequence315 1543 335 gene locus_tag LOCUS_23820 1543 335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23820 1667 2548 gene locus_tag LOCUS_23830 1667 2548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23830 2587 3174 gene locus_tag LOCUS_23840 2587 3174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23840 >Feature sequence316 1391 927 gene locus_tag LOCUS_23850 1391 927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23850 1743 1333 gene locus_tag LOCUS_23860 1743 1333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23860 >Feature sequence317 459 1283 gene locus_tag LOCUS_23870 459 1283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23870 1280 2113 gene locus_tag LOCUS_23880 1280 2113 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920181.1 protein_id gnl|my_center|LOCUS_23880 2159 2770 gene locus_tag LOCUS_23890 2159 2770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23890 >Feature sequence318 <1 793 gene locus_tag LOCUS_23900 <1 793 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015064354.1:amidohydrolase 990 2657 gene locus_tag LOCUS_23910 gene ftsH 990 2657 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143134.1 protein_id gnl|my_center|LOCUS_23910 <3176 2617 gene locus_tag LOCUS_23920 <3176 2617 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_226986783.1:HD domain-containing protein >Feature sequence319 420 656 gene locus_tag LOCUS_23930 420 656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23930 662 2542 gene locus_tag LOCUS_23940 gene acsA 662 2542 CDS product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000862095.1 protein_id gnl|my_center|LOCUS_23940 >Feature sequence320 386 1369 gene locus_tag LOCUS_23950 386 1369 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024311772.1 protein_id gnl|my_center|LOCUS_23950 1500 2768 gene locus_tag LOCUS_23960 1500 2768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23960 >Feature sequence321 1119 430 gene locus_tag LOCUS_23970 1119 430 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530738.1 protein_id gnl|my_center|LOCUS_23970 1232 1513 gene locus_tag LOCUS_23980 1232 1513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23980 1548 1916 gene locus_tag LOCUS_23990 1548 1916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23990 1975 2211 gene locus_tag LOCUS_24000 1975 2211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24000 2475 2266 gene locus_tag LOCUS_24010 2475 2266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24010 2935 2636 gene locus_tag LOCUS_24020 2935 2636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24020 >Feature sequence322 1869 565 gene locus_tag LOCUS_24030 gene tig 1869 565 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208322.1 protein_id gnl|my_center|LOCUS_24030 >Feature sequence323 2232 1504 gene locus_tag LOCUS_24040 2232 1504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030062.1 protein_id gnl|my_center|LOCUS_24040 >Feature sequence324 <1 2839 gene locus_tag LOCUS_24050 <1 2839 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003910517.1:protein kinase >Feature sequence325 <1 935 gene locus_tag LOCUS_24060 <1 935 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003896630.1:NAD-dependent epimerase/dehydratase family protein 932 1660 gene locus_tag LOCUS_24070 932 1660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24070 1672 2283 gene locus_tag LOCUS_24080 1672 2283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24080 >Feature sequence326 352 570 gene locus_tag LOCUS_24090 352 570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24090 751 551 gene locus_tag LOCUS_24100 751 551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24100 1296 691 gene locus_tag LOCUS_24110 1296 691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24110 2154 1300 gene locus_tag LOCUS_24120 2154 1300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24120 >Feature sequence327 276 52 gene locus_tag LOCUS_24130 276 52 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24130 558 298 gene locus_tag LOCUS_24140 558 298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24140 734 1108 gene locus_tag LOCUS_24150 734 1108 CDS product DUF4234 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879095.1 protein_id gnl|my_center|LOCUS_24150 1292 1567 gene locus_tag LOCUS_24160 1292 1567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24160 1580 2014 gene locus_tag LOCUS_24170 1580 2014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24170 2600 2160 gene locus_tag LOCUS_24180 2600 2160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24180 2799 2617 gene locus_tag LOCUS_24190 2799 2617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24190 >Feature sequence328 423 1112 gene locus_tag LOCUS_24200 423 1112 CDS product 1,4-dihydroxy-2-naphthoyl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074323.1 protein_id gnl|my_center|LOCUS_24200 1181 1633 gene locus_tag LOCUS_24210 1181 1633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24210 2004 2687 gene locus_tag LOCUS_24220 2004 2687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24220 >Feature sequence329 324 614 gene locus_tag LOCUS_24230 324 614 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943484.1 protein_id gnl|my_center|LOCUS_24230 617 1444 gene locus_tag LOCUS_24240 gene rplB 617 1444 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943483.1 protein_id gnl|my_center|LOCUS_24240 1444 1746 gene locus_tag LOCUS_24250 gene rpsS 1444 1746 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943482.1 protein_id gnl|my_center|LOCUS_24250 1749 2099 gene locus_tag LOCUS_24260 gene rplV 1749 2099 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000387527.1 protein_id gnl|my_center|LOCUS_24260 2103 2765 gene locus_tag LOCUS_24270 gene rpsC 2103 2765 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943480.1 protein_id gnl|my_center|LOCUS_24270 >Feature sequence330 <1 765 gene locus_tag LOCUS_24280 <1 765 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011038671.1:3-deoxy-7-phosphoheptulonate synthase 1178 825 gene locus_tag LOCUS_24290 1178 825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24290 2100 1081 gene locus_tag LOCUS_24300 2100 1081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24300 2512 2141 gene locus_tag LOCUS_24310 2512 2141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24310 2634 2831 gene locus_tag LOCUS_24320 2634 2831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24320 >Feature sequence331 244 1146 gene locus_tag LOCUS_24330 gene ppk2 244 1146 CDS product polyphosphate kinase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001086042.1 protein_id gnl|my_center|LOCUS_24330 1231 2094 gene locus_tag LOCUS_24340 1231 2094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24340 2841 2119 gene locus_tag LOCUS_24350 2841 2119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24350 >Feature sequence332 376 44 gene locus_tag LOCUS_24360 376 44 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24360 1314 856 gene locus_tag LOCUS_24370 1314 856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_24370 2419 1277 gene locus_tag LOCUS_24380 2419 1277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_24380 <2995 2416 gene locus_tag LOCUS_24390 <2995 2416 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_235433858.1:alpha/beta fold hydrolase >Feature sequence333 839 1105 gene locus_tag LOCUS_24400 839 1105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24400 1096 1893 gene locus_tag LOCUS_24410 1096 1893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24410 2076 2747 gene locus_tag LOCUS_24420 2076 2747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_24420 >Feature sequence334 245 1300 gene locus_tag LOCUS_24430 gene moaA 245 1300 CDS product GTP 3',8-cyclase MoaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339000.1 protein_id gnl|my_center|LOCUS_24430 2344 1331 gene locus_tag LOCUS_24440 2344 1331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24440 >Feature sequence335 25 114 gene locus_tag LOCUS_t00140 25 114 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 838 1962 gene locus_tag LOCUS_24450 838 1962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_24450 >Feature sequence336 >Feature sequence337 89 400 gene locus_tag LOCUS_24460 89 400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_24460 289 597 gene locus_tag LOCUS_24470 289 597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_24470 1769 594 gene locus_tag LOCUS_24480 1769 594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24480 >Feature sequence338 <1 831 gene locus_tag LOCUS_24490 <1 831 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005480130.1:HlyD family secretion protein 855 2339 gene locus_tag LOCUS_24500 855 2339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24500 >Feature sequence339 634 440 gene locus_tag LOCUS_24510 634 440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24510 1081 650 gene locus_tag LOCUS_24520 1081 650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24520 <2899 1082 gene locus_tag LOCUS_24530 <2899 1082 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004184731.1:Rieske 2Fe-2S domain-containing protein >Feature sequence340 1 963 gene locus_tag LOCUS_24540 1 963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24540 1908 988 gene locus_tag LOCUS_24550 1908 988 CDS product enoyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009873559.1 protein_id gnl|my_center|LOCUS_24550 1956 2780 gene locus_tag LOCUS_24560 1956 2780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_24560 >Feature sequence341 977 213 gene locus_tag LOCUS_24570 977 213 CDS product NAD-dependent deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112457.1 protein_id gnl|my_center|LOCUS_24570 1005 1589 gene locus_tag LOCUS_24580 gene msrA 1005 1589 CDS product peptide-methionine (S)-S-oxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_096571812.1 protein_id gnl|my_center|LOCUS_24580 >Feature sequence342 1253 111 gene locus_tag LOCUS_24590 1253 111 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770780.1 protein_id gnl|my_center|LOCUS_24590 2038 1259 gene locus_tag LOCUS_24600 2038 1259 CDS product enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973042.1 protein_id gnl|my_center|LOCUS_24600 2466 2035 gene locus_tag LOCUS_24610 2466 2035 CDS product YiiD C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114565.1 protein_id gnl|my_center|LOCUS_24610 >Feature sequence343 <1 765 gene locus_tag LOCUS_24620 <1 765 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941209.1:DNA polymerase I 1595 792 gene locus_tag LOCUS_24630 1595 792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24630 >Feature sequence344 1375 497 gene locus_tag LOCUS_24640 1375 497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24640 2634 1378 gene locus_tag LOCUS_24650 2634 1378 CDS product acetyl-CoA C-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005083037.1 protein_id gnl|my_center|LOCUS_24650 >Feature sequence345 911 402 gene locus_tag LOCUS_24660 911 402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24660 1426 908 gene locus_tag LOCUS_24670 1426 908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24670 2798 1452 gene locus_tag LOCUS_24680 2798 1452 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942141.1 protein_id gnl|my_center|LOCUS_24680 >Feature sequence346 205 519 gene locus_tag LOCUS_24690 205 519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24690 522 890 gene locus_tag LOCUS_24700 gene rplN 522 890 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390428.1 protein_id gnl|my_center|LOCUS_24700 890 1207 gene locus_tag LOCUS_24710 gene rplX 890 1207 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003728539.1 protein_id gnl|my_center|LOCUS_24710 1215 1766 gene locus_tag LOCUS_24720 gene rplE 1215 1766 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943474.1 protein_id gnl|my_center|LOCUS_24720 1971 2216 gene locus_tag LOCUS_24730 1971 2216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_24730 2216 2806 gene locus_tag LOCUS_24740 gene rplF 2216 2806 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919142.1 protein_id gnl|my_center|LOCUS_24740 >Feature sequence347 <1 732 gene locus_tag LOCUS_24750 <1 732 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012584121.1:C4-dicarboxylate TRAP transporter substrate-binding protein 988 1500 gene locus_tag LOCUS_24760 988 1500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_24760 1584 2213 gene locus_tag LOCUS_24770 1584 2213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_24770 2231 2614 gene locus_tag LOCUS_24780 2231 2614 CDS product DUF779 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727277.1 protein_id gnl|my_center|LOCUS_24780 >Feature sequence348 <2819 2111 gene locus_tag LOCUS_24790 <2819 2111 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012805031.1:Stk1 family PASTA domain-containing Ser/Thr kinase >Feature sequence349 988 74 gene locus_tag LOCUS_24800 988 74 CDS product DUF1571 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122738.1 protein_id gnl|my_center|LOCUS_24800 962 1186 gene locus_tag LOCUS_24810 962 1186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24810 1203 2522 gene locus_tag LOCUS_24820 1203 2522 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392350.1 protein_id gnl|my_center|LOCUS_24820 >Feature sequence350 345 121 gene locus_tag LOCUS_24830 345 121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_24830 1973 258 gene locus_tag LOCUS_24840 1973 258 CDS product AMP-dependent synthetase/ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229431.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_24840 2104 2490 gene locus_tag LOCUS_24850 2104 2490 CDS product GFA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090036.1 protein_id gnl|my_center|LOCUS_24850 >Feature sequence351 1441 2454 gene locus_tag LOCUS_24860 1441 2454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24860 >Feature sequence352 1484 555 gene locus_tag LOCUS_24870 1484 555 CDS product hydroxymethylglutaryl-CoA lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072000.1 protein_id gnl|my_center|LOCUS_24870 1585 2277 gene locus_tag LOCUS_24880 1585 2277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24880 >Feature sequence353 312 839 gene locus_tag LOCUS_24890 312 839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24890 929 1411 gene locus_tag LOCUS_24900 929 1411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24900 1408 1965 gene locus_tag LOCUS_24910 1408 1965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24910 >Feature sequence354 <2780 1845 gene locus_tag LOCUS_24920 <2780 1845 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003380226.1:two-component system response regulator OmpR >Feature sequence355 1380 226 gene locus_tag LOCUS_24930 1380 226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24930 >Feature sequence356 175 1407 gene locus_tag LOCUS_24940 175 1407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24940 1355 2119 gene locus_tag LOCUS_24950 1355 2119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24950 >Feature sequence357 18 470 gene locus_tag LOCUS_24960 18 470 CDS product nitroreductase family deazaflavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466832.1 protein_id gnl|my_center|LOCUS_24960 792 517 gene locus_tag LOCUS_24970 792 517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24970 1376 789 gene locus_tag LOCUS_24980 1376 789 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141762.1 protein_id gnl|my_center|LOCUS_24980 <2756 1376 gene locus_tag LOCUS_24990 <2756 1376 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_047816072.1:serine/threonine protein kinase >Feature sequence358 921 2666 gene locus_tag LOCUS_25000 921 2666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25000 >Feature sequence359 <1 520 gene locus_tag LOCUS_25010 <1 520 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011085686.1:bifunctional alpha/beta hydrolase/OsmC family protein 517 2568 gene locus_tag LOCUS_25020 517 2568 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925311.1 protein_id gnl|my_center|LOCUS_25020 >Feature sequence360 659 24 gene locus_tag LOCUS_25030 659 24 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25030 782 2281 gene locus_tag LOCUS_25040 782 2281 CDS product sigma 54-interacting transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235044917.1 protein_id gnl|my_center|LOCUS_25040 >Feature sequence361 642 2057 gene locus_tag LOCUS_25050 642 2057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25050 2054 2725 gene locus_tag LOCUS_25060 2054 2725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25060 >Feature sequence362 307 897 gene locus_tag LOCUS_25070 307 897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25070 955 2016 gene locus_tag LOCUS_25080 955 2016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25080 >Feature sequence363 1106 279 gene locus_tag LOCUS_25090 1106 279 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921011.1 protein_id gnl|my_center|LOCUS_25090 1157 1993 gene locus_tag LOCUS_25100 1157 1993 CDS product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977406.1 protein_id gnl|my_center|LOCUS_25100 >Feature sequence364 <1 2004 gene locus_tag LOCUS_25110 <1 2004 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_016269243.1:glycoside hydrolase family 31 protein 2730 2041 gene locus_tag LOCUS_25120 2730 2041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25120 >Feature sequence365 2380 1349 gene locus_tag LOCUS_25130 2380 1349 CDS product phosphatidylinositol-specific phospholipase C1-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920762.1 protein_id gnl|my_center|LOCUS_25130 >Feature sequence366 2062 767 gene locus_tag LOCUS_25140 2062 767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25140 >Feature sequence367 3 590 gene locus_tag LOCUS_25150 3 590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25150 590 2032 gene locus_tag LOCUS_25160 590 2032 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_092532455.1 protein_id gnl|my_center|LOCUS_25160 >Feature sequence368 1909 1019 gene locus_tag LOCUS_25170 1909 1019 CDS product 1,4-dihydroxy-2-naphthoate polyprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902772.1 protein_id gnl|my_center|LOCUS_25170 2655 1906 gene locus_tag LOCUS_25180 gene menH 2655 1906 CDS product 2-succinyl-6-hydroxy-2,4-cyclohexadiene-1-carboxylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255997.1 protein_id gnl|my_center|LOCUS_25180 >Feature sequence369 1037 501 gene locus_tag LOCUS_25190 1037 501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25190 1278 2624 gene locus_tag LOCUS_25200 1278 2624 CDS product cellulase family glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003089230.1 protein_id gnl|my_center|LOCUS_25200 >Feature sequence370 285 22 gene locus_tag LOCUS_25210 285 22 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_25210 809 375 gene locus_tag LOCUS_25220 809 375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_25220 1356 802 gene locus_tag LOCUS_25230 gene rfbC 1356 802 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870350.1 protein_id gnl|my_center|LOCUS_25230 2237 1356 gene locus_tag LOCUS_25240 gene rfbA 2237 1356 CDS product glucose-1-phosphate thymidylyltransferase RfbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097851.1 protein_id gnl|my_center|LOCUS_25240 >Feature sequence371 2146 497 gene locus_tag LOCUS_25250 gene pgi 2146 497 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932668.1 protein_id gnl|my_center|LOCUS_25250 >Feature sequence372 >Feature sequence373 38 1330 gene locus_tag LOCUS_25260 gene fadI 38 1330 CDS product acetyl-CoA C-acyltransferase FadI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000517921.1 protein_id gnl|my_center|LOCUS_25260 >Feature sequence374 230 754 gene locus_tag LOCUS_25270 gene hpt 230 754 CDS product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416006.1 protein_id gnl|my_center|LOCUS_25270 >Feature sequence375 29 1078 gene locus_tag LOCUS_25280 29 1078 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002067912.1 protein_id gnl|my_center|LOCUS_25280 2605 1136 gene locus_tag LOCUS_25290 2605 1136 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284768.1 protein_id gnl|my_center|LOCUS_25290 >Feature sequence376 383 27 gene locus_tag LOCUS_25300 383 27 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25300 876 301 gene locus_tag LOCUS_25310 876 301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25310 2098 860 gene locus_tag LOCUS_25320 2098 860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25320 >Feature sequence377 <1 1831 gene locus_tag LOCUS_25330 <1 1831 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942130.1:tetratricopeptide repeat protein >Feature sequence378 <1 703 gene locus_tag LOCUS_25340 <1 703 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015776786.1:sulfatase-like hydrolase/transferase 1175 750 gene locus_tag LOCUS_25350 1175 750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25350 2635 1172 gene locus_tag LOCUS_25360 2635 1172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25360 >Feature sequence379 606 863 gene locus_tag LOCUS_25370 606 863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_25370 >Feature sequence380 315 695 gene locus_tag LOCUS_25380 315 695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25380 689 1528 gene locus_tag LOCUS_25390 689 1528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25390 >Feature sequence381 397 119 gene locus_tag LOCUS_25400 397 119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25400 816 391 gene locus_tag LOCUS_25410 816 391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25410 1218 823 gene locus_tag LOCUS_25420 1218 823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25420 1664 1236 gene locus_tag LOCUS_25430 1664 1236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25430 2192 1668 gene locus_tag LOCUS_25440 2192 1668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_25440 >Feature sequence382 591 1295 gene locus_tag LOCUS_25450 591 1295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25450 2194 1292 gene locus_tag LOCUS_25460 gene truA 2194 1292 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943506.1 protein_id gnl|my_center|LOCUS_25460 >Feature sequence383 2400 1591 gene locus_tag LOCUS_25470 2400 1591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25470 >Feature sequence384 159 578 gene locus_tag LOCUS_25480 159 578 CDS product oxidation-sensing regulator MosR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405595.1 protein_id gnl|my_center|LOCUS_25480 672 1010 gene locus_tag LOCUS_25490 672 1010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25490 904 2280 gene locus_tag LOCUS_25500 904 2280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25500 >Feature sequence385 <1 715 gene locus_tag LOCUS_25510 <1 715 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003113262.1:glutathione S-transferase family protein <2571 712 gene locus_tag LOCUS_25520 <2571 712 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005478902.1:efflux RND transporter permease subunit VmeI >Feature sequence386 1360 335 gene locus_tag LOCUS_25530 1360 335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25530 2305 1361 gene locus_tag LOCUS_25540 2305 1361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25540 >Feature sequence387 1686 682 gene locus_tag LOCUS_25550 1686 682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25550 2549 1683 gene locus_tag LOCUS_25560 2549 1683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25560 >Feature sequence388 1828 500 gene locus_tag LOCUS_25570 1828 500 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682344.1 protein_id gnl|my_center|LOCUS_25570 >Feature sequence389 1554 568 gene locus_tag LOCUS_25580 1554 568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25580 <2534 1551 gene locus_tag LOCUS_25590 <2534 1551 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_162494117.1:arylsulfatase >Feature sequence390 696 905 gene locus_tag LOCUS_25600 696 905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25600 913 1275 gene locus_tag LOCUS_25610 913 1275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_25610 1685 2140 gene locus_tag LOCUS_25620 1685 2140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_25620 >Feature sequence391 1405 227 gene locus_tag LOCUS_25630 1405 227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25630 1630 2349 gene locus_tag LOCUS_25640 1630 2349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25640 >Feature sequence392 1393 386 gene locus_tag LOCUS_25650 1393 386 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111998.1 protein_id gnl|my_center|LOCUS_25650 2414 1413 gene locus_tag LOCUS_25660 2414 1413 CDS product C4-dicarboxylate TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584121.1 protein_id gnl|my_center|LOCUS_25660 >Feature sequence393 678 280 gene locus_tag LOCUS_25670 678 280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_25670 1959 763 gene locus_tag LOCUS_25680 gene clpX 1959 763 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942435.1 protein_id gnl|my_center|LOCUS_25680 >Feature sequence394 <1 1666 gene locus_tag LOCUS_25690 <1 1666 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011107585.1:GH92 family glycosyl hydrolase >Feature sequence395 1252 851 gene locus_tag LOCUS_25700 1252 851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25700 <2460 1281 gene locus_tag LOCUS_25710 <2460 1281 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005454162.1:arylsulfatase >Feature sequence396 34 957 gene locus_tag LOCUS_25720 34 957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25720 1007 1216 gene locus_tag LOCUS_25730 1007 1216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25730 2057 1260 gene locus_tag LOCUS_25740 2057 1260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25740 >Feature sequence397 340 984 gene locus_tag LOCUS_25750 340 984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25750 981 2168 gene locus_tag LOCUS_25760 981 2168 CDS product FAD/NAD(P)-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259724.1 protein_id gnl|my_center|LOCUS_25760 >Feature sequence398 <1 1171 gene locus_tag LOCUS_25770 <1 1171 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010940824.1:alanine--tRNA ligase 1172 1945 gene locus_tag LOCUS_25780 1172 1945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25780 1938 2357 gene locus_tag LOCUS_25790 1938 2357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_25790 >Feature sequence399 <1 649 gene locus_tag LOCUS_25800 <1 649 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000688696.1:NAD-dependent epimerase/dehydratase family protein 646 1119 gene locus_tag LOCUS_25810 gene tadA 646 1119 CDS product tRNA adenosine(34) deaminase TadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640954.1 protein_id gnl|my_center|LOCUS_25810 1252 1339 gene locus_tag LOCUS_t00150 1252 1339 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 1551 2336 gene locus_tag LOCUS_25820 1551 2336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25820 >Feature sequence400 440 516 gene locus_tag LOCUS_t00160 440 516 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence401 >Feature sequence402 3 1169 gene locus_tag LOCUS_25830 3 1169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25830 1178 2380 gene locus_tag LOCUS_25840 1178 2380 CDS product glycoside hydrolase family 57 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023945.1 protein_id gnl|my_center|LOCUS_25840 >Feature sequence403 1081 386 gene locus_tag LOCUS_25850 1081 386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25850 1803 1081 gene locus_tag LOCUS_25860 1803 1081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25860 >Feature sequence404 531 286 gene locus_tag LOCUS_25870 531 286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_25870 807 1061 gene locus_tag LOCUS_25880 807 1061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25880 1106 1996 gene locus_tag LOCUS_25890 1106 1996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25890 >Feature sequence405 >Feature sequence406 <1 516 gene locus_tag LOCUS_25900 <1 516 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005816731.1:acetolactate synthase small subunit 544 1557 gene locus_tag LOCUS_25910 gene ilvC 544 1557 CDS product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256075.1 protein_id gnl|my_center|LOCUS_25910 >Feature sequence407 840 1448 gene locus_tag LOCUS_25920 840 1448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25920 <2380 1456 gene locus_tag LOCUS_25930 <2380 1456 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164922962.1:DUF1552 domain-containing protein >Feature sequence408 <1 1000 gene locus_tag LOCUS_25940 <1 1000 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011261833.1:threonine--tRNA ligase 1065 1571 gene locus_tag LOCUS_25950 gene infC 1065 1571 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942163.1 protein_id gnl|my_center|LOCUS_25950 1612 2028 gene locus_tag LOCUS_25960 1612 2028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25960 >Feature sequence409 42 959 gene locus_tag LOCUS_25970 42 959 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004187634.1 protein_id gnl|my_center|LOCUS_25970 >Feature sequence410 822 280 gene locus_tag LOCUS_25980 822 280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25980 892 1257 gene locus_tag LOCUS_25990 892 1257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25990 >Feature sequence411 1475 822 gene locus_tag LOCUS_26000 1475 822 CDS product ZIP family zinc transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225190.1 protein_id gnl|my_center|LOCUS_26000 2140 1631 gene locus_tag LOCUS_26010 2140 1631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_26010 >Feature sequence412 1715 597 gene locus_tag LOCUS_26020 1715 597 CDS product thiolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889105.1 protein_id gnl|my_center|LOCUS_26020 <2342 1761 gene locus_tag LOCUS_26030 <2342 1761 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000486377.1:3-hydroxyacyl-CoA dehydrogenase/enoyl-CoA hydratase family protein >Feature sequence413 1010 390 gene locus_tag LOCUS_26040 1010 390 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966671.1 protein_id gnl|my_center|LOCUS_26040 2300 1011 gene locus_tag LOCUS_26050 2300 1011 CDS product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897085.1 protein_id gnl|my_center|LOCUS_26050 >Feature sequence414 1682 315 gene locus_tag LOCUS_26060 1682 315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26060 1872 2300 gene locus_tag LOCUS_26070 1872 2300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26070 >Feature sequence415 171 1136 gene locus_tag LOCUS_26080 171 1136 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902312.1 protein_id gnl|my_center|LOCUS_26080 1191 2012 gene locus_tag LOCUS_26090 1191 2012 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005061558.1 protein_id gnl|my_center|LOCUS_26090 >Feature sequence416 1081 869 gene locus_tag LOCUS_26100 1081 869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26100 1670 1143 gene locus_tag LOCUS_26110 1670 1143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26110 >Feature sequence417 108 1289 gene locus_tag LOCUS_26120 108 1289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26120 <2257 1286 gene locus_tag LOCUS_26130 <2257 1286 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013224754.1:biotin carboxylase N-terminal domain-containing protein >Feature sequence418 >Feature sequence419 597 1598 gene locus_tag LOCUS_26140 597 1598 CDS product NADP-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097826.1 protein_id gnl|my_center|LOCUS_26140 <2242 1609 gene locus_tag LOCUS_26150 <2242 1609 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002227868.1:tRNA1(Val) (adenine(37)-N6)-methyltransferase >Feature sequence420 >Feature sequence421 591 1460 gene locus_tag LOCUS_26160 591 1460 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902034.1 protein_id gnl|my_center|LOCUS_26160 >Feature sequence422 <1 1565 gene locus_tag LOCUS_26170 <1 1565 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013527896.1:transcription termination factor NusA 1569 2180 gene locus_tag LOCUS_26180 1569 2180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26180 >Feature sequence423 1303 143 gene locus_tag LOCUS_26190 1303 143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26190 2060 1335 gene locus_tag LOCUS_26200 2060 1335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26200 >Feature sequence424 344 814 gene locus_tag LOCUS_26210 344 814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_26210 <2230 832 gene locus_tag LOCUS_26220 <2230 832 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011086462.1:amidohydrolase family protein >Feature sequence425 107 358 gene locus_tag LOCUS_26230 107 358 CDS product GlsB/YeaQ/YmgE family stress response membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008500746.1 protein_id gnl|my_center|LOCUS_26230 2089 374 gene locus_tag LOCUS_26240 2089 374 CDS product carbon starvation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880806.1 protein_id gnl|my_center|LOCUS_26240 >Feature sequence426 >Feature sequence427 565 197 gene locus_tag LOCUS_26250 565 197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26250 <2201 760 gene locus_tag LOCUS_26260 <2201 760 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003106692.1:arylsulfatase AtsA >Feature sequence428 317 15 gene locus_tag LOCUS_26270 317 15 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26270 1233 328 gene locus_tag LOCUS_26280 1233 328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26280 <2196 1479 gene locus_tag LOCUS_26290 <2196 1479 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164928794.1:thioredoxin domain-containing protein >Feature sequence429 176 733 gene locus_tag LOCUS_26300 176 733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26300 1945 839 gene locus_tag LOCUS_26310 1945 839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26310 >Feature sequence430 >Feature sequence431 717 298 gene locus_tag LOCUS_26320 717 298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_26320 1796 720 gene locus_tag LOCUS_26330 1796 720 CDS product phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730231.1 protein_id gnl|my_center|LOCUS_26330 >Feature sequence432 1817 1002 gene locus_tag LOCUS_26340 1817 1002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26340 >Feature sequence433 1404 256 gene locus_tag LOCUS_26350 1404 256 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705166.1 protein_id gnl|my_center|LOCUS_26350 1455 2063 gene locus_tag LOCUS_26360 1455 2063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26360 >Feature sequence434 1 198 gene locus_tag LOCUS_26370 1 198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26370 1337 243 gene locus_tag LOCUS_26380 1337 243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26380 <2160 1473 gene locus_tag LOCUS_26390 <2160 1473 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000255354.1:type 1 glutamine amidotransferase domain-containing protein >Feature sequence435 <1 1354 gene locus_tag LOCUS_26400 <1 1354 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_103017237.1:SDR family oxidoreductase 1369 2133 gene locus_tag LOCUS_26410 1369 2133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26410 >Feature sequence436 247 438 gene locus_tag LOCUS_26420 247 438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26420 435 668 gene locus_tag LOCUS_26430 435 668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26430 665 979 gene locus_tag LOCUS_26440 665 979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26440 <2146 1150 gene locus_tag LOCUS_26450 <2146 1150 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003412350.1:Rv2407 family type 3 sulfatase >Feature sequence437 829 629 gene locus_tag LOCUS_26460 829 629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26460 961 1311 gene locus_tag LOCUS_26470 961 1311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_26470 >Feature sequence438 >Feature sequence439 1279 137 gene locus_tag LOCUS_26480 1279 137 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112221.1 protein_id gnl|my_center|LOCUS_26480 2121 1294 gene locus_tag LOCUS_26490 2121 1294 CDS product OB-fold domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224382.1 protein_id gnl|my_center|LOCUS_26490 >Feature sequence440 <1 547 gene locus_tag LOCUS_26500 <1 547 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003421145.1:amidohydrolase family protein 557 1237 gene locus_tag LOCUS_26510 557 1237 CDS product DUF4336 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837011.1 protein_id gnl|my_center|LOCUS_26510 >Feature sequence441 1304 15 gene locus_tag LOCUS_26520 1304 15 CDS product dihydrolipoamide acetyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766153.1 protein_id gnl|my_center|LOCUS_26520 1410 1736 gene locus_tag LOCUS_26530 1410 1736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26530 >Feature sequence442 423 1118 gene locus_tag LOCUS_26540 gene aqpZ 423 1118 CDS product aquaporin Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262065.1 protein_id gnl|my_center|LOCUS_26540 1115 1930 gene locus_tag LOCUS_26550 1115 1930 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895799.1 protein_id gnl|my_center|LOCUS_26550 >Feature sequence443 402 1634 gene locus_tag LOCUS_26560 402 1634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26560 >Feature sequence444 61 1923 gene locus_tag LOCUS_26570 61 1923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26570 >Feature sequence445 <1 1967 gene locus_tag LOCUS_26580 <1 1967 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004522336.1:aminopeptidase N >Feature sequence446 >Feature sequence447 1447 488 gene locus_tag LOCUS_26590 1447 488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330175.1 protein_id gnl|my_center|LOCUS_26590 1914 1468 gene locus_tag LOCUS_26600 1914 1468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26600 >Feature sequence448 1121 213 gene locus_tag LOCUS_26610 1121 213 CDS product OB-fold nucleic acid binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224428.1 protein_id gnl|my_center|LOCUS_26610 1484 1149 gene locus_tag LOCUS_26620 1484 1149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26620 1988 1620 gene locus_tag LOCUS_26630 1988 1620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26630 >Feature sequence449 >Feature sequence450 <1 646 gene locus_tag LOCUS_26640 <1 646 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008765451.1:MBOAT family protein >Feature sequence451 285 707 gene locus_tag LOCUS_26650 gene rplK 285 707 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966425.1 protein_id gnl|my_center|LOCUS_26650 795 1493 gene locus_tag LOCUS_26660 gene rplA 795 1493 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943496.1 protein_id gnl|my_center|LOCUS_26660 1496 2065 gene locus_tag LOCUS_26670 gene rplJ 1496 2065 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001832306.1 protein_id gnl|my_center|LOCUS_26670 >Feature sequence452 52 672 gene locus_tag LOCUS_26680 52 672 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974264.1 protein_id gnl|my_center|LOCUS_26680 707 1615 gene locus_tag LOCUS_26690 gene glpG 707 1615 CDS product rhomboid family intramembrane serine protease GlpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000928705.1 protein_id gnl|my_center|LOCUS_26690 2064 1645 gene locus_tag LOCUS_26700 2064 1645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26700 >Feature sequence453 406 891 gene locus_tag LOCUS_26710 406 891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26710 1903 905 gene locus_tag LOCUS_26720 1903 905 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001118268.1 protein_id gnl|my_center|LOCUS_26720 >Feature sequence454 636 1373 gene locus_tag LOCUS_26730 636 1373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_26730 1370 1903 gene locus_tag LOCUS_26740 1370 1903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26740 >Feature sequence455 <1 586 gene locus_tag LOCUS_26750 <1 586 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011337282.1:inorganic phosphate transporter note possible pseudo, frameshifted 475 957 gene locus_tag LOCUS_26760 475 957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_26760 >Feature sequence456 <1 1206 gene locus_tag LOCUS_26770 <1 1206 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011119132.1:glycosyltransferase family 4 protein 1203 1772 gene locus_tag LOCUS_26780 1203 1772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_26780