>Feature sequence001 756 3491 gene locus_tag LOCUS_00010 gene fdhF 756 3491 CDS product formate dehydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_080510933.1 protein_id gnl|my_center|LOCUS_00010 3488 3970 gene locus_tag LOCUS_00020 gene nuoE 3488 3970 CDS product NADH-quinone oxidoreductase subunit NuoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011343661.1 protein_id gnl|my_center|LOCUS_00020 3979 7104 gene locus_tag LOCUS_00030 3979 7104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00030 7107 7766 gene locus_tag LOCUS_00040 7107 7766 CDS product methylenetetrahydrofolate reductase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023431.1 protein_id gnl|my_center|LOCUS_00040 7928 8815 gene locus_tag LOCUS_00050 7928 8815 CDS product methylenetetrahydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436920.1 protein_id gnl|my_center|LOCUS_00050 9164 8841 gene locus_tag LOCUS_00060 9164 8841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00060 10110 9328 gene locus_tag LOCUS_00070 10110 9328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00070 11367 10132 gene locus_tag LOCUS_00080 11367 10132 CDS product beta-ketoacyl-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074037.1 protein_id gnl|my_center|LOCUS_00080 11661 11404 gene locus_tag LOCUS_00090 11661 11404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00090 12570 11788 gene locus_tag LOCUS_00100 12570 11788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00100 14535 12796 gene locus_tag LOCUS_00110 14535 12796 CDS product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939228.1 protein_id gnl|my_center|LOCUS_00110 14891 14538 gene locus_tag LOCUS_00120 14891 14538 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074029.1 protein_id gnl|my_center|LOCUS_00120 15354 16928 gene locus_tag LOCUS_00130 15354 16928 CDS product NAD(P)H-hydrate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393655.1 protein_id gnl|my_center|LOCUS_00130 17462 17238 gene locus_tag LOCUS_00140 17462 17238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00140 17664 18392 gene locus_tag LOCUS_00150 17664 18392 CDS product UPF0280 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583102.1 protein_id gnl|my_center|LOCUS_00150 18948 18460 gene locus_tag LOCUS_00160 18948 18460 CDS product zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943377.1 protein_id gnl|my_center|LOCUS_00160 19169 19645 gene locus_tag LOCUS_00170 19169 19645 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027329.1 protein_id gnl|my_center|LOCUS_00170 19656 20141 gene locus_tag LOCUS_00180 19656 20141 CDS product HIT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942345.1 protein_id gnl|my_center|LOCUS_00180 20283 20630 gene locus_tag LOCUS_00190 20283 20630 CDS product LapA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938940.1 protein_id gnl|my_center|LOCUS_00190 20937 22157 gene locus_tag LOCUS_00200 gene lapB 20937 22157 CDS product lipopolysaccharide assembly protein LapB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481625.1 protein_id gnl|my_center|LOCUS_00200 22167 24779 gene locus_tag LOCUS_00210 gene mutS 22167 24779 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942467.1 protein_id gnl|my_center|LOCUS_00210 24823 26550 gene locus_tag LOCUS_00220 24823 26550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00220 27579 26557 gene locus_tag LOCUS_00230 gene prfB 27579 26557 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942918.1 protein_id gnl|my_center|LOCUS_00230 28276 27785 gene locus_tag LOCUS_00240 28276 27785 CDS product DUF3124 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_139455833.1 protein_id gnl|my_center|LOCUS_00240 28809 29330 gene locus_tag LOCUS_00250 28809 29330 CDS product O-acetyl-ADP-ribose deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941194.1 protein_id gnl|my_center|LOCUS_00250 30417 29413 gene locus_tag LOCUS_00260 gene hpnH 30417 29413 CDS product adenosyl-hopene transferase HpnH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387821.1 protein_id gnl|my_center|LOCUS_00260 31124 30510 gene locus_tag LOCUS_00270 31124 30510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00270 32079 31237 gene locus_tag LOCUS_00280 32079 31237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00280 34842 32140 gene locus_tag LOCUS_00290 34842 32140 CDS product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190795.1 protein_id gnl|my_center|LOCUS_00290 36177 35032 gene locus_tag LOCUS_00300 36177 35032 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197530058.1 protein_id gnl|my_center|LOCUS_00300 37111 36308 gene locus_tag LOCUS_00310 37111 36308 CDS product mechanosensitive ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860622.1 protein_id gnl|my_center|LOCUS_00310 37383 37216 gene locus_tag LOCUS_00320 37383 37216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00320 37373 37558 gene locus_tag LOCUS_00330 37373 37558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00330 37769 37933 gene locus_tag LOCUS_00340 37769 37933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00340 38087 38890 gene locus_tag LOCUS_00350 38087 38890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00350 38895 41021 gene locus_tag LOCUS_00360 38895 41021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00360 41074 43812 gene locus_tag LOCUS_00370 41074 43812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00370 43826 45028 gene locus_tag LOCUS_00380 43826 45028 CDS product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919308.1 protein_id gnl|my_center|LOCUS_00380 45090 47096 gene locus_tag LOCUS_00390 45090 47096 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461059.1 protein_id gnl|my_center|LOCUS_00390 47291 47491 gene locus_tag LOCUS_00400 47291 47491 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288762.1 protein_id gnl|my_center|LOCUS_00400 48745 47579 gene locus_tag LOCUS_00410 48745 47579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00410 49741 48836 gene locus_tag LOCUS_00420 49741 48836 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462061.1 protein_id gnl|my_center|LOCUS_00420 51298 49745 gene locus_tag LOCUS_00430 51298 49745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00430 51233 51436 gene locus_tag LOCUS_00440 51233 51436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00440 51605 52825 gene locus_tag LOCUS_00450 51605 52825 CDS product nucleoside transporter C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088367.1 protein_id gnl|my_center|LOCUS_00450 53070 54236 gene locus_tag LOCUS_00460 53070 54236 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938190.1 protein_id gnl|my_center|LOCUS_00460 54260 55597 gene locus_tag LOCUS_00470 54260 55597 CDS product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545264.1 protein_id gnl|my_center|LOCUS_00470 55605 56825 gene locus_tag LOCUS_00480 55605 56825 CDS product cofactor-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545558.1 protein_id gnl|my_center|LOCUS_00480 56901 57584 gene locus_tag LOCUS_00490 56901 57584 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939218.1 protein_id gnl|my_center|LOCUS_00490 58520 57693 gene locus_tag LOCUS_00500 58520 57693 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964353.1 protein_id gnl|my_center|LOCUS_00500 61561 58493 gene locus_tag LOCUS_00510 61561 58493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00510 62289 61570 gene locus_tag LOCUS_00520 62289 61570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00520 62769 63140 gene locus_tag LOCUS_00530 62769 63140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00530 63447 64550 gene locus_tag LOCUS_00540 63447 64550 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583737.1 protein_id gnl|my_center|LOCUS_00540 >Feature sequence002 463 1002 gene locus_tag LOCUS_00550 463 1002 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948618.1 protein_id gnl|my_center|LOCUS_00550 1292 1083 gene locus_tag LOCUS_00560 1292 1083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00560 1656 1351 gene locus_tag LOCUS_00570 1656 1351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00570 1887 1717 gene locus_tag LOCUS_00580 1887 1717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00580 4084 1868 gene locus_tag LOCUS_00590 4084 1868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00590 4416 4081 gene locus_tag LOCUS_00600 4416 4081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00600 6069 4420 gene locus_tag LOCUS_00610 gene kaiC 6069 4420 CDS product circadian clock protein KaiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390295.1 protein_id gnl|my_center|LOCUS_00610 6308 6120 gene locus_tag LOCUS_00620 6308 6120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00620 7324 7070 gene locus_tag LOCUS_00630 7324 7070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00630 7326 7625 gene locus_tag LOCUS_00640 7326 7625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00640 9275 7932 gene locus_tag LOCUS_00650 9275 7932 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088880.1 protein_id gnl|my_center|LOCUS_00650 10224 9280 gene locus_tag LOCUS_00660 10224 9280 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088879.1 protein_id gnl|my_center|LOCUS_00660 11253 10240 gene locus_tag LOCUS_00670 11253 10240 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941622.1 protein_id gnl|my_center|LOCUS_00670 12942 11284 gene locus_tag LOCUS_00680 12942 11284 CDS product carboxyl transferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902654.1 protein_id gnl|my_center|LOCUS_00680 14343 13180 gene locus_tag LOCUS_00690 14343 13180 CDS product isovaleryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483372.1 protein_id gnl|my_center|LOCUS_00690 15202 16500 gene locus_tag LOCUS_00700 15202 16500 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392962.1 transl_except (pos:15892..15894,aa:Sec) note codon on position 231 is selenocysteine opal codon. protein_id gnl|my_center|LOCUS_00700 17326 16559 gene locus_tag LOCUS_00710 17326 16559 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403122.1 protein_id gnl|my_center|LOCUS_00710 17940 17323 gene locus_tag LOCUS_00720 17940 17323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00720 18997 17945 gene locus_tag LOCUS_00730 18997 17945 CDS product MlaD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403121.1 protein_id gnl|my_center|LOCUS_00730 20344 19190 gene locus_tag LOCUS_00740 20344 19190 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403123.1 protein_id gnl|my_center|LOCUS_00740 22676 20562 gene locus_tag LOCUS_00750 22676 20562 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583043.1 protein_id gnl|my_center|LOCUS_00750 23498 22698 gene locus_tag LOCUS_00760 23498 22698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00760 25075 23501 gene locus_tag LOCUS_00770 25075 23501 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942079.1 protein_id gnl|my_center|LOCUS_00770 26477 25509 gene locus_tag LOCUS_00780 26477 25509 CDS product RNA polymerase factor sigma-32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938875.1 protein_id gnl|my_center|LOCUS_00780 27853 26636 gene locus_tag LOCUS_00790 gene tyrS 27853 26636 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048264.1 protein_id gnl|my_center|LOCUS_00790 28880 27855 gene locus_tag LOCUS_00800 28880 27855 CDS product DUF4115 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939186.1 protein_id gnl|my_center|LOCUS_00800 29911 28991 gene locus_tag LOCUS_00810 29911 28991 CDS product SurA N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546060.1 protein_id gnl|my_center|LOCUS_00810 31008 30031 gene locus_tag LOCUS_00820 31008 30031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00820 34664 31101 gene locus_tag LOCUS_00830 gene mfd 34664 31101 CDS product transcription-repair coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940695.1 protein_id gnl|my_center|LOCUS_00830 35692 34766 gene locus_tag LOCUS_00840 35692 34766 CDS product LD-carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392232.1 protein_id gnl|my_center|LOCUS_00840 36474 35707 gene locus_tag LOCUS_00850 36474 35707 CDS product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942579.1 protein_id gnl|my_center|LOCUS_00850 37330 36482 gene locus_tag LOCUS_00860 gene folP 37330 36482 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545277.1 protein_id gnl|my_center|LOCUS_00860 39245 37332 gene locus_tag LOCUS_00870 gene ftsH 39245 37332 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_200858940.1 protein_id gnl|my_center|LOCUS_00870 39522 39334 gene locus_tag LOCUS_00880 39522 39334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00880 39553 40176 gene locus_tag LOCUS_00890 39553 40176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00890 40240 41592 gene locus_tag LOCUS_00900 40240 41592 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545408.1 protein_id gnl|my_center|LOCUS_00900 41592 44774 gene locus_tag LOCUS_00910 41592 44774 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544956.1 protein_id gnl|my_center|LOCUS_00910 44767 46203 gene locus_tag LOCUS_00920 44767 46203 CDS product efflux transporter outer membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_200855661.1 protein_id gnl|my_center|LOCUS_00920 46295 47092 gene locus_tag LOCUS_00930 46295 47092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00930 47527 47312 gene locus_tag LOCUS_00940 47527 47312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00940 47950 48321 gene locus_tag LOCUS_00950 47950 48321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00950 49889 48378 gene locus_tag LOCUS_00960 49889 48378 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017586463.1 protein_id gnl|my_center|LOCUS_00960 51782 49974 gene locus_tag LOCUS_00970 51782 49974 CDS product 3-oxoacid CoA-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000414123.1 protein_id gnl|my_center|LOCUS_00970 52561 51779 gene locus_tag LOCUS_00980 52561 51779 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090653.1 protein_id gnl|my_center|LOCUS_00980 53321 52542 gene locus_tag LOCUS_00990 53321 52542 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807268.1 protein_id gnl|my_center|LOCUS_00990 54361 53345 gene locus_tag LOCUS_01000 54361 53345 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090655.1 protein_id gnl|my_center|LOCUS_01000 55234 54368 gene locus_tag LOCUS_01010 55234 54368 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090656.1 protein_id gnl|my_center|LOCUS_01010 55766 55284 gene locus_tag LOCUS_01020 55766 55284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01020 >Feature sequence003 1386 1039 gene locus_tag LOCUS_01030 1386 1039 CDS product type II toxin-antitoxin system PemK/MazF family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000621175.1 protein_id gnl|my_center|LOCUS_01030 1598 1386 gene locus_tag LOCUS_01040 1598 1386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01040 1859 2989 gene locus_tag LOCUS_01050 1859 2989 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_074553996.1 protein_id gnl|my_center|LOCUS_01050 2971 3303 gene locus_tag LOCUS_01060 2971 3303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01060 3627 4073 gene locus_tag LOCUS_01070 gene mraZ 3627 4073 CDS product division/cell wall cluster transcriptional repressor MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172625480.1 protein_id gnl|my_center|LOCUS_01070 4089 5030 gene locus_tag LOCUS_01080 gene rsmH 4089 5030 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949033.1 protein_id gnl|my_center|LOCUS_01080 5027 5395 gene locus_tag LOCUS_01090 5027 5395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01090 5392 7377 gene locus_tag LOCUS_01100 5392 7377 CDS product penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943700.1 protein_id gnl|my_center|LOCUS_01100 7503 8984 gene locus_tag LOCUS_01110 7503 8984 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943699.1 protein_id gnl|my_center|LOCUS_01110 8994 10463 gene locus_tag LOCUS_01120 8994 10463 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943698.1 protein_id gnl|my_center|LOCUS_01120 10756 11121 gene locus_tag LOCUS_01130 10756 11121 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072313.1 protein_id gnl|my_center|LOCUS_01130 11175 12254 gene locus_tag LOCUS_01140 gene mraY 11175 12254 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943697.1 protein_id gnl|my_center|LOCUS_01140 12260 13678 gene locus_tag LOCUS_01150 gene murD 12260 13678 CDS product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943696.1 protein_id gnl|my_center|LOCUS_01150 13671 14774 gene locus_tag LOCUS_01160 gene ftsW 13671 14774 CDS product putative lipid II flippase FtsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943695.1 protein_id gnl|my_center|LOCUS_01160 14914 16035 gene locus_tag LOCUS_01170 gene murG 14914 16035 CDS product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943694.1 protein_id gnl|my_center|LOCUS_01170 16068 17474 gene locus_tag LOCUS_01180 gene murC 16068 17474 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943693.1 protein_id gnl|my_center|LOCUS_01180 17538 18470 gene locus_tag LOCUS_01190 gene murB 17538 18470 CDS product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943692.1 protein_id gnl|my_center|LOCUS_01190 18609 19361 gene locus_tag LOCUS_01200 18609 19361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01200 19475 20698 gene locus_tag LOCUS_01210 gene ftsA 19475 20698 CDS product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939770.1 protein_id gnl|my_center|LOCUS_01210 20816 22102 gene locus_tag LOCUS_01220 20816 22102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01220 22203 23990 gene locus_tag LOCUS_01230 22203 23990 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943687.1 protein_id gnl|my_center|LOCUS_01230 24713 25285 gene locus_tag LOCUS_01240 24713 25285 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393180.1 protein_id gnl|my_center|LOCUS_01240 25368 25856 gene locus_tag LOCUS_01250 25368 25856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01250 25868 29074 gene locus_tag LOCUS_01260 25868 29074 CDS product UvrD-helicase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943878.1 protein_id gnl|my_center|LOCUS_01260 29747 29454 gene locus_tag LOCUS_01270 29747 29454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01270 33112 29888 gene locus_tag LOCUS_01280 33112 29888 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000838383.1 protein_id gnl|my_center|LOCUS_01280 34800 33553 gene locus_tag LOCUS_01290 34800 33553 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057580.1 protein_id gnl|my_center|LOCUS_01290 36676 34793 gene locus_tag LOCUS_01300 gene mnmG 36676 34793 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944073.1 protein_id gnl|my_center|LOCUS_01300 37055 38278 gene locus_tag LOCUS_01310 37055 38278 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403144.1 protein_id gnl|my_center|LOCUS_01310 38325 39290 gene locus_tag LOCUS_01320 38325 39290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01320 39663 39959 gene locus_tag LOCUS_01330 39663 39959 CDS product MTH1187 family thiamine-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876811.1 protein_id gnl|my_center|LOCUS_01330 39979 40224 gene locus_tag LOCUS_01340 39979 40224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01340 41865 40297 gene locus_tag LOCUS_01350 41865 40297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01350 44751 41884 gene locus_tag LOCUS_01360 44751 41884 CDS product DUF799 family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545518.1 protein_id gnl|my_center|LOCUS_01360 46964 44748 gene locus_tag LOCUS_01370 46964 44748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01370 47949 47221 gene locus_tag LOCUS_01380 47949 47221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01380 >Feature sequence004 <1 826 gene locus_tag LOCUS_01390 <1 826 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012256973.1:ABC transporter ATP-binding protein 823 1683 gene locus_tag LOCUS_01400 823 1683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01400 3178 1808 gene locus_tag LOCUS_01410 3178 1808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01410 6408 3190 gene locus_tag LOCUS_01420 6408 3190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01420 7305 6511 gene locus_tag LOCUS_01430 7305 6511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01430 8709 7387 gene locus_tag LOCUS_01440 8709 7387 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939112.1 protein_id gnl|my_center|LOCUS_01440 8892 9524 gene locus_tag LOCUS_01450 8892 9524 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042064868.1 protein_id gnl|my_center|LOCUS_01450 9538 10203 gene locus_tag LOCUS_01460 9538 10203 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939817.1 protein_id gnl|my_center|LOCUS_01460 10316 11356 gene locus_tag LOCUS_01470 10316 11356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01470 11935 11519 gene locus_tag LOCUS_01480 gene vapC 11935 11519 CDS product tRNA(fMet)-specific endonuclease VapC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005170069.1 protein_id gnl|my_center|LOCUS_01480 12165 11935 gene locus_tag LOCUS_01490 12165 11935 CDS product antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005649046.1 protein_id gnl|my_center|LOCUS_01490 12479 12354 gene locus_tag LOCUS_01500 12479 12354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01500 12956 13159 gene locus_tag LOCUS_01510 12956 13159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01510 13406 14431 gene locus_tag LOCUS_01520 13406 14431 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051000281.1 protein_id gnl|my_center|LOCUS_01520 14582 15364 gene locus_tag LOCUS_01530 14582 15364 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496912.1 protein_id gnl|my_center|LOCUS_01530 15361 16170 gene locus_tag LOCUS_01540 15361 16170 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966629.1 protein_id gnl|my_center|LOCUS_01540 16191 16412 gene locus_tag LOCUS_01550 16191 16412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01550 17016 16384 gene locus_tag LOCUS_01560 17016 16384 CDS product YchE family NAAT transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210656.1 protein_id gnl|my_center|LOCUS_01560 18941 17142 gene locus_tag LOCUS_01570 18941 17142 CDS product KamA family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870139.1 protein_id gnl|my_center|LOCUS_01570 19121 20044 gene locus_tag LOCUS_01580 19121 20044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01580 20233 20060 gene locus_tag LOCUS_01590 20233 20060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01590 23086 20798 gene locus_tag LOCUS_01600 gene topA 23086 20798 CDS product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_203473432.1 protein_id gnl|my_center|LOCUS_01600 24185 23076 gene locus_tag LOCUS_01610 gene dprA 24185 23076 CDS product DNA-processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943186.1 protein_id gnl|my_center|LOCUS_01610 25339 24287 gene locus_tag LOCUS_01620 25339 24287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01620 25925 25647 gene locus_tag LOCUS_01630 25925 25647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01630 26212 28029 gene locus_tag LOCUS_01640 gene extM 26212 28029 CDS product selenite/tellurite reduction operon c-type cytochrome ExtM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943566.1 protein_id gnl|my_center|LOCUS_01640 28017 29789 gene locus_tag LOCUS_01650 gene extM 28017 29789 CDS product selenite/tellurite reduction operon c-type cytochrome ExtM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943566.1 protein_id gnl|my_center|LOCUS_01650 31746 30091 gene locus_tag LOCUS_01660 31746 30091 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583044.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01660 31630 31920 gene locus_tag LOCUS_01670 31630 31920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01670 32160 32447 gene locus_tag LOCUS_01680 32160 32447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01680 32477 33601 gene locus_tag LOCUS_01690 32477 33601 CDS product 2-oxoacid:acceptor oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869774.1 protein_id gnl|my_center|LOCUS_01690 33598 34455 gene locus_tag LOCUS_01700 33598 34455 CDS product 2-oxoacid:ferredoxin oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867632.1 protein_id gnl|my_center|LOCUS_01700 34452 35051 gene locus_tag LOCUS_01710 34452 35051 CDS product 2-oxoacid:ferredoxin oxidoreductase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496537.1 protein_id gnl|my_center|LOCUS_01710 35054 38461 gene locus_tag LOCUS_01720 35054 38461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01720 38561 40144 gene locus_tag LOCUS_01730 38561 40144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01730 40208 40837 gene locus_tag LOCUS_01740 40208 40837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_01740 40853 42568 gene locus_tag LOCUS_01750 40853 42568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_01750 >Feature sequence005 350 1369 gene locus_tag LOCUS_01760 350 1369 CDS product zinc-dependent dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545362.1 protein_id gnl|my_center|LOCUS_01760 1517 2527 gene locus_tag LOCUS_01770 gene hypE 1517 2527 CDS product hydrogenase expression/formation protein HypE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933452.1 protein_id gnl|my_center|LOCUS_01770 2854 3087 gene locus_tag LOCUS_01780 2854 3087 CDS product type II toxin-antitoxin system prevent-host-death family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061623.1 protein_id gnl|my_center|LOCUS_01780 3084 3455 gene locus_tag LOCUS_01790 3084 3455 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532314.1 protein_id gnl|my_center|LOCUS_01790 4024 3626 gene locus_tag LOCUS_01800 4024 3626 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141769.1 protein_id gnl|my_center|LOCUS_01800 4248 4021 gene locus_tag LOCUS_01810 4248 4021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01810 4810 5025 gene locus_tag LOCUS_01820 4810 5025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01820 5594 7174 gene locus_tag LOCUS_01830 5594 7174 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005086603.1 protein_id gnl|my_center|LOCUS_01830 7205 7933 gene locus_tag LOCUS_01840 7205 7933 CDS product tRNA 2-thiocytidine(32) synthetase TtcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003362794.1 protein_id gnl|my_center|LOCUS_01840 9762 8251 gene locus_tag LOCUS_01850 9762 8251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01850 10865 9849 gene locus_tag LOCUS_01860 10865 9849 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250751.1 protein_id gnl|my_center|LOCUS_01860 11826 10873 gene locus_tag LOCUS_01870 11826 10873 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002670599.1 protein_id gnl|my_center|LOCUS_01870 12729 11827 gene locus_tag LOCUS_01880 12729 11827 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385788.1 protein_id gnl|my_center|LOCUS_01880 13772 12795 gene locus_tag LOCUS_01890 13772 12795 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385787.1 protein_id gnl|my_center|LOCUS_01890 15606 13852 gene locus_tag LOCUS_01900 15606 13852 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970501.1 protein_id gnl|my_center|LOCUS_01900 16631 15603 gene locus_tag LOCUS_01910 gene gshB 16631 15603 CDS product glutathione synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056752.1 protein_id gnl|my_center|LOCUS_01910 17540 16653 gene locus_tag LOCUS_01920 17540 16653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01920 19236 17551 gene locus_tag LOCUS_01930 19236 17551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01930 19632 20843 gene locus_tag LOCUS_01940 gene cdaA 19632 20843 CDS product diadenylate cyclase CdaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941532.1 protein_id gnl|my_center|LOCUS_01940 21753 20875 gene locus_tag LOCUS_01950 21753 20875 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390908.1 protein_id gnl|my_center|LOCUS_01950 22329 21943 gene locus_tag LOCUS_01960 gene queF 22329 21943 CDS product preQ(1) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080885.1 protein_id gnl|my_center|LOCUS_01960 22991 22464 gene locus_tag LOCUS_01970 22991 22464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01970 26274 23017 gene locus_tag LOCUS_01980 26274 23017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01980 26578 27387 gene locus_tag LOCUS_01990 26578 27387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01990 27666 27358 gene locus_tag LOCUS_02000 27666 27358 CDS product HNH endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942712.1 protein_id gnl|my_center|LOCUS_02000 29252 27666 gene locus_tag LOCUS_02010 29252 27666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02010 29709 30356 gene locus_tag LOCUS_02020 29709 30356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02020 30843 31418 gene locus_tag LOCUS_02030 gene grpE 30843 31418 CDS product nucleotide exchange factor GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816478.1 protein_id gnl|my_center|LOCUS_02030 31546 33456 gene locus_tag LOCUS_02040 gene dnaK 31546 33456 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940711.1 protein_id gnl|my_center|LOCUS_02040 33453 35408 gene locus_tag LOCUS_02050 33453 35408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02050 36245 35463 gene locus_tag LOCUS_02060 36245 35463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02060 36636 36238 gene locus_tag LOCUS_02070 36636 36238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02070 37151 36660 gene locus_tag LOCUS_02080 37151 36660 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546022.1 protein_id gnl|my_center|LOCUS_02080 37899 37267 gene locus_tag LOCUS_02090 37899 37267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02090 39616 37940 gene locus_tag LOCUS_02100 gene argS 39616 37940 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_039648220.1 protein_id gnl|my_center|LOCUS_02100 40713 39613 gene locus_tag LOCUS_02110 gene alr 40713 39613 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941268.1 protein_id gnl|my_center|LOCUS_02110 >Feature sequence006 2091 1141 gene locus_tag LOCUS_02120 2091 1141 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232632.1 protein_id gnl|my_center|LOCUS_02120 4582 2135 gene locus_tag LOCUS_02130 gene copA 4582 2135 CDS product copper-exporting P-type ATPase CopA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242925.1 protein_id gnl|my_center|LOCUS_02130 4792 4589 gene locus_tag LOCUS_02140 4792 4589 CDS product copper ion binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461873.1 protein_id gnl|my_center|LOCUS_02140 5198 5554 gene locus_tag LOCUS_02150 5198 5554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048124573.1 protein_id gnl|my_center|LOCUS_02150 5978 5778 gene locus_tag LOCUS_02160 5978 5778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02160 7440 6007 gene locus_tag LOCUS_02170 gene lpdA 7440 6007 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393264.1 protein_id gnl|my_center|LOCUS_02170 7778 7464 gene locus_tag LOCUS_02180 7778 7464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02180 8360 7959 gene locus_tag LOCUS_02190 8360 7959 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958096.1 protein_id gnl|my_center|LOCUS_02190 8578 8345 gene locus_tag LOCUS_02200 8578 8345 CDS product ribbon-helix-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770787.1 protein_id gnl|my_center|LOCUS_02200 9812 8664 gene locus_tag LOCUS_02210 9812 8664 CDS product geranylgeranyl reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880006.1 protein_id gnl|my_center|LOCUS_02210 10717 9860 gene locus_tag LOCUS_02220 10717 9860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02220 11949 13727 gene locus_tag LOCUS_02230 11949 13727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02230 14082 13819 gene locus_tag LOCUS_02240 14082 13819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02240 16317 15337 gene locus_tag LOCUS_02250 16317 15337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02250 19872 16324 gene locus_tag LOCUS_02260 19872 16324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02260 20571 20299 gene locus_tag LOCUS_02270 20571 20299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02270 21217 21468 gene locus_tag LOCUS_02280 gene yefM 21217 21468 CDS product YoeB-YefM toxin-antitoxin system antitoxin YefM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001259253.1 protein_id gnl|my_center|LOCUS_02280 21465 21719 gene locus_tag LOCUS_02290 gene yoeB 21465 21719 CDS product type II toxin-antitoxin system mRNA interferase toxin YoeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000767829.1 protein_id gnl|my_center|LOCUS_02290 21915 22427 gene locus_tag LOCUS_02300 21915 22427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02300 22396 22611 gene locus_tag LOCUS_02310 22396 22611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02310 23610 22771 gene locus_tag LOCUS_02320 23610 22771 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009896899.1 protein_id gnl|my_center|LOCUS_02320 24136 23840 gene locus_tag LOCUS_02330 24136 23840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02330 24652 24362 gene locus_tag LOCUS_02340 24652 24362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02340 26295 25069 gene locus_tag LOCUS_02350 26295 25069 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393701.1 protein_id gnl|my_center|LOCUS_02350 28092 26365 gene locus_tag LOCUS_02360 28092 26365 CDS product hydantoinase B/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226376432.1 protein_id gnl|my_center|LOCUS_02360 30268 28169 gene locus_tag LOCUS_02370 30268 28169 CDS product hydantoinase/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229602.1 protein_id gnl|my_center|LOCUS_02370 32714 30336 gene locus_tag LOCUS_02380 32714 30336 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861444.1 protein_id gnl|my_center|LOCUS_02380 33360 32887 gene locus_tag LOCUS_02390 33360 32887 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062284418.1 protein_id gnl|my_center|LOCUS_02390 34235 33357 gene locus_tag LOCUS_02400 34235 33357 CDS product xanthine dehydrogenase family protein subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969635.1 protein_id gnl|my_center|LOCUS_02400 35547 34252 gene locus_tag LOCUS_02410 35547 34252 CDS product phenylacetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942694.1 protein_id gnl|my_center|LOCUS_02410 37034 35730 gene locus_tag LOCUS_02420 37034 35730 CDS product TRAP transporter large permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942699.1 protein_id gnl|my_center|LOCUS_02420 37523 37038 gene locus_tag LOCUS_02430 37523 37038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02430 38671 37649 gene locus_tag LOCUS_02440 38671 37649 CDS product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942697.1 protein_id gnl|my_center|LOCUS_02440 40769 39141 gene locus_tag LOCUS_02450 40769 39141 CDS product methylmalonyl-CoA mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879704.1 protein_id gnl|my_center|LOCUS_02450 41252 40851 gene locus_tag LOCUS_02460 41252 40851 CDS product cobalamin B12-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942223.1 protein_id gnl|my_center|LOCUS_02460 >Feature sequence007 173 1273 gene locus_tag LOCUS_02470 173 1273 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250726.1 protein_id gnl|my_center|LOCUS_02470 1381 2703 gene locus_tag LOCUS_02480 1381 2703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02480 2752 3456 gene locus_tag LOCUS_02490 gene lipB 2752 3456 CDS product lipoyl(octanoyl) transferase LipB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011174104.1 protein_id gnl|my_center|LOCUS_02490 3536 3772 gene locus_tag LOCUS_02500 3536 3772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02500 3786 4538 gene locus_tag LOCUS_02510 gene fabG 3786 4538 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460500.1 protein_id gnl|my_center|LOCUS_02510 5984 4593 gene locus_tag LOCUS_02520 gene asnS 5984 4593 CDS product asparagine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058304.1 protein_id gnl|my_center|LOCUS_02520 7099 6014 gene locus_tag LOCUS_02530 gene serC 7099 6014 CDS product 3-phosphoserine/phosphohydroxythreonine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256881.1 protein_id gnl|my_center|LOCUS_02530 7875 7114 gene locus_tag LOCUS_02540 7875 7114 CDS product carbon monoxide dehydrogenase accessory protein CooC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888532.1 protein_id gnl|my_center|LOCUS_02540 8265 7987 gene locus_tag LOCUS_02550 8265 7987 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002290178.1 protein_id gnl|my_center|LOCUS_02550 8800 9306 gene locus_tag LOCUS_02560 8800 9306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_02560 9325 9693 gene locus_tag LOCUS_02570 9325 9693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_02570 10074 11000 gene locus_tag LOCUS_02580 10074 11000 CDS product 2-dehydropantoate 2-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963695.1 protein_id gnl|my_center|LOCUS_02580 11042 11203 gene locus_tag LOCUS_02590 11042 11203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02590 11456 11674 gene locus_tag LOCUS_02600 11456 11674 CDS product MoaD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762698.1 protein_id gnl|my_center|LOCUS_02600 11801 13675 gene locus_tag LOCUS_02610 gene aor 11801 13675 CDS product aldehyde ferredoxin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868080.1 protein_id gnl|my_center|LOCUS_02610 13798 14622 gene locus_tag LOCUS_02620 gene nifU 13798 14622 CDS product Fe-S cluster assembly protein NifU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937968.1 protein_id gnl|my_center|LOCUS_02620 14619 15803 gene locus_tag LOCUS_02630 gene nifS 14619 15803 CDS product cysteine desulfurase NifS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942654.1 protein_id gnl|my_center|LOCUS_02630 15814 16788 gene locus_tag LOCUS_02640 15814 16788 CDS product serine acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120272.1 protein_id gnl|my_center|LOCUS_02640 16806 17735 gene locus_tag LOCUS_02650 gene cysK 16806 17735 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932382.1 protein_id gnl|my_center|LOCUS_02650 18052 18327 gene locus_tag LOCUS_02660 18052 18327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02660 20531 18450 gene locus_tag LOCUS_02670 20531 18450 CDS product DUF1926 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250760.1 protein_id gnl|my_center|LOCUS_02670 20732 21493 gene locus_tag LOCUS_02680 20732 21493 CDS product FadR/GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811089.1 protein_id gnl|my_center|LOCUS_02680 21542 22609 gene locus_tag LOCUS_02690 21542 22609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02690 22653 24593 gene locus_tag LOCUS_02700 22653 24593 CDS product TRAP transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_133957058.1 protein_id gnl|my_center|LOCUS_02700 24590 25585 gene locus_tag LOCUS_02710 24590 25585 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012296290.1 protein_id gnl|my_center|LOCUS_02710 25856 27520 gene locus_tag LOCUS_02720 25856 27520 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814052.1 protein_id gnl|my_center|LOCUS_02720 27567 27779 gene locus_tag LOCUS_02730 27567 27779 CDS product ferredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814054.1 protein_id gnl|my_center|LOCUS_02730 27843 30056 gene locus_tag LOCUS_02740 27843 30056 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861481.1 protein_id gnl|my_center|LOCUS_02740 30053 30550 gene locus_tag LOCUS_02750 30053 30550 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810043.1 protein_id gnl|my_center|LOCUS_02750 30596 31348 gene locus_tag LOCUS_02760 30596 31348 CDS product protein-L-isoaspartate(D-aspartate) O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141698.1 protein_id gnl|my_center|LOCUS_02760 31430 31981 gene locus_tag LOCUS_02770 31430 31981 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393013.1 protein_id gnl|my_center|LOCUS_02770 31978 32577 gene locus_tag LOCUS_02780 31978 32577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02780 32786 32962 gene locus_tag LOCUS_02790 32786 32962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02790 33283 33011 gene locus_tag LOCUS_02800 33283 33011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02800 34111 33389 gene locus_tag LOCUS_02810 34111 33389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02810 35295 34102 gene locus_tag LOCUS_02820 35295 34102 CDS product PilT/PilU family type 4a pilus ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545245.1 protein_id gnl|my_center|LOCUS_02820 36394 35312 gene locus_tag LOCUS_02830 36394 35312 CDS product type IV pilus twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546105.1 protein_id gnl|my_center|LOCUS_02830 36908 36609 gene locus_tag LOCUS_02840 36908 36609 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000221356.1 protein_id gnl|my_center|LOCUS_02840 37152 36898 gene locus_tag LOCUS_02850 37152 36898 CDS product type II toxin-antitoxin system Phd/YefM family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001250181.1 protein_id gnl|my_center|LOCUS_02850 37716 38552 gene locus_tag LOCUS_02860 gene panB 37716 38552 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287874.1 protein_id gnl|my_center|LOCUS_02860 38581 39507 gene locus_tag LOCUS_02870 38581 39507 CDS product 2-dehydropantoate 2-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258713.1 protein_id gnl|my_center|LOCUS_02870 40069 39527 gene locus_tag LOCUS_02880 40069 39527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02880 >Feature sequence008 991 98 gene locus_tag LOCUS_02890 991 98 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02890 2325 991 gene locus_tag LOCUS_02900 gene miaB 2325 991 CDS product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942838.1 protein_id gnl|my_center|LOCUS_02900 2557 2315 gene locus_tag LOCUS_02910 2557 2315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02910 3438 2557 gene locus_tag LOCUS_02920 3438 2557 CDS product NAD(+)/NADH kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942707.1 protein_id gnl|my_center|LOCUS_02920 5192 3441 gene locus_tag LOCUS_02930 gene ade 5192 3441 CDS product adenine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338640.1 protein_id gnl|my_center|LOCUS_02930 5832 5227 gene locus_tag LOCUS_02940 5832 5227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02940 6885 5875 gene locus_tag LOCUS_02950 6885 5875 CDS product gluconokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880139.1 protein_id gnl|my_center|LOCUS_02950 7775 6882 gene locus_tag LOCUS_02960 7775 6882 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942094.1 protein_id gnl|my_center|LOCUS_02960 8575 7955 gene locus_tag LOCUS_02970 8575 7955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02970 9081 9902 gene locus_tag LOCUS_02980 9081 9902 CDS product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933475.1 protein_id gnl|my_center|LOCUS_02980 11178 10063 gene locus_tag LOCUS_02990 gene ribD 11178 10063 CDS product bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942331.1 protein_id gnl|my_center|LOCUS_02990 11658 11188 gene locus_tag LOCUS_03000 gene nrdR 11658 11188 CDS product transcriptional regulator NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942330.1 protein_id gnl|my_center|LOCUS_03000 12071 11655 gene locus_tag LOCUS_03010 12071 11655 CDS product cytidine/deoxycytidylate deaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942329.1 protein_id gnl|my_center|LOCUS_03010 13458 12199 gene locus_tag LOCUS_03020 13458 12199 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583175.1 protein_id gnl|my_center|LOCUS_03020 13879 13451 gene locus_tag LOCUS_03030 gene rpiB 13879 13451 CDS product ribose 5-phosphate isomerase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546357.1 protein_id gnl|my_center|LOCUS_03030 15473 14229 gene locus_tag LOCUS_03040 gene fabF 15473 14229 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544941.1 protein_id gnl|my_center|LOCUS_03040 15887 15651 gene locus_tag LOCUS_03050 gene acpP 15887 15651 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006081231.1 protein_id gnl|my_center|LOCUS_03050 16727 15972 gene locus_tag LOCUS_03060 gene fabG 16727 15972 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989818.1 protein_id gnl|my_center|LOCUS_03060 17746 16751 gene locus_tag LOCUS_03070 gene plsX 17746 16751 CDS product phosphate acyltransferase PlsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938504.1 protein_id gnl|my_center|LOCUS_03070 17930 17748 gene locus_tag LOCUS_03080 gene rpmF 17930 17748 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942244.1 protein_id gnl|my_center|LOCUS_03080 18785 18252 gene locus_tag LOCUS_03090 18785 18252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03090 19184 20245 gene locus_tag LOCUS_03100 19184 20245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03100 20297 21733 gene locus_tag LOCUS_03110 gene gltX 20297 21733 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941876.1 protein_id gnl|my_center|LOCUS_03110 22567 21800 gene locus_tag LOCUS_03120 gene lgt 22567 21800 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583316.1 protein_id gnl|my_center|LOCUS_03120 23027 22572 gene locus_tag LOCUS_03130 gene lspA 23027 22572 CDS product signal peptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939214.1 protein_id gnl|my_center|LOCUS_03130 25822 23024 gene locus_tag LOCUS_03140 gene ileS 25822 23024 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943758.1 protein_id gnl|my_center|LOCUS_03140 26603 26271 gene locus_tag LOCUS_03150 26603 26271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03150 26895 26584 gene locus_tag LOCUS_03160 26895 26584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03160 27305 28066 gene locus_tag LOCUS_03170 27305 28066 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546451.1 protein_id gnl|my_center|LOCUS_03170 28398 29399 gene locus_tag LOCUS_03180 28398 29399 CDS product DHH family phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937763.1 protein_id gnl|my_center|LOCUS_03180 29447 30814 gene locus_tag LOCUS_03190 gene mgtE 29447 30814 CDS product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404919.1 protein_id gnl|my_center|LOCUS_03190 32685 30811 gene locus_tag LOCUS_03200 gene uvrC 32685 30811 CDS product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876080.1 protein_id gnl|my_center|LOCUS_03200 33187 34047 gene locus_tag LOCUS_03210 33187 34047 CDS product ChaN family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012164238.1 protein_id gnl|my_center|LOCUS_03210 34540 35832 gene locus_tag LOCUS_03220 gene hisD 34540 35832 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496833.1 protein_id gnl|my_center|LOCUS_03220 35905 36354 gene locus_tag LOCUS_03230 gene gcvH 35905 36354 CDS product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391976.1 protein_id gnl|my_center|LOCUS_03230 36371 37438 gene locus_tag LOCUS_03240 36371 37438 CDS product lipoate--protein ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979957.1 protein_id gnl|my_center|LOCUS_03240 37491 38675 gene locus_tag LOCUS_03250 37491 38675 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391983.1 protein_id gnl|my_center|LOCUS_03250 38824 38900 gene locus_tag LOCUS_t00010 38824 38900 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 39739 39359 gene locus_tag LOCUS_03260 39739 39359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03260 >Feature sequence009 2320 2003 gene locus_tag LOCUS_03270 2320 2003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03270 6834 2362 gene locus_tag LOCUS_03280 6834 2362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03280 7852 7025 gene locus_tag LOCUS_03290 7852 7025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03290 8502 7849 gene locus_tag LOCUS_03300 8502 7849 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328727.1 protein_id gnl|my_center|LOCUS_03300 9282 9710 gene locus_tag LOCUS_03310 9282 9710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03310 11049 9754 gene locus_tag LOCUS_03320 11049 9754 CDS product folylpolyglutamate synthase/dihydrofolate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943004.1 protein_id gnl|my_center|LOCUS_03320 13475 11322 gene locus_tag LOCUS_03330 13475 11322 CDS product ATP-dependent helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937467.1 protein_id gnl|my_center|LOCUS_03330 14548 13736 gene locus_tag LOCUS_03340 14548 13736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03340 14817 14545 gene locus_tag LOCUS_03350 14817 14545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03350 15403 16005 gene locus_tag LOCUS_03360 gene cobC 15403 16005 CDS product alpha-ribazole phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041914029.1 protein_id gnl|my_center|LOCUS_03360 16085 18244 gene locus_tag LOCUS_03370 16085 18244 CDS product ATPase, T2SS/T4P/T4SS family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943246.1 protein_id gnl|my_center|LOCUS_03370 18271 19071 gene locus_tag LOCUS_03380 18271 19071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03380 20777 19227 gene locus_tag LOCUS_03390 gene cobA 20777 19227 CDS product uroporphyrinogen-III C-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938035.1 protein_id gnl|my_center|LOCUS_03390 21709 20774 gene locus_tag LOCUS_03400 gene hemC 21709 20774 CDS product hydroxymethylbilane synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939176.1 protein_id gnl|my_center|LOCUS_03400 22538 21783 gene locus_tag LOCUS_03410 gene ispD 22538 21783 CDS product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943979.1 protein_id gnl|my_center|LOCUS_03410 22986 22603 gene locus_tag LOCUS_03420 22986 22603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03420 23894 23148 gene locus_tag LOCUS_03430 23894 23148 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943067.1 protein_id gnl|my_center|LOCUS_03430 25276 23954 gene locus_tag LOCUS_03440 25276 23954 CDS product nodulation protein NfeD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546843.1 protein_id gnl|my_center|LOCUS_03440 26024 25269 gene locus_tag LOCUS_03450 26024 25269 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941787.1 protein_id gnl|my_center|LOCUS_03450 27219 26014 gene locus_tag LOCUS_03460 gene coaBC 27219 26014 CDS product bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941785.1 protein_id gnl|my_center|LOCUS_03460 28063 27563 gene locus_tag LOCUS_03470 28063 27563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03470 28903 28130 gene locus_tag LOCUS_03480 28903 28130 CDS product NAD-dependent deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545809.1 protein_id gnl|my_center|LOCUS_03480 29662 28928 gene locus_tag LOCUS_03490 29662 28928 CDS product DUF4197 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941866.1 protein_id gnl|my_center|LOCUS_03490 32159 29865 gene locus_tag LOCUS_03500 32159 29865 CDS product xanthine dehydrogenase family protein molybdopterin-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975050.1 protein_id gnl|my_center|LOCUS_03500 32653 32162 gene locus_tag LOCUS_03510 32653 32162 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062284418.1 protein_id gnl|my_center|LOCUS_03510 33725 32724 gene locus_tag LOCUS_03520 33725 32724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03520 35113 33860 gene locus_tag LOCUS_03530 gene hemL 35113 33860 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878736.1 protein_id gnl|my_center|LOCUS_03530 36244 35129 gene locus_tag LOCUS_03540 36244 35129 CDS product saccharopine dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879085.1 protein_id gnl|my_center|LOCUS_03540 37799 36657 gene locus_tag LOCUS_03550 37799 36657 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017276276.1 protein_id gnl|my_center|LOCUS_03550 39044 37941 gene locus_tag LOCUS_03560 gene ald 39044 37941 CDS product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583412.1 protein_id gnl|my_center|LOCUS_03560 >Feature sequence010 1069 221 gene locus_tag LOCUS_03570 1069 221 CDS product UbiA-like polyprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_084205587.1 protein_id gnl|my_center|LOCUS_03570 2505 1066 gene locus_tag LOCUS_03580 2505 1066 CDS product menaquinone biosynthesis decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391643.1 protein_id gnl|my_center|LOCUS_03580 3724 2567 gene locus_tag LOCUS_03590 3724 2567 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940160.1 protein_id gnl|my_center|LOCUS_03590 4797 3724 gene locus_tag LOCUS_03600 gene mqnC 4797 3724 CDS product cyclic dehypoxanthinyl futalosine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940023.1 protein_id gnl|my_center|LOCUS_03600 5938 4736 gene locus_tag LOCUS_03610 gene mqnE 5938 4736 CDS product aminofutalosine synthase MqnE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940022.1 protein_id gnl|my_center|LOCUS_03610 8965 6035 gene locus_tag LOCUS_03620 8965 6035 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071225.1 protein_id gnl|my_center|LOCUS_03620 10240 9053 gene locus_tag LOCUS_03630 10240 9053 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103015670.1 protein_id gnl|my_center|LOCUS_03630 11949 10480 gene locus_tag LOCUS_03640 11949 10480 CDS product efflux transporter outer membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403254.1 protein_id gnl|my_center|LOCUS_03640 12599 11949 gene locus_tag LOCUS_03650 12599 11949 CDS product DUF1956 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792895.1 protein_id gnl|my_center|LOCUS_03650 14117 12753 gene locus_tag LOCUS_03660 14117 12753 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941261.1 protein_id gnl|my_center|LOCUS_03660 15598 14129 gene locus_tag LOCUS_03670 15598 14129 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940686.1 protein_id gnl|my_center|LOCUS_03670 17592 15595 gene locus_tag LOCUS_03680 17592 15595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03680 17840 17589 gene locus_tag LOCUS_03690 17840 17589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03690 18917 17985 gene locus_tag LOCUS_03700 18917 17985 CDS product methylenetetrahydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392705.1 protein_id gnl|my_center|LOCUS_03700 19582 18914 gene locus_tag LOCUS_03710 19582 18914 CDS product methylenetetrahydrofolate reductase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392706.1 protein_id gnl|my_center|LOCUS_03710 20019 19603 gene locus_tag LOCUS_03720 20019 19603 CDS product hydrogenase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392707.1 protein_id gnl|my_center|LOCUS_03720 22889 20151 gene locus_tag LOCUS_03730 22889 20151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03730 23215 23661 gene locus_tag LOCUS_03740 23215 23661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03740 23790 24428 gene locus_tag LOCUS_03750 23790 24428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03750 24716 24438 gene locus_tag LOCUS_03760 24716 24438 CDS product TMEM165/GDT1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140124.1 protein_id gnl|my_center|LOCUS_03760 25173 25802 gene locus_tag LOCUS_03770 25173 25802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03770 25973 26773 gene locus_tag LOCUS_03780 25973 26773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03780 26795 26968 gene locus_tag LOCUS_03790 26795 26968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03790 26991 27227 gene locus_tag LOCUS_03800 26991 27227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03800 27342 29009 gene locus_tag LOCUS_03810 27342 29009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03810 29716 29057 gene locus_tag LOCUS_03820 29716 29057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03820 31064 29748 gene locus_tag LOCUS_03830 31064 29748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03830 31667 32146 gene locus_tag LOCUS_03840 31667 32146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03840 32146 32625 gene locus_tag LOCUS_03850 32146 32625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03850 33389 32745 gene locus_tag LOCUS_03860 33389 32745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03860 34444 33386 gene locus_tag LOCUS_03870 34444 33386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03870 35660 34602 gene locus_tag LOCUS_03880 35660 34602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03880 37145 35688 gene locus_tag LOCUS_03890 37145 35688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03890 38252 37185 gene locus_tag LOCUS_03900 38252 37185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03900 39452 38271 gene locus_tag LOCUS_03910 gene nrfD 39452 38271 CDS product polysulfide reductase NrfD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071541886.1 protein_id gnl|my_center|LOCUS_03910 >Feature sequence011 238 723 gene locus_tag LOCUS_03920 238 723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03920 1049 3922 gene locus_tag LOCUS_03930 1049 3922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03930 3984 4928 gene locus_tag LOCUS_03940 3984 4928 CDS product TIGR01212 family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461526.1 protein_id gnl|my_center|LOCUS_03940 4871 5296 gene locus_tag LOCUS_03950 4871 5296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_03950 5947 5402 gene locus_tag LOCUS_03960 5947 5402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03960 6296 5973 gene locus_tag LOCUS_03970 6296 5973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03970 6852 6325 gene locus_tag LOCUS_03980 6852 6325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03980 7107 7031 gene locus_tag LOCUS_t00020 7107 7031 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 8207 7224 gene locus_tag LOCUS_03990 8207 7224 CDS product electron transfer flavoprotein subunit alpha/FixB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817156.1 protein_id gnl|my_center|LOCUS_03990 9112 8318 gene locus_tag LOCUS_04000 9112 8318 CDS product electron transfer flavoprotein subunit beta/FixA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817158.1 protein_id gnl|my_center|LOCUS_04000 9762 9172 gene locus_tag LOCUS_04010 gene fadR 9762 9172 CDS product fatty acid metabolism transcriptional regulator FadR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229547.1 protein_id gnl|my_center|LOCUS_04010 10289 10002 gene locus_tag LOCUS_04020 10289 10002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04020 10773 11981 gene locus_tag LOCUS_04030 10773 11981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04030 11978 12808 gene locus_tag LOCUS_04040 11978 12808 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227942.1 protein_id gnl|my_center|LOCUS_04040 12844 14658 gene locus_tag LOCUS_04050 12844 14658 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227943.1 protein_id gnl|my_center|LOCUS_04050 14675 15487 gene locus_tag LOCUS_04060 14675 15487 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227944.1 protein_id gnl|my_center|LOCUS_04060 15596 16186 gene locus_tag LOCUS_04070 15596 16186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04070 16141 16554 gene locus_tag LOCUS_04080 16141 16554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04080 16567 17370 gene locus_tag LOCUS_04090 16567 17370 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227947.1 protein_id gnl|my_center|LOCUS_04090 17470 22176 gene locus_tag LOCUS_04100 17470 22176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04100 23526 22213 gene locus_tag LOCUS_04110 23526 22213 CDS product TRAP transporter large permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942699.1 protein_id gnl|my_center|LOCUS_04110 24008 23523 gene locus_tag LOCUS_04120 24008 23523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04120 25108 24083 gene locus_tag LOCUS_04130 25108 24083 CDS product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942697.1 protein_id gnl|my_center|LOCUS_04130 25721 25548 gene locus_tag LOCUS_04140 25721 25548 CDS product Trm112 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937959.1 protein_id gnl|my_center|LOCUS_04140 26812 25718 gene locus_tag LOCUS_04150 gene waaC 26812 25718 CDS product lipopolysaccharide heptosyltransferase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546021.1 protein_id gnl|my_center|LOCUS_04150 27493 26909 gene locus_tag LOCUS_04160 gene gmhB 27493 26909 CDS product D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942726.1 protein_id gnl|my_center|LOCUS_04160 28533 27490 gene locus_tag LOCUS_04170 gene waaF 28533 27490 CDS product lipopolysaccharide heptosyltransferase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942896.1 protein_id gnl|my_center|LOCUS_04170 29911 28703 gene locus_tag LOCUS_04180 gene lpxK 29911 28703 CDS product tetraacyldisaccharide 4'-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942898.1 protein_id gnl|my_center|LOCUS_04180 31253 29901 gene locus_tag LOCUS_04190 31253 29901 CDS product 3-deoxy-D-manno-octulosonic acid transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942899.1 protein_id gnl|my_center|LOCUS_04190 33495 31261 gene locus_tag LOCUS_04200 33495 31261 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941478.1 protein_id gnl|my_center|LOCUS_04200 34123 33539 gene locus_tag LOCUS_04210 34123 33539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04210 35339 34407 gene locus_tag LOCUS_04220 gene lpxC 35339 34407 CDS product UDP-3-O-acyl-N-acetylglucosamine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707578.1 protein_id gnl|my_center|LOCUS_04220 35684 36901 gene locus_tag LOCUS_04230 35684 36901 CDS product murein transglycosylase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938186.1 protein_id gnl|my_center|LOCUS_04230 36907 37179 gene locus_tag LOCUS_04240 36907 37179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04240 37204 37548 gene locus_tag LOCUS_04250 37204 37548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04250 37781 38725 gene locus_tag LOCUS_04260 37781 38725 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009292180.1 protein_id gnl|my_center|LOCUS_04260 >Feature sequence012 900 688 gene locus_tag LOCUS_04270 900 688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04270 1556 1113 gene locus_tag LOCUS_04280 1556 1113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04280 2170 1556 gene locus_tag LOCUS_04290 2170 1556 CDS product DUF488 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390294.1 protein_id gnl|my_center|LOCUS_04290 2685 2260 gene locus_tag LOCUS_04300 2685 2260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04300 2871 2689 gene locus_tag LOCUS_04310 2871 2689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04310 5905 3020 gene locus_tag LOCUS_04320 5905 3020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04320 6384 7037 gene locus_tag LOCUS_04330 6384 7037 CDS product XTP/dITP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942438.1 protein_id gnl|my_center|LOCUS_04330 7407 7559 gene locus_tag LOCUS_04340 7407 7559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04340 7578 7772 gene locus_tag LOCUS_04350 7578 7772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04350 8301 7867 gene locus_tag LOCUS_04360 8301 7867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04360 8663 9322 gene locus_tag LOCUS_04370 8663 9322 CDS product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020542.1 protein_id gnl|my_center|LOCUS_04370 11337 9319 gene locus_tag LOCUS_04380 gene tkt 11337 9319 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142294.1 protein_id gnl|my_center|LOCUS_04380 11972 12199 gene locus_tag LOCUS_04390 11972 12199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04390 13728 12196 gene locus_tag LOCUS_04400 gene rng 13728 12196 CDS product ribonuclease G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943853.1 protein_id gnl|my_center|LOCUS_04400 16279 13775 gene locus_tag LOCUS_04410 16279 13775 CDS product TIGR03960 family B12-binding radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943854.1 protein_id gnl|my_center|LOCUS_04410 18174 16462 gene locus_tag LOCUS_04420 18174 16462 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942140.1 protein_id gnl|my_center|LOCUS_04420 19396 18185 gene locus_tag LOCUS_04430 19396 18185 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942139.1 protein_id gnl|my_center|LOCUS_04430 19852 20064 gene locus_tag LOCUS_04440 19852 20064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04440 20717 20262 gene locus_tag LOCUS_04450 20717 20262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04450 21955 20813 gene locus_tag LOCUS_04460 21955 20813 CDS product sodium ion-translocating decarboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879576.1 protein_id gnl|my_center|LOCUS_04460 22327 24003 gene locus_tag LOCUS_04470 22327 24003 CDS product methylmalonyl-CoA mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869041.1 protein_id gnl|my_center|LOCUS_04470 24239 24637 gene locus_tag LOCUS_04480 24239 24637 CDS product cobalamin B12-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255952.1 protein_id gnl|my_center|LOCUS_04480 25483 24716 gene locus_tag LOCUS_04490 25483 24716 CDS product short-chain-enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048188.1 protein_id gnl|my_center|LOCUS_04490 26760 25624 gene locus_tag LOCUS_04500 26760 25624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04500 27931 26828 gene locus_tag LOCUS_04510 27931 26828 CDS product alcohol dehydrogenase catalytic domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762093.1 protein_id gnl|my_center|LOCUS_04510 28957 28172 gene locus_tag LOCUS_04520 gene fabG 28957 28172 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000911773.1 protein_id gnl|my_center|LOCUS_04520 29232 30689 gene locus_tag LOCUS_04530 gene thrC 29232 30689 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108281.1 protein_id gnl|my_center|LOCUS_04530 31601 32869 gene locus_tag LOCUS_04540 gene hflX 31601 32869 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000460362.1 protein_id gnl|my_center|LOCUS_04540 34233 32971 gene locus_tag LOCUS_04550 34233 32971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04550 34524 34447 gene locus_tag LOCUS_t00030 34524 34447 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 34766 36400 gene locus_tag LOCUS_04560 34766 36400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04560 37339 36539 gene locus_tag LOCUS_04570 37339 36539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04570 >Feature sequence013 244 981 gene locus_tag LOCUS_04580 244 981 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256973.1 protein_id gnl|my_center|LOCUS_04580 965 1741 gene locus_tag LOCUS_04590 965 1741 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090653.1 protein_id gnl|my_center|LOCUS_04590 1732 3570 gene locus_tag LOCUS_04600 1732 3570 CDS product AMP-dependent synthetase/ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090652.1 protein_id gnl|my_center|LOCUS_04600 3676 4884 gene locus_tag LOCUS_04610 3676 4884 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063921375.1 protein_id gnl|my_center|LOCUS_04610 4979 5548 gene locus_tag LOCUS_04620 4979 5548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04620 5890 7944 gene locus_tag LOCUS_04630 5890 7944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04630 8093 8902 gene locus_tag LOCUS_04640 8093 8902 CDS product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707640.1 protein_id gnl|my_center|LOCUS_04640 8938 10590 gene locus_tag LOCUS_04650 8938 10590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04650 10604 11326 gene locus_tag LOCUS_04660 10604 11326 CDS product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071482.1 protein_id gnl|my_center|LOCUS_04660 11515 12000 gene locus_tag LOCUS_04670 11515 12000 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106290.1 protein_id gnl|my_center|LOCUS_04670 11969 13225 gene locus_tag LOCUS_04680 11969 13225 CDS product protein-glutamate O-methyltransferase CheR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113845.1 protein_id gnl|my_center|LOCUS_04680 13312 13977 gene locus_tag LOCUS_04690 13312 13977 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525366.1 protein_id gnl|my_center|LOCUS_04690 13974 17330 gene locus_tag LOCUS_04700 13974 17330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04700 17327 17899 gene locus_tag LOCUS_04710 17327 17899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04710 17841 18329 gene locus_tag LOCUS_04720 17841 18329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04720 18331 19791 gene locus_tag LOCUS_04730 18331 19791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04730 19970 21160 gene locus_tag LOCUS_04740 19970 21160 CDS product SpoIIE family protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056995.1 protein_id gnl|my_center|LOCUS_04740 21477 23573 gene locus_tag LOCUS_04750 21477 23573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04750 24229 23642 gene locus_tag LOCUS_04760 gene yihA 24229 23642 CDS product ribosome biogenesis GTP-binding protein YihA/YsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943641.1 protein_id gnl|my_center|LOCUS_04760 25377 24229 gene locus_tag LOCUS_04770 25377 24229 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020683.1 protein_id gnl|my_center|LOCUS_04770 26249 25377 gene locus_tag LOCUS_04780 gene hisG 26249 25377 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937425.1 protein_id gnl|my_center|LOCUS_04780 26647 26246 gene locus_tag LOCUS_04790 gene hisI 26647 26246 CDS product phosphoribosyl-AMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937424.1 protein_id gnl|my_center|LOCUS_04790 27022 27957 gene locus_tag LOCUS_04800 27022 27957 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250984.1 protein_id gnl|my_center|LOCUS_04800 28680 27970 gene locus_tag LOCUS_04810 28680 27970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04810 29065 28640 gene locus_tag LOCUS_04820 29065 28640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04820 29943 29131 gene locus_tag LOCUS_04830 gene mscS 29943 29131 CDS product small-conductance mechanosensitive channel MscS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482477.1 protein_id gnl|my_center|LOCUS_04830 31166 30372 gene locus_tag LOCUS_04840 31166 30372 CDS product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010925816.1 protein_id gnl|my_center|LOCUS_04840 31886 31185 gene locus_tag LOCUS_04850 31886 31185 CDS product acetate--CoA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867475.1 protein_id gnl|my_center|LOCUS_04850 32403 31897 gene locus_tag LOCUS_04860 32403 31897 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014810586.1 protein_id gnl|my_center|LOCUS_04860 33667 32441 gene locus_tag LOCUS_04870 33667 32441 CDS product Tm-1-like ATP-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122999.1 protein_id gnl|my_center|LOCUS_04870 35090 33690 gene locus_tag LOCUS_04880 35090 33690 CDS product CoA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249895.1 protein_id gnl|my_center|LOCUS_04880 35197 35421 gene locus_tag LOCUS_04890 35197 35421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04890 35390 36199 gene locus_tag LOCUS_04900 gene recO 35390 36199 CDS product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941240.1 protein_id gnl|my_center|LOCUS_04900 36404 36619 gene locus_tag LOCUS_04910 36404 36619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04910 >Feature sequence014 896 294 gene locus_tag LOCUS_04920 gene gmk 896 294 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942878.1 protein_id gnl|my_center|LOCUS_04920 1171 899 gene locus_tag LOCUS_04930 1171 899 CDS product DUF370 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965024.1 protein_id gnl|my_center|LOCUS_04930 2463 1582 gene locus_tag LOCUS_04940 2463 1582 CDS product YicC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942879.1 protein_id gnl|my_center|LOCUS_04940 2995 2456 gene locus_tag LOCUS_04950 2995 2456 CDS product DUF4416 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544933.1 protein_id gnl|my_center|LOCUS_04950 4005 2995 gene locus_tag LOCUS_04960 gene rfaE1 4005 2995 CDS product D-glycero-beta-D-manno-heptose-7-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546729.1 protein_id gnl|my_center|LOCUS_04960 4661 6019 gene locus_tag LOCUS_04970 gene trkA 4661 6019 CDS product Trk system potassium transporter TrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545959.1 protein_id gnl|my_center|LOCUS_04970 6019 7467 gene locus_tag LOCUS_04980 6019 7467 CDS product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545413.1 protein_id gnl|my_center|LOCUS_04980 9371 7485 gene locus_tag LOCUS_04990 9371 7485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04990 9867 10604 gene locus_tag LOCUS_05000 gene radC 9867 10604 CDS product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971736.1 protein_id gnl|my_center|LOCUS_05000 10601 11524 gene locus_tag LOCUS_05010 10601 11524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05010 11926 12117 gene locus_tag LOCUS_05020 11926 12117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05020 13406 12207 gene locus_tag LOCUS_05030 gene amrS 13406 12207 CDS product AmmeMemoRadiSam system radical SAM enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867880.1 protein_id gnl|my_center|LOCUS_05030 15560 13449 gene locus_tag LOCUS_05040 15560 13449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05040 16178 15600 gene locus_tag LOCUS_05050 16178 15600 CDS product TIGR00296 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023500.1 protein_id gnl|my_center|LOCUS_05050 16478 16666 gene locus_tag LOCUS_05060 16478 16666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05060 17030 16653 gene locus_tag LOCUS_05070 17030 16653 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212659.1 protein_id gnl|my_center|LOCUS_05070 17266 17027 gene locus_tag LOCUS_05080 17266 17027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067165.1 protein_id gnl|my_center|LOCUS_05080 17643 18086 gene locus_tag LOCUS_05090 17643 18086 CDS product HTH-type transcriptional regulator Ptr1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496594.1 protein_id gnl|my_center|LOCUS_05090 18401 18805 gene locus_tag LOCUS_05100 gene gcvH 18401 18805 CDS product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404804.1 protein_id gnl|my_center|LOCUS_05100 18806 20143 gene locus_tag LOCUS_05110 gene gcvPA 18806 20143 CDS product aminomethyl-transferring glycine dehydrogenase subunit GcvPA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460675.1 protein_id gnl|my_center|LOCUS_05110 20251 21684 gene locus_tag LOCUS_05120 gene gcvPB 20251 21684 CDS product aminomethyl-transferring glycine dehydrogenase subunit GcvPB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460674.1 protein_id gnl|my_center|LOCUS_05120 22253 22918 gene locus_tag LOCUS_05130 gene lipB 22253 22918 CDS product lipoyl(octanoyl) transferase LipB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011174104.1 protein_id gnl|my_center|LOCUS_05130 22929 23453 gene locus_tag LOCUS_05140 22929 23453 CDS product amino acid-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944067.1 protein_id gnl|my_center|LOCUS_05140 23488 25488 gene locus_tag LOCUS_05150 23488 25488 CDS product ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693783.1 protein_id gnl|my_center|LOCUS_05150 25502 26131 gene locus_tag LOCUS_05160 25502 26131 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000808789.1 protein_id gnl|my_center|LOCUS_05160 28445 26289 gene locus_tag LOCUS_05170 28445 26289 CDS product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870094.1 protein_id gnl|my_center|LOCUS_05170 29258 28449 gene locus_tag LOCUS_05180 29258 28449 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231526.1 protein_id gnl|my_center|LOCUS_05180 29762 32365 gene locus_tag LOCUS_05190 gene clpB 29762 32365 CDS product ATP-dependent chaperone ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941319.1 protein_id gnl|my_center|LOCUS_05190 33198 32362 gene locus_tag LOCUS_05200 33198 32362 CDS product phosphoribosylformylglycinamidine synthase subunit PurQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938913.1 protein_id gnl|my_center|LOCUS_05200 36188 33195 gene locus_tag LOCUS_05210 36188 33195 CDS product phosphoribosylformylglycinamidine synthase subunit PurS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942279.1 protein_id gnl|my_center|LOCUS_05210 >Feature sequence015 985 2262 gene locus_tag LOCUS_05220 gene serS 985 2262 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545752.1 protein_id gnl|my_center|LOCUS_05220 2265 3620 gene locus_tag LOCUS_05230 2265 3620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05230 5235 3655 gene locus_tag LOCUS_05240 gene pyrG 5235 3655 CDS product CTP synthase (glutamine hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002657046.1 protein_id gnl|my_center|LOCUS_05240 5931 6377 gene locus_tag LOCUS_05250 5931 6377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05250 6361 6600 gene locus_tag LOCUS_05260 6361 6600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05260 7845 7045 gene locus_tag LOCUS_05270 gene pgeF 7845 7045 CDS product peptidoglycan editing factor PgeF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392375.1 protein_id gnl|my_center|LOCUS_05270 8455 8177 gene locus_tag LOCUS_05280 8455 8177 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942391.1 protein_id gnl|my_center|LOCUS_05280 9348 10454 gene locus_tag LOCUS_05290 gene hisC 9348 10454 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392052.1 protein_id gnl|my_center|LOCUS_05290 10497 11198 gene locus_tag LOCUS_05300 gene cmk 10497 11198 CDS product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943242.1 protein_id gnl|my_center|LOCUS_05300 11333 13348 gene locus_tag LOCUS_05310 11333 13348 CDS product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943240.1 protein_id gnl|my_center|LOCUS_05310 13776 14693 gene locus_tag LOCUS_05320 gene sppA 13776 14693 CDS product signal peptide peptidase SppA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545082.1 protein_id gnl|my_center|LOCUS_05320 15306 14677 gene locus_tag LOCUS_05330 15306 14677 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942241.1 protein_id gnl|my_center|LOCUS_05330 15332 16111 gene locus_tag LOCUS_05340 15332 16111 CDS product A24 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942686.1 protein_id gnl|my_center|LOCUS_05340 17546 16614 gene locus_tag LOCUS_05350 17546 16614 CDS product DUF814 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583848.1 protein_id gnl|my_center|LOCUS_05350 18597 17665 gene locus_tag LOCUS_05360 18597 17665 CDS product DnaJ C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940692.1 protein_id gnl|my_center|LOCUS_05360 18922 22554 gene locus_tag LOCUS_05370 18922 22554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05370 22782 23336 gene locus_tag LOCUS_05380 22782 23336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05380 24683 23364 gene locus_tag LOCUS_05390 gene mtaB 24683 23364 CDS product tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase MtaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943204.1 protein_id gnl|my_center|LOCUS_05390 25743 24670 gene locus_tag LOCUS_05400 gene mnmA 25743 24670 CDS product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943205.1 protein_id gnl|my_center|LOCUS_05400 26427 27500 gene locus_tag LOCUS_05410 gene queA 26427 27500 CDS product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943258.1 protein_id gnl|my_center|LOCUS_05410 27565 28683 gene locus_tag LOCUS_05420 gene tgt 27565 28683 CDS product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943257.1 protein_id gnl|my_center|LOCUS_05420 28856 29179 gene locus_tag LOCUS_05430 gene yajC 28856 29179 CDS product preprotein translocase subunit YajC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943256.1 protein_id gnl|my_center|LOCUS_05430 29263 30864 gene locus_tag LOCUS_05440 gene secD 29263 30864 CDS product protein translocase subunit SecD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943255.1 protein_id gnl|my_center|LOCUS_05440 30884 31936 gene locus_tag LOCUS_05450 gene secF 30884 31936 CDS product protein translocase subunit SecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939105.1 protein_id gnl|my_center|LOCUS_05450 31993 34023 gene locus_tag LOCUS_05460 31993 34023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05460 34033 34494 gene locus_tag LOCUS_05470 34033 34494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05470 34605 34925 gene locus_tag LOCUS_05480 34605 34925 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098568.1 protein_id gnl|my_center|LOCUS_05480 >Feature sequence016 583 119 gene locus_tag LOCUS_05490 583 119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05490 2741 594 gene locus_tag LOCUS_05500 2741 594 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064349.1 protein_id gnl|my_center|LOCUS_05500 3026 2760 gene locus_tag LOCUS_05510 3026 2760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05510 3542 3228 gene locus_tag LOCUS_05520 3542 3228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05520 3764 3558 gene locus_tag LOCUS_05530 3764 3558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05530 5554 4100 gene locus_tag LOCUS_05540 gene purF 5554 4100 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937472.1 protein_id gnl|my_center|LOCUS_05540 8073 5551 gene locus_tag LOCUS_05550 gene glnD 8073 5551 CDS product [protein-PII] uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942465.1 protein_id gnl|my_center|LOCUS_05550 6046 5970 gene locus_tag LOCUS_t00040 6046 5970 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 8530 8192 gene locus_tag LOCUS_05560 gene glnB 8530 8192 CDS product nitrogen regulatory protein P-II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005436810.1 protein_id gnl|my_center|LOCUS_05560 11583 8935 gene locus_tag LOCUS_05570 11583 8935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05570 13389 11878 gene locus_tag LOCUS_05580 13389 11878 CDS product glutamate synthase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870869.1 protein_id gnl|my_center|LOCUS_05580 14779 13382 gene locus_tag LOCUS_05590 14779 13382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05590 15713 14799 gene locus_tag LOCUS_05600 15713 14799 CDS product methylenetetrahydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392705.1 protein_id gnl|my_center|LOCUS_05600 16386 15718 gene locus_tag LOCUS_05610 16386 15718 CDS product methylenetetrahydrofolate reductase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392706.1 protein_id gnl|my_center|LOCUS_05610 16611 16414 gene locus_tag LOCUS_05620 16611 16414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05620 17032 16613 gene locus_tag LOCUS_05630 17032 16613 CDS product hydrogenase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028842401.1 protein_id gnl|my_center|LOCUS_05630 18114 17593 gene locus_tag LOCUS_05640 18114 17593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05640 18620 18156 gene locus_tag LOCUS_05650 18620 18156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05650 19154 18657 gene locus_tag LOCUS_05660 gene mog 19154 18657 CDS product molybdopterin adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943343.1 protein_id gnl|my_center|LOCUS_05660 21241 19163 gene locus_tag LOCUS_05670 gene fusA 21241 19163 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942578.1 protein_id gnl|my_center|LOCUS_05670 21533 22459 gene locus_tag LOCUS_05680 gene xerC 21533 22459 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941160.1 protein_id gnl|my_center|LOCUS_05680 22576 23154 gene locus_tag LOCUS_05690 gene hslV 22576 23154 CDS product ATP-dependent protease subunit HslV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392543.1 protein_id gnl|my_center|LOCUS_05690 23233 24636 gene locus_tag LOCUS_05700 gene hslU 23233 24636 CDS product ATP-dependent protease ATPase subunit HslU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_181406033.1 protein_id gnl|my_center|LOCUS_05700 24719 25600 gene locus_tag LOCUS_05710 gene argB 24719 25600 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938759.1 protein_id gnl|my_center|LOCUS_05710 25634 26848 gene locus_tag LOCUS_05720 25634 26848 CDS product acetylornithine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393770.1 protein_id gnl|my_center|LOCUS_05720 26971 28179 gene locus_tag LOCUS_05730 26971 28179 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940829.1 protein_id gnl|my_center|LOCUS_05730 28276 29670 gene locus_tag LOCUS_05740 gene argH 28276 29670 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393767.1 protein_id gnl|my_center|LOCUS_05740 29972 30451 gene locus_tag LOCUS_05750 29972 30451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05750 30564 31811 gene locus_tag LOCUS_05760 gene lysA 30564 31811 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940834.1 protein_id gnl|my_center|LOCUS_05760 31824 32522 gene locus_tag LOCUS_05770 gene dapF 31824 32522 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881196.1 protein_id gnl|my_center|LOCUS_05770 32637 33509 gene locus_tag LOCUS_05780 gene dapA 32637 33509 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545135.1 protein_id gnl|my_center|LOCUS_05780 33565 33987 gene locus_tag LOCUS_05790 33565 33987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05790 34508 33984 gene locus_tag LOCUS_05800 34508 33984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05800 >Feature sequence017 103 783 gene locus_tag LOCUS_05810 103 783 CDS product paraquat-inducible protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003107436.1 protein_id gnl|my_center|LOCUS_05810 783 2477 gene locus_tag LOCUS_05820 783 2477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05820 3097 2507 gene locus_tag LOCUS_05830 3097 2507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05830 3437 3267 gene locus_tag LOCUS_05840 3437 3267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05840 3708 3421 gene locus_tag LOCUS_05850 3708 3421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05850 3592 4389 gene locus_tag LOCUS_05860 3592 4389 CDS product lytic murein transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262256.1 protein_id gnl|my_center|LOCUS_05860 4760 5038 gene locus_tag LOCUS_05870 4760 5038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05870 7987 5096 gene locus_tag LOCUS_05880 7987 5096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05880 8633 8184 gene locus_tag LOCUS_05890 8633 8184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05890 10610 8643 gene locus_tag LOCUS_05900 10610 8643 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942735.1 protein_id gnl|my_center|LOCUS_05900 11034 13046 gene locus_tag LOCUS_05910 11034 13046 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941764.1 protein_id gnl|my_center|LOCUS_05910 13518 13072 gene locus_tag LOCUS_05920 13518 13072 CDS product CoA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933012.1 protein_id gnl|my_center|LOCUS_05920 13849 13526 gene locus_tag LOCUS_05930 13849 13526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05930 14349 13861 gene locus_tag LOCUS_05940 14349 13861 CDS product DUF523 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392153.1 protein_id gnl|my_center|LOCUS_05940 15413 14349 gene locus_tag LOCUS_05950 gene purM 15413 14349 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942402.1 protein_id gnl|my_center|LOCUS_05950 16622 15441 gene locus_tag LOCUS_05960 16622 15441 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103930.1 protein_id gnl|my_center|LOCUS_05960 17103 16777 gene locus_tag LOCUS_05970 17103 16777 CDS product SCP2 sterol-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087993.1 protein_id gnl|my_center|LOCUS_05970 17462 17860 gene locus_tag LOCUS_05980 17462 17860 CDS product polymer-forming cytoskeletal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000039429.1 protein_id gnl|my_center|LOCUS_05980 17960 18388 gene locus_tag LOCUS_05990 17960 18388 CDS product ATP synthase F0 subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940784.1 protein_id gnl|my_center|LOCUS_05990 18385 18993 gene locus_tag LOCUS_06000 18385 18993 CDS product ATP synthase F0 subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940785.1 protein_id gnl|my_center|LOCUS_06000 18990 19541 gene locus_tag LOCUS_06010 gene atpH 18990 19541 CDS product ATP synthase F1 subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940786.1 protein_id gnl|my_center|LOCUS_06010 19541 21055 gene locus_tag LOCUS_06020 gene atpA 19541 21055 CDS product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938078.1 protein_id gnl|my_center|LOCUS_06020 21165 22046 gene locus_tag LOCUS_06030 21165 22046 CDS product F0F1 ATP synthase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938077.1 protein_id gnl|my_center|LOCUS_06030 22082 23497 gene locus_tag LOCUS_06040 gene atpD 22082 23497 CDS product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940789.1 protein_id gnl|my_center|LOCUS_06040 23510 23917 gene locus_tag LOCUS_06050 23510 23917 CDS product F0F1 ATP synthase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938075.1 protein_id gnl|my_center|LOCUS_06050 24198 24479 gene locus_tag LOCUS_06060 24198 24479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06060 24543 24824 gene locus_tag LOCUS_06070 24543 24824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06070 25392 26963 gene locus_tag LOCUS_06080 gene rny 25392 26963 CDS product ribonuclease Y inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941798.1 protein_id gnl|my_center|LOCUS_06080 27780 27010 gene locus_tag LOCUS_06090 27780 27010 CDS product NRDE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941457.1 protein_id gnl|my_center|LOCUS_06090 28039 28123 gene locus_tag LOCUS_t00050 28039 28123 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 28434 29738 gene locus_tag LOCUS_06100 gene tig 28434 29738 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942437.1 protein_id gnl|my_center|LOCUS_06100 29774 30382 gene locus_tag LOCUS_06110 gene clpP 29774 30382 CDS product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545892.1 protein_id gnl|my_center|LOCUS_06110 30499 31746 gene locus_tag LOCUS_06120 gene clpX 30499 31746 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942435.1 protein_id gnl|my_center|LOCUS_06120 31739 34207 gene locus_tag LOCUS_06130 gene lon 31739 34207 CDS product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942434.1 protein_id gnl|my_center|LOCUS_06130 34283 34357 gene locus_tag LOCUS_t00060 34283 34357 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 34367 34445 gene locus_tag LOCUS_t00070 34367 34445 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence018 280 1800 gene locus_tag LOCUS_06140 gene aprA 280 1800 CDS product adenylyl-sulfate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879166.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06140 2329 3597 gene locus_tag LOCUS_06150 2329 3597 CDS product CoB--CoM heterodisulfide reductase iron-sulfur subunit A family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932547.1 protein_id gnl|my_center|LOCUS_06150 3602 5833 gene locus_tag LOCUS_06160 3602 5833 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932548.1 protein_id gnl|my_center|LOCUS_06160 6066 6656 gene locus_tag LOCUS_06170 6066 6656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06170 6653 7531 gene locus_tag LOCUS_06180 6653 7531 CDS product CoB--CoM heterodisulfide reductase iron-sulfur subunit B family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392331.1 protein_id gnl|my_center|LOCUS_06180 7623 7892 gene locus_tag LOCUS_06190 7623 7892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926944.1 protein_id gnl|my_center|LOCUS_06190 7889 8665 gene locus_tag LOCUS_06200 7889 8665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06200 8885 9184 gene locus_tag LOCUS_06210 8885 9184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06210 9484 9209 gene locus_tag LOCUS_06220 9484 9209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06220 9893 9594 gene locus_tag LOCUS_06230 9893 9594 CDS product YggT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941530.1 protein_id gnl|my_center|LOCUS_06230 10840 10157 gene locus_tag LOCUS_06240 10840 10157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878811.1 protein_id gnl|my_center|LOCUS_06240 12275 11541 gene locus_tag LOCUS_06250 12275 11541 CDS product C4-type zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545753.1 protein_id gnl|my_center|LOCUS_06250 13199 12375 gene locus_tag LOCUS_06260 13199 12375 CDS product Nif3-like dinuclear metal center hexameric protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047988.1 protein_id gnl|my_center|LOCUS_06260 13381 13306 gene locus_tag LOCUS_t00080 13381 13306 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 15218 13452 gene locus_tag LOCUS_06270 gene rpoD 15218 13452 CDS product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943710.1 protein_id gnl|my_center|LOCUS_06270 17062 15320 gene locus_tag LOCUS_06280 gene dnaG 17062 15320 CDS product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943711.1 protein_id gnl|my_center|LOCUS_06280 17889 17443 gene locus_tag LOCUS_06290 17889 17443 CDS product GatB/YqeY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081070.1 protein_id gnl|my_center|LOCUS_06290 18760 18014 gene locus_tag LOCUS_06300 gene hisA 18760 18014 CDS product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino]imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007246848.1 protein_id gnl|my_center|LOCUS_06300 19510 18788 gene locus_tag LOCUS_06310 19510 18788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06310 20115 19525 gene locus_tag LOCUS_06320 gene hisB 20115 19525 CDS product imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943719.1 protein_id gnl|my_center|LOCUS_06320 20221 20146 gene locus_tag LOCUS_t00090 20221 20146 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 20395 20471 gene locus_tag LOCUS_t00100 20395 20471 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 20501 20731 gene locus_tag LOCUS_06330 20501 20731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06330 21807 20788 gene locus_tag LOCUS_06340 21807 20788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06340 22312 21932 gene locus_tag LOCUS_06350 22312 21932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06350 23399 22467 gene locus_tag LOCUS_06360 23399 22467 CDS product methylenetetrahydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392705.1 protein_id gnl|my_center|LOCUS_06360 24064 23396 gene locus_tag LOCUS_06370 24064 23396 CDS product methylenetetrahydrofolate reductase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392706.1 protein_id gnl|my_center|LOCUS_06370 24503 24153 gene locus_tag LOCUS_06380 24503 24153 CDS product hydrogenase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392707.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_06380 29178 24931 gene locus_tag LOCUS_06390 29178 24931 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392708.1 protein_id gnl|my_center|LOCUS_06390 29370 29179 gene locus_tag LOCUS_06400 29370 29179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_06400 30263 29388 gene locus_tag LOCUS_06410 30263 29388 CDS product methylenetetrahydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436920.1 protein_id gnl|my_center|LOCUS_06410 30654 30280 gene locus_tag LOCUS_06420 30654 30280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06420 31502 31308 gene locus_tag LOCUS_06430 31502 31308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06430 33079 31616 gene locus_tag LOCUS_06440 gene acdAII 33079 31616 CDS product acetate--CoA ligase I subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868410.1 protein_id gnl|my_center|LOCUS_06440 >Feature sequence019 2965 1487 gene locus_tag LOCUS_06450 2965 1487 CDS product FAD-linked oxidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393791.1 protein_id gnl|my_center|LOCUS_06450 4402 3011 gene locus_tag LOCUS_06460 4402 3011 CDS product FAD-linked oxidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257031.1 protein_id gnl|my_center|LOCUS_06460 5819 4671 gene locus_tag LOCUS_06470 5819 4671 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245114.1 protein_id gnl|my_center|LOCUS_06470 6302 5823 gene locus_tag LOCUS_06480 6302 5823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06480 6542 6312 gene locus_tag LOCUS_06490 6542 6312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06490 6943 7575 gene locus_tag LOCUS_06500 6943 7575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06500 7641 9566 gene locus_tag LOCUS_06510 7641 9566 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807270.1 protein_id gnl|my_center|LOCUS_06510 9582 10367 gene locus_tag LOCUS_06520 9582 10367 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009566968.1 protein_id gnl|my_center|LOCUS_06520 10443 11057 gene locus_tag LOCUS_06530 10443 11057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06530 11105 11254 gene locus_tag LOCUS_06540 11105 11254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06540 11355 12413 gene locus_tag LOCUS_06550 11355 12413 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807261.1 protein_id gnl|my_center|LOCUS_06550 12586 13941 gene locus_tag LOCUS_06560 12586 13941 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104318.1 protein_id gnl|my_center|LOCUS_06560 14129 14944 gene locus_tag LOCUS_06570 14129 14944 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719435.1 protein_id gnl|my_center|LOCUS_06570 15772 15002 gene locus_tag LOCUS_06580 15772 15002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06580 16036 15806 gene locus_tag LOCUS_06590 16036 15806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06590 17024 16059 gene locus_tag LOCUS_06600 gene meaB 17024 16059 CDS product methylmalonyl Co-A mutase-associated GTPase MeaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942224.1 protein_id gnl|my_center|LOCUS_06600 17413 17030 gene locus_tag LOCUS_06610 17413 17030 CDS product cobalamin B12-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942223.1 protein_id gnl|my_center|LOCUS_06610 19361 17676 gene locus_tag LOCUS_06620 19361 17676 CDS product methylmalonyl-CoA mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257715.1 protein_id gnl|my_center|LOCUS_06620 19913 19422 gene locus_tag LOCUS_06630 19913 19422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06630 20514 19900 gene locus_tag LOCUS_06640 20514 19900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06640 21304 20516 gene locus_tag LOCUS_06650 21304 20516 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816058.1 protein_id gnl|my_center|LOCUS_06650 22835 21621 gene locus_tag LOCUS_06660 22835 21621 CDS product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878693.1 protein_id gnl|my_center|LOCUS_06660 24116 22926 gene locus_tag LOCUS_06670 24116 22926 CDS product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357329.1 protein_id gnl|my_center|LOCUS_06670 24688 24470 gene locus_tag LOCUS_06680 24688 24470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06680 24977 24705 gene locus_tag LOCUS_06690 24977 24705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06690 26602 25352 gene locus_tag LOCUS_06700 26602 25352 CDS product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888868.1 protein_id gnl|my_center|LOCUS_06700 27566 26670 gene locus_tag LOCUS_06710 gene mltG 27566 26670 CDS product endolytic transglycosylase MltG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941176.1 protein_id gnl|my_center|LOCUS_06710 29079 27739 gene locus_tag LOCUS_06720 29079 27739 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259421.1 protein_id gnl|my_center|LOCUS_06720 30521 29301 gene locus_tag LOCUS_06730 30521 29301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06730 30877 31542 gene locus_tag LOCUS_06740 30877 31542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06740 31649 32032 gene locus_tag LOCUS_06750 31649 32032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06750 >Feature sequence020 1651 3177 gene locus_tag LOCUS_06760 1651 3177 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933195.1 protein_id gnl|my_center|LOCUS_06760 3357 4370 gene locus_tag LOCUS_06770 3357 4370 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792172.1 protein_id gnl|my_center|LOCUS_06770 4575 6944 gene locus_tag LOCUS_06780 4575 6944 CDS product HDIG domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942922.1 protein_id gnl|my_center|LOCUS_06780 6844 7317 gene locus_tag LOCUS_06790 gene ybeY 6844 7317 CDS product rRNA maturation RNase YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942921.1 protein_id gnl|my_center|LOCUS_06790 7298 8017 gene locus_tag LOCUS_06800 7298 8017 CDS product pyridoxine 5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942449.1 protein_id gnl|my_center|LOCUS_06800 8019 8444 gene locus_tag LOCUS_06810 8019 8444 CDS product holo-[acyl-carrier-protein] synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942448.1 protein_id gnl|my_center|LOCUS_06810 8438 8887 gene locus_tag LOCUS_06820 8438 8887 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942446.1 protein_id gnl|my_center|LOCUS_06820 8980 9366 gene locus_tag LOCUS_06830 8980 9366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06830 9374 10606 gene locus_tag LOCUS_06840 9374 10606 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942444.1 protein_id gnl|my_center|LOCUS_06840 10800 11168 gene locus_tag LOCUS_06850 10800 11168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06850 11395 12573 gene locus_tag LOCUS_06860 gene tsaD 11395 12573 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942510.1 protein_id gnl|my_center|LOCUS_06860 12578 13135 gene locus_tag LOCUS_06870 12578 13135 CDS product DUF2062 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939086.1 protein_id gnl|my_center|LOCUS_06870 13075 13929 gene locus_tag LOCUS_06880 gene rsmA 13075 13929 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391600.1 protein_id gnl|my_center|LOCUS_06880 14220 15089 gene locus_tag LOCUS_06890 gene panC 14220 15089 CDS product pantoate--beta-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942350.1 protein_id gnl|my_center|LOCUS_06890 15107 16273 gene locus_tag LOCUS_06900 gene metK 15107 16273 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942525.1 protein_id gnl|my_center|LOCUS_06900 16319 17644 gene locus_tag LOCUS_06910 gene ahcY 16319 17644 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545526.1 protein_id gnl|my_center|LOCUS_06910 17727 19457 gene locus_tag LOCUS_06920 17727 19457 CDS product glutamine--tRNA ligase/YqeY domain fusion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940210.1 protein_id gnl|my_center|LOCUS_06920 19469 20263 gene locus_tag LOCUS_06930 gene yqeB 19469 20263 CDS product selenium-dependent molybdenum cofactor biosynthesis protein YqeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393498.1 protein_id gnl|my_center|LOCUS_06930 21225 20260 gene locus_tag LOCUS_06940 21225 20260 CDS product nitronate monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225688.1 protein_id gnl|my_center|LOCUS_06940 21776 21342 gene locus_tag LOCUS_06950 21776 21342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06950 23298 22285 gene locus_tag LOCUS_06960 23298 22285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06960 23642 23391 gene locus_tag LOCUS_06970 23642 23391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06970 24286 23642 gene locus_tag LOCUS_06980 24286 23642 CDS product lactate utilization protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583891.1 protein_id gnl|my_center|LOCUS_06980 25385 24318 gene locus_tag LOCUS_06990 25385 24318 CDS product XdhC/CoxI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002362591.1 protein_id gnl|my_center|LOCUS_06990 26233 25475 gene locus_tag LOCUS_07000 gene yqeC 26233 25475 CDS product selenium cofactor biosynthesis protein YqeC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459386.1 protein_id gnl|my_center|LOCUS_07000 28280 26469 gene locus_tag LOCUS_07010 gene selB 28280 26469 CDS product selenocysteine-specific translation elongation factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937806.1 protein_id gnl|my_center|LOCUS_07010 29098 28277 gene locus_tag LOCUS_07020 29098 28277 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_144685205.1 protein_id gnl|my_center|LOCUS_07020 29768 29109 gene locus_tag LOCUS_07030 29768 29109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07030 29948 31654 gene locus_tag LOCUS_07040 29948 31654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07040 >Feature sequence021 526 317 gene locus_tag LOCUS_07050 526 317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07050 805 1605 gene locus_tag LOCUS_07060 gene cobS 805 1605 CDS product adenosylcobinamide-GDP ribazoletransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926961.1 protein_id gnl|my_center|LOCUS_07060 2076 1618 gene locus_tag LOCUS_07070 2076 1618 CDS product Mut7-C RNAse domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249247.1 protein_id gnl|my_center|LOCUS_07070 4342 2096 gene locus_tag LOCUS_07080 4342 2096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07080 5056 4373 gene locus_tag LOCUS_07090 gene mtgA 5056 4373 CDS product monofunctional biosynthetic peptidoglycan transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107650.1 protein_id gnl|my_center|LOCUS_07090 5901 5104 gene locus_tag LOCUS_07100 gene mazG 5901 5104 CDS product nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941834.1 protein_id gnl|my_center|LOCUS_07100 6457 5915 gene locus_tag LOCUS_07110 6457 5915 CDS product CvpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938481.1 protein_id gnl|my_center|LOCUS_07110 7259 6546 gene locus_tag LOCUS_07120 7259 6546 CDS product queuosine precursor transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011174123.1 protein_id gnl|my_center|LOCUS_07120 8849 7263 gene locus_tag LOCUS_07130 8849 7263 CDS product DUF4301 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107406.1 protein_id gnl|my_center|LOCUS_07130 10088 9072 gene locus_tag LOCUS_07140 10088 9072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07140 10456 11757 gene locus_tag LOCUS_07150 gene proP 10456 11757 CDS product glycine betaine/L-proline transporter ProP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028291.1 protein_id gnl|my_center|LOCUS_07150 11857 13509 gene locus_tag LOCUS_07160 gene pgi 11857 13509 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000916643.1 protein_id gnl|my_center|LOCUS_07160 14861 13650 gene locus_tag LOCUS_07170 14861 13650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07170 16854 15325 gene locus_tag LOCUS_07180 16854 15325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07180 17312 16833 gene locus_tag LOCUS_07190 17312 16833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07190 18658 17432 gene locus_tag LOCUS_07200 gene fabF 18658 17432 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544941.1 protein_id gnl|my_center|LOCUS_07200 19828 18830 gene locus_tag LOCUS_07210 19828 18830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07210 20153 19899 gene locus_tag LOCUS_07220 20153 19899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07220 20524 20168 gene locus_tag LOCUS_07230 20524 20168 CDS product hydroxymyristoyl-ACP dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707157.1 protein_id gnl|my_center|LOCUS_07230 20725 20549 gene locus_tag LOCUS_07240 20725 20549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07240 21897 20701 gene locus_tag LOCUS_07250 21897 20701 CDS product B12-binding domain-containing radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940912.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07250 24075 22024 gene locus_tag LOCUS_07260 24075 22024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07260 24337 24077 gene locus_tag LOCUS_07270 24337 24077 CDS product phosphopantetheine-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964357.1 protein_id gnl|my_center|LOCUS_07270 24700 25128 gene locus_tag LOCUS_07280 24700 25128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07280 25128 25871 gene locus_tag LOCUS_07290 gene fabG 25128 25871 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583308.1 protein_id gnl|my_center|LOCUS_07290 26025 27194 gene locus_tag LOCUS_07300 26025 27194 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958239.1 protein_id gnl|my_center|LOCUS_07300 27579 27298 gene locus_tag LOCUS_07310 27579 27298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07310 27804 27586 gene locus_tag LOCUS_07320 27804 27586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07320 29397 28636 gene locus_tag LOCUS_07330 gene hisF 29397 28636 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228686.1 protein_id gnl|my_center|LOCUS_07330 29947 29696 gene locus_tag LOCUS_07340 29947 29696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07340 30342 29995 gene locus_tag LOCUS_07350 30342 29995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07350 >Feature sequence022 3745 944 gene locus_tag LOCUS_07360 3745 944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_07360 4045 3812 gene locus_tag LOCUS_07370 4045 3812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07370 5230 4058 gene locus_tag LOCUS_07380 5230 4058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07380 5817 5266 gene locus_tag LOCUS_07390 5817 5266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07390 7838 5835 gene locus_tag LOCUS_07400 gene aor 7838 5835 CDS product aldehyde ferredoxin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868080.1 protein_id gnl|my_center|LOCUS_07400 8382 7933 gene locus_tag LOCUS_07410 8382 7933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07410 8605 8396 gene locus_tag LOCUS_07420 8605 8396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07420 8817 9509 gene locus_tag LOCUS_07430 8817 9509 CDS product transglutaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098789.1 protein_id gnl|my_center|LOCUS_07430 9509 10087 gene locus_tag LOCUS_07440 9509 10087 CDS product Slp family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941211.1 protein_id gnl|my_center|LOCUS_07440 10761 10324 gene locus_tag LOCUS_07450 10761 10324 CDS product secondary thiamine-phosphate synthase enzyme YjbQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064279.1 protein_id gnl|my_center|LOCUS_07450 11945 10842 gene locus_tag LOCUS_07460 gene rodA 11945 10842 CDS product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942720.1 protein_id gnl|my_center|LOCUS_07460 13865 11952 gene locus_tag LOCUS_07470 gene mrdA 13865 11952 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942721.1 protein_id gnl|my_center|LOCUS_07470 14548 14078 gene locus_tag LOCUS_07480 14548 14078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07480 15224 14925 gene locus_tag LOCUS_07490 15224 14925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07490 15565 15239 gene locus_tag LOCUS_07500 15565 15239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07500 16682 15648 gene locus_tag LOCUS_07510 16682 15648 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938090.1 protein_id gnl|my_center|LOCUS_07510 17360 17680 gene locus_tag LOCUS_07520 gene rnpA 17360 17680 CDS product ribonuclease P protein component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944077.1 protein_id gnl|my_center|LOCUS_07520 18026 19696 gene locus_tag LOCUS_07530 gene yidC 18026 19696 CDS product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944075.1 protein_id gnl|my_center|LOCUS_07530 19713 20477 gene locus_tag LOCUS_07540 19713 20477 CDS product KH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256032.1 protein_id gnl|my_center|LOCUS_07540 20536 21918 gene locus_tag LOCUS_07550 gene mnmE 20536 21918 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944074.1 protein_id gnl|my_center|LOCUS_07550 22167 21934 gene locus_tag LOCUS_07560 22167 21934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07560 22192 23706 gene locus_tag LOCUS_07570 22192 23706 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005086603.1 protein_id gnl|my_center|LOCUS_07570 23780 24757 gene locus_tag LOCUS_07580 23780 24757 CDS product TAXI family TRAP transporter solute-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869565.1 protein_id gnl|my_center|LOCUS_07580 24867 25388 gene locus_tag LOCUS_07590 24867 25388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07590 25375 27273 gene locus_tag LOCUS_07600 25375 27273 CDS product TRAP transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925163.1 protein_id gnl|my_center|LOCUS_07600 27325 28209 gene locus_tag LOCUS_07610 27325 28209 CDS product 3-keto-5-aminohexanoate cleavage protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088206.1 protein_id gnl|my_center|LOCUS_07610 28206 29306 gene locus_tag LOCUS_07620 28206 29306 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005086624.1 protein_id gnl|my_center|LOCUS_07620 29687 29481 gene locus_tag LOCUS_07630 29687 29481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07630 >Feature sequence023 422 273 gene locus_tag LOCUS_07640 422 273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07640 1083 382 gene locus_tag LOCUS_07650 1083 382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07650 1753 1184 gene locus_tag LOCUS_07660 1753 1184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07660 3313 2042 gene locus_tag LOCUS_07670 gene tolB 3313 2042 CDS product Tol-Pal system beta propeller repeat protein TolB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940703.1 protein_id gnl|my_center|LOCUS_07670 4261 3464 gene locus_tag LOCUS_07680 4261 3464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07680 4868 4446 gene locus_tag LOCUS_07690 gene tolR 4868 4446 CDS product protein TolR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940705.1 protein_id gnl|my_center|LOCUS_07690 5680 4865 gene locus_tag LOCUS_07700 gene tolQ 5680 4865 CDS product protein TolQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940706.1 protein_id gnl|my_center|LOCUS_07700 6285 5782 gene locus_tag LOCUS_07710 gene mobB 6285 5782 CDS product molybdopterin-guanine dinucleotide biosynthesis protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393319.1 protein_id gnl|my_center|LOCUS_07710 6644 6282 gene locus_tag LOCUS_07720 6644 6282 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206717.1 protein_id gnl|my_center|LOCUS_07720 8580 6646 gene locus_tag LOCUS_07730 8580 6646 CDS product molybdopterin biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940249.1 protein_id gnl|my_center|LOCUS_07730 9833 8577 gene locus_tag LOCUS_07740 9833 8577 CDS product molybdopterin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545855.1 protein_id gnl|my_center|LOCUS_07740 10085 10390 gene locus_tag LOCUS_07750 10085 10390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07750 11655 10465 gene locus_tag LOCUS_07760 11655 10465 CDS product alanine--glyoxylate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074000.1 protein_id gnl|my_center|LOCUS_07760 12841 11852 gene locus_tag LOCUS_07770 gene serB 12841 11852 CDS product phosphoserine phosphatase SerB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064533.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07770 13040 12819 gene locus_tag LOCUS_07780 13040 12819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07780 13588 13037 gene locus_tag LOCUS_07790 13588 13037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07790 13973 13581 gene locus_tag LOCUS_07800 13973 13581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07800 16665 14014 gene locus_tag LOCUS_07810 16665 14014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07810 17658 16834 gene locus_tag LOCUS_07820 17658 16834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07820 18212 17934 gene locus_tag LOCUS_07830 18212 17934 CDS product FeoA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939842.1 protein_id gnl|my_center|LOCUS_07830 19074 18271 gene locus_tag LOCUS_07840 19074 18271 CDS product inositol monophosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973972.1 protein_id gnl|my_center|LOCUS_07840 20231 19089 gene locus_tag LOCUS_07850 20231 19089 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064757.1 protein_id gnl|my_center|LOCUS_07850 21220 20252 gene locus_tag LOCUS_07860 21220 20252 CDS product electron transfer flavoprotein subunit alpha/FixB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877798.1 protein_id gnl|my_center|LOCUS_07860 22000 21221 gene locus_tag LOCUS_07870 22000 21221 CDS product electron transfer flavoprotein subunit beta/FixA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877797.1 protein_id gnl|my_center|LOCUS_07870 24286 22259 gene locus_tag LOCUS_07880 24286 22259 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001086770.1 protein_id gnl|my_center|LOCUS_07880 24697 24939 gene locus_tag LOCUS_07890 24697 24939 CDS product exodeoxyribonuclease VII small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942410.1 protein_id gnl|my_center|LOCUS_07890 24923 25837 gene locus_tag LOCUS_07900 24923 25837 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942409.1 protein_id gnl|my_center|LOCUS_07900 25834 27732 gene locus_tag LOCUS_07910 gene dxs 25834 27732 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941346.1 protein_id gnl|my_center|LOCUS_07910 27719 28477 gene locus_tag LOCUS_07920 27719 28477 CDS product TlyA family rRNA (cytidine-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942068.1 protein_id gnl|my_center|LOCUS_07920 28580 29350 gene locus_tag LOCUS_07930 28580 29350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07930 29860 29438 gene locus_tag LOCUS_07940 29860 29438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07940 >Feature sequence024 102 428 gene locus_tag LOCUS_07950 102 428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07950 489 788 gene locus_tag LOCUS_07960 489 788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07960 805 1197 gene locus_tag LOCUS_07970 805 1197 CDS product phage holin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198632.1 protein_id gnl|my_center|LOCUS_07970 1315 2613 gene locus_tag LOCUS_07980 gene radA 1315 2613 CDS product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940957.1 protein_id gnl|my_center|LOCUS_07980 2668 3570 gene locus_tag LOCUS_07990 2668 3570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07990 4012 3587 gene locus_tag LOCUS_08000 gene arfB 4012 3587 CDS product alternative ribosome rescue aminoacyl-tRNA hydrolase ArfB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387858.1 protein_id gnl|my_center|LOCUS_08000 4401 4102 gene locus_tag LOCUS_08010 4401 4102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08010 4579 5103 gene locus_tag LOCUS_08020 4579 5103 CDS product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021158.1 protein_id gnl|my_center|LOCUS_08020 5277 5954 gene locus_tag LOCUS_08030 5277 5954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08030 6291 6608 gene locus_tag LOCUS_08040 6291 6608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08040 6657 8018 gene locus_tag LOCUS_08050 6657 8018 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031698.1 protein_id gnl|my_center|LOCUS_08050 8040 9980 gene locus_tag LOCUS_08060 8040 9980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08060 9984 11054 gene locus_tag LOCUS_08070 gene ugpC 9984 11054 CDS product sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004079960.1 protein_id gnl|my_center|LOCUS_08070 11123 11944 gene locus_tag LOCUS_08080 11123 11944 CDS product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941055.1 protein_id gnl|my_center|LOCUS_08080 11965 12903 gene locus_tag LOCUS_08090 11965 12903 CDS product DUF368 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263632.1 protein_id gnl|my_center|LOCUS_08090 14992 12917 gene locus_tag LOCUS_08100 gene lptD 14992 12917 CDS product LPS assembly protein LptD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792614.1 protein_id gnl|my_center|LOCUS_08100 15830 16255 gene locus_tag LOCUS_08110 15830 16255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08110 16591 16289 gene locus_tag LOCUS_08120 16591 16289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08120 17015 16644 gene locus_tag LOCUS_08130 17015 16644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08130 17542 17186 gene locus_tag LOCUS_08140 17542 17186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08140 18235 17984 gene locus_tag LOCUS_08150 18235 17984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08150 18769 19398 gene locus_tag LOCUS_08160 18769 19398 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948225.1 protein_id gnl|my_center|LOCUS_08160 19463 19789 gene locus_tag LOCUS_08170 19463 19789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08170 21017 19884 gene locus_tag LOCUS_08180 gene dnaJ 21017 19884 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522147.1 protein_id gnl|my_center|LOCUS_08180 21568 21317 gene locus_tag LOCUS_08190 21568 21317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08190 21728 22894 gene locus_tag LOCUS_08200 21728 22894 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197192.1 protein_id gnl|my_center|LOCUS_08200 22914 23747 gene locus_tag LOCUS_08210 22914 23747 CDS product 3-keto-5-aminohexanoate cleavage protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002494032.1 protein_id gnl|my_center|LOCUS_08210 25080 24136 gene locus_tag LOCUS_08220 25080 24136 CDS product P1 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009892121.1 protein_id gnl|my_center|LOCUS_08220 26801 25107 gene locus_tag LOCUS_08230 gene recN 26801 25107 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942706.1 protein_id gnl|my_center|LOCUS_08230 27206 26868 gene locus_tag LOCUS_08240 27206 26868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08240 27603 28031 gene locus_tag LOCUS_08250 27603 28031 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090571.1 protein_id gnl|my_center|LOCUS_08250 29368 28643 gene locus_tag LOCUS_08260 29368 28643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08260 <30036 29280 gene locus_tag LOCUS_08270 <30036 29280 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011022102.1:class I SAM-dependent DNA methyltransferase note possible pseudo, frameshifted >Feature sequence025 1559 1029 gene locus_tag LOCUS_08280 1559 1029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08280 2670 1651 gene locus_tag LOCUS_08290 2670 1651 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943025.1 protein_id gnl|my_center|LOCUS_08290 3912 2851 gene locus_tag LOCUS_08300 3912 2851 CDS product CaiB/BaiF CoA-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224352.1 protein_id gnl|my_center|LOCUS_08300 5359 4262 gene locus_tag LOCUS_08310 5359 4262 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391983.1 protein_id gnl|my_center|LOCUS_08310 6379 5435 gene locus_tag LOCUS_08320 6379 5435 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391984.1 protein_id gnl|my_center|LOCUS_08320 7430 6366 gene locus_tag LOCUS_08330 7430 6366 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391982.1 protein_id gnl|my_center|LOCUS_08330 9004 7442 gene locus_tag LOCUS_08340 9004 7442 CDS product DUF116 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391981.1 protein_id gnl|my_center|LOCUS_08340 9542 10333 gene locus_tag LOCUS_08350 9542 10333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08350 10556 10804 gene locus_tag LOCUS_08360 10556 10804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08360 10785 11222 gene locus_tag LOCUS_08370 10785 11222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08370 11523 12803 gene locus_tag LOCUS_08380 11523 12803 CDS product hydroxyacid-oxoacid transhydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222287.1 protein_id gnl|my_center|LOCUS_08380 13075 13347 gene locus_tag LOCUS_08390 13075 13347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08390 13347 13751 gene locus_tag LOCUS_08400 13347 13751 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000281042.1 protein_id gnl|my_center|LOCUS_08400 13925 15535 gene locus_tag LOCUS_08410 gene lnt 13925 15535 CDS product apolipoprotein N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933164.1 protein_id gnl|my_center|LOCUS_08410 15558 16178 gene locus_tag LOCUS_08420 15558 16178 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919766.1 protein_id gnl|my_center|LOCUS_08420 16199 16615 gene locus_tag LOCUS_08430 16199 16615 CDS product YajD family HNH nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071871.1 protein_id gnl|my_center|LOCUS_08430 17427 16639 gene locus_tag LOCUS_08440 17427 16639 CDS product energy-coupling factor transporter transmembrane protein EcfT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357319.1 protein_id gnl|my_center|LOCUS_08440 18406 17522 gene locus_tag LOCUS_08450 18406 17522 CDS product energy-coupling factor transporter ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966383.1 protein_id gnl|my_center|LOCUS_08450 19269 18727 gene locus_tag LOCUS_08460 19269 18727 CDS product biotin transporter BioY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024220.1 protein_id gnl|my_center|LOCUS_08460 20250 19279 gene locus_tag LOCUS_08470 20250 19279 CDS product biotin--[acetyl-CoA-carboxylase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_196768282.1 protein_id gnl|my_center|LOCUS_08470 21310 20492 gene locus_tag LOCUS_08480 gene proC 21310 20492 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404307.1 protein_id gnl|my_center|LOCUS_08480 21680 21375 gene locus_tag LOCUS_08490 21680 21375 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940862.1 protein_id gnl|my_center|LOCUS_08490 22223 23986 gene locus_tag LOCUS_08500 22223 23986 CDS product formate--tetrahydrofolate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546634.1 protein_id gnl|my_center|LOCUS_08500 24741 24073 gene locus_tag LOCUS_08510 24741 24073 CDS product YkgJ family cysteine cluster protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546743.1 protein_id gnl|my_center|LOCUS_08510 25413 24748 gene locus_tag LOCUS_08520 25413 24748 CDS product TIGR00153 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883319.1 protein_id gnl|my_center|LOCUS_08520 26691 25441 gene locus_tag LOCUS_08530 26691 25441 CDS product inorganic phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100079.1 protein_id gnl|my_center|LOCUS_08530 28020 26884 gene locus_tag LOCUS_08540 28020 26884 CDS product thiolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460369.1 protein_id gnl|my_center|LOCUS_08540 29852 28275 gene locus_tag LOCUS_08550 gene fadD5 29852 28275 CDS product fatty-acid--CoA ligase FadD5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726688.1 protein_id gnl|my_center|LOCUS_08550 >Feature sequence026 575 384 gene locus_tag LOCUS_08560 575 384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08560 759 1667 gene locus_tag LOCUS_08570 759 1667 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948625.1 protein_id gnl|my_center|LOCUS_08570 1713 2117 gene locus_tag LOCUS_08580 1713 2117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08580 2119 2409 gene locus_tag LOCUS_08590 2119 2409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08590 2529 3317 gene locus_tag LOCUS_08600 2529 3317 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008657976.1 protein_id gnl|my_center|LOCUS_08600 3280 4542 gene locus_tag LOCUS_08610 3280 4542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08610 4625 5248 gene locus_tag LOCUS_08620 4625 5248 CDS product DUF4254 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010945848.1 protein_id gnl|my_center|LOCUS_08620 6292 5276 gene locus_tag LOCUS_08630 6292 5276 CDS product glycosyltransferase family 9 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032807985.1 protein_id gnl|my_center|LOCUS_08630 6845 8059 gene locus_tag LOCUS_08640 6845 8059 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877734.1 protein_id gnl|my_center|LOCUS_08640 8257 9129 gene locus_tag LOCUS_08650 8257 9129 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877735.1 protein_id gnl|my_center|LOCUS_08650 9328 10329 gene locus_tag LOCUS_08660 9328 10329 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807976.1 protein_id gnl|my_center|LOCUS_08660 10311 11084 gene locus_tag LOCUS_08670 10311 11084 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870136.1 protein_id gnl|my_center|LOCUS_08670 11092 11841 gene locus_tag LOCUS_08680 11092 11841 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680283.1 protein_id gnl|my_center|LOCUS_08680 11847 13487 gene locus_tag LOCUS_08690 11847 13487 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228677.1 protein_id gnl|my_center|LOCUS_08690 14307 13504 gene locus_tag LOCUS_08700 14307 13504 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256968.1 protein_id gnl|my_center|LOCUS_08700 15304 14561 gene locus_tag LOCUS_08710 15304 14561 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256973.1 protein_id gnl|my_center|LOCUS_08710 17370 15469 gene locus_tag LOCUS_08720 17370 15469 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256972.1 protein_id gnl|my_center|LOCUS_08720 18648 17473 gene locus_tag LOCUS_08730 18648 17473 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926442.1 protein_id gnl|my_center|LOCUS_08730 19809 18766 gene locus_tag LOCUS_08740 19809 18766 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812443.1 protein_id gnl|my_center|LOCUS_08740 20796 19912 gene locus_tag LOCUS_08750 20796 19912 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391255.1 protein_id gnl|my_center|LOCUS_08750 22272 21115 gene locus_tag LOCUS_08760 22272 21115 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546471.1 protein_id gnl|my_center|LOCUS_08760 22677 22489 gene locus_tag LOCUS_08770 22677 22489 CDS product ferredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940534.1 protein_id gnl|my_center|LOCUS_08770 23601 23110 gene locus_tag LOCUS_08780 23601 23110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08780 24280 23570 gene locus_tag LOCUS_08790 24280 23570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08790 25106 24288 gene locus_tag LOCUS_08800 25106 24288 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393110.1 protein_id gnl|my_center|LOCUS_08800 25492 25106 gene locus_tag LOCUS_08810 gene dsrJ 25492 25106 CDS product sulfate reduction electron transfer complex DsrMKJOP subunit DsrJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393111.1 protein_id gnl|my_center|LOCUS_08810 27119 25485 gene locus_tag LOCUS_08820 27119 25485 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393112.1 protein_id gnl|my_center|LOCUS_08820 28192 27122 gene locus_tag LOCUS_08830 gene dsrM 28192 27122 CDS product sulfate reduction electron transfer complex DsrMKJOP subunit DsrM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393108.1 protein_id gnl|my_center|LOCUS_08830 28748 28236 gene locus_tag LOCUS_08840 28748 28236 CDS product RsbRD N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393113.1 protein_id gnl|my_center|LOCUS_08840 >Feature sequence027 74 241 gene locus_tag LOCUS_08850 74 241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08850 837 412 gene locus_tag LOCUS_08860 837 412 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583101.1 protein_id gnl|my_center|LOCUS_08860 2051 873 gene locus_tag LOCUS_08870 2051 873 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941722.1 protein_id gnl|my_center|LOCUS_08870 2498 3676 gene locus_tag LOCUS_08880 2498 3676 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931942.1 protein_id gnl|my_center|LOCUS_08880 3979 5061 gene locus_tag LOCUS_08890 gene ispG 3979 5061 CDS product flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071541503.1 protein_id gnl|my_center|LOCUS_08890 5208 6935 gene locus_tag LOCUS_08900 5208 6935 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942106.1 protein_id gnl|my_center|LOCUS_08900 6919 9060 gene locus_tag LOCUS_08910 6919 9060 CDS product bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942876.1 protein_id gnl|my_center|LOCUS_08910 9272 9057 gene locus_tag LOCUS_08920 gene rpmB 9272 9057 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942874.1 protein_id gnl|my_center|LOCUS_08920 9390 10856 gene locus_tag LOCUS_08930 9390 10856 CDS product Mur ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403684.1 protein_id gnl|my_center|LOCUS_08930 10988 11542 gene locus_tag LOCUS_08940 10988 11542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08940 13042 11660 gene locus_tag LOCUS_08950 13042 11660 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546604.1 protein_id gnl|my_center|LOCUS_08950 14213 13044 gene locus_tag LOCUS_08960 gene lpxB 14213 13044 CDS product lipid-A-disaccharide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942901.1 protein_id gnl|my_center|LOCUS_08960 15501 14530 gene locus_tag LOCUS_08970 15501 14530 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942903.1 protein_id gnl|my_center|LOCUS_08970 16338 15508 gene locus_tag LOCUS_08980 gene lpxI 16338 15508 CDS product UDP-2,3-diacylglucosamine diphosphatase LpxI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546653.1 protein_id gnl|my_center|LOCUS_08980 17544 16759 gene locus_tag LOCUS_08990 gene lpxA 17544 16759 CDS product acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546244.1 protein_id gnl|my_center|LOCUS_08990 18041 17577 gene locus_tag LOCUS_09000 gene fabZ 18041 17577 CDS product 3-hydroxyacyl-ACP dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545346.1 protein_id gnl|my_center|LOCUS_09000 19084 18044 gene locus_tag LOCUS_09010 gene lpxD 19084 18044 CDS product UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942906.1 protein_id gnl|my_center|LOCUS_09010 19523 19101 gene locus_tag LOCUS_09020 19523 19101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09020 22455 19711 gene locus_tag LOCUS_09030 gene bamA 22455 19711 CDS product outer membrane protein assembly factor BamA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942908.1 protein_id gnl|my_center|LOCUS_09030 23140 22439 gene locus_tag LOCUS_09040 23140 22439 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942909.1 protein_id gnl|my_center|LOCUS_09040 24356 23133 gene locus_tag LOCUS_09050 24356 23133 CDS product lipoprotein-releasing ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942910.1 protein_id gnl|my_center|LOCUS_09050 25932 24445 gene locus_tag LOCUS_09060 gene lysS 25932 24445 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942911.1 protein_id gnl|my_center|LOCUS_09060 26292 27821 gene locus_tag LOCUS_09070 26292 27821 CDS product acetate--CoA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867476.1 protein_id gnl|my_center|LOCUS_09070 28219 27818 gene locus_tag LOCUS_09080 28219 27818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09080 29389 28223 gene locus_tag LOCUS_09090 29389 28223 CDS product beta-ketoacyl synthase N-terminal-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878787.1 protein_id gnl|my_center|LOCUS_09090 >Feature sequence028 877 245 gene locus_tag LOCUS_09100 877 245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09100 1982 897 gene locus_tag LOCUS_09110 1982 897 CDS product MlaD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454833.1 protein_id gnl|my_center|LOCUS_09110 2770 1982 gene locus_tag LOCUS_09120 2770 1982 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454839.1 protein_id gnl|my_center|LOCUS_09120 3920 2775 gene locus_tag LOCUS_09130 3920 2775 CDS product MlaE family lipid ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023003620.1 protein_id gnl|my_center|LOCUS_09130 5258 3933 gene locus_tag LOCUS_09140 5258 3933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09140 5504 7696 gene locus_tag LOCUS_09150 5504 7696 CDS product aldehyde ferredoxin oxidoreductase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869551.1 protein_id gnl|my_center|LOCUS_09150 7693 7947 gene locus_tag LOCUS_09160 7693 7947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09160 9758 7944 gene locus_tag LOCUS_09170 9758 7944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09170 10762 9932 gene locus_tag LOCUS_09180 10762 9932 CDS product P-loop NTPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939133.1 protein_id gnl|my_center|LOCUS_09180 11766 10858 gene locus_tag LOCUS_09190 11766 10858 CDS product methyltetrahydrofolate cobalamin methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393605.1 protein_id gnl|my_center|LOCUS_09190 13196 11853 gene locus_tag LOCUS_09200 gene acsC 13196 11853 CDS product acetyl-CoA decarbonylase/synthase complex subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392715.1 protein_id gnl|my_center|LOCUS_09200 15486 13315 gene locus_tag LOCUS_09210 gene acsB 15486 13315 CDS product acetyl-CoA decarbonylase/synthase complex subunit alpha/beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418359.1 protein_id gnl|my_center|LOCUS_09210 17595 15562 gene locus_tag LOCUS_09220 gene cooS 17595 15562 CDS product anaerobic carbon-monoxide dehydrogenase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066467.1 protein_id gnl|my_center|LOCUS_09220 18329 17697 gene locus_tag LOCUS_09230 18329 17697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09230 19272 18349 gene locus_tag LOCUS_09240 gene acsD 19272 18349 CDS product acetyl-CoA decarbonylase/synthase complex subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003432254.1 protein_id gnl|my_center|LOCUS_09240 20604 19861 gene locus_tag LOCUS_09250 20604 19861 CDS product carbon monoxide dehydrogenase accessory protein CooC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418348.1 protein_id gnl|my_center|LOCUS_09250 20915 22204 gene locus_tag LOCUS_09260 gene dnaA 20915 22204 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947895.1 protein_id gnl|my_center|LOCUS_09260 22406 23521 gene locus_tag LOCUS_09270 gene dnaN 22406 23521 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940679.1 protein_id gnl|my_center|LOCUS_09270 23526 25910 gene locus_tag LOCUS_09280 gene gyrB 23526 25910 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940681.1 protein_id gnl|my_center|LOCUS_09280 26100 28580 gene locus_tag LOCUS_09290 gene gyrA 26100 28580 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940682.1 protein_id gnl|my_center|LOCUS_09290 28555 28740 gene locus_tag LOCUS_09300 28555 28740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09300 >Feature sequence029 <1 868 gene locus_tag LOCUS_09310 <1 868 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010958239.1:ATP-binding protein 3686 1059 gene locus_tag LOCUS_09320 3686 1059 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929460.1 protein_id gnl|my_center|LOCUS_09320 4265 6760 gene locus_tag LOCUS_09330 4265 6760 CDS product vitamin B12-dependent ribonucleotide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164561900.1 protein_id gnl|my_center|LOCUS_09330 8168 6771 gene locus_tag LOCUS_09340 gene purD 8168 6771 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456447.1 protein_id gnl|my_center|LOCUS_09340 10249 8207 gene locus_tag LOCUS_09350 10249 8207 CDS product TRAP transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228476.1 protein_id gnl|my_center|LOCUS_09350 11690 10284 gene locus_tag LOCUS_09360 11690 10284 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879446.1 protein_id gnl|my_center|LOCUS_09360 12750 11986 gene locus_tag LOCUS_09370 gene trpA 12750 11986 CDS product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392849.1 protein_id gnl|my_center|LOCUS_09370 13385 12753 gene locus_tag LOCUS_09380 13385 12753 CDS product phosphoribosylanthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943014.1 protein_id gnl|my_center|LOCUS_09380 14166 13372 gene locus_tag LOCUS_09390 gene trpC 14166 13372 CDS product indole-3-glycerol phosphate synthase TrpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122620.1 protein_id gnl|my_center|LOCUS_09390 15256 14177 gene locus_tag LOCUS_09400 gene trpD 15256 14177 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943017.1 protein_id gnl|my_center|LOCUS_09400 15839 15276 gene locus_tag LOCUS_09410 gene pabA 15839 15276 CDS product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000602287.1 protein_id gnl|my_center|LOCUS_09410 17310 15820 gene locus_tag LOCUS_09420 gene trpE 17310 15820 CDS product anthranilate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546555.1 protein_id gnl|my_center|LOCUS_09420 17801 18355 gene locus_tag LOCUS_09430 17801 18355 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546210.1 protein_id gnl|my_center|LOCUS_09430 18345 19403 gene locus_tag LOCUS_09440 gene aroC 18345 19403 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938193.1 protein_id gnl|my_center|LOCUS_09440 19815 20696 gene locus_tag LOCUS_09450 19815 20696 CDS product 2-amino-3,7-dideoxy-D-threo-hept-6-ulosonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020491.1 protein_id gnl|my_center|LOCUS_09450 20624 22417 gene locus_tag LOCUS_09460 20624 22417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09460 22414 23409 gene locus_tag LOCUS_09470 22414 23409 CDS product 3-dehydroquinate synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881255.1 protein_id gnl|my_center|LOCUS_09470 23406 24074 gene locus_tag LOCUS_09480 23406 24074 CDS product 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249221.1 protein_id gnl|my_center|LOCUS_09480 24074 24901 gene locus_tag LOCUS_09490 24074 24901 CDS product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393067.1 protein_id gnl|my_center|LOCUS_09490 24888 26156 gene locus_tag LOCUS_09500 gene aroA 24888 26156 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031206.1 protein_id gnl|my_center|LOCUS_09500 26498 26343 gene locus_tag LOCUS_09510 26498 26343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09510 28724 26844 gene locus_tag LOCUS_09520 gene ftsH 28724 26844 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869596.1 protein_id gnl|my_center|LOCUS_09520 >Feature sequence030 372 1010 gene locus_tag LOCUS_09530 372 1010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09530 1710 1474 gene locus_tag LOCUS_09540 1710 1474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09540 5068 1664 gene locus_tag LOCUS_09550 5068 1664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09550 5238 5753 gene locus_tag LOCUS_09560 5238 5753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09560 5941 6390 gene locus_tag LOCUS_09570 gene trxA 5941 6390 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228708.1 protein_id gnl|my_center|LOCUS_09570 6706 6383 gene locus_tag LOCUS_09580 6706 6383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09580 8215 6905 gene locus_tag LOCUS_09590 gene fabF 8215 6905 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544941.1 protein_id gnl|my_center|LOCUS_09590 9063 10046 gene locus_tag LOCUS_09600 9063 10046 CDS product exo-alpha-sialidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103756.1 protein_id gnl|my_center|LOCUS_09600 10046 10639 gene locus_tag LOCUS_09610 10046 10639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09610 11205 12065 gene locus_tag LOCUS_09620 11205 12065 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881241.1 protein_id gnl|my_center|LOCUS_09620 12062 12994 gene locus_tag LOCUS_09630 12062 12994 CDS product lysylphosphatidylglycerol synthase transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140943.1 protein_id gnl|my_center|LOCUS_09630 13001 14128 gene locus_tag LOCUS_09640 gene lptF 13001 14128 CDS product LPS export ABC transporter permease LptF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938951.1 protein_id gnl|my_center|LOCUS_09640 14179 16050 gene locus_tag LOCUS_09650 14179 16050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_098076974.1 protein_id gnl|my_center|LOCUS_09650 17062 16043 gene locus_tag LOCUS_09660 17062 16043 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792562.1 protein_id gnl|my_center|LOCUS_09660 17669 17076 gene locus_tag LOCUS_09670 17669 17076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09670 18559 17741 gene locus_tag LOCUS_09680 gene fdhD 18559 17741 CDS product formate dehydrogenase accessory sulfurtransferase FdhD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005084892.1 protein_id gnl|my_center|LOCUS_09680 18783 18998 gene locus_tag LOCUS_09690 18783 18998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09690 19419 19015 gene locus_tag LOCUS_09700 gene mce 19419 19015 CDS product methylmalonyl-CoA epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869043.1 protein_id gnl|my_center|LOCUS_09700 19592 19843 gene locus_tag LOCUS_09710 19592 19843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09710 20059 21648 gene locus_tag LOCUS_09720 20059 21648 CDS product VCBS repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940448.1 protein_id gnl|my_center|LOCUS_09720 22064 21663 gene locus_tag LOCUS_09730 22064 21663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_09730 22511 22101 gene locus_tag LOCUS_09740 22511 22101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09740 23436 22570 gene locus_tag LOCUS_09750 23436 22570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09750 23913 23674 gene locus_tag LOCUS_09760 23913 23674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09760 24190 24264 gene locus_tag LOCUS_t00110 24190 24264 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 24942 25706 gene locus_tag LOCUS_09770 gene htpX 24942 25706 CDS product zinc metalloprotease HtpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942212.1 protein_id gnl|my_center|LOCUS_09770 26282 25695 gene locus_tag LOCUS_09780 26282 25695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09780 26459 27313 gene locus_tag LOCUS_09790 26459 27313 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003433818.1 protein_id gnl|my_center|LOCUS_09790 27412 28605 gene locus_tag LOCUS_09800 27412 28605 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000498060.1 protein_id gnl|my_center|LOCUS_09800 >Feature sequence031 816 175 gene locus_tag LOCUS_09810 816 175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09810 1027 1197 gene locus_tag LOCUS_09820 1027 1197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09820 2416 1241 gene locus_tag LOCUS_09830 2416 1241 CDS product DUF1343 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545899.1 protein_id gnl|my_center|LOCUS_09830 2694 3494 gene locus_tag LOCUS_09840 2694 3494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09840 3628 5631 gene locus_tag LOCUS_09850 3628 5631 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461059.1 protein_id gnl|my_center|LOCUS_09850 5650 5874 gene locus_tag LOCUS_09860 5650 5874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09860 5881 6657 gene locus_tag LOCUS_09870 5881 6657 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973077.1 protein_id gnl|my_center|LOCUS_09870 8021 6669 gene locus_tag LOCUS_09880 8021 6669 CDS product bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868207.1 protein_id gnl|my_center|LOCUS_09880 8626 8018 gene locus_tag LOCUS_09890 8626 8018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09890 9303 8623 gene locus_tag LOCUS_09900 9303 8623 CDS product energy-coupling factor transporter transmembrane component T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256686.1 protein_id gnl|my_center|LOCUS_09900 10798 9305 gene locus_tag LOCUS_09910 10798 9305 CDS product energy-coupling factor ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461242.1 protein_id gnl|my_center|LOCUS_09910 11277 10795 gene locus_tag LOCUS_09920 11277 10795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09920 12578 11274 gene locus_tag LOCUS_09930 gene cytX 12578 11274 CDS product putative hydroxymethylpyrimidine transporter CytX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868210.1 protein_id gnl|my_center|LOCUS_09930 13060 14187 gene locus_tag LOCUS_09940 13060 14187 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941744.1 protein_id gnl|my_center|LOCUS_09940 14365 15576 gene locus_tag LOCUS_09950 14365 15576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09950 15933 18274 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtttcaaatccacttcggtttgatgggaac 18750 18484 gene locus_tag LOCUS_09960 gene cas2 18750 18484 CDS product CRISPR-associated endonuclease Cas2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023576.1 protein_id gnl|my_center|LOCUS_09960 19793 18747 gene locus_tag LOCUS_09970 gene cas1b 19793 18747 CDS product type I-B CRISPR-associated endonuclease Cas1b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008768967.1 protein_id gnl|my_center|LOCUS_09970 20311 19790 gene locus_tag LOCUS_09980 gene cas4 20311 19790 CDS product CRISPR-associated protein Cas4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930592.1 protein_id gnl|my_center|LOCUS_09980 21305 20301 gene locus_tag LOCUS_09990 21305 20301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09990 21648 21923 gene locus_tag LOCUS_10000 21648 21923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10000 23310 22834 gene locus_tag LOCUS_10010 23310 22834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10010 24334 23354 gene locus_tag LOCUS_10020 24334 23354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10020 24870 24331 gene locus_tag LOCUS_10030 24870 24331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10030 27443 26601 gene locus_tag LOCUS_10040 27443 26601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10040 >Feature sequence032 320 1114 gene locus_tag LOCUS_10050 320 1114 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256973.1 protein_id gnl|my_center|LOCUS_10050 1120 3123 gene locus_tag LOCUS_10060 1120 3123 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256972.1 protein_id gnl|my_center|LOCUS_10060 3123 4013 gene locus_tag LOCUS_10070 3123 4013 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391255.1 protein_id gnl|my_center|LOCUS_10070 4303 5343 gene locus_tag LOCUS_10080 4303 5343 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005463596.1 protein_id gnl|my_center|LOCUS_10080 5437 6648 gene locus_tag LOCUS_10090 5437 6648 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228048.1 protein_id gnl|my_center|LOCUS_10090 6705 8291 gene locus_tag LOCUS_10100 6705 8291 CDS product benzoate-CoA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083897.1 protein_id gnl|my_center|LOCUS_10100 8535 9329 gene locus_tag LOCUS_10110 8535 9329 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256968.1 protein_id gnl|my_center|LOCUS_10110 9357 9821 gene locus_tag LOCUS_10120 9357 9821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10120 10368 11279 gene locus_tag LOCUS_10130 10368 11279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10130 11297 13225 gene locus_tag LOCUS_10140 11297 13225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10140 13146 13358 gene locus_tag LOCUS_10150 13146 13358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10150 15149 13407 gene locus_tag LOCUS_10160 15149 13407 CDS product ArsB/NhaD family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546477.1 protein_id gnl|my_center|LOCUS_10160 15343 15149 gene locus_tag LOCUS_10170 15343 15149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10170 15321 15761 gene locus_tag LOCUS_10180 15321 15761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10180 16232 15795 gene locus_tag LOCUS_10190 16232 15795 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546418.1 protein_id gnl|my_center|LOCUS_10190 17810 16569 gene locus_tag LOCUS_10200 17810 16569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10200 18244 17825 gene locus_tag LOCUS_10210 18244 17825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10210 18973 18308 gene locus_tag LOCUS_10220 18973 18308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10220 19344 18970 gene locus_tag LOCUS_10230 19344 18970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10230 21080 19362 gene locus_tag LOCUS_10240 21080 19362 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940221.1 protein_id gnl|my_center|LOCUS_10240 21770 21084 gene locus_tag LOCUS_10250 21770 21084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10250 22375 21887 gene locus_tag LOCUS_10260 22375 21887 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545664.1 protein_id gnl|my_center|LOCUS_10260 23006 22491 gene locus_tag LOCUS_10270 23006 22491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10270 23097 24056 gene locus_tag LOCUS_10280 23097 24056 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546489.1 protein_id gnl|my_center|LOCUS_10280 24099 24524 gene locus_tag LOCUS_10290 24099 24524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545633.1 protein_id gnl|my_center|LOCUS_10290 25661 25101 gene locus_tag LOCUS_10300 25661 25101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10300 26062 25940 gene locus_tag LOCUS_10310 26062 25940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10310 27999 27043 gene locus_tag LOCUS_10320 27999 27043 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942246.1 protein_id gnl|my_center|LOCUS_10320 >Feature sequence033 456 101 gene locus_tag LOCUS_tm00010 456 101 tmRNA product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 1025 552 gene locus_tag LOCUS_10330 gene smpB 1025 552 CDS product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942353.1 protein_id gnl|my_center|LOCUS_10330 2892 1108 gene locus_tag LOCUS_10340 gene ptsP 2892 1108 CDS product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_092157593.1 protein_id gnl|my_center|LOCUS_10340 4079 2889 gene locus_tag LOCUS_10350 4079 2889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10350 4460 4092 gene locus_tag LOCUS_10360 4460 4092 CDS product YraN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941311.1 protein_id gnl|my_center|LOCUS_10360 5117 4536 gene locus_tag LOCUS_10370 5117 4536 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941310.1 protein_id gnl|my_center|LOCUS_10370 5624 5280 gene locus_tag LOCUS_10380 gene rplS 5624 5280 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392486.1 protein_id gnl|my_center|LOCUS_10380 6200 5643 gene locus_tag LOCUS_10390 6200 5643 CDS product SPOUT family RNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081987.1 protein_id gnl|my_center|LOCUS_10390 6937 6203 gene locus_tag LOCUS_10400 gene trmD 6937 6203 CDS product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392485.1 protein_id gnl|my_center|LOCUS_10400 7460 6927 gene locus_tag LOCUS_10410 gene rimM 7460 6927 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_200858943.1 protein_id gnl|my_center|LOCUS_10410 7693 7463 gene locus_tag LOCUS_10420 7693 7463 CDS product KH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938139.1 protein_id gnl|my_center|LOCUS_10420 7994 7746 gene locus_tag LOCUS_10430 gene rpsP 7994 7746 CDS product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357434.1 protein_id gnl|my_center|LOCUS_10430 9391 8066 gene locus_tag LOCUS_10440 gene ffh 9391 8066 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392481.1 protein_id gnl|my_center|LOCUS_10440 9815 10204 gene locus_tag LOCUS_10450 9815 10204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10450 10116 12572 gene locus_tag LOCUS_10460 gene ligA 10116 12572 CDS product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941554.1 protein_id gnl|my_center|LOCUS_10460 12831 13109 gene locus_tag LOCUS_10470 12831 13109 CDS product acylphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250981.1 protein_id gnl|my_center|LOCUS_10470 13649 14572 gene locus_tag LOCUS_10480 13649 14572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10480 14597 15856 gene locus_tag LOCUS_10490 gene murA 14597 15856 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943723.1 protein_id gnl|my_center|LOCUS_10490 16076 15816 gene locus_tag LOCUS_10500 16076 15816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10500 16029 18299 gene locus_tag LOCUS_10510 16029 18299 CDS product DNA internalization-related competence protein ComEC/Rec2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942301.1 protein_id gnl|my_center|LOCUS_10510 18508 18993 gene locus_tag LOCUS_10520 18508 18993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10520 19181 18990 gene locus_tag LOCUS_10530 19181 18990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10530 20610 19273 gene locus_tag LOCUS_10540 20610 19273 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938045.1 protein_id gnl|my_center|LOCUS_10540 23029 20639 gene locus_tag LOCUS_10550 23029 20639 CDS product PBP1A family penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937936.1 protein_id gnl|my_center|LOCUS_10550 23909 23106 gene locus_tag LOCUS_10560 23909 23106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10560 24375 23929 gene locus_tag LOCUS_10570 24375 23929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10570 27009 24469 gene locus_tag LOCUS_10580 27009 24469 CDS product Na-K-Cl cotransporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404985.1 protein_id gnl|my_center|LOCUS_10580 27195 27671 gene locus_tag LOCUS_10590 27195 27671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10590 >Feature sequence034 361 2 gene locus_tag LOCUS_10600 361 2 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10600 579 863 gene locus_tag LOCUS_10610 579 863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10610 1063 878 gene locus_tag LOCUS_10620 1063 878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10620 1387 1632 gene locus_tag LOCUS_10630 1387 1632 CDS product zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393102.1 protein_id gnl|my_center|LOCUS_10630 1629 1916 gene locus_tag LOCUS_10640 1629 1916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10640 1918 3015 gene locus_tag LOCUS_10650 1918 3015 CDS product PBS lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393103.1 protein_id gnl|my_center|LOCUS_10650 3012 4166 gene locus_tag LOCUS_10660 3012 4166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10660 4779 4126 gene locus_tag LOCUS_10670 4779 4126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940532.1 protein_id gnl|my_center|LOCUS_10670 5442 4795 gene locus_tag LOCUS_10680 5442 4795 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393104.1 protein_id gnl|my_center|LOCUS_10680 5851 5618 gene locus_tag LOCUS_10690 5851 5618 CDS product dissimilatory sulfite reductase D family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393105.1 protein_id gnl|my_center|LOCUS_10690 7126 5939 gene locus_tag LOCUS_10700 gene dsrB 7126 5939 CDS product dissimilatory-type sulfite reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393106.1 protein_id gnl|my_center|LOCUS_10700 8557 7139 gene locus_tag LOCUS_10710 gene dsrA 8557 7139 CDS product dissimilatory-type sulfite reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393107.1 protein_id gnl|my_center|LOCUS_10710 8977 10365 gene locus_tag LOCUS_10720 gene cobB 8977 10365 CDS product hydrogenobyrinic acid a,c-diamide synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545628.1 protein_id gnl|my_center|LOCUS_10720 10390 10578 gene locus_tag LOCUS_10730 10390 10578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10730 10624 10941 gene locus_tag LOCUS_10740 10624 10941 CDS product TusE/DsrC/DsvC family sulfur relay protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940042.1 protein_id gnl|my_center|LOCUS_10740 11992 10994 gene locus_tag LOCUS_10750 11992 10994 CDS product nitrilase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810480.1 protein_id gnl|my_center|LOCUS_10750 12072 13649 gene locus_tag LOCUS_10760 12072 13649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10760 13997 13752 gene locus_tag LOCUS_10770 13997 13752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10770 14611 13994 gene locus_tag LOCUS_10780 14611 13994 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259729.1 protein_id gnl|my_center|LOCUS_10780 15646 15050 gene locus_tag LOCUS_10790 15646 15050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10790 17322 15733 gene locus_tag LOCUS_10800 17322 15733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10800 18685 17525 gene locus_tag LOCUS_10810 gene nrfD 18685 17525 CDS product polysulfide reductase NrfD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940748.1 protein_id gnl|my_center|LOCUS_10810 19491 18685 gene locus_tag LOCUS_10820 19491 18685 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940747.1 protein_id gnl|my_center|LOCUS_10820 20024 19491 gene locus_tag LOCUS_10830 20024 19491 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940746.1 protein_id gnl|my_center|LOCUS_10830 20015 20164 gene locus_tag LOCUS_10840 20015 20164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10840 21328 20624 gene locus_tag LOCUS_10850 21328 20624 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071542425.1 protein_id gnl|my_center|LOCUS_10850 21661 23277 gene locus_tag LOCUS_10860 21661 23277 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808106.1 protein_id gnl|my_center|LOCUS_10860 23402 24001 gene locus_tag LOCUS_10870 23402 24001 CDS product FmdE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889526.1 protein_id gnl|my_center|LOCUS_10870 25352 24045 gene locus_tag LOCUS_10880 gene larA 25352 24045 CDS product nickel-dependent lactate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062283069.1 protein_id gnl|my_center|LOCUS_10880 26002 25349 gene locus_tag LOCUS_10890 26002 25349 CDS product lactate utilization protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939415.1 protein_id gnl|my_center|LOCUS_10890 27240 26098 gene locus_tag LOCUS_10900 27240 26098 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003134747.1 protein_id gnl|my_center|LOCUS_10900 >Feature sequence035 1820 897 gene locus_tag LOCUS_10910 1820 897 CDS product divergent polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942413.1 protein_id gnl|my_center|LOCUS_10910 3162 1831 gene locus_tag LOCUS_10920 3162 1831 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942416.1 protein_id gnl|my_center|LOCUS_10920 4318 3272 gene locus_tag LOCUS_10930 4318 3272 CDS product peptidoglycan DD-metalloendopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942417.1 protein_id gnl|my_center|LOCUS_10930 5325 4444 gene locus_tag LOCUS_10940 gene ftsX 5325 4444 CDS product permease-like cell division protein FtsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942418.1 protein_id gnl|my_center|LOCUS_10940 6155 5457 gene locus_tag LOCUS_10950 gene ftsE 6155 5457 CDS product cell division ATP-binding protein FtsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942419.1 protein_id gnl|my_center|LOCUS_10950 7517 6192 gene locus_tag LOCUS_10960 7517 6192 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940356.1 protein_id gnl|my_center|LOCUS_10960 7951 8247 gene locus_tag LOCUS_10970 7951 8247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10970 8213 8401 gene locus_tag LOCUS_10980 8213 8401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10980 8926 10287 gene locus_tag LOCUS_10990 8926 10287 CDS product B12-binding domain-containing radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933561.1 protein_id gnl|my_center|LOCUS_10990 10343 11167 gene locus_tag LOCUS_11000 10343 11167 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938516.1 protein_id gnl|my_center|LOCUS_11000 11187 11720 gene locus_tag LOCUS_11010 11187 11720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11010 11913 11827 gene locus_tag LOCUS_t00120 11913 11827 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 12250 12023 gene locus_tag LOCUS_11020 12250 12023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11020 12158 13111 gene locus_tag LOCUS_11030 12158 13111 CDS product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546739.1 protein_id gnl|my_center|LOCUS_11030 13179 14501 gene locus_tag LOCUS_11040 gene rsxC 13179 14501 CDS product electron transport complex subunit RsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583453.1 protein_id gnl|my_center|LOCUS_11040 14570 15574 gene locus_tag LOCUS_11050 14570 15574 CDS product RnfABCDGE type electron transport complex subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948146.1 protein_id gnl|my_center|LOCUS_11050 15571 16485 gene locus_tag LOCUS_11060 15571 16485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11060 16517 17143 gene locus_tag LOCUS_11070 16517 17143 CDS product electron transport complex subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002670120.1 protein_id gnl|my_center|LOCUS_11070 17140 18102 gene locus_tag LOCUS_11080 17140 18102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11080 18194 18355 gene locus_tag LOCUS_11090 18194 18355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11090 18398 19057 gene locus_tag LOCUS_11100 18398 19057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_11100 19132 20187 gene locus_tag LOCUS_11110 19132 20187 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940064.1 protein_id gnl|my_center|LOCUS_11110 21621 20257 gene locus_tag LOCUS_11120 gene dnaB 21621 20257 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941663.1 protein_id gnl|my_center|LOCUS_11120 22167 21700 gene locus_tag LOCUS_11130 gene rplI 22167 21700 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941329.1 protein_id gnl|my_center|LOCUS_11130 23079 22183 gene locus_tag LOCUS_11140 23079 22183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11140 23546 23199 gene locus_tag LOCUS_11150 gene rpsR 23546 23199 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941327.1 protein_id gnl|my_center|LOCUS_11150 23865 23461 gene locus_tag LOCUS_11160 23865 23461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11160 25115 24030 gene locus_tag LOCUS_11170 gene gmd 25115 24030 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937755.1 protein_id gnl|my_center|LOCUS_11170 26102 25134 gene locus_tag LOCUS_11180 gene gmd 26102 25134 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257005.1 protein_id gnl|my_center|LOCUS_11180 27131 26571 gene locus_tag LOCUS_11190 27131 26571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11190 >Feature sequence036 147 338 gene locus_tag LOCUS_11200 147 338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11200 352 537 gene locus_tag LOCUS_11210 352 537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11210 747 1394 gene locus_tag LOCUS_11220 747 1394 CDS product cytochrome c3 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940677.1 protein_id gnl|my_center|LOCUS_11220 1406 3871 gene locus_tag LOCUS_11230 1406 3871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11230 3946 4776 gene locus_tag LOCUS_11240 3946 4776 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937996.1 protein_id gnl|my_center|LOCUS_11240 4831 6069 gene locus_tag LOCUS_11250 gene nrfD 4831 6069 CDS product polysulfide reductase NrfD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937995.1 protein_id gnl|my_center|LOCUS_11250 6082 6240 gene locus_tag LOCUS_11260 6082 6240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11260 7850 6237 gene locus_tag LOCUS_11270 gene nadB 7850 6237 CDS product L-aspartate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942471.1 protein_id gnl|my_center|LOCUS_11270 8210 8022 gene locus_tag LOCUS_11280 8210 8022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11280 8258 9484 gene locus_tag LOCUS_11290 8258 9484 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142659.1 protein_id gnl|my_center|LOCUS_11290 9639 10082 gene locus_tag LOCUS_11300 gene gspG 9639 10082 CDS product type II secretion system major pseudopilin GspG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940994.1 protein_id gnl|my_center|LOCUS_11300 10176 10676 gene locus_tag LOCUS_11310 10176 10676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11310 10789 11205 gene locus_tag LOCUS_11320 10789 11205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11320 11232 11864 gene locus_tag LOCUS_11330 11232 11864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11330 11917 12903 gene locus_tag LOCUS_11340 11917 12903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11340 12900 14411 gene locus_tag LOCUS_11350 12900 14411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11350 14562 15047 gene locus_tag LOCUS_11360 14562 15047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11360 15044 15967 gene locus_tag LOCUS_11370 15044 15967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11370 16046 16906 gene locus_tag LOCUS_11380 16046 16906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11380 16934 18595 gene locus_tag LOCUS_11390 16934 18595 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942184.1 protein_id gnl|my_center|LOCUS_11390 18753 19409 gene locus_tag LOCUS_11400 18753 19409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11400 19457 21562 gene locus_tag LOCUS_11410 gene gspD 19457 21562 CDS product type II secretion system secretin GspD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940997.1 protein_id gnl|my_center|LOCUS_11410 21704 23401 gene locus_tag LOCUS_11420 gene gspE 21704 23401 CDS product type II secretion system ATPase GspE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000853744.1 protein_id gnl|my_center|LOCUS_11420 23370 24695 gene locus_tag LOCUS_11430 23370 24695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11430 24662 25303 gene locus_tag LOCUS_11440 24662 25303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11440 26869 25367 gene locus_tag LOCUS_11450 26869 25367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11450 >Feature sequence037 153 1022 gene locus_tag LOCUS_11460 153 1022 CDS product Mrp/NBP35 family ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942056.1 protein_id gnl|my_center|LOCUS_11460 1182 1664 gene locus_tag LOCUS_11470 gene nifU 1182 1664 CDS product Fe-S cluster assembly scaffold protein NifU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_124796962.1 protein_id gnl|my_center|LOCUS_11470 1807 3891 gene locus_tag LOCUS_11480 1807 3891 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545814.1 protein_id gnl|my_center|LOCUS_11480 3920 4426 gene locus_tag LOCUS_11490 3920 4426 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545501.1 protein_id gnl|my_center|LOCUS_11490 4476 6644 gene locus_tag LOCUS_11500 4476 6644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11500 6660 6872 gene locus_tag LOCUS_11510 6660 6872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11510 6984 7433 gene locus_tag LOCUS_11520 6984 7433 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000275600.1 protein_id gnl|my_center|LOCUS_11520 7454 8221 gene locus_tag LOCUS_11530 7454 8221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11530 8211 9011 gene locus_tag LOCUS_11540 gene ubiE 8211 9011 CDS product bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889031.1 protein_id gnl|my_center|LOCUS_11540 10397 8985 gene locus_tag LOCUS_11550 10397 8985 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942141.1 protein_id gnl|my_center|LOCUS_11550 11661 10381 gene locus_tag LOCUS_11560 11661 10381 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941927.1 protein_id gnl|my_center|LOCUS_11560 12442 12014 gene locus_tag LOCUS_11570 12442 12014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11570 13588 12512 gene locus_tag LOCUS_11580 13588 12512 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943459.1 protein_id gnl|my_center|LOCUS_11580 14299 13670 gene locus_tag LOCUS_11590 gene rpsD 14299 13670 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943460.1 protein_id gnl|my_center|LOCUS_11590 14753 14358 gene locus_tag LOCUS_11600 gene rpsK 14753 14358 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943461.1 protein_id gnl|my_center|LOCUS_11600 15144 14773 gene locus_tag LOCUS_11610 gene rpsM 15144 14773 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938621.1 protein_id gnl|my_center|LOCUS_11610 15345 15187 gene locus_tag LOCUS_11620 15345 15187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11620 15736 15512 gene locus_tag LOCUS_11630 gene infA 15736 15512 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003156508.1 protein_id gnl|my_center|LOCUS_11630 17103 15790 gene locus_tag LOCUS_11640 gene secY 17103 15790 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943466.1 protein_id gnl|my_center|LOCUS_11640 17569 17129 gene locus_tag LOCUS_11650 gene rplO 17569 17129 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723680.1 protein_id gnl|my_center|LOCUS_11650 17762 17556 gene locus_tag LOCUS_11660 gene rpmD 17762 17556 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000201159.1 protein_id gnl|my_center|LOCUS_11660 18343 17846 gene locus_tag LOCUS_11670 gene rpsE 18343 17846 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943469.1 protein_id gnl|my_center|LOCUS_11670 18813 18445 gene locus_tag LOCUS_11680 gene rplR 18813 18445 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081803.1 protein_id gnl|my_center|LOCUS_11680 19435 18896 gene locus_tag LOCUS_11690 gene rplF 19435 18896 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055950.1 protein_id gnl|my_center|LOCUS_11690 19882 19484 gene locus_tag LOCUS_11700 gene rpsH 19882 19484 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943472.1 protein_id gnl|my_center|LOCUS_11700 20134 19949 gene locus_tag LOCUS_11710 20134 19949 CDS product type Z 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938611.1 protein_id gnl|my_center|LOCUS_11710 20703 20158 gene locus_tag LOCUS_11720 gene rplE 20703 20158 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943474.1 protein_id gnl|my_center|LOCUS_11720 21066 20737 gene locus_tag LOCUS_11730 gene rplX 21066 20737 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938609.1 protein_id gnl|my_center|LOCUS_11730 21495 21127 gene locus_tag LOCUS_11740 gene rplN 21495 21127 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938608.1 protein_id gnl|my_center|LOCUS_11740 21780 21517 gene locus_tag LOCUS_11750 gene rpsQ 21780 21517 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546149.1 protein_id gnl|my_center|LOCUS_11750 21996 21793 gene locus_tag LOCUS_11760 gene rpmC 21996 21793 CDS product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003567550.1 protein_id gnl|my_center|LOCUS_11760 22411 22001 gene locus_tag LOCUS_11770 gene rplP 22411 22001 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943479.1 protein_id gnl|my_center|LOCUS_11770 23063 22416 gene locus_tag LOCUS_11780 gene rpsC 23063 22416 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943480.1 protein_id gnl|my_center|LOCUS_11780 23453 23121 gene locus_tag LOCUS_11790 gene rplV 23453 23121 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001148025.1 protein_id gnl|my_center|LOCUS_11790 23828 23538 gene locus_tag LOCUS_11800 gene rpsS 23828 23538 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938602.1 protein_id gnl|my_center|LOCUS_11800 24708 23884 gene locus_tag LOCUS_11810 gene rplB 24708 23884 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943483.1 protein_id gnl|my_center|LOCUS_11810 25128 24841 gene locus_tag LOCUS_11820 25128 24841 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943484.1 protein_id gnl|my_center|LOCUS_11820 25751 25128 gene locus_tag LOCUS_11830 gene rplD 25751 25128 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393936.1 protein_id gnl|my_center|LOCUS_11830 26393 25761 gene locus_tag LOCUS_11840 gene rplC 26393 25761 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081835.1 protein_id gnl|my_center|LOCUS_11840 26765 26454 gene locus_tag LOCUS_11850 gene rpsJ 26765 26454 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943487.1 protein_id gnl|my_center|LOCUS_11850 >Feature sequence038 1200 2294 gene locus_tag LOCUS_11860 1200 2294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11860 2298 3149 gene locus_tag LOCUS_11870 2298 3149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11870 3355 4368 gene locus_tag LOCUS_11880 3355 4368 CDS product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064253036.1 protein_id gnl|my_center|LOCUS_11880 4612 5139 gene locus_tag LOCUS_11890 4612 5139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11890 5136 6407 gene locus_tag LOCUS_11900 5136 6407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11900 7628 6552 gene locus_tag LOCUS_11910 7628 6552 CDS product two-component system response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071150.1 protein_id gnl|my_center|LOCUS_11910 8142 7774 gene locus_tag LOCUS_11920 8142 7774 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626534.1 protein_id gnl|my_center|LOCUS_11920 10423 8252 gene locus_tag LOCUS_11930 10423 8252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11930 10836 10420 gene locus_tag LOCUS_11940 10836 10420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11940 11656 12513 gene locus_tag LOCUS_11950 11656 12513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11950 13199 12768 gene locus_tag LOCUS_11960 gene mce 13199 12768 CDS product methylmalonyl-CoA epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867372.1 protein_id gnl|my_center|LOCUS_11960 16279 13505 gene locus_tag LOCUS_11970 16279 13505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11970 16778 16284 gene locus_tag LOCUS_11980 16778 16284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11980 17430 16798 gene locus_tag LOCUS_11990 17430 16798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11990 17896 17420 gene locus_tag LOCUS_12000 17896 17420 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764719.1 protein_id gnl|my_center|LOCUS_12000 19267 18335 gene locus_tag LOCUS_12010 19267 18335 CDS product hydroxymethylglutaryl-CoA lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256277.1 protein_id gnl|my_center|LOCUS_12010 21470 19278 gene locus_tag LOCUS_12020 21470 19278 CDS product acetate--CoA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226412.1 protein_id gnl|my_center|LOCUS_12020 22149 22889 gene locus_tag LOCUS_12030 22149 22889 CDS product NYN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406424.1 protein_id gnl|my_center|LOCUS_12030 23255 26707 gene locus_tag LOCUS_12040 23255 26707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12040 >Feature sequence039 459 1418 gene locus_tag LOCUS_12050 gene rseP 459 1418 CDS product RIP metalloprotease RseP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942559.1 protein_id gnl|my_center|LOCUS_12050 1465 2160 gene locus_tag LOCUS_12060 gene tsaB 1465 2160 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942558.1 protein_id gnl|my_center|LOCUS_12060 2551 3243 gene locus_tag LOCUS_12070 2551 3243 CDS product phosphatidylserine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196436.1 protein_id gnl|my_center|LOCUS_12070 3265 4050 gene locus_tag LOCUS_12080 gene pssA 3265 4050 CDS product CDP-diacylglycerol--serine O-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942552.1 protein_id gnl|my_center|LOCUS_12080 4052 4612 gene locus_tag LOCUS_12090 gene rsmD 4052 4612 CDS product 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941900.1 protein_id gnl|my_center|LOCUS_12090 4877 5446 gene locus_tag LOCUS_12100 gene coaD 4877 5446 CDS product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938824.1 protein_id gnl|my_center|LOCUS_12100 5534 5827 gene locus_tag LOCUS_12110 5534 5827 CDS product integration host factor subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942168.1 protein_id gnl|my_center|LOCUS_12110 6245 5919 gene locus_tag LOCUS_12120 6245 5919 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546816.1 protein_id gnl|my_center|LOCUS_12120 8664 6250 gene locus_tag LOCUS_12130 gene pheT 8664 6250 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942167.1 protein_id gnl|my_center|LOCUS_12130 9774 8767 gene locus_tag LOCUS_12140 gene pheS 9774 8767 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393252.1 protein_id gnl|my_center|LOCUS_12140 10151 9807 gene locus_tag LOCUS_12150 gene rplT 10151 9807 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006081652.1 protein_id gnl|my_center|LOCUS_12150 10555 10358 gene locus_tag LOCUS_12160 gene rpmI 10555 10358 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808207.1 protein_id gnl|my_center|LOCUS_12160 10664 10479 gene locus_tag LOCUS_12170 10664 10479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12170 11390 10866 gene locus_tag LOCUS_12180 gene infC 11390 10866 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051498574.1 protein_id gnl|my_center|LOCUS_12180 13303 11390 gene locus_tag LOCUS_12190 gene thrS 13303 11390 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193360261.1 protein_id gnl|my_center|LOCUS_12190 14448 13681 gene locus_tag LOCUS_12200 14448 13681 CDS product carbon-nitrogen family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975129.1 protein_id gnl|my_center|LOCUS_12200 14839 14423 gene locus_tag LOCUS_12210 14839 14423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12210 15057 16700 gene locus_tag LOCUS_12220 gene pgm 15057 16700 CDS product phosphoglucomutase (alpha-D-glucose-1,6-bisphosphate-dependent) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967369.1 protein_id gnl|my_center|LOCUS_12220 16757 17662 gene locus_tag LOCUS_12230 16757 17662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018304987.1 protein_id gnl|my_center|LOCUS_12230 18553 17684 gene locus_tag LOCUS_12240 gene rapZ 18553 17684 CDS product RNase adapter RapZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942529.1 protein_id gnl|my_center|LOCUS_12240 18737 20032 gene locus_tag LOCUS_12250 18737 20032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12250 20025 21374 gene locus_tag LOCUS_12260 gene glmM 20025 21374 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942450.1 protein_id gnl|my_center|LOCUS_12260 21631 21377 gene locus_tag LOCUS_12270 21631 21377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12270 23226 21955 gene locus_tag LOCUS_12280 gene eno 23226 21955 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391810.1 protein_id gnl|my_center|LOCUS_12280 23964 23398 gene locus_tag LOCUS_12290 23964 23398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12290 25052 23985 gene locus_tag LOCUS_12300 25052 23985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12300 26065 25049 gene locus_tag LOCUS_12310 26065 25049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12310 >Feature sequence040 1278 100 gene locus_tag LOCUS_12320 1278 100 CDS product FprA family A-type flavoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939297.1 protein_id gnl|my_center|LOCUS_12320 1665 2138 gene locus_tag LOCUS_12330 1665 2138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12330 5238 2410 gene locus_tag LOCUS_12340 5238 2410 CDS product UPF0182 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392653.1 protein_id gnl|my_center|LOCUS_12340 6745 5243 gene locus_tag LOCUS_12350 6745 5243 CDS product PAS domain-containing hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_100176370.1 protein_id gnl|my_center|LOCUS_12350 7320 6748 gene locus_tag LOCUS_12360 7320 6748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12360 8231 7350 gene locus_tag LOCUS_12370 gene xerD 8231 7350 CDS product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393010.1 protein_id gnl|my_center|LOCUS_12370 9653 8532 gene locus_tag LOCUS_12380 9653 8532 CDS product Xaa-Pro peptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393048.1 protein_id gnl|my_center|LOCUS_12380 9853 11835 gene locus_tag LOCUS_12390 9853 11835 CDS product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056499.1 protein_id gnl|my_center|LOCUS_12390 12644 11841 gene locus_tag LOCUS_12400 12644 11841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12400 14012 12720 gene locus_tag LOCUS_12410 gene purB 14012 12720 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942277.1 protein_id gnl|my_center|LOCUS_12410 15563 14619 gene locus_tag LOCUS_12420 15563 14619 CDS product 1,4-dihydroxy-2-naphthoate polyprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256005.1 protein_id gnl|my_center|LOCUS_12420 15919 16320 gene locus_tag LOCUS_12430 15919 16320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12430 16317 16541 gene locus_tag LOCUS_12440 16317 16541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12440 16471 17574 gene locus_tag LOCUS_12450 16471 17574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12450 17631 19064 gene locus_tag LOCUS_12460 17631 19064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12460 19412 20347 gene locus_tag LOCUS_12470 19412 20347 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011791454.1 protein_id gnl|my_center|LOCUS_12470 20351 21331 gene locus_tag LOCUS_12480 gene wtpA 20351 21331 CDS product tungstate ABC transporter substrate-binding protein WtpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013684400.1 protein_id gnl|my_center|LOCUS_12480 21337 22140 gene locus_tag LOCUS_12490 21337 22140 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020339.1 protein_id gnl|my_center|LOCUS_12490 22141 23214 gene locus_tag LOCUS_12500 gene wtpC 22141 23214 CDS product tungstate ABC transporter ATP-binding protein WtpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867278.1 protein_id gnl|my_center|LOCUS_12500 23326 24048 gene locus_tag LOCUS_12510 23326 24048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12510 25412 23979 gene locus_tag LOCUS_12520 25412 23979 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944025.1 protein_id gnl|my_center|LOCUS_12520 25613 25879 gene locus_tag LOCUS_12530 25613 25879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12530 >Feature sequence041 383 802 gene locus_tag LOCUS_12540 383 802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12540 799 2616 gene locus_tag LOCUS_12550 gene aor 799 2616 CDS product aldehyde ferredoxin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868080.1 protein_id gnl|my_center|LOCUS_12550 3000 2773 gene locus_tag LOCUS_12560 3000 2773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12560 3189 4169 gene locus_tag LOCUS_12570 3189 4169 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404896.1 protein_id gnl|my_center|LOCUS_12570 4171 5046 gene locus_tag LOCUS_12580 4171 5046 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205421555.1 protein_id gnl|my_center|LOCUS_12580 5043 6017 gene locus_tag LOCUS_12590 5043 6017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12590 6014 7009 gene locus_tag LOCUS_12600 6014 7009 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787921.1 protein_id gnl|my_center|LOCUS_12600 7006 8868 gene locus_tag LOCUS_12610 7006 8868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12610 8870 10609 gene locus_tag LOCUS_12620 8870 10609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12620 10606 11490 gene locus_tag LOCUS_12630 10606 11490 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765730.1 protein_id gnl|my_center|LOCUS_12630 11613 12761 gene locus_tag LOCUS_12640 11613 12761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12640 12824 14005 gene locus_tag LOCUS_12650 gene larC 12824 14005 CDS product nickel pincer cofactor biosynthesis protein LarC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583893.1 protein_id gnl|my_center|LOCUS_12650 14005 14514 gene locus_tag LOCUS_12660 14005 14514 CDS product phosphatidylglycerophosphatase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940818.1 protein_id gnl|my_center|LOCUS_12660 14540 15796 gene locus_tag LOCUS_12670 14540 15796 CDS product competence/damage-inducible protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940819.1 protein_id gnl|my_center|LOCUS_12670 15768 16343 gene locus_tag LOCUS_12680 gene thpR 15768 16343 CDS product RNA 2',3'-cyclic phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_221267029.1 protein_id gnl|my_center|LOCUS_12680 16414 17433 gene locus_tag LOCUS_12690 gene recA 16414 17433 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940821.1 protein_id gnl|my_center|LOCUS_12690 17525 20185 gene locus_tag LOCUS_12700 gene alaS 17525 20185 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940824.1 protein_id gnl|my_center|LOCUS_12700 20878 20147 gene locus_tag LOCUS_12710 20878 20147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12710 21293 20970 gene locus_tag LOCUS_12720 gene trxA 21293 20970 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693835.1 protein_id gnl|my_center|LOCUS_12720 21506 21333 gene locus_tag LOCUS_12730 21506 21333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12730 21764 21582 gene locus_tag LOCUS_12740 21764 21582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12740 22396 21776 gene locus_tag LOCUS_12750 22396 21776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12750 22691 22960 gene locus_tag LOCUS_12760 22691 22960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12760 24458 22974 gene locus_tag LOCUS_12770 24458 22974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12770 25767 24964 gene locus_tag LOCUS_12780 25767 24964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12780 >Feature sequence042 795 247 gene locus_tag LOCUS_12790 795 247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12790 2361 820 gene locus_tag LOCUS_12800 2361 820 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228885.1 protein_id gnl|my_center|LOCUS_12800 3571 2546 gene locus_tag LOCUS_12810 3571 2546 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088974.1 protein_id gnl|my_center|LOCUS_12810 4451 3594 gene locus_tag LOCUS_12820 4451 3594 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966751.1 protein_id gnl|my_center|LOCUS_12820 5730 4510 gene locus_tag LOCUS_12830 5730 4510 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037397986.1 protein_id gnl|my_center|LOCUS_12830 6550 5846 gene locus_tag LOCUS_12840 6550 5846 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809848.1 protein_id gnl|my_center|LOCUS_12840 7298 6543 gene locus_tag LOCUS_12850 7298 6543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_12850 7703 8362 gene locus_tag LOCUS_12860 7703 8362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12860 8385 9344 gene locus_tag LOCUS_12870 gene pdhA 8385 9344 CDS product pyruvate dehydrogenase (acetyl-transferring) E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949161.1 protein_id gnl|my_center|LOCUS_12870 9399 10376 gene locus_tag LOCUS_12880 9399 10376 CDS product alpha-ketoacid dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815527.1 protein_id gnl|my_center|LOCUS_12880 10393 11445 gene locus_tag LOCUS_12890 10393 11445 CDS product 2,3-butanediol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047756.1 protein_id gnl|my_center|LOCUS_12890 11463 12236 gene locus_tag LOCUS_12900 11463 12236 CDS product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462069.1 protein_id gnl|my_center|LOCUS_12900 12271 13053 gene locus_tag LOCUS_12910 12271 13053 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228679.1 protein_id gnl|my_center|LOCUS_12910 13069 15705 gene locus_tag LOCUS_12920 13069 15705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12920 15876 17057 gene locus_tag LOCUS_12930 15876 17057 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897303.1 protein_id gnl|my_center|LOCUS_12930 17095 18228 gene locus_tag LOCUS_12940 17095 18228 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225715.1 protein_id gnl|my_center|LOCUS_12940 18276 18791 gene locus_tag LOCUS_12950 18276 18791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12950 18832 20436 gene locus_tag LOCUS_12960 gene caiC 18832 20436 CDS product crotonobetaine/carnitine-CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000355790.1 protein_id gnl|my_center|LOCUS_12960 20452 21198 gene locus_tag LOCUS_12970 20452 21198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12970 22690 21230 gene locus_tag LOCUS_12980 22690 21230 CDS product 4-hydroxyphenylacetate 3-hydroxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064616.1 protein_id gnl|my_center|LOCUS_12980 24459 22777 gene locus_tag LOCUS_12990 24459 22777 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879268.1 protein_id gnl|my_center|LOCUS_12990 24794 25558 gene locus_tag LOCUS_13000 24794 25558 CDS product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976215.1 protein_id gnl|my_center|LOCUS_13000 >Feature sequence043 1998 1822 gene locus_tag LOCUS_13010 1998 1822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13010 2252 1995 gene locus_tag LOCUS_13020 2252 1995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13020 3219 2230 gene locus_tag LOCUS_13030 3219 2230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13030 4661 3294 gene locus_tag LOCUS_13040 4661 3294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_13040 7745 4662 gene locus_tag LOCUS_13050 7745 4662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_13050 8661 7750 gene locus_tag LOCUS_13060 8661 7750 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015868484.1 protein_id gnl|my_center|LOCUS_13060 11560 8879 gene locus_tag LOCUS_13070 gene polA 11560 8879 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941209.1 protein_id gnl|my_center|LOCUS_13070 11975 11670 gene locus_tag LOCUS_13080 11975 11670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13080 12948 12100 gene locus_tag LOCUS_13090 12948 12100 CDS product histidinol-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887115.1 protein_id gnl|my_center|LOCUS_13090 14028 13105 gene locus_tag LOCUS_13100 14028 13105 CDS product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039561.1 protein_id gnl|my_center|LOCUS_13100 14985 14038 gene locus_tag LOCUS_13110 14985 14038 CDS product energy transducer TonB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141813.1 protein_id gnl|my_center|LOCUS_13110 15947 15276 gene locus_tag LOCUS_13120 15947 15276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13120 16126 16725 gene locus_tag LOCUS_13130 16126 16725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13130 16906 18081 gene locus_tag LOCUS_13140 16906 18081 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207481.1 protein_id gnl|my_center|LOCUS_13140 19661 18327 gene locus_tag LOCUS_13150 19661 18327 CDS product patatin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259127.1 protein_id gnl|my_center|LOCUS_13150 20191 19787 gene locus_tag LOCUS_13160 20191 19787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13160 22347 20272 gene locus_tag LOCUS_13170 22347 20272 CDS product serine carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259150.1 protein_id gnl|my_center|LOCUS_13170 24733 22940 gene locus_tag LOCUS_13180 24733 22940 CDS product wax ester/triacylglycerol synthase family O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405217.1 protein_id gnl|my_center|LOCUS_13180 25017 24760 gene locus_tag LOCUS_13190 25017 24760 CDS product acyl-CoA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255973.1 protein_id gnl|my_center|LOCUS_13190 >Feature sequence044 <1 1437 gene locus_tag LOCUS_13200 <1 1437 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012545144.1:caspase family protein 1412 1421 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2027 3547 gene locus_tag LOCUS_13210 gene glgA 2027 3547 CDS product glycogen synthase GlgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939519.1 protein_id gnl|my_center|LOCUS_13210 5149 4040 gene locus_tag LOCUS_13220 gene hemW 5149 4040 CDS product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392119.1 protein_id gnl|my_center|LOCUS_13220 6965 5160 gene locus_tag LOCUS_13230 gene lepA 6965 5160 CDS product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007334775.1 protein_id gnl|my_center|LOCUS_13230 9705 7240 gene locus_tag LOCUS_13240 gene priA 9705 7240 CDS product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232079.1 protein_id gnl|my_center|LOCUS_13240 9999 12494 gene locus_tag LOCUS_13250 gene ppsA 9999 12494 CDS product phosphoenolpyruvate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056610.1 protein_id gnl|my_center|LOCUS_13250 12498 13493 gene locus_tag LOCUS_13260 12498 13493 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942246.1 protein_id gnl|my_center|LOCUS_13260 13495 14271 gene locus_tag LOCUS_13270 13495 14271 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460483.1 protein_id gnl|my_center|LOCUS_13270 15619 14429 gene locus_tag LOCUS_13280 15619 14429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13280 16291 15647 gene locus_tag LOCUS_13290 16291 15647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13290 17279 16344 gene locus_tag LOCUS_13300 gene miaA 17279 16344 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942643.1 protein_id gnl|my_center|LOCUS_13300 19028 17289 gene locus_tag LOCUS_13310 gene mutL 19028 17289 CDS product DNA mismatch repair endonuclease MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105240.1 protein_id gnl|my_center|LOCUS_13310 19949 19086 gene locus_tag LOCUS_13320 19949 19086 CDS product zinc dependent phospholipase C family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792899.1 protein_id gnl|my_center|LOCUS_13320 20499 20215 gene locus_tag LOCUS_13330 20499 20215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13330 20612 20478 gene locus_tag LOCUS_13340 20612 20478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13340 20892 22307 gene locus_tag LOCUS_13350 20892 22307 CDS product cytochrome c biogenesis protein ResB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941275.1 protein_id gnl|my_center|LOCUS_13350 22311 23150 gene locus_tag LOCUS_13360 gene ccsB 22311 23150 CDS product c-type cytochrome biogenesis protein CcsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941276.1 protein_id gnl|my_center|LOCUS_13360 24008 23190 gene locus_tag LOCUS_13370 24008 23190 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402848.1 protein_id gnl|my_center|LOCUS_13370 >Feature sequence045 517 930 gene locus_tag LOCUS_13380 517 930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13380 943 1344 gene locus_tag LOCUS_13390 943 1344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13390 1975 3372 gene locus_tag LOCUS_13400 1975 3372 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938513.1 protein_id gnl|my_center|LOCUS_13400 4031 3375 gene locus_tag LOCUS_13410 gene metW 4031 3375 CDS product methionine biosynthesis protein MetW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084530.1 protein_id gnl|my_center|LOCUS_13410 5250 4006 gene locus_tag LOCUS_13420 5250 4006 CDS product homoserine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391014.1 protein_id gnl|my_center|LOCUS_13420 6536 5250 gene locus_tag LOCUS_13430 6536 5250 CDS product O-acetylhomoserine aminocarboxypropyltransferase/cysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941843.1 protein_id gnl|my_center|LOCUS_13430 7111 6737 gene locus_tag LOCUS_13440 7111 6737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13440 7461 8513 gene locus_tag LOCUS_13450 gene nadA 7461 8513 CDS product quinolinate synthase NadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389688.1 protein_id gnl|my_center|LOCUS_13450 8708 8854 gene locus_tag LOCUS_13460 8708 8854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13460 8873 9205 gene locus_tag LOCUS_13470 8873 9205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13470 9220 10314 gene locus_tag LOCUS_13480 9220 10314 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941973.1 protein_id gnl|my_center|LOCUS_13480 10439 10822 gene locus_tag LOCUS_13490 10439 10822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13490 10967 11872 gene locus_tag LOCUS_13500 10967 11872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13500 11967 12482 gene locus_tag LOCUS_13510 gene tpx 11967 12482 CDS product thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938524.1 protein_id gnl|my_center|LOCUS_13510 12617 13111 gene locus_tag LOCUS_13520 12617 13111 CDS product rubrerythrin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943250.1 protein_id gnl|my_center|LOCUS_13520 13191 13412 gene locus_tag LOCUS_13530 13191 13412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13530 13467 13664 gene locus_tag LOCUS_13540 13467 13664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13540 13651 13797 gene locus_tag LOCUS_13550 13651 13797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13550 13802 14146 gene locus_tag LOCUS_13560 13802 14146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13560 14170 16416 gene locus_tag LOCUS_13570 14170 16416 CDS product aconitate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000863308.1 protein_id gnl|my_center|LOCUS_13570 16484 16786 gene locus_tag LOCUS_13580 16484 16786 CDS product (2Fe-2S) ferredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933319.1 protein_id gnl|my_center|LOCUS_13580 16851 17168 gene locus_tag LOCUS_13590 16851 17168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13590 17165 18310 gene locus_tag LOCUS_13600 17165 18310 CDS product 2-oxoacid:acceptor oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939231.1 protein_id gnl|my_center|LOCUS_13600 18314 19162 gene locus_tag LOCUS_13610 18314 19162 CDS product 2-oxoacid:ferredoxin oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939232.1 protein_id gnl|my_center|LOCUS_13610 19110 19748 gene locus_tag LOCUS_13620 19110 19748 CDS product 2-oxoacid:acceptor oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942116.1 protein_id gnl|my_center|LOCUS_13620 19817 20788 gene locus_tag LOCUS_13630 gene glk 19817 20788 CDS product glucokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141169.1 protein_id gnl|my_center|LOCUS_13630 20821 21573 gene locus_tag LOCUS_13640 20821 21573 CDS product DUF547 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404636.1 protein_id gnl|my_center|LOCUS_13640 21616 23061 gene locus_tag LOCUS_13650 21616 23061 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938336.1 protein_id gnl|my_center|LOCUS_13650 >Feature sequence046 660 1427 gene locus_tag LOCUS_13660 660 1427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13660 1428 2342 gene locus_tag LOCUS_13670 1428 2342 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942090.1 protein_id gnl|my_center|LOCUS_13670 2526 4562 gene locus_tag LOCUS_13680 2526 4562 CDS product TonB-dependent hemoglobin/transferrin/lactoferrin family receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704907.1 protein_id gnl|my_center|LOCUS_13680 5005 4853 gene locus_tag LOCUS_13690 5005 4853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13690 5388 5002 gene locus_tag LOCUS_13700 5388 5002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13700 5897 8167 gene locus_tag LOCUS_13710 5897 8167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13710 8183 8368 gene locus_tag LOCUS_13720 8183 8368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13720 8387 8635 gene locus_tag LOCUS_13730 8387 8635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13730 8686 9360 gene locus_tag LOCUS_13740 8686 9360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13740 9461 10606 gene locus_tag LOCUS_13750 9461 10606 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546471.1 protein_id gnl|my_center|LOCUS_13750 10684 11025 gene locus_tag LOCUS_13760 10684 11025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13760 11022 12299 gene locus_tag LOCUS_13770 11022 12299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13770 12477 14060 gene locus_tag LOCUS_13780 12477 14060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13780 14483 14082 gene locus_tag LOCUS_13790 14483 14082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13790 17278 14483 gene locus_tag LOCUS_13800 gene ppdK 17278 14483 CDS product pyruvate, phosphate dikinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392144.1 protein_id gnl|my_center|LOCUS_13800 17460 17278 gene locus_tag LOCUS_13810 17460 17278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13810 17865 17548 gene locus_tag LOCUS_13820 17865 17548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13820 18248 17907 gene locus_tag LOCUS_13830 18248 17907 CDS product zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256377.1 protein_id gnl|my_center|LOCUS_13830 18704 19438 gene locus_tag LOCUS_13840 18704 19438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13840 19350 20207 gene locus_tag LOCUS_13850 19350 20207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13850 22640 20523 gene locus_tag LOCUS_13860 22640 20523 CDS product molybdopterin oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459738.1 protein_id gnl|my_center|LOCUS_13860 22605 22868 gene locus_tag LOCUS_13870 22605 22868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13870 <23776 23110 gene locus_tag LOCUS_13880 <23776 23110 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010878191.1:4Fe-4S binding protein >Feature sequence047 182 679 gene locus_tag LOCUS_13890 182 679 CDS product bifunctional nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880135.1 protein_id gnl|my_center|LOCUS_13890 918 2483 gene locus_tag LOCUS_13900 918 2483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13900 2434 3168 gene locus_tag LOCUS_13910 2434 3168 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816573.1 protein_id gnl|my_center|LOCUS_13910 3172 4881 gene locus_tag LOCUS_13920 3172 4881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13920 5160 6443 gene locus_tag LOCUS_13930 5160 6443 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940511.1 protein_id gnl|my_center|LOCUS_13930 6645 7148 gene locus_tag LOCUS_13940 6645 7148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13940 8619 7297 gene locus_tag LOCUS_13950 8619 7297 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034099434.1 protein_id gnl|my_center|LOCUS_13950 9423 8683 gene locus_tag LOCUS_13960 9423 8683 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034100836.1 protein_id gnl|my_center|LOCUS_13960 10448 9447 gene locus_tag LOCUS_13970 10448 9447 CDS product BtrH N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964365.1 protein_id gnl|my_center|LOCUS_13970 10869 10468 gene locus_tag LOCUS_13980 10869 10468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964366.1 protein_id gnl|my_center|LOCUS_13980 12697 10949 gene locus_tag LOCUS_13990 gene acsA 12697 10949 CDS product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000862049.1 protein_id gnl|my_center|LOCUS_13990 13549 12998 gene locus_tag LOCUS_14000 13549 12998 CDS product isochorismatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545477.1 protein_id gnl|my_center|LOCUS_14000 14294 13617 gene locus_tag LOCUS_14010 14294 13617 CDS product TIGR04211 family SH3 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455434.1 protein_id gnl|my_center|LOCUS_14010 14801 14367 gene locus_tag LOCUS_14020 gene moaC 14801 14367 CDS product cyclic pyranopterin monophosphate synthase MoaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_202943324.1 protein_id gnl|my_center|LOCUS_14020 15250 14891 gene locus_tag LOCUS_14030 15250 14891 CDS product molybdenum cofactor biosynthesis protein MoaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546341.1 protein_id gnl|my_center|LOCUS_14030 16580 15264 gene locus_tag LOCUS_14040 gene hemA 16580 15264 CDS product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938754.1 protein_id gnl|my_center|LOCUS_14040 17416 16586 gene locus_tag LOCUS_14050 gene ccsB 17416 16586 CDS product c-type cytochrome biogenesis protein CcsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943894.1 protein_id gnl|my_center|LOCUS_14050 18130 17417 gene locus_tag LOCUS_14060 18130 17417 CDS product bifunctional precorrin-2 dehydrogenase/sirohydrochlorin ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811192.1 protein_id gnl|my_center|LOCUS_14060 19368 18208 gene locus_tag LOCUS_14070 19368 18208 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459741.1 protein_id gnl|my_center|LOCUS_14070 19743 21662 gene locus_tag LOCUS_14080 19743 21662 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878757.1 protein_id gnl|my_center|LOCUS_14080 22080 21655 gene locus_tag LOCUS_14090 22080 21655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14090 22958 22077 gene locus_tag LOCUS_14100 gene rfbD 22958 22077 CDS product dTDP-4-dehydrorhamnose reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877394.1 protein_id gnl|my_center|LOCUS_14100 >Feature sequence048 544 918 gene locus_tag LOCUS_14110 544 918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14110 1175 864 gene locus_tag LOCUS_14120 1175 864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14120 1442 1182 gene locus_tag LOCUS_14130 1442 1182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14130 1785 1666 gene locus_tag LOCUS_14140 1785 1666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14140 1909 3144 gene locus_tag LOCUS_14150 1909 3144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14150 3141 5051 gene locus_tag LOCUS_14160 gene iorA 3141 5051 CDS product indolepyruvate ferredoxin oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392452.1 protein_id gnl|my_center|LOCUS_14160 5052 5666 gene locus_tag LOCUS_14170 5052 5666 CDS product indolepyruvate oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021058.1 protein_id gnl|my_center|LOCUS_14170 5824 8274 gene locus_tag LOCUS_14180 5824 8274 CDS product DUF3536 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942995.1 protein_id gnl|my_center|LOCUS_14180 8897 8505 gene locus_tag LOCUS_14190 8897 8505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14190 9164 9931 gene locus_tag LOCUS_14200 9164 9931 CDS product enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228734.1 protein_id gnl|my_center|LOCUS_14200 9935 10540 gene locus_tag LOCUS_14210 9935 10540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14210 10554 12104 gene locus_tag LOCUS_14220 gene mmdA 10554 12104 CDS product methylmalonyl-CoA decarboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868010.1 protein_id gnl|my_center|LOCUS_14220 12284 13840 gene locus_tag LOCUS_14230 12284 13840 CDS product carboxyl transferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250573.1 protein_id gnl|my_center|LOCUS_14230 13899 14768 gene locus_tag LOCUS_14240 13899 14768 CDS product 3-keto-5-aminohexanoate cleavage protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524880.1 protein_id gnl|my_center|LOCUS_14240 14832 15098 gene locus_tag LOCUS_14250 14832 15098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14250 15199 16566 gene locus_tag LOCUS_14260 gene accC 15199 16566 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230253.1 protein_id gnl|my_center|LOCUS_14260 16591 17745 gene locus_tag LOCUS_14270 16591 17745 CDS product isovaleryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040775.1 protein_id gnl|my_center|LOCUS_14270 17800 19476 gene locus_tag LOCUS_14280 17800 19476 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879268.1 protein_id gnl|my_center|LOCUS_14280 19577 21091 gene locus_tag LOCUS_14290 19577 21091 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051000248.1 protein_id gnl|my_center|LOCUS_14290 21091 22248 gene locus_tag LOCUS_14300 21091 22248 CDS product hybrid-cluster NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967917.1 protein_id gnl|my_center|LOCUS_14300 22669 23217 gene locus_tag LOCUS_14310 22669 23217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14310 23210 23389 gene locus_tag LOCUS_14320 23210 23389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14320 >Feature sequence049 <1 580 gene locus_tag LOCUS_14330 <1 580 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_235044884.1:PAS domain S-box protein note possible pseudo, frameshifted 546 1421 gene locus_tag LOCUS_14340 546 1421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14340 1474 1608 gene locus_tag LOCUS_14350 1474 1608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14350 1651 3276 gene locus_tag LOCUS_14360 1651 3276 CDS product PAS domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895602.1 protein_id gnl|my_center|LOCUS_14360 3342 4850 gene locus_tag LOCUS_14370 3342 4850 CDS product phosphomannomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003022277.1 protein_id gnl|my_center|LOCUS_14370 5513 4845 gene locus_tag LOCUS_14380 gene pyrH 5513 4845 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002668261.1 protein_id gnl|my_center|LOCUS_14380 6591 5521 gene locus_tag LOCUS_14390 gene rfbB 6591 5521 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679073.1 protein_id gnl|my_center|LOCUS_14390 7462 6581 gene locus_tag LOCUS_14400 gene rfbD 7462 6581 CDS product dTDP-4-dehydrorhamnose reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965612.1 protein_id gnl|my_center|LOCUS_14400 8224 7487 gene locus_tag LOCUS_14410 8224 7487 CDS product vitamin B12 dependent-methionine synthase activation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813120.1 protein_id gnl|my_center|LOCUS_14410 8641 8441 gene locus_tag LOCUS_14420 8641 8441 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940882.1 protein_id gnl|my_center|LOCUS_14420 9323 10603 gene locus_tag LOCUS_14430 9323 10603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14430 11092 10694 gene locus_tag LOCUS_14440 11092 10694 CDS product VanZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011791844.1 protein_id gnl|my_center|LOCUS_14440 11625 11089 gene locus_tag LOCUS_14450 gene cobU 11625 11089 CDS product bifunctional adenosylcobinamide kinase/adenosylcobinamide-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938306.1 protein_id gnl|my_center|LOCUS_14450 12572 11673 gene locus_tag LOCUS_14460 12572 11673 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920959.1 protein_id gnl|my_center|LOCUS_14460 14026 12791 gene locus_tag LOCUS_14470 14026 12791 CDS product M20 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939114.1 protein_id gnl|my_center|LOCUS_14470 14715 14107 gene locus_tag LOCUS_14480 14715 14107 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001068458.1 protein_id gnl|my_center|LOCUS_14480 15071 14739 gene locus_tag LOCUS_14490 15071 14739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14490 15617 16690 gene locus_tag LOCUS_14500 gene hadC 15617 16690 CDS product (R)-2-hydroxyisocaproyl-CoA dehydratase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003427763.1 protein_id gnl|my_center|LOCUS_14500 16909 16775 gene locus_tag LOCUS_14510 16909 16775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14510 16908 18065 gene locus_tag LOCUS_14520 16908 18065 CDS product 2-hydroxyacyl-CoA dehydratase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879450.1 protein_id gnl|my_center|LOCUS_14520 18067 18864 gene locus_tag LOCUS_14530 18067 18864 CDS product acyl-CoA dehydratase activase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392520.1 protein_id gnl|my_center|LOCUS_14530 18897 20060 gene locus_tag LOCUS_14540 18897 20060 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389837.1 protein_id gnl|my_center|LOCUS_14540 20287 20661 gene locus_tag LOCUS_14550 20287 20661 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957599.1 protein_id gnl|my_center|LOCUS_14550 21443 20880 gene locus_tag LOCUS_14560 gene rfbC 21443 20880 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143691.1 protein_id gnl|my_center|LOCUS_14560 22329 21424 gene locus_tag LOCUS_14570 gene rfbA 22329 21424 CDS product glucose-1-phosphate thymidylyltransferase RfbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938224.1 protein_id gnl|my_center|LOCUS_14570 >Feature sequence050 309 3422 gene locus_tag LOCUS_14580 309 3422 CDS product CusA/CzcA family heavy metal efflux RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941497.1 protein_id gnl|my_center|LOCUS_14580 3436 3765 gene locus_tag LOCUS_14590 gene glnB 3436 3765 CDS product nitrogen regulatory protein P-II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005654045.1 protein_id gnl|my_center|LOCUS_14590 3762 4316 gene locus_tag LOCUS_14600 3762 4316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14600 4971 6098 gene locus_tag LOCUS_14610 4971 6098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14610 6977 8005 gene locus_tag LOCUS_14620 6977 8005 CDS product DUF362 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941750.1 protein_id gnl|my_center|LOCUS_14620 8182 9168 gene locus_tag LOCUS_14630 8182 9168 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941871.1 protein_id gnl|my_center|LOCUS_14630 9514 10209 gene locus_tag LOCUS_14640 9514 10209 CDS product ImmA/IrrE family metallo-endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922416.1 protein_id gnl|my_center|LOCUS_14640 10236 10604 gene locus_tag LOCUS_14650 10236 10604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14650 10604 14221 gene locus_tag LOCUS_14660 10604 14221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14660 14226 17867 gene locus_tag LOCUS_14670 gene recB 14226 17867 CDS product exodeoxyribonuclease V subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115861.1 protein_id gnl|my_center|LOCUS_14670 18079 20028 gene locus_tag LOCUS_14680 18079 20028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14680 20280 20408 gene locus_tag LOCUS_14690 20280 20408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14690 20824 20432 gene locus_tag LOCUS_14700 20824 20432 CDS product secondary thiamine-phosphate synthase enzyme YjbQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082423.1 protein_id gnl|my_center|LOCUS_14700 22192 20996 gene locus_tag LOCUS_14710 22192 20996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14710 >Feature sequence051 <1 617 gene locus_tag LOCUS_14720 <1 617 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000277074.1:TVP38/TMEM64 family protein 646 2823 gene locus_tag LOCUS_14730 646 2823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14730 2936 3841 gene locus_tag LOCUS_14740 gene gnd 2936 3841 CDS product decarboxylating 6-phosphogluconate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256404.1 protein_id gnl|my_center|LOCUS_14740 3973 5538 gene locus_tag LOCUS_14750 gene zwf 3973 5538 CDS product glucose-6-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256405.1 protein_id gnl|my_center|LOCUS_14750 5553 6596 gene locus_tag LOCUS_14760 5553 6596 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193345599.1 protein_id gnl|my_center|LOCUS_14760 6787 7599 gene locus_tag LOCUS_14770 6787 7599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14770 7707 8426 gene locus_tag LOCUS_14780 7707 8426 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086076.1 protein_id gnl|my_center|LOCUS_14780 8423 9214 gene locus_tag LOCUS_14790 8423 9214 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393477.1 protein_id gnl|my_center|LOCUS_14790 9630 10583 gene locus_tag LOCUS_14800 gene msrB 9630 10583 CDS product peptide-methionine (R)-S-oxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262910.1 protein_id gnl|my_center|LOCUS_14800 10643 11596 gene locus_tag LOCUS_14810 10643 11596 CDS product alpha-hydroxy acid oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969836.1 protein_id gnl|my_center|LOCUS_14810 11640 12929 gene locus_tag LOCUS_14820 11640 12929 CDS product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326127.1 protein_id gnl|my_center|LOCUS_14820 14237 12969 gene locus_tag LOCUS_14830 gene icd 14237 12969 CDS product isocitrate dehydrogenase (NADP(+)) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868777.1 protein_id gnl|my_center|LOCUS_14830 15101 14514 gene locus_tag LOCUS_14840 15101 14514 CDS product indolepyruvate oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939236.1 protein_id gnl|my_center|LOCUS_14840 16966 15116 gene locus_tag LOCUS_14850 gene iorA 16966 15116 CDS product indolepyruvate ferredoxin oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939237.1 protein_id gnl|my_center|LOCUS_14850 18680 17109 gene locus_tag LOCUS_14860 18680 17109 CDS product class I adenylate-forming enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461744.1 protein_id gnl|my_center|LOCUS_14860 19557 18877 gene locus_tag LOCUS_14870 19557 18877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14870 19792 20427 gene locus_tag LOCUS_14880 19792 20427 CDS product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205421523.1 protein_id gnl|my_center|LOCUS_14880 20760 20440 gene locus_tag LOCUS_14890 20760 20440 CDS product divalent-cation tolerance protein CutA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877119.1 protein_id gnl|my_center|LOCUS_14890 20950 21858 gene locus_tag LOCUS_14900 gene folD 20950 21858 CDS product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941526.1 protein_id gnl|my_center|LOCUS_14900 22093 21923 gene locus_tag LOCUS_14910 22093 21923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14910 22319 22395 gene locus_tag LOCUS_t00130 22319 22395 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence052 910 143 gene locus_tag LOCUS_14920 910 143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14920 1809 1168 gene locus_tag LOCUS_14930 1809 1168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14930 2097 2780 gene locus_tag LOCUS_14940 2097 2780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14940 2788 3081 gene locus_tag LOCUS_14950 2788 3081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14950 3029 3373 gene locus_tag LOCUS_14960 3029 3373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14960 3586 3954 gene locus_tag LOCUS_14970 3586 3954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14970 5158 3974 gene locus_tag LOCUS_14980 5158 3974 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940478.1 protein_id gnl|my_center|LOCUS_14980 5465 5740 gene locus_tag LOCUS_14990 5465 5740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14990 6330 6893 gene locus_tag LOCUS_15000 6330 6893 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942658.1 protein_id gnl|my_center|LOCUS_15000 6875 10348 gene locus_tag LOCUS_15010 6875 10348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15010 10649 10380 gene locus_tag LOCUS_15020 10649 10380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15020 11741 10803 gene locus_tag LOCUS_15030 gene mdh 11741 10803 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325654.1 protein_id gnl|my_center|LOCUS_15030 12215 13804 gene locus_tag LOCUS_15040 12215 13804 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005079788.1 protein_id gnl|my_center|LOCUS_15040 13953 14909 gene locus_tag LOCUS_15050 13953 14909 CDS product DUF2333 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073652.1 protein_id gnl|my_center|LOCUS_15050 14964 15305 gene locus_tag LOCUS_15060 gene hypA 14964 15305 CDS product hydrogenase maturation nickel metallochaperone HypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941042.1 protein_id gnl|my_center|LOCUS_15060 15409 16077 gene locus_tag LOCUS_15070 gene hypB 15409 16077 CDS product hydrogenase nickel incorporation protein HypB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545559.1 protein_id gnl|my_center|LOCUS_15070 16077 18395 gene locus_tag LOCUS_15080 gene hypF 16077 18395 CDS product carbamoyltransferase HypF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940975.1 protein_id gnl|my_center|LOCUS_15080 18382 19467 gene locus_tag LOCUS_15090 gene hypD 18382 19467 CDS product hydrogenase formation protein HypD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940977.1 protein_id gnl|my_center|LOCUS_15090 19589 20158 gene locus_tag LOCUS_15100 19589 20158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15100 20883 20188 gene locus_tag LOCUS_15110 20883 20188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15110 21767 20880 gene locus_tag LOCUS_15120 21767 20880 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878840.1 protein_id gnl|my_center|LOCUS_15120 >Feature sequence053 1042 314 gene locus_tag LOCUS_15130 1042 314 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002985169.1 protein_id gnl|my_center|LOCUS_15130 1378 2520 gene locus_tag LOCUS_15140 gene atuD 1378 2520 CDS product citronellyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101733.1 protein_id gnl|my_center|LOCUS_15140 2890 4188 gene locus_tag LOCUS_15150 2890 4188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15150 4313 5197 gene locus_tag LOCUS_15160 4313 5197 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256971.1 protein_id gnl|my_center|LOCUS_15160 5201 5986 gene locus_tag LOCUS_15170 5201 5986 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227947.1 protein_id gnl|my_center|LOCUS_15170 5977 6774 gene locus_tag LOCUS_15180 5977 6774 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930184.1 protein_id gnl|my_center|LOCUS_15180 6782 8683 gene locus_tag LOCUS_15190 6782 8683 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256972.1 protein_id gnl|my_center|LOCUS_15190 8774 9877 gene locus_tag LOCUS_15200 8774 9877 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812443.1 protein_id gnl|my_center|LOCUS_15200 10279 10440 gene locus_tag LOCUS_15210 10279 10440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15210 10430 11776 gene locus_tag LOCUS_15220 10430 11776 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228885.1 protein_id gnl|my_center|LOCUS_15220 12155 13576 gene locus_tag LOCUS_15230 gene tilS 12155 13576 CDS product tRNA lysidine(34) synthetase TilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546068.1 protein_id gnl|my_center|LOCUS_15230 14652 13705 gene locus_tag LOCUS_15240 14652 13705 CDS product cyclase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387903.1 protein_id gnl|my_center|LOCUS_15240 14937 15254 gene locus_tag LOCUS_15250 14937 15254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15250 15405 15223 gene locus_tag LOCUS_15260 15405 15223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15260 16324 15350 gene locus_tag LOCUS_15270 16324 15350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15270 17090 16521 gene locus_tag LOCUS_15280 17090 16521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15280 17344 17165 gene locus_tag LOCUS_15290 17344 17165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15290 17663 17385 gene locus_tag LOCUS_15300 17663 17385 CDS product CopG family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958642.1 protein_id gnl|my_center|LOCUS_15300 17976 17656 gene locus_tag LOCUS_15310 17976 17656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957044.1 protein_id gnl|my_center|LOCUS_15310 19139 17976 gene locus_tag LOCUS_15320 19139 17976 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000486144.1 protein_id gnl|my_center|LOCUS_15320 19484 19176 gene locus_tag LOCUS_15330 19484 19176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15330 20582 19977 gene locus_tag LOCUS_15340 20582 19977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15340 20820 20830 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 20999 21379 gene locus_tag LOCUS_15350 20999 21379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15350 >Feature sequence054 724 3219 gene locus_tag LOCUS_15360 724 3219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15360 3281 4624 gene locus_tag LOCUS_15370 3281 4624 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941790.1 protein_id gnl|my_center|LOCUS_15370 4605 5204 gene locus_tag LOCUS_15380 4605 5204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15380 5496 6428 gene locus_tag LOCUS_15390 5496 6428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15390 7610 6486 gene locus_tag LOCUS_15400 7610 6486 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879490.1 protein_id gnl|my_center|LOCUS_15400 7859 8542 gene locus_tag LOCUS_15410 7859 8542 CDS product DUF1847 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272550.1 protein_id gnl|my_center|LOCUS_15410 8757 9653 gene locus_tag LOCUS_15420 8757 9653 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459741.1 protein_id gnl|my_center|LOCUS_15420 9720 10928 gene locus_tag LOCUS_15430 9720 10928 CDS product Tm-1-like ATP-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949085.1 protein_id gnl|my_center|LOCUS_15430 11925 10861 gene locus_tag LOCUS_15440 11925 10861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15440 12234 14090 gene locus_tag LOCUS_15450 12234 14090 CDS product PEP-utilizing enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013724.1 protein_id gnl|my_center|LOCUS_15450 14235 15305 gene locus_tag LOCUS_15460 14235 15305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15460 15340 15873 gene locus_tag LOCUS_15470 15340 15873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15470 16513 15953 gene locus_tag LOCUS_15480 16513 15953 CDS product UbiX family flavin prenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015706171.1 protein_id gnl|my_center|LOCUS_15480 16718 16548 gene locus_tag LOCUS_15490 16718 16548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15490 18079 16733 gene locus_tag LOCUS_15500 18079 16733 CDS product phenylacetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388548.1 protein_id gnl|my_center|LOCUS_15500 19389 18109 gene locus_tag LOCUS_15510 19389 18109 CDS product Tm-1-like ATP-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949085.1 protein_id gnl|my_center|LOCUS_15510 20848 19439 gene locus_tag LOCUS_15520 20848 19439 CDS product UbiD family decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010977989.1 protein_id gnl|my_center|LOCUS_15520 >Feature sequence055 342 521 gene locus_tag LOCUS_15530 342 521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15530 645 1076 gene locus_tag LOCUS_15540 645 1076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15540 2729 1194 gene locus_tag LOCUS_15550 2729 1194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15550 4899 2719 gene locus_tag LOCUS_15560 4899 2719 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937885.1 protein_id gnl|my_center|LOCUS_15560 7210 4916 gene locus_tag LOCUS_15570 7210 4916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15570 8745 7255 gene locus_tag LOCUS_15580 8745 7255 CDS product monovalent cation/H+ antiporter subunit D family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389325.1 protein_id gnl|my_center|LOCUS_15580 9140 8739 gene locus_tag LOCUS_15590 9140 8739 CDS product cation:proton antiporter subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389326.1 protein_id gnl|my_center|LOCUS_15590 9426 9151 gene locus_tag LOCUS_15600 9426 9151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15600 9668 9423 gene locus_tag LOCUS_15610 9668 9423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15610 9982 9665 gene locus_tag LOCUS_15620 gene mnhG 9982 9665 CDS product monovalent cation/H(+) antiporter subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902380.1 protein_id gnl|my_center|LOCUS_15620 10248 9982 gene locus_tag LOCUS_15630 10248 9982 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902381.1 protein_id gnl|my_center|LOCUS_15630 10703 10245 gene locus_tag LOCUS_15640 10703 10245 CDS product Na(+)/H(+) antiporter subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389327.1 protein_id gnl|my_center|LOCUS_15640 11462 10743 gene locus_tag LOCUS_15650 11462 10743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15650 12169 11552 gene locus_tag LOCUS_15660 12169 11552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15660 12734 12333 gene locus_tag LOCUS_15670 12734 12333 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937569.1 protein_id gnl|my_center|LOCUS_15670 14548 12794 gene locus_tag LOCUS_15680 14548 12794 CDS product Na(+)/H(+) antiporter subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389322.1 protein_id gnl|my_center|LOCUS_15680 14789 14538 gene locus_tag LOCUS_15690 14789 14538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15690 15757 15521 gene locus_tag LOCUS_15700 15757 15521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15700 16012 17523 gene locus_tag LOCUS_15710 16012 17523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15710 18820 17552 gene locus_tag LOCUS_15720 gene rhlB 18820 17552 CDS product ATP-dependent RNA helicase RhlB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119269.1 protein_id gnl|my_center|LOCUS_15720 20061 19000 gene locus_tag LOCUS_15730 20061 19000 CDS product methylcobamide--CoM methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003388243.1 protein_id gnl|my_center|LOCUS_15730 >Feature sequence056 428 895 gene locus_tag LOCUS_15740 gene tadA 428 895 CDS product tRNA adenosine(34) deaminase TadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391574.1 protein_id gnl|my_center|LOCUS_15740 904 999 gene locus_tag LOCUS_t00140 904 999 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 3061 1568 gene locus_tag LOCUS_15750 gene oadA 3061 1568 CDS product sodium-extruding oxaloacetate decarboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870743.1 protein_id gnl|my_center|LOCUS_15750 5545 3269 gene locus_tag LOCUS_15760 5545 3269 CDS product chloride channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119127.1 protein_id gnl|my_center|LOCUS_15760 6093 7436 gene locus_tag LOCUS_15770 gene xseA 6093 7436 CDS product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942411.1 protein_id gnl|my_center|LOCUS_15770 8904 7465 gene locus_tag LOCUS_15780 8904 7465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15780 10489 8897 gene locus_tag LOCUS_15790 10489 8897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15790 12484 10562 gene locus_tag LOCUS_15800 12484 10562 CDS product alpha-amylase family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123692.1 protein_id gnl|my_center|LOCUS_15800 12841 13656 gene locus_tag LOCUS_15810 gene murI 12841 13656 CDS product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202028.1 protein_id gnl|my_center|LOCUS_15810 14504 13689 gene locus_tag LOCUS_15820 gene nudC 14504 13689 CDS product NAD(+) diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021453.1 protein_id gnl|my_center|LOCUS_15820 15981 14719 gene locus_tag LOCUS_15830 15981 14719 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943927.1 protein_id gnl|my_center|LOCUS_15830 16259 17794 gene locus_tag LOCUS_15840 16259 17794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15840 18090 18004 gene locus_tag LOCUS_t00150 18090 18004 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 18436 18107 gene locus_tag LOCUS_15850 18436 18107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15850 19423 18644 gene locus_tag LOCUS_15860 gene tpiA 19423 18644 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942272.1 protein_id gnl|my_center|LOCUS_15860 20476 19475 gene locus_tag LOCUS_15870 gene gap 20476 19475 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391806.1 protein_id gnl|my_center|LOCUS_15870 >Feature sequence057 1794 721 gene locus_tag LOCUS_15880 1794 721 CDS product iron-containing alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072443.1 protein_id gnl|my_center|LOCUS_15880 3122 1935 gene locus_tag LOCUS_15890 3122 1935 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072442.1 protein_id gnl|my_center|LOCUS_15890 6802 3602 gene locus_tag LOCUS_15900 gene carB 6802 3602 CDS product carbamoyl-phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810321.1 protein_id gnl|my_center|LOCUS_15900 8303 6825 gene locus_tag LOCUS_15910 gene purF 8303 6825 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_084785566.1 protein_id gnl|my_center|LOCUS_15910 9866 8736 gene locus_tag LOCUS_15920 gene asnA 9866 8736 CDS product aspartate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790904.1 protein_id gnl|my_center|LOCUS_15920 11315 9966 gene locus_tag LOCUS_15930 gene gdhA 11315 9966 CDS product NADP-specific glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962445.1 protein_id gnl|my_center|LOCUS_15930 12907 11342 gene locus_tag LOCUS_15940 12907 11342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15940 14210 12945 gene locus_tag LOCUS_15950 14210 12945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15950 15931 14348 gene locus_tag LOCUS_15960 15931 14348 CDS product FMN-binding glutamate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080443.1 protein_id gnl|my_center|LOCUS_15960 16923 16213 gene locus_tag LOCUS_15970 16923 16213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15970 17201 16932 gene locus_tag LOCUS_15980 17201 16932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15980 20466 17221 gene locus_tag LOCUS_15990 20466 17221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15990 >Feature sequence058 <1 847 gene locus_tag LOCUS_16000 <1 847 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_054938010.1:MtaA/CmuA family methyltransferase 948 2024 gene locus_tag LOCUS_16010 948 2024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16010 2125 2775 gene locus_tag LOCUS_16020 2125 2775 CDS product corrinoid protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393606.1 protein_id gnl|my_center|LOCUS_16020 2808 4742 gene locus_tag LOCUS_16030 2808 4742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16030 5293 4739 gene locus_tag LOCUS_16040 5293 4739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16040 5703 5344 gene locus_tag LOCUS_16050 5703 5344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16050 6046 6666 gene locus_tag LOCUS_16060 6046 6666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16060 6782 7717 gene locus_tag LOCUS_16070 6782 7717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16070 7841 9220 gene locus_tag LOCUS_16080 gene glcD 7841 9220 CDS product glycolate oxidase subunit GlcD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398865.1 protein_id gnl|my_center|LOCUS_16080 9301 10404 gene locus_tag LOCUS_16090 9301 10404 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878013.1 protein_id gnl|my_center|LOCUS_16090 10426 10848 gene locus_tag LOCUS_16100 gene gcvH 10426 10848 CDS product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391976.1 protein_id gnl|my_center|LOCUS_16100 10955 12142 gene locus_tag LOCUS_16110 10955 12142 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020733.1 protein_id gnl|my_center|LOCUS_16110 12267 12800 gene locus_tag LOCUS_16120 12267 12800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16120 13054 13851 gene locus_tag LOCUS_16130 13054 13851 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807682.1 protein_id gnl|my_center|LOCUS_16130 13844 15175 gene locus_tag LOCUS_16140 13844 15175 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001205893.1 protein_id gnl|my_center|LOCUS_16140 15277 16464 gene locus_tag LOCUS_16150 15277 16464 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089186.1 protein_id gnl|my_center|LOCUS_16150 16770 17627 gene locus_tag LOCUS_16160 16770 17627 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965993.1 protein_id gnl|my_center|LOCUS_16160 17653 18627 gene locus_tag LOCUS_16170 17653 18627 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948215.1 protein_id gnl|my_center|LOCUS_16170 18708 19427 gene locus_tag LOCUS_16180 18708 19427 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063921642.1 protein_id gnl|my_center|LOCUS_16180 19435 20145 gene locus_tag LOCUS_16190 19435 20145 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_081214215.1 protein_id gnl|my_center|LOCUS_16190 >Feature sequence059 370 696 gene locus_tag LOCUS_16200 370 696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16200 1199 933 gene locus_tag LOCUS_16210 1199 933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16210 1416 1856 gene locus_tag LOCUS_16220 1416 1856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16220 1862 2572 gene locus_tag LOCUS_16230 1862 2572 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083143.1 protein_id gnl|my_center|LOCUS_16230 2569 3591 gene locus_tag LOCUS_16240 2569 3591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16240 3605 4984 gene locus_tag LOCUS_16250 3605 4984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16250 5234 6382 gene locus_tag LOCUS_16260 5234 6382 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418888.1 protein_id gnl|my_center|LOCUS_16260 6384 7187 gene locus_tag LOCUS_16270 6384 7187 CDS product electron transfer flavoprotein subunit beta/FixA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048185.1 protein_id gnl|my_center|LOCUS_16270 7199 8215 gene locus_tag LOCUS_16280 7199 8215 CDS product electron transfer flavoprotein subunit alpha/FixB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417347.1 protein_id gnl|my_center|LOCUS_16280 8624 8776 gene locus_tag LOCUS_16290 8624 8776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16290 8793 9878 gene locus_tag LOCUS_16300 8793 9878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16300 10761 10081 gene locus_tag LOCUS_16310 10761 10081 CDS product acetate--CoA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867423.1 protein_id gnl|my_center|LOCUS_16310 12152 10791 gene locus_tag LOCUS_16320 12152 10791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16320 13570 12161 gene locus_tag LOCUS_16330 13570 12161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16330 14383 13934 gene locus_tag LOCUS_16340 14383 13934 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942129.1 protein_id gnl|my_center|LOCUS_16340 15118 14723 gene locus_tag LOCUS_16350 15118 14723 CDS product cobalamin-dependent protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879708.1 protein_id gnl|my_center|LOCUS_16350 16833 15151 gene locus_tag LOCUS_16360 16833 15151 CDS product methylmalonyl-CoA mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879704.1 protein_id gnl|my_center|LOCUS_16360 17907 16846 gene locus_tag LOCUS_16370 gene meaB 17907 16846 CDS product methylmalonyl Co-A mutase-associated GTPase MeaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942224.1 protein_id gnl|my_center|LOCUS_16370 18313 17882 gene locus_tag LOCUS_16380 18313 17882 CDS product cobalamin B12-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846721.1 protein_id gnl|my_center|LOCUS_16380 20028 18334 gene locus_tag LOCUS_16390 20028 18334 CDS product methylmalonyl-CoA mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879704.1 protein_id gnl|my_center|LOCUS_16390 >Feature sequence060 359 709 gene locus_tag LOCUS_16400 359 709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16400 1043 2425 gene locus_tag LOCUS_16410 1043 2425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16410 2428 3879 gene locus_tag LOCUS_16420 2428 3879 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937421.1 protein_id gnl|my_center|LOCUS_16420 4439 4603 gene locus_tag LOCUS_16430 4439 4603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16430 4594 5343 gene locus_tag LOCUS_16440 4594 5343 CDS product DUF1538 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478515.1 protein_id gnl|my_center|LOCUS_16440 5350 6129 gene locus_tag LOCUS_16450 5350 6129 CDS product DUF1538 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454529.1 protein_id gnl|my_center|LOCUS_16450 6131 6493 gene locus_tag LOCUS_16460 6131 6493 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005382084.1 protein_id gnl|my_center|LOCUS_16460 6843 8453 gene locus_tag LOCUS_16470 6843 8453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16470 8573 9010 gene locus_tag LOCUS_16480 8573 9010 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545664.1 protein_id gnl|my_center|LOCUS_16480 9160 10866 gene locus_tag LOCUS_16490 9160 10866 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937450.1 protein_id gnl|my_center|LOCUS_16490 11091 11489 gene locus_tag LOCUS_16500 11091 11489 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937451.1 protein_id gnl|my_center|LOCUS_16500 11486 11911 gene locus_tag LOCUS_16510 11486 11911 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940496.1 protein_id gnl|my_center|LOCUS_16510 12203 13495 gene locus_tag LOCUS_16520 12203 13495 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011793113.1 protein_id gnl|my_center|LOCUS_16520 13492 14178 gene locus_tag LOCUS_16530 13492 14178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937444.1 protein_id gnl|my_center|LOCUS_16530 14622 17240 gene locus_tag LOCUS_16540 14622 17240 CDS product PEP/pyruvate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940472.1 protein_id gnl|my_center|LOCUS_16540 17318 18277 gene locus_tag LOCUS_16550 17318 18277 CDS product carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436788.1 protein_id gnl|my_center|LOCUS_16550 19031 19996 gene locus_tag LOCUS_16560 19031 19996 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958239.1 protein_id gnl|my_center|LOCUS_16560 >Feature sequence061 1708 59 gene locus_tag LOCUS_16570 1708 59 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16570 3723 2212 gene locus_tag LOCUS_16580 3723 2212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16580 4128 4997 gene locus_tag LOCUS_16590 4128 4997 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009936067.1 protein_id gnl|my_center|LOCUS_16590 4994 5422 gene locus_tag LOCUS_16600 4994 5422 CDS product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390712.1 protein_id gnl|my_center|LOCUS_16600 6193 7557 gene locus_tag LOCUS_16610 6193 7557 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087324.1 protein_id gnl|my_center|LOCUS_16610 7738 8772 gene locus_tag LOCUS_16620 7738 8772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16620 8787 9731 gene locus_tag LOCUS_16630 8787 9731 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061268.1 protein_id gnl|my_center|LOCUS_16630 9733 10590 gene locus_tag LOCUS_16640 9733 10590 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529760.1 protein_id gnl|my_center|LOCUS_16640 10874 12235 gene locus_tag LOCUS_16650 10874 12235 CDS product glycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938066.1 protein_id gnl|my_center|LOCUS_16650 12449 12264 gene locus_tag LOCUS_16660 12449 12264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16660 12439 12636 gene locus_tag LOCUS_16670 12439 12636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16670 14200 12761 gene locus_tag LOCUS_16680 gene pyk 14200 12761 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066546.1 protein_id gnl|my_center|LOCUS_16680 14882 15439 gene locus_tag LOCUS_16690 14882 15439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16690 15486 15704 gene locus_tag LOCUS_16700 gene infA 15486 15704 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004596875.1 protein_id gnl|my_center|LOCUS_16700 16119 16349 gene locus_tag LOCUS_16710 16119 16349 CDS product KH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938139.1 protein_id gnl|my_center|LOCUS_16710 16517 17632 gene locus_tag LOCUS_16720 16517 17632 CDS product inositol-3-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065345.1 protein_id gnl|my_center|LOCUS_16720 17629 18951 gene locus_tag LOCUS_16730 17629 18951 CDS product bifunctional L-myo-inositol-1-phosphate cytidylyltransferase/CDP-L-myo-inositol myo-inositolphosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868152.1 protein_id gnl|my_center|LOCUS_16730 18944 19516 gene locus_tag LOCUS_16740 18944 19516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16740 >Feature sequence062 100 912 gene locus_tag LOCUS_16750 100 912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16750 1764 943 gene locus_tag LOCUS_16760 1764 943 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064452.1 protein_id gnl|my_center|LOCUS_16760 2471 2247 gene locus_tag LOCUS_16770 2471 2247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16770 2568 3497 gene locus_tag LOCUS_16780 2568 3497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16780 3877 4263 gene locus_tag LOCUS_16790 3877 4263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16790 4260 4454 gene locus_tag LOCUS_16800 4260 4454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16800 5154 4594 gene locus_tag LOCUS_16810 5154 4594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16810 6663 5167 gene locus_tag LOCUS_16820 6663 5167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16820 8021 6720 gene locus_tag LOCUS_16830 8021 6720 CDS product TRAP transporter large permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942699.1 protein_id gnl|my_center|LOCUS_16830 8536 8033 gene locus_tag LOCUS_16840 8536 8033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16840 9645 8602 gene locus_tag LOCUS_16850 9645 8602 CDS product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942697.1 protein_id gnl|my_center|LOCUS_16850 10814 10098 gene locus_tag LOCUS_16860 10814 10098 CDS product SIMPL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072997.1 protein_id gnl|my_center|LOCUS_16860 11145 11996 gene locus_tag LOCUS_16870 11145 11996 CDS product monoacylglycerol lipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726751.1 protein_id gnl|my_center|LOCUS_16870 13054 12020 gene locus_tag LOCUS_16880 13054 12020 CDS product potassium channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546063.1 protein_id gnl|my_center|LOCUS_16880 14368 13298 gene locus_tag LOCUS_16890 14368 13298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16890 14954 14439 gene locus_tag LOCUS_16900 gene hpt 14954 14439 CDS product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393596.1 protein_id gnl|my_center|LOCUS_16900 15551 15108 gene locus_tag LOCUS_16910 15551 15108 CDS product PaaI family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937904.1 protein_id gnl|my_center|LOCUS_16910 17859 15553 gene locus_tag LOCUS_16920 17859 15553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16920 >Feature sequence063 155 574 gene locus_tag LOCUS_16930 155 574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16930 564 896 gene locus_tag LOCUS_16940 564 896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064500.1 protein_id gnl|my_center|LOCUS_16940 1156 2079 gene locus_tag LOCUS_16950 gene hgcA 1156 2079 CDS product mercury methylation corrinoid protein HgcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942086.1 protein_id gnl|my_center|LOCUS_16950 2092 2439 gene locus_tag LOCUS_16960 2092 2439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16960 2689 2465 gene locus_tag LOCUS_16970 2689 2465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16970 2851 3351 gene locus_tag LOCUS_16980 2851 3351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16980 3398 3607 gene locus_tag LOCUS_16990 3398 3607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16990 3624 4811 gene locus_tag LOCUS_17000 gene dinB 3624 4811 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942261.1 protein_id gnl|my_center|LOCUS_17000 5051 8005 gene locus_tag LOCUS_17010 5051 8005 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393372.1 protein_id gnl|my_center|LOCUS_17010 8134 10230 gene locus_tag LOCUS_17020 gene shc 8134 10230 CDS product squalene--hopene cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004529547.1 protein_id gnl|my_center|LOCUS_17020 10227 11000 gene locus_tag LOCUS_17030 10227 11000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17030 11017 11547 gene locus_tag LOCUS_17040 11017 11547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17040 12759 11893 gene locus_tag LOCUS_17050 12759 11893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17050 12932 12753 gene locus_tag LOCUS_17060 12932 12753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17060 13322 14221 gene locus_tag LOCUS_17070 13322 14221 CDS product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964193.1 protein_id gnl|my_center|LOCUS_17070 14444 15391 gene locus_tag LOCUS_17080 14444 15391 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938071.1 protein_id gnl|my_center|LOCUS_17080 15839 16378 gene locus_tag LOCUS_17090 15839 16378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17090 16368 17096 gene locus_tag LOCUS_17100 16368 17096 CDS product DUF364 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392949.1 protein_id gnl|my_center|LOCUS_17100 17911 17252 gene locus_tag LOCUS_17110 17911 17252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17110 18422 18204 gene locus_tag LOCUS_17120 18422 18204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17120 18438 19430 gene locus_tag LOCUS_17130 18438 19430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17130 >Feature sequence064 278 1357 gene locus_tag LOCUS_17140 gene ahbD 278 1357 CDS product heme b synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938155.1 protein_id gnl|my_center|LOCUS_17140 1464 1910 gene locus_tag LOCUS_17150 gene ahbA 1464 1910 CDS product siroheme decarboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938154.1 protein_id gnl|my_center|LOCUS_17150 1963 2712 gene locus_tag LOCUS_17160 1963 2712 CDS product Mut7-C RNAse domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898511.1 protein_id gnl|my_center|LOCUS_17160 2797 3822 gene locus_tag LOCUS_17170 gene pdxA 2797 3822 CDS product 4-hydroxythreonine-4-phosphate dehydrogenase PdxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940791.1 protein_id gnl|my_center|LOCUS_17170 4092 4442 gene locus_tag LOCUS_17180 4092 4442 CDS product septum formation initiator family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942459.1 protein_id gnl|my_center|LOCUS_17180 4872 5048 gene locus_tag LOCUS_17190 4872 5048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17190 5041 6090 gene locus_tag LOCUS_17200 5041 6090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392352.1 protein_id gnl|my_center|LOCUS_17200 6734 6456 gene locus_tag LOCUS_17210 6734 6456 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000605676.1 protein_id gnl|my_center|LOCUS_17210 8167 7055 gene locus_tag LOCUS_17220 gene cfa 8167 7055 CDS product cyclopropane fatty acyl phospholipid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933625.1 protein_id gnl|my_center|LOCUS_17220 8347 9876 gene locus_tag LOCUS_17230 8347 9876 CDS product thiamine pyrophosphate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972394.1 protein_id gnl|my_center|LOCUS_17230 10080 11000 gene locus_tag LOCUS_17240 10080 11000 CDS product bile acid:sodium symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001156916.1 protein_id gnl|my_center|LOCUS_17240 11028 11837 gene locus_tag LOCUS_17250 11028 11837 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106828.1 protein_id gnl|my_center|LOCUS_17250 11979 12614 gene locus_tag LOCUS_17260 11979 12614 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393348.1 protein_id gnl|my_center|LOCUS_17260 14041 12662 gene locus_tag LOCUS_17270 gene glcD 14041 12662 CDS product glycolate oxidase subunit GlcD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398865.1 protein_id gnl|my_center|LOCUS_17270 15259 14270 gene locus_tag LOCUS_17280 15259 14270 CDS product calcium/sodium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070719.1 protein_id gnl|my_center|LOCUS_17280 15631 15425 gene locus_tag LOCUS_17290 15631 15425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17290 17276 15762 gene locus_tag LOCUS_17300 17276 15762 CDS product acyl--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393478.1 protein_id gnl|my_center|LOCUS_17300 17863 17330 gene locus_tag LOCUS_17310 17863 17330 CDS product 2-oxoacid:acceptor oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393484.1 protein_id gnl|my_center|LOCUS_17310 18708 17860 gene locus_tag LOCUS_17320 18708 17860 CDS product thiamine pyrophosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393483.1 protein_id gnl|my_center|LOCUS_17320 <19751 18708 gene locus_tag LOCUS_17330 <19751 18708 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011393482.1:2-oxoglutarate ferredoxin oxidoreductase subunit alpha >Feature sequence065 141 1781 gene locus_tag LOCUS_17340 141 1781 CDS product nucleotide sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_084529509.1 protein_id gnl|my_center|LOCUS_17340 1834 2952 gene locus_tag LOCUS_17350 1834 2952 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583297.1 protein_id gnl|my_center|LOCUS_17350 3131 4048 gene locus_tag LOCUS_17360 3131 4048 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944005.1 protein_id gnl|my_center|LOCUS_17360 4048 5046 gene locus_tag LOCUS_17370 4048 5046 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186310.1 protein_id gnl|my_center|LOCUS_17370 5043 6266 gene locus_tag LOCUS_17380 5043 6266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17380 6253 6954 gene locus_tag LOCUS_17390 6253 6954 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_081214215.1 protein_id gnl|my_center|LOCUS_17390 7037 7210 gene locus_tag LOCUS_17400 7037 7210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17400 7342 8139 gene locus_tag LOCUS_17410 gene folE2 7342 8139 CDS product GTP cyclohydrolase FolE2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941152.1 protein_id gnl|my_center|LOCUS_17410 8158 9450 gene locus_tag LOCUS_17420 8158 9450 CDS product phosphoribosylaminoimidazolecarboxamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011791443.1 protein_id gnl|my_center|LOCUS_17420 9469 10032 gene locus_tag LOCUS_17430 gene efp 9469 10032 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942396.1 protein_id gnl|my_center|LOCUS_17430 10010 10963 gene locus_tag LOCUS_17440 gene epmA 10010 10963 CDS product EF-P lysine aminoacylase EpmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942397.1 protein_id gnl|my_center|LOCUS_17440 11144 11890 gene locus_tag LOCUS_17450 11144 11890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17450 13314 11965 gene locus_tag LOCUS_17460 13314 11965 CDS product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942709.1 protein_id gnl|my_center|LOCUS_17460 13558 17019 gene locus_tag LOCUS_17470 gene dnaE 13558 17019 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942050.1 protein_id gnl|my_center|LOCUS_17470 17204 18046 gene locus_tag LOCUS_17480 gene amrB 17204 18046 CDS product AmmeMemoRadiSam system protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875685.1 protein_id gnl|my_center|LOCUS_17480 18979 18059 gene locus_tag LOCUS_17490 gene argF 18979 18059 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393769.1 protein_id gnl|my_center|LOCUS_17490 >Feature sequence066 77 1 gene locus_tag LOCUS_t00160 77 1 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 1476 55 gene locus_tag LOCUS_17500 1476 55 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17500 2709 1957 gene locus_tag LOCUS_17510 gene cobB 2709 1957 CDS product NAD-dependent protein deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762545.1 protein_id gnl|my_center|LOCUS_17510 2988 2800 gene locus_tag LOCUS_17520 2988 2800 CDS product CooT family nickel-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545767.1 protein_id gnl|my_center|LOCUS_17520 3244 3041 gene locus_tag LOCUS_17530 3244 3041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17530 3424 3942 gene locus_tag LOCUS_17540 3424 3942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17540 4836 4093 gene locus_tag LOCUS_17550 4836 4093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17550 5882 5022 gene locus_tag LOCUS_17560 5882 5022 CDS product MEMO1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250428.1 protein_id gnl|my_center|LOCUS_17560 6284 6931 gene locus_tag LOCUS_17570 6284 6931 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869499.1 protein_id gnl|my_center|LOCUS_17570 7404 8573 gene locus_tag LOCUS_17580 gene sucC 7404 8573 CDS product ADP-forming succinate--CoA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002439496.1 protein_id gnl|my_center|LOCUS_17580 8665 9540 gene locus_tag LOCUS_17590 gene sucD 8665 9540 CDS product succinate--CoA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931961.1 protein_id gnl|my_center|LOCUS_17590 9625 10011 gene locus_tag LOCUS_17600 9625 10011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17600 10088 10303 gene locus_tag LOCUS_17610 10088 10303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17610 10768 10352 gene locus_tag LOCUS_17620 10768 10352 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943738.1 protein_id gnl|my_center|LOCUS_17620 11075 12724 gene locus_tag LOCUS_17630 11075 12724 CDS product ribonuclease J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943734.1 protein_id gnl|my_center|LOCUS_17630 12757 14976 gene locus_tag LOCUS_17640 12757 14976 CDS product DNA translocase FtsK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943733.1 protein_id gnl|my_center|LOCUS_17640 14978 15640 gene locus_tag LOCUS_17650 14978 15640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17650 16809 15646 gene locus_tag LOCUS_17660 16809 15646 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256669.1 protein_id gnl|my_center|LOCUS_17660 17738 16806 gene locus_tag LOCUS_17670 17738 16806 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256872.1 protein_id gnl|my_center|LOCUS_17670 17872 18141 gene locus_tag LOCUS_17680 17872 18141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17680 18146 18718 gene locus_tag LOCUS_17690 gene pgsA 18146 18718 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942469.1 protein_id gnl|my_center|LOCUS_17690 19108 19183 gene locus_tag LOCUS_t00170 19108 19183 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 19190 19265 gene locus_tag LOCUS_t00180 19190 19265 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence067 625 467 gene locus_tag LOCUS_17700 625 467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17700 764 1216 gene locus_tag LOCUS_17710 764 1216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17710 1197 2132 gene locus_tag LOCUS_17720 1197 2132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17720 2323 2129 gene locus_tag LOCUS_17730 2323 2129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17730 2223 2486 gene locus_tag LOCUS_17740 2223 2486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17740 2960 2574 gene locus_tag LOCUS_17750 2960 2574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17750 3788 3009 gene locus_tag LOCUS_17760 3788 3009 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583667.1 protein_id gnl|my_center|LOCUS_17760 4225 3815 gene locus_tag LOCUS_17770 4225 3815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17770 5043 4225 gene locus_tag LOCUS_17780 5043 4225 CDS product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938636.1 protein_id gnl|my_center|LOCUS_17780 5809 5048 gene locus_tag LOCUS_17790 5809 5048 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020083.1 protein_id gnl|my_center|LOCUS_17790 6683 5817 gene locus_tag LOCUS_17800 gene nadC 6683 5817 CDS product carboxylating nicotinate-nucleotide diphosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_067615902.1 protein_id gnl|my_center|LOCUS_17800 9330 6676 gene locus_tag LOCUS_17810 9330 6676 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942688.1 protein_id gnl|my_center|LOCUS_17810 10049 9594 gene locus_tag LOCUS_17820 10049 9594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17820 10211 10585 gene locus_tag LOCUS_17830 10211 10585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17830 10697 11323 gene locus_tag LOCUS_17840 10697 11323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17840 13709 11379 gene locus_tag LOCUS_17850 13709 11379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17850 13809 14684 gene locus_tag LOCUS_17860 13809 14684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17860 15998 14679 gene locus_tag LOCUS_17870 15998 14679 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964893.1 protein_id gnl|my_center|LOCUS_17870 16430 16095 gene locus_tag LOCUS_17880 16430 16095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17880 16791 16465 gene locus_tag LOCUS_17890 16791 16465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17890 18653 16812 gene locus_tag LOCUS_17900 18653 16812 CDS product fumarate reductase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940520.1 protein_id gnl|my_center|LOCUS_17900 >Feature sequence068 1169 156 gene locus_tag LOCUS_17910 gene nadA 1169 156 CDS product quinolinate synthase NadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940699.1 protein_id gnl|my_center|LOCUS_17910 1267 2463 gene locus_tag LOCUS_17920 1267 2463 CDS product Xaa-Pro peptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927165.1 protein_id gnl|my_center|LOCUS_17920 3164 2541 gene locus_tag LOCUS_17930 gene lepB 3164 2541 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941922.1 protein_id gnl|my_center|LOCUS_17930 3411 4043 gene locus_tag LOCUS_17940 3411 4043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17940 5290 4052 gene locus_tag LOCUS_17950 5290 4052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17950 6261 5365 gene locus_tag LOCUS_17960 6261 5365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17960 6672 6274 gene locus_tag LOCUS_17970 6672 6274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17970 7105 6683 gene locus_tag LOCUS_17980 7105 6683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17980 8561 7308 gene locus_tag LOCUS_17990 8561 7308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17990 9266 8589 gene locus_tag LOCUS_18000 9266 8589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18000 9577 9392 gene locus_tag LOCUS_18010 9577 9392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18010 9989 10531 gene locus_tag LOCUS_18020 9989 10531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18020 10761 10952 gene locus_tag LOCUS_18030 10761 10952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18030 11180 11380 gene locus_tag LOCUS_18040 11180 11380 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942676.1 protein_id gnl|my_center|LOCUS_18040 11491 12645 gene locus_tag LOCUS_18050 gene pilM 11491 12645 CDS product type IV pilus assembly protein PilM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942675.1 protein_id gnl|my_center|LOCUS_18050 12642 13244 gene locus_tag LOCUS_18060 12642 13244 CDS product PilN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942674.1 protein_id gnl|my_center|LOCUS_18060 13245 13886 gene locus_tag LOCUS_18070 13245 13886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18070 14121 14690 gene locus_tag LOCUS_18080 14121 14690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18080 14757 16103 gene locus_tag LOCUS_18090 14757 16103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18090 16153 18228 gene locus_tag LOCUS_18100 16153 18228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18100 >Feature sequence069 434 129 gene locus_tag LOCUS_18110 434 129 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000147081.1 protein_id gnl|my_center|LOCUS_18110 1468 1040 gene locus_tag LOCUS_18120 1468 1040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18120 1580 2227 gene locus_tag LOCUS_18130 1580 2227 CDS product DUF3313 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940507.1 protein_id gnl|my_center|LOCUS_18130 2784 4103 gene locus_tag LOCUS_18140 2784 4103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18140 4096 5205 gene locus_tag LOCUS_18150 gene hisC 4096 5205 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115433.1 protein_id gnl|my_center|LOCUS_18150 5222 7540 gene locus_tag LOCUS_18160 5222 7540 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528450.1 protein_id gnl|my_center|LOCUS_18160 7537 8010 gene locus_tag LOCUS_18170 7537 8010 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062284418.1 protein_id gnl|my_center|LOCUS_18170 7997 8860 gene locus_tag LOCUS_18180 gene xdhB 7997 8860 CDS product xanthine dehydrogenase FAD-binding subunit XdhB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393457.1 protein_id gnl|my_center|LOCUS_18180 8857 10038 gene locus_tag LOCUS_18190 8857 10038 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000503245.1 protein_id gnl|my_center|LOCUS_18190 10035 11108 gene locus_tag LOCUS_18200 10035 11108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18200 11235 12263 gene locus_tag LOCUS_18210 11235 12263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18210 13089 12271 gene locus_tag LOCUS_18220 13089 12271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18220 13322 13116 gene locus_tag LOCUS_18230 13322 13116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18230 13930 13394 gene locus_tag LOCUS_18240 13930 13394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18240 14649 14194 gene locus_tag LOCUS_18250 14649 14194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18250 15588 14653 gene locus_tag LOCUS_18260 15588 14653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18260 15851 15663 gene locus_tag LOCUS_18270 15851 15663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18270 17475 16069 gene locus_tag LOCUS_18280 gene orpR 17475 16069 CDS product sigma 54-interacting transcriptional regulator OrpR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939383.1 protein_id gnl|my_center|LOCUS_18280 >Feature sequence070 294 163 gene locus_tag LOCUS_18290 294 163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18290 897 577 gene locus_tag LOCUS_18300 897 577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18300 1268 819 gene locus_tag LOCUS_18310 1268 819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18310 1840 1388 gene locus_tag LOCUS_18320 1840 1388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18320 2136 1948 gene locus_tag LOCUS_18330 2136 1948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18330 2612 2220 gene locus_tag LOCUS_18340 2612 2220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18340 3240 2644 gene locus_tag LOCUS_18350 3240 2644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18350 3660 3301 gene locus_tag LOCUS_18360 3660 3301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18360 6200 3660 gene locus_tag LOCUS_18370 6200 3660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18370 6382 6206 gene locus_tag LOCUS_18380 6382 6206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18380 6776 6588 gene locus_tag LOCUS_18390 6776 6588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18390 7315 6833 gene locus_tag LOCUS_18400 7315 6833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18400 7783 7698 gene locus_tag LOCUS_t00190 7783 7698 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 8861 7869 gene locus_tag LOCUS_18410 8861 7869 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943066.1 protein_id gnl|my_center|LOCUS_18410 9163 9993 gene locus_tag LOCUS_18420 gene larE 9163 9993 CDS product ATP-dependent sacrificial sulfur transferase LarE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393988.1 protein_id gnl|my_center|LOCUS_18420 10093 10593 gene locus_tag LOCUS_18430 10093 10593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938912.1 protein_id gnl|my_center|LOCUS_18430 10590 11807 gene locus_tag LOCUS_18440 10590 11807 CDS product mechanosensitive ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784900.1 protein_id gnl|my_center|LOCUS_18440 13638 11791 gene locus_tag LOCUS_18450 13638 11791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18450 14779 13901 gene locus_tag LOCUS_18460 14779 13901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18460 15184 14867 gene locus_tag LOCUS_18470 15184 14867 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938537.1 protein_id gnl|my_center|LOCUS_18470 15984 15184 gene locus_tag LOCUS_18480 15984 15184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18480 17171 16587 gene locus_tag LOCUS_18490 17171 16587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18490 17462 17908 gene locus_tag LOCUS_18500 17462 17908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18500 >Feature sequence071 307 2133 gene locus_tag LOCUS_18510 gene glmS 307 2133 CDS product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838750.1 protein_id gnl|my_center|LOCUS_18510 2569 3897 gene locus_tag LOCUS_18520 2569 3897 CDS product glutamine synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940646.1 protein_id gnl|my_center|LOCUS_18520 3922 5154 gene locus_tag LOCUS_18530 3922 5154 CDS product asparagine synthetase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867370.1 protein_id gnl|my_center|LOCUS_18530 5549 6184 gene locus_tag LOCUS_18540 gene hisH 5549 6184 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937594.1 protein_id gnl|my_center|LOCUS_18540 6178 6957 gene locus_tag LOCUS_18550 gene hisF 6178 6957 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937595.1 protein_id gnl|my_center|LOCUS_18550 7484 8620 gene locus_tag LOCUS_18560 gene carA 7484 8620 CDS product glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941928.1 protein_id gnl|my_center|LOCUS_18560 8639 11998 gene locus_tag LOCUS_18570 gene carB 8639 11998 CDS product carbamoyl-phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941931.1 protein_id gnl|my_center|LOCUS_18570 12619 12029 gene locus_tag LOCUS_18580 12619 12029 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939708.1 protein_id gnl|my_center|LOCUS_18580 12885 13391 gene locus_tag LOCUS_18590 gene def 12885 13391 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545479.1 protein_id gnl|my_center|LOCUS_18590 13394 14404 gene locus_tag LOCUS_18600 gene fmt 13394 14404 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940806.1 protein_id gnl|my_center|LOCUS_18600 14401 15234 gene locus_tag LOCUS_18610 14401 15234 CDS product DUF116 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940807.1 protein_id gnl|my_center|LOCUS_18610 15227 16591 gene locus_tag LOCUS_18620 gene rsmB 15227 16591 CDS product 16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943984.1 protein_id gnl|my_center|LOCUS_18620 16829 17491 gene locus_tag LOCUS_18630 gene rpe 16829 17491 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943985.1 protein_id gnl|my_center|LOCUS_18630 >Feature sequence072 1327 182 gene locus_tag LOCUS_18640 gene dinB 1327 182 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937382.1 protein_id gnl|my_center|LOCUS_18640 2554 1403 gene locus_tag LOCUS_18650 2554 1403 CDS product trypsin-like peptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583661.1 protein_id gnl|my_center|LOCUS_18650 3436 4632 gene locus_tag LOCUS_18660 gene sat 3436 4632 CDS product sulfate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932543.1 protein_id gnl|my_center|LOCUS_18660 7449 4912 gene locus_tag LOCUS_18670 7449 4912 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142589.1 protein_id gnl|my_center|LOCUS_18670 9450 7831 gene locus_tag LOCUS_18680 9450 7831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18680 9745 10686 gene locus_tag LOCUS_18690 9745 10686 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942919.1 protein_id gnl|my_center|LOCUS_18690 10699 12243 gene locus_tag LOCUS_18700 gene lnt 10699 12243 CDS product apolipoprotein N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545206.1 protein_id gnl|my_center|LOCUS_18700 12281 13225 gene locus_tag LOCUS_18710 12281 13225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18710 13520 15895 gene locus_tag LOCUS_18720 13520 15895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18720 15828 16091 gene locus_tag LOCUS_18730 15828 16091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18730 >Feature sequence073 7 1206 gene locus_tag LOCUS_18740 7 1206 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938060.1 protein_id gnl|my_center|LOCUS_18740 1266 2081 gene locus_tag LOCUS_18750 1266 2081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18750 4907 2163 gene locus_tag LOCUS_18760 4907 2163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18760 5171 5923 gene locus_tag LOCUS_18770 5171 5923 CDS product ribonuclease H-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020864.1 protein_id gnl|my_center|LOCUS_18770 5926 6297 gene locus_tag LOCUS_18780 5926 6297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18780 7801 6785 gene locus_tag LOCUS_18790 7801 6785 CDS product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940684.1 protein_id gnl|my_center|LOCUS_18790 9613 8102 gene locus_tag LOCUS_18800 gene glpK 9613 8102 CDS product glycerol kinase GlpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259133.1 protein_id gnl|my_center|LOCUS_18800 11842 10115 gene locus_tag LOCUS_18810 11842 10115 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_148771775.1 protein_id gnl|my_center|LOCUS_18810 12302 12018 gene locus_tag LOCUS_18820 12302 12018 CDS product DUF2160 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003376264.1 protein_id gnl|my_center|LOCUS_18820 13118 12315 gene locus_tag LOCUS_18830 13118 12315 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337643.1 protein_id gnl|my_center|LOCUS_18830 13990 13115 gene locus_tag LOCUS_18840 13990 13115 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002552729.1 protein_id gnl|my_center|LOCUS_18840 15516 14431 gene locus_tag LOCUS_18850 15516 14431 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267209.1 protein_id gnl|my_center|LOCUS_18850 16485 15526 gene locus_tag LOCUS_18860 16485 15526 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003409725.1 protein_id gnl|my_center|LOCUS_18860 >Feature sequence074 189 116 gene locus_tag LOCUS_t00200 189 116 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 1564 566 gene locus_tag LOCUS_18870 1564 566 CDS product dipeptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258123.1 protein_id gnl|my_center|LOCUS_18870 2598 1600 gene locus_tag LOCUS_18880 2598 1600 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227960.1 protein_id gnl|my_center|LOCUS_18880 3066 2713 gene locus_tag LOCUS_18890 3066 2713 CDS product four helix bundle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964356.1 protein_id gnl|my_center|LOCUS_18890 4324 3146 gene locus_tag LOCUS_18900 4324 3146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18900 5449 4490 gene locus_tag LOCUS_18910 5449 4490 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546375.1 protein_id gnl|my_center|LOCUS_18910 7697 5565 gene locus_tag LOCUS_18920 7697 5565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18920 8073 8831 gene locus_tag LOCUS_18930 8073 8831 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206877.1 protein_id gnl|my_center|LOCUS_18930 8965 9525 gene locus_tag LOCUS_18940 8965 9525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18940 9527 10333 gene locus_tag LOCUS_18950 9527 10333 CDS product TIGR02757 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941192.1 protein_id gnl|my_center|LOCUS_18950 10712 13144 gene locus_tag LOCUS_18960 10712 13144 CDS product 3-hydroxyacyl-CoA dehydrogenase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000486386.1 protein_id gnl|my_center|LOCUS_18960 13224 14408 gene locus_tag LOCUS_18970 13224 14408 CDS product thiolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259064.1 protein_id gnl|my_center|LOCUS_18970 >Feature sequence075 614 1420 gene locus_tag LOCUS_18980 gene dapB 614 1420 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545687.1 protein_id gnl|my_center|LOCUS_18980 1488 2654 gene locus_tag LOCUS_18990 1488 2654 CDS product LL-diaminopimelate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392408.1 protein_id gnl|my_center|LOCUS_18990 2664 3173 gene locus_tag LOCUS_19000 2664 3173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19000 3174 3425 gene locus_tag LOCUS_19010 3174 3425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19010 3527 4168 gene locus_tag LOCUS_19020 gene fsa 3527 4168 CDS product fructose-6-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544952.1 protein_id gnl|my_center|LOCUS_19020 4165 4755 gene locus_tag LOCUS_19030 4165 4755 CDS product lytic transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942470.1 protein_id gnl|my_center|LOCUS_19030 4824 6026 gene locus_tag LOCUS_19040 gene dacB 4824 6026 CDS product D-alanyl-D-alanine carboxypeptidase/D-alanyl-D-alanine-endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091272.1 protein_id gnl|my_center|LOCUS_19040 6320 6042 gene locus_tag LOCUS_19050 6320 6042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19050 6381 6809 gene locus_tag LOCUS_19060 6381 6809 CDS product archease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583624.1 protein_id gnl|my_center|LOCUS_19060 6888 8333 gene locus_tag LOCUS_19070 6888 8333 CDS product RtcB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546530.1 protein_id gnl|my_center|LOCUS_19070 9363 8482 gene locus_tag LOCUS_19080 gene lipA 9363 8482 CDS product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258693.1 protein_id gnl|my_center|LOCUS_19080 10094 9378 gene locus_tag LOCUS_19090 10094 9378 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000868621.1 protein_id gnl|my_center|LOCUS_19090 10587 10375 gene locus_tag LOCUS_19100 10587 10375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19100 10522 11133 gene locus_tag LOCUS_19110 10522 11133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19110 11235 11540 gene locus_tag LOCUS_19120 11235 11540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19120 12563 11883 gene locus_tag LOCUS_19130 12563 11883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19130 15441 12667 gene locus_tag LOCUS_19140 15441 12667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19140 15512 15673 gene locus_tag LOCUS_19150 15512 15673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19150 >Feature sequence076 1245 172 gene locus_tag LOCUS_19160 1245 172 CDS product branched-chain amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244231.1 protein_id gnl|my_center|LOCUS_19160 1542 1973 gene locus_tag LOCUS_19170 1542 1973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19170 2007 2978 gene locus_tag LOCUS_19180 2007 2978 CDS product TAXI family TRAP transporter solute-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261720.1 protein_id gnl|my_center|LOCUS_19180 3040 3534 gene locus_tag LOCUS_19190 3040 3534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19190 3574 5511 gene locus_tag LOCUS_19200 3574 5511 CDS product TRAP transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925163.1 protein_id gnl|my_center|LOCUS_19200 5640 8555 gene locus_tag LOCUS_19210 5640 8555 CDS product insulinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938240.1 protein_id gnl|my_center|LOCUS_19210 8970 9530 gene locus_tag LOCUS_19220 8970 9530 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_133957191.1 protein_id gnl|my_center|LOCUS_19220 9727 11073 gene locus_tag LOCUS_19230 9727 11073 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_157868120.1 protein_id gnl|my_center|LOCUS_19230 11150 11473 gene locus_tag LOCUS_19240 11150 11473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19240 12207 13013 gene locus_tag LOCUS_19250 12207 13013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19250 >Feature sequence077 81 764 gene locus_tag LOCUS_19260 81 764 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546205.1 protein_id gnl|my_center|LOCUS_19260 761 1201 gene locus_tag LOCUS_19270 gene mlaD 761 1201 CDS product outer membrane lipid asymmetry maintenance protein MlaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941481.1 protein_id gnl|my_center|LOCUS_19270 1397 1999 gene locus_tag LOCUS_19280 1397 1999 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546348.1 protein_id gnl|my_center|LOCUS_19280 1986 2924 gene locus_tag LOCUS_19290 1986 2924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19290 4292 3330 gene locus_tag LOCUS_19300 4292 3330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19300 5259 4255 gene locus_tag LOCUS_19310 5259 4255 CDS product KpsF/GutQ family sugar-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942538.1 protein_id gnl|my_center|LOCUS_19310 6187 6795 gene locus_tag LOCUS_19320 6187 6795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19320 6800 7411 gene locus_tag LOCUS_19330 6800 7411 CDS product FmdE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392977.1 protein_id gnl|my_center|LOCUS_19330 7408 8196 gene locus_tag LOCUS_19340 7408 8196 CDS product putative hydro-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925131.1 protein_id gnl|my_center|LOCUS_19340 8589 9902 gene locus_tag LOCUS_19350 8589 9902 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965775.1 protein_id gnl|my_center|LOCUS_19350 10122 11036 gene locus_tag LOCUS_19360 10122 11036 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028172393.1 protein_id gnl|my_center|LOCUS_19360 11024 12031 gene locus_tag LOCUS_19370 11024 12031 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965773.1 protein_id gnl|my_center|LOCUS_19370 12031 12792 gene locus_tag LOCUS_19380 12031 12792 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942651.1 protein_id gnl|my_center|LOCUS_19380 12874 13590 gene locus_tag LOCUS_19390 12874 13590 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080267.1 protein_id gnl|my_center|LOCUS_19390 15841 13661 gene locus_tag LOCUS_19400 15841 13661 CDS product ATP-dependent RecD-like DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938194.1 protein_id gnl|my_center|LOCUS_19400 >Feature sequence078 583 798 gene locus_tag LOCUS_19410 583 798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19410 785 1357 gene locus_tag LOCUS_19420 785 1357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19420 1622 1933 gene locus_tag LOCUS_19430 gene rplU 1622 1933 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392094.1 protein_id gnl|my_center|LOCUS_19430 1965 2219 gene locus_tag LOCUS_19440 gene rpmA 1965 2219 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140826.1 protein_id gnl|my_center|LOCUS_19440 2254 3297 gene locus_tag LOCUS_19450 gene obgE 2254 3297 CDS product GTPase ObgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943831.1 protein_id gnl|my_center|LOCUS_19450 3243 4433 gene locus_tag LOCUS_19460 gene proB 3243 4433 CDS product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943830.1 protein_id gnl|my_center|LOCUS_19460 4421 5677 gene locus_tag LOCUS_19470 4421 5677 CDS product glutamate-5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943829.1 protein_id gnl|my_center|LOCUS_19470 5688 6347 gene locus_tag LOCUS_19480 gene nadD 5688 6347 CDS product nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943828.1 protein_id gnl|my_center|LOCUS_19480 6331 6675 gene locus_tag LOCUS_19490 gene rsfS 6331 6675 CDS product ribosome silencing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546466.1 protein_id gnl|my_center|LOCUS_19490 6695 8137 gene locus_tag LOCUS_19500 6695 8137 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938869.1 protein_id gnl|my_center|LOCUS_19500 8174 9469 gene locus_tag LOCUS_19510 8174 9469 CDS product class II fructose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941850.1 protein_id gnl|my_center|LOCUS_19510 9459 10505 gene locus_tag LOCUS_19520 9459 10505 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941783.1 protein_id gnl|my_center|LOCUS_19520 10625 14527 gene locus_tag LOCUS_19530 gene hrpA 10625 14527 CDS product ATP-dependent RNA helicase HrpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228749.1 protein_id gnl|my_center|LOCUS_19530 <15544 14645 gene locus_tag LOCUS_19540 <15544 14645 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943105.1:integron integrase >Feature sequence079 375 1478 gene locus_tag LOCUS_19550 375 1478 CDS product DUF481 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942983.1 protein_id gnl|my_center|LOCUS_19550 2260 1625 gene locus_tag LOCUS_19560 2260 1625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19560 3056 2271 gene locus_tag LOCUS_19570 3056 2271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19570 3391 3762 gene locus_tag LOCUS_19580 3391 3762 CDS product SMR family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192320.1 protein_id gnl|my_center|LOCUS_19580 3822 4913 gene locus_tag LOCUS_19590 gene arnB 3822 4913 CDS product UDP-4-amino-4-deoxy-L-arabinose aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001303599.1 protein_id gnl|my_center|LOCUS_19590 4921 5958 gene locus_tag LOCUS_19600 gene arnC 4921 5958 CDS product undecaprenyl-phosphate 4-deoxy-4-formamido-L-arabinose transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369284.1 protein_id gnl|my_center|LOCUS_19600 5970 7988 gene locus_tag LOCUS_19610 gene arnA 5970 7988 CDS product bifunctional UDP-4-amino-4-deoxy-L-arabinose formyltransferase/UDP-glucuronic acid oxidase ArnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704925.1 protein_id gnl|my_center|LOCUS_19610 8244 9149 gene locus_tag LOCUS_19620 gene arnD 8244 9149 CDS product 4-deoxy-4-formamido-L-arabinose-phosphoundecaprenol deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267893.1 protein_id gnl|my_center|LOCUS_19620 9146 10795 gene locus_tag LOCUS_19630 gene arnT 9146 10795 CDS product lipid IV(A) 4-amino-4-deoxy-L-arabinosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704923.1 protein_id gnl|my_center|LOCUS_19630 11876 10800 gene locus_tag LOCUS_19640 gene lptG 11876 10800 CDS product LPS export ABC transporter permease LptG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942568.1 protein_id gnl|my_center|LOCUS_19640 13769 11913 gene locus_tag LOCUS_19650 13769 11913 CDS product glycosyltransferase family 39 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869035.1 protein_id gnl|my_center|LOCUS_19650 14352 13756 gene locus_tag LOCUS_19660 14352 13756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19660 15203 14382 gene locus_tag LOCUS_19670 15203 14382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19670 >Feature sequence080 328 1074 gene locus_tag LOCUS_19680 328 1074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19680 1071 1865 gene locus_tag LOCUS_19690 1071 1865 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765730.1 protein_id gnl|my_center|LOCUS_19690 1967 3430 gene locus_tag LOCUS_19700 1967 3430 CDS product DegQ family serine endoprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940999.1 protein_id gnl|my_center|LOCUS_19700 3758 5245 gene locus_tag LOCUS_19710 3758 5245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19710 5249 6418 gene locus_tag LOCUS_19720 gene fabF 5249 6418 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000412656.1 protein_id gnl|my_center|LOCUS_19720 6426 7145 gene locus_tag LOCUS_19730 6426 7145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19730 7108 8823 gene locus_tag LOCUS_19740 7108 8823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19740 9635 8856 gene locus_tag LOCUS_19750 9635 8856 CDS product DUF169 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012468436.1 protein_id gnl|my_center|LOCUS_19750 10272 9643 gene locus_tag LOCUS_19760 10272 9643 CDS product DUF3786 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813269.1 protein_id gnl|my_center|LOCUS_19760 10729 10298 gene locus_tag LOCUS_19770 10729 10298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19770 11655 13373 gene locus_tag LOCUS_19780 11655 13373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19780 13692 14768 gene locus_tag LOCUS_19790 gene wecB 13692 14768 CDS product UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010871027.1 protein_id gnl|my_center|LOCUS_19790 14955 15230 gene locus_tag LOCUS_19800 14955 15230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19800 >Feature sequence081 23 2242 gene locus_tag LOCUS_19810 23 2242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19810 2455 3633 gene locus_tag LOCUS_19820 2455 3633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19820 4454 4224 gene locus_tag LOCUS_19830 4454 4224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19830 4455 4892 gene locus_tag LOCUS_19840 4455 4892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19840 6018 4930 gene locus_tag LOCUS_19850 6018 4930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19850 7100 6015 gene locus_tag LOCUS_19860 7100 6015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19860 7861 7247 gene locus_tag LOCUS_19870 7861 7247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19870 9234 8581 gene locus_tag LOCUS_19880 9234 8581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19880 11042 10284 gene locus_tag LOCUS_19890 11042 10284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19890 13355 11760 gene locus_tag LOCUS_19900 13355 11760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19900 13982 13356 gene locus_tag LOCUS_19910 13982 13356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19910 >Feature sequence082 1050 1370 gene locus_tag LOCUS_19920 1050 1370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19920 1471 1396 gene locus_tag LOCUS_t00210 1471 1396 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 1898 3331 gene locus_tag LOCUS_19930 gene selA 1898 3331 CDS product L-seryl-tRNA(Sec) selenium transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943980.1 protein_id gnl|my_center|LOCUS_19930 3333 3920 gene locus_tag LOCUS_19940 3333 3920 CDS product D-sedoheptulose 7-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939175.1 protein_id gnl|my_center|LOCUS_19940 4149 5111 gene locus_tag LOCUS_19950 4149 5111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942728.1 protein_id gnl|my_center|LOCUS_19950 5126 5344 gene locus_tag LOCUS_19960 5126 5344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19960 5554 6033 gene locus_tag LOCUS_19970 gene ispF 5554 6033 CDS product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459082.1 protein_id gnl|my_center|LOCUS_19970 6147 7607 gene locus_tag LOCUS_19980 gene cysS 6147 7607 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943976.1 protein_id gnl|my_center|LOCUS_19980 7600 9591 gene locus_tag LOCUS_19990 gene uvrB 7600 9591 CDS product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943874.1 protein_id gnl|my_center|LOCUS_19990 9588 10337 gene locus_tag LOCUS_20000 gene rlmB 9588 10337 CDS product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942108.1 protein_id gnl|my_center|LOCUS_20000 11004 10354 gene locus_tag LOCUS_20010 11004 10354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20010 11680 11063 gene locus_tag LOCUS_20020 11680 11063 CDS product Maf family nucleotide pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943181.1 protein_id gnl|my_center|LOCUS_20020 12602 11829 gene locus_tag LOCUS_20030 12602 11829 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435866.1 protein_id gnl|my_center|LOCUS_20030 12838 15177 gene locus_tag LOCUS_20040 12838 15177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20040 >Feature sequence083 399 1172 gene locus_tag LOCUS_20050 399 1172 CDS product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090527.1 protein_id gnl|my_center|LOCUS_20050 2159 1809 gene locus_tag LOCUS_20060 2159 1809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20060 4384 2828 gene locus_tag LOCUS_20070 4384 2828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20070 4878 5804 gene locus_tag LOCUS_20080 4878 5804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939277.1 protein_id gnl|my_center|LOCUS_20080 5807 7039 gene locus_tag LOCUS_20090 5807 7039 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249141.1 protein_id gnl|my_center|LOCUS_20090 7078 7752 gene locus_tag LOCUS_20100 7078 7752 CDS product diphthine--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546873.1 protein_id gnl|my_center|LOCUS_20100 7852 8526 gene locus_tag LOCUS_20110 7852 8526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20110 8611 9267 gene locus_tag LOCUS_20120 8611 9267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20120 10574 9288 gene locus_tag LOCUS_20130 10574 9288 CDS product glyceraldehyde 3-phosphate dehydrogenase NAD-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546756.1 protein_id gnl|my_center|LOCUS_20130 14759 10575 gene locus_tag LOCUS_20140 14759 10575 CDS product PEP/pyruvate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545209.1 protein_id gnl|my_center|LOCUS_20140 >Feature sequence084 191 39 gene locus_tag LOCUS_20150 191 39 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20150 1832 426 gene locus_tag LOCUS_20160 gene rlmD 1832 426 CDS product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226986823.1 protein_id gnl|my_center|LOCUS_20160 3265 1895 gene locus_tag LOCUS_20170 gene zraR 3265 1895 CDS product sigma-54-dependent response regulator transcription factor ZraR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000148522.1 protein_id gnl|my_center|LOCUS_20170 5019 3262 gene locus_tag LOCUS_20180 5019 3262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20180 5317 5808 gene locus_tag LOCUS_20190 5317 5808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20190 7819 5999 gene locus_tag LOCUS_20200 7819 5999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940971.1 protein_id gnl|my_center|LOCUS_20200 8672 7797 gene locus_tag LOCUS_20210 8672 7797 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943921.1 protein_id gnl|my_center|LOCUS_20210 8950 9597 gene locus_tag LOCUS_20220 gene rrmJ 8950 9597 CDS product 23S rRNA (uridine(2552)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877375.1 protein_id gnl|my_center|LOCUS_20220 9763 10509 gene locus_tag LOCUS_20230 9763 10509 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941735.1 protein_id gnl|my_center|LOCUS_20230 10509 10994 gene locus_tag LOCUS_20240 gene ruvC 10509 10994 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941736.1 protein_id gnl|my_center|LOCUS_20240 10991 11593 gene locus_tag LOCUS_20250 gene ruvA 10991 11593 CDS product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941737.1 protein_id gnl|my_center|LOCUS_20250 11604 12635 gene locus_tag LOCUS_20260 gene ruvB 11604 12635 CDS product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941738.1 protein_id gnl|my_center|LOCUS_20260 12802 13866 gene locus_tag LOCUS_20270 gene pyrB 12802 13866 CDS product aspartate carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095365.1 protein_id gnl|my_center|LOCUS_20270 14320 14784 gene locus_tag LOCUS_20280 14320 14784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20280 >Feature sequence085 2974 284 gene locus_tag LOCUS_20290 2974 284 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120353.1 protein_id gnl|my_center|LOCUS_20290 4133 3093 gene locus_tag LOCUS_20300 gene ltaE 4133 3093 CDS product low-specificity L-threonine aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082276.1 protein_id gnl|my_center|LOCUS_20300 4342 4650 gene locus_tag LOCUS_20310 4342 4650 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879039.1 protein_id gnl|my_center|LOCUS_20310 4660 5379 gene locus_tag LOCUS_20320 4660 5379 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932770.1 protein_id gnl|my_center|LOCUS_20320 5355 6161 gene locus_tag LOCUS_20330 gene fetB 5355 6161 CDS product iron export ABC transporter permease subunit FetB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926980.1 protein_id gnl|my_center|LOCUS_20330 6176 6631 gene locus_tag LOCUS_20340 6176 6631 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022180.1 protein_id gnl|my_center|LOCUS_20340 7293 6652 gene locus_tag LOCUS_20350 7293 6652 CDS product cyclase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933918.1 protein_id gnl|my_center|LOCUS_20350 7698 8117 gene locus_tag LOCUS_20360 7698 8117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20360 8163 9314 gene locus_tag LOCUS_20370 8163 9314 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902861.1 protein_id gnl|my_center|LOCUS_20370 10376 9426 gene locus_tag LOCUS_20380 10376 9426 CDS product biotin-dependent carboxyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016387.1 protein_id gnl|my_center|LOCUS_20380 11050 10355 gene locus_tag LOCUS_20390 gene pxpB 11050 10355 CDS product 5-oxoprolinase subunit PxpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029494307.1 protein_id gnl|my_center|LOCUS_20390 11926 11141 gene locus_tag LOCUS_20400 11926 11141 CDS product 5-oxoprolinase subunit PxpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868110.1 protein_id gnl|my_center|LOCUS_20400 12347 12886 gene locus_tag LOCUS_20410 12347 12886 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459068.1 protein_id gnl|my_center|LOCUS_20410 14712 12979 gene locus_tag LOCUS_20420 14712 12979 CDS product aldehyde ferredoxin oxidoreductase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546166.1 protein_id gnl|my_center|LOCUS_20420 >Feature sequence086 1937 1134 gene locus_tag LOCUS_20430 1937 1134 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942561.1 protein_id gnl|my_center|LOCUS_20430 2707 1991 gene locus_tag LOCUS_20440 2707 1991 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071541499.1 protein_id gnl|my_center|LOCUS_20440 3325 2768 gene locus_tag LOCUS_20450 gene frr 3325 2768 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938169.1 protein_id gnl|my_center|LOCUS_20450 4003 3401 gene locus_tag LOCUS_20460 gene tsf 4003 3401 CDS product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392547.1 protein_id gnl|my_center|LOCUS_20460 5087 4215 gene locus_tag LOCUS_20470 gene rpsB 5087 4215 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938173.1 protein_id gnl|my_center|LOCUS_20470 5443 5694 gene locus_tag LOCUS_20480 5443 5694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20480 5691 6860 gene locus_tag LOCUS_20490 5691 6860 CDS product deoxyguanosinetriphosphate triphosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546176.1 protein_id gnl|my_center|LOCUS_20490 7106 6873 gene locus_tag LOCUS_20500 7106 6873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20500 7217 8038 gene locus_tag LOCUS_20510 7217 8038 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256973.1 protein_id gnl|my_center|LOCUS_20510 8047 9969 gene locus_tag LOCUS_20520 8047 9969 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256972.1 protein_id gnl|my_center|LOCUS_20520 10014 10391 gene locus_tag LOCUS_20530 10014 10391 CDS product four helix bundle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530241.1 protein_id gnl|my_center|LOCUS_20530 10428 11297 gene locus_tag LOCUS_20540 10428 11297 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391255.1 protein_id gnl|my_center|LOCUS_20540 11463 12563 gene locus_tag LOCUS_20550 11463 12563 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256970.1 protein_id gnl|my_center|LOCUS_20550 12851 14110 gene locus_tag LOCUS_20560 12851 14110 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391253.1 protein_id gnl|my_center|LOCUS_20560 14144 14950 gene locus_tag LOCUS_20570 14144 14950 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256968.1 protein_id gnl|my_center|LOCUS_20570 >Feature sequence087 97 21 gene locus_tag LOCUS_t00220 97 21 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 1431 235 gene locus_tag LOCUS_20580 1431 235 CDS product Xaa-Pro peptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941766.1 protein_id gnl|my_center|LOCUS_20580 1605 1973 gene locus_tag LOCUS_20590 1605 1973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20590 2968 1940 gene locus_tag LOCUS_20600 2968 1940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_20600 3570 3142 gene locus_tag LOCUS_20610 3570 3142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20610 3956 3654 gene locus_tag LOCUS_20620 3956 3654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20620 7605 4558 gene locus_tag LOCUS_20630 7605 4558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20630 8130 7747 gene locus_tag LOCUS_20640 8130 7747 CDS product (2Fe-2S) ferredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583283.1 protein_id gnl|my_center|LOCUS_20640 8699 8163 gene locus_tag LOCUS_20650 8699 8163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20650 9439 8702 gene locus_tag LOCUS_20660 9439 8702 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583280.1 protein_id gnl|my_center|LOCUS_20660 9831 9490 gene locus_tag LOCUS_20670 9831 9490 CDS product DRTGG domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869442.1 protein_id gnl|my_center|LOCUS_20670 12803 9891 gene locus_tag LOCUS_20680 gene fdhF 12803 9891 CDS product formate dehydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_080510933.1 protein_id gnl|my_center|LOCUS_20680 13701 12940 gene locus_tag LOCUS_20690 13701 12940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20690 <14700 13587 gene locus_tag LOCUS_20700 <14700 13587 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005482725.1:formate dehydrogenase subunit alpha note possible pseudo, frameshifted >Feature sequence088 560 1831 gene locus_tag LOCUS_20710 gene glgC 560 1831 CDS product glucose-1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329623.1 protein_id gnl|my_center|LOCUS_20710 1893 4445 gene locus_tag LOCUS_20720 1893 4445 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941039.1 protein_id gnl|my_center|LOCUS_20720 4719 6956 gene locus_tag LOCUS_20730 gene glgB 4719 6956 CDS product 1,4-alpha-glucan branching enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056426.1 protein_id gnl|my_center|LOCUS_20730 7855 7277 gene locus_tag LOCUS_20740 7855 7277 CDS product pyruvate kinase alpha/beta domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877282.1 protein_id gnl|my_center|LOCUS_20740 8075 7917 gene locus_tag LOCUS_20750 8075 7917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20750 10943 8769 gene locus_tag LOCUS_20760 gene rlmKL 10943 8769 CDS product bifunctional 23S rRNA (guanine(2069)-N(7))-methyltransferase RlmK/23S rRNA (guanine(2445)-N(2))-methyltransferase RlmL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113961.1 protein_id gnl|my_center|LOCUS_20760 12951 10996 gene locus_tag LOCUS_20770 12951 10996 CDS product acetoacetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000372280.1 protein_id gnl|my_center|LOCUS_20770 13947 13072 gene locus_tag LOCUS_20780 13947 13072 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119568.1 protein_id gnl|my_center|LOCUS_20780 >Feature sequence089 738 298 gene locus_tag LOCUS_20790 738 298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20790 987 1062 gene locus_tag LOCUS_t00230 987 1062 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 1290 1778 gene locus_tag LOCUS_20800 gene rimP 1290 1778 CDS product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460396.1 protein_id gnl|my_center|LOCUS_20800 1800 3308 gene locus_tag LOCUS_20810 gene nusA 1800 3308 CDS product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942231.1 protein_id gnl|my_center|LOCUS_20810 3337 3588 gene locus_tag LOCUS_20820 3337 3588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20820 3604 6297 gene locus_tag LOCUS_20830 3604 6297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20830 6301 6588 gene locus_tag LOCUS_20840 6301 6588 CDS product DUF503 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583570.1 protein_id gnl|my_center|LOCUS_20840 6819 7178 gene locus_tag LOCUS_20850 gene rbfA 6819 7178 CDS product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001829509.1 protein_id gnl|my_center|LOCUS_20850 7175 8149 gene locus_tag LOCUS_20860 7175 8149 CDS product bifunctional oligoribonuclease/PAP phosphatase NrnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942235.1 protein_id gnl|my_center|LOCUS_20860 8130 9083 gene locus_tag LOCUS_20870 gene truB 8130 9083 CDS product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942236.1 protein_id gnl|my_center|LOCUS_20870 9167 9436 gene locus_tag LOCUS_20880 gene rpsO 9167 9436 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942237.1 protein_id gnl|my_center|LOCUS_20880 9509 11608 gene locus_tag LOCUS_20890 gene pnp 9509 11608 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041914012.1 protein_id gnl|my_center|LOCUS_20890 11595 12872 gene locus_tag LOCUS_20900 11595 12872 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942239.1 protein_id gnl|my_center|LOCUS_20900 12973 13338 gene locus_tag LOCUS_20910 gene dut 12973 13338 CDS product dUTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942240.1 protein_id gnl|my_center|LOCUS_20910 13347 14120 gene locus_tag LOCUS_20920 13347 14120 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014551636.1 protein_id gnl|my_center|LOCUS_20920 >Feature sequence090 619 149 gene locus_tag LOCUS_20930 gene rpsG 619 149 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001138050.1 protein_id gnl|my_center|LOCUS_20930 1085 696 gene locus_tag LOCUS_20940 gene rpsL 1085 696 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943491.1 protein_id gnl|my_center|LOCUS_20940 5389 1313 gene locus_tag LOCUS_20950 gene rpoC 5389 1313 CDS product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943492.1 protein_id gnl|my_center|LOCUS_20950 9841 5447 gene locus_tag LOCUS_20960 gene rpoB 9841 5447 CDS product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390505.1 protein_id gnl|my_center|LOCUS_20960 10367 9984 gene locus_tag LOCUS_20970 gene rplL 10367 9984 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215374.1 protein_id gnl|my_center|LOCUS_20970 10924 10403 gene locus_tag LOCUS_20980 gene rplJ 10924 10403 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943495.1 protein_id gnl|my_center|LOCUS_20980 12008 11301 gene locus_tag LOCUS_20990 gene rplA 12008 11301 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943496.1 protein_id gnl|my_center|LOCUS_20990 12548 12126 gene locus_tag LOCUS_21000 gene rplK 12548 12126 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003718336.1 protein_id gnl|my_center|LOCUS_21000 13553 13023 gene locus_tag LOCUS_21010 gene nusG 13553 13023 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943498.1 protein_id gnl|my_center|LOCUS_21010 13961 13563 gene locus_tag LOCUS_21020 13961 13563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21020 14151 14075 gene locus_tag LOCUS_t00240 14151 14075 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 14319 14170 gene locus_tag LOCUS_21030 gene rpmG 14319 14170 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943500.1 protein_id gnl|my_center|LOCUS_21030 >Feature sequence091 1732 605 gene locus_tag LOCUS_21040 1732 605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21040 2714 1716 gene locus_tag LOCUS_21050 2714 1716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21050 4298 2748 gene locus_tag LOCUS_21060 gene murJ 4298 2748 CDS product murein biosynthesis integral membrane protein MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941832.1 protein_id gnl|my_center|LOCUS_21060 4510 4785 gene locus_tag LOCUS_21070 gene rpsT 4510 4785 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939182.1 protein_id gnl|my_center|LOCUS_21070 5804 4815 gene locus_tag LOCUS_21080 gene holA 5804 4815 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392113.1 protein_id gnl|my_center|LOCUS_21080 6358 5804 gene locus_tag LOCUS_21090 6358 5804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21090 8988 6412 gene locus_tag LOCUS_21100 gene leuS 8988 6412 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942849.1 protein_id gnl|my_center|LOCUS_21100 9408 8995 gene locus_tag LOCUS_21110 gene nusB 9408 8995 CDS product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082311.1 protein_id gnl|my_center|LOCUS_21110 9922 9443 gene locus_tag LOCUS_21120 gene ribE 9922 9443 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942334.1 protein_id gnl|my_center|LOCUS_21120 11554 10346 gene locus_tag LOCUS_21130 11554 10346 CDS product bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942333.1 protein_id gnl|my_center|LOCUS_21130 12387 11725 gene locus_tag LOCUS_21140 12387 11725 CDS product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942332.1 protein_id gnl|my_center|LOCUS_21140 13377 12412 gene locus_tag LOCUS_21150 13377 12412 CDS product alcohol dehydrogenase catalytic domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255943.1 protein_id gnl|my_center|LOCUS_21150 14326 13385 gene locus_tag LOCUS_21160 14326 13385 CDS product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942288.1 protein_id gnl|my_center|LOCUS_21160 >Feature sequence092 <1 577 gene locus_tag LOCUS_21170 <1 577 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_115892553.1:pyruvate synthase subunit PorC 577 2229 gene locus_tag LOCUS_21180 577 2229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21180 2226 3365 gene locus_tag LOCUS_21190 2226 3365 CDS product pyruvate ferredoxin oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393422.1 protein_id gnl|my_center|LOCUS_21190 3482 4339 gene locus_tag LOCUS_21200 3482 4339 CDS product 3-methyl-2-oxobutanoate dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846976.1 protein_id gnl|my_center|LOCUS_21200 4437 4841 gene locus_tag LOCUS_21210 4437 4841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21210 4898 4917 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 5108 6949 gene locus_tag LOCUS_21220 5108 6949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21220 7196 8686 gene locus_tag LOCUS_21230 7196 8686 CDS product GumC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583709.1 protein_id gnl|my_center|LOCUS_21230 8727 9440 gene locus_tag LOCUS_21240 gene epsB 8727 9440 CDS product protein tyrosine kinase EpsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228249.1 protein_id gnl|my_center|LOCUS_21240 9554 9390 gene locus_tag LOCUS_21250 9554 9390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21250 9553 10227 gene locus_tag LOCUS_21260 9553 10227 CDS product polysaccharide biosynthesis/export family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640491.1 protein_id gnl|my_center|LOCUS_21260 10742 10452 gene locus_tag LOCUS_21270 10742 10452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21270 10794 11435 gene locus_tag LOCUS_21280 10794 11435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21280 11959 12759 gene locus_tag LOCUS_21290 11959 12759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21290 12780 13817 gene locus_tag LOCUS_21300 12780 13817 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257502.1 protein_id gnl|my_center|LOCUS_21300 13814 14314 gene locus_tag LOCUS_21310 13814 14314 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061729.1 protein_id gnl|my_center|LOCUS_21310 >Feature sequence093 196 450 gene locus_tag LOCUS_21320 196 450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21320 617 865 gene locus_tag LOCUS_21330 617 865 CDS product sulfurtransferase TusA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391974.1 protein_id gnl|my_center|LOCUS_21330 876 2048 gene locus_tag LOCUS_21340 gene nifS 876 2048 CDS product cysteine desulfurase NifS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393154.1 protein_id gnl|my_center|LOCUS_21340 2065 2472 gene locus_tag LOCUS_21350 2065 2472 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393155.1 protein_id gnl|my_center|LOCUS_21350 2503 3015 gene locus_tag LOCUS_21360 2503 3015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21360 3008 3490 gene locus_tag LOCUS_21370 3008 3490 CDS product MOSC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943767.1 protein_id gnl|my_center|LOCUS_21370 4364 5290 gene locus_tag LOCUS_21380 4364 5290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21380 5332 5898 gene locus_tag LOCUS_21390 5332 5898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21390 5901 7058 gene locus_tag LOCUS_21400 5901 7058 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941993.1 protein_id gnl|my_center|LOCUS_21400 7069 7755 gene locus_tag LOCUS_21410 7069 7755 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941994.1 protein_id gnl|my_center|LOCUS_21410 8286 9128 gene locus_tag LOCUS_21420 8286 9128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21420 9373 9993 gene locus_tag LOCUS_21430 9373 9993 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939849.1 protein_id gnl|my_center|LOCUS_21430 10199 10026 gene locus_tag LOCUS_21440 10199 10026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21440 12738 10777 gene locus_tag LOCUS_21450 12738 10777 CDS product glycoside hydrolase family 15 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980092.1 protein_id gnl|my_center|LOCUS_21450 13711 12695 gene locus_tag LOCUS_21460 13711 12695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21460 >Feature sequence094 1429 848 gene locus_tag LOCUS_21470 1429 848 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002677237.1 protein_id gnl|my_center|LOCUS_21470 4008 1702 gene locus_tag LOCUS_21480 4008 1702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21480 5205 5005 gene locus_tag LOCUS_21490 5205 5005 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003563620.1 protein_id gnl|my_center|LOCUS_21490 6561 5392 gene locus_tag LOCUS_21500 6561 5392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21500 8444 6558 gene locus_tag LOCUS_21510 8444 6558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21510 9229 8483 gene locus_tag LOCUS_21520 9229 8483 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113858.1 protein_id gnl|my_center|LOCUS_21520 10182 9226 gene locus_tag LOCUS_21530 10182 9226 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113857.1 protein_id gnl|my_center|LOCUS_21530 12161 10392 gene locus_tag LOCUS_21540 12161 10392 CDS product YcaO-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939485.1 protein_id gnl|my_center|LOCUS_21540 13248 12265 gene locus_tag LOCUS_21550 13248 12265 CDS product TAXI family TRAP transporter solute-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464586.1 protein_id gnl|my_center|LOCUS_21550 13473 13279 gene locus_tag LOCUS_21560 13473 13279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21560 13576 14220 gene locus_tag LOCUS_21570 gene tmk 13576 14220 CDS product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546833.1 protein_id gnl|my_center|LOCUS_21570 >Feature sequence095 32 2119 gene locus_tag LOCUS_21580 gene fusA 32 2119 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682356.1 protein_id gnl|my_center|LOCUS_21580 2116 2811 gene locus_tag LOCUS_21590 2116 2811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21590 2815 2961 gene locus_tag LOCUS_21600 2815 2961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21600 3405 2965 gene locus_tag LOCUS_21610 gene dtd 3405 2965 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080996.1 protein_id gnl|my_center|LOCUS_21610 4459 3428 gene locus_tag LOCUS_21620 gene ftsY 4459 3428 CDS product signal recognition particle-docking protein FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941793.1 protein_id gnl|my_center|LOCUS_21620 7255 4463 gene locus_tag LOCUS_21630 gene smc 7255 4463 CDS product chromosome segregation protein SMC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941791.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_21630 7986 7285 gene locus_tag LOCUS_21640 7986 7285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21640 8218 9099 gene locus_tag LOCUS_21650 8218 9099 CDS product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001159609.1 protein_id gnl|my_center|LOCUS_21650 9554 10480 gene locus_tag LOCUS_21660 gene selD 9554 10480 CDS product selenide, water dikinase SelD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_196768338.1 protein_id gnl|my_center|LOCUS_21660 10833 11432 gene locus_tag LOCUS_21670 gene yedF 10833 11432 CDS product sulfurtransferase-like selenium metabolism protein YedF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938959.1 protein_id gnl|my_center|LOCUS_21670 11730 12746 gene locus_tag LOCUS_21680 11730 12746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21680 12911 13099 gene locus_tag LOCUS_21690 12911 13099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21690 13168 14079 gene locus_tag LOCUS_21700 13168 14079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21700 >Feature sequence096 1966 194 gene locus_tag LOCUS_21710 1966 194 CDS product Na(+)/H(+) antiporter subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118364.1 protein_id gnl|my_center|LOCUS_21710 2306 1959 gene locus_tag LOCUS_21720 2306 1959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21720 2487 2356 gene locus_tag LOCUS_21730 2487 2356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21730 4336 2855 gene locus_tag LOCUS_21740 4336 2855 CDS product monovalent cation/H+ antiporter subunit D family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064242829.1 protein_id gnl|my_center|LOCUS_21740 5818 4973 gene locus_tag LOCUS_21750 5818 4973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_21750 6324 5914 gene locus_tag LOCUS_21760 6324 5914 CDS product cation:proton antiporter subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389326.1 protein_id gnl|my_center|LOCUS_21760 7168 6338 gene locus_tag LOCUS_21770 7168 6338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_21770 7410 7165 gene locus_tag LOCUS_21780 7410 7165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_21780 7738 7415 gene locus_tag LOCUS_21790 gene mnhG 7738 7415 CDS product monovalent cation/H(+) antiporter subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249571.1 protein_id gnl|my_center|LOCUS_21790 8036 7761 gene locus_tag LOCUS_21800 8036 7761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21800 8359 8036 gene locus_tag LOCUS_21810 8359 8036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21810 9800 8646 gene locus_tag LOCUS_21820 9800 8646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21820 10281 9787 gene locus_tag LOCUS_21830 10281 9787 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546418.1 protein_id gnl|my_center|LOCUS_21830 10589 10768 gene locus_tag LOCUS_21840 10589 10768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_21840 >Feature sequence097 1379 33 gene locus_tag LOCUS_21850 gene orpR 1379 33 CDS product sigma 54-interacting transcriptional regulator OrpR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939383.1 protein_id gnl|my_center|LOCUS_21850 1656 1868 gene locus_tag LOCUS_21860 1656 1868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21860 1899 2255 gene locus_tag LOCUS_21870 1899 2255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21870 2365 2580 gene locus_tag LOCUS_21880 2365 2580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21880 2590 3705 gene locus_tag LOCUS_21890 2590 3705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21890 3772 4206 gene locus_tag LOCUS_21900 3772 4206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21900 5237 4488 gene locus_tag LOCUS_21910 5237 4488 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002894681.1 protein_id gnl|my_center|LOCUS_21910 6007 5240 gene locus_tag LOCUS_21920 6007 5240 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869436.1 protein_id gnl|my_center|LOCUS_21920 6461 6012 gene locus_tag LOCUS_21930 6461 6012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_21930 7686 6436 gene locus_tag LOCUS_21940 7686 6436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_21940 8923 7883 gene locus_tag LOCUS_21950 8923 7883 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_143274355.1 protein_id gnl|my_center|LOCUS_21950 9794 8925 gene locus_tag LOCUS_21960 9794 8925 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877735.1 protein_id gnl|my_center|LOCUS_21960 11181 9907 gene locus_tag LOCUS_21970 11181 9907 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089186.1 protein_id gnl|my_center|LOCUS_21970 13220 12045 gene locus_tag LOCUS_21980 13220 12045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21980 13548 13213 gene locus_tag LOCUS_21990 13548 13213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21990 >Feature sequence098 522 728 gene locus_tag LOCUS_22000 522 728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22000 725 967 gene locus_tag LOCUS_22010 725 967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22010 1001 1555 gene locus_tag LOCUS_22020 gene nuoE 1001 1555 CDS product NADH-quinone oxidoreductase subunit NuoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877157.1 protein_id gnl|my_center|LOCUS_22020 1539 2240 gene locus_tag LOCUS_22030 1539 2240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_22030 2198 3436 gene locus_tag LOCUS_22040 2198 3436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_22040 3436 4149 gene locus_tag LOCUS_22050 3436 4149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22050 4225 5247 gene locus_tag LOCUS_22060 gene dusB 4225 5247 CDS product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941670.1 protein_id gnl|my_center|LOCUS_22060 5244 6974 gene locus_tag LOCUS_22070 gene ispH 5244 6974 CDS product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011417689.1 protein_id gnl|my_center|LOCUS_22070 7025 7819 gene locus_tag LOCUS_22080 7025 7819 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001099029.1 protein_id gnl|my_center|LOCUS_22080 7983 9383 gene locus_tag LOCUS_22090 7983 9383 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000550944.1 protein_id gnl|my_center|LOCUS_22090 9760 10914 gene locus_tag LOCUS_22100 9760 10914 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097850.1 protein_id gnl|my_center|LOCUS_22100 10955 11830 gene locus_tag LOCUS_22110 10955 11830 CDS product 3-hydroxyacyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030215.1 protein_id gnl|my_center|LOCUS_22110 11922 13403 gene locus_tag LOCUS_22120 11922 13403 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_031160740.1 protein_id gnl|my_center|LOCUS_22120 >Feature sequence099 1775 243 gene locus_tag LOCUS_22130 gene cls 1775 243 CDS product cardiolipin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705220.1 protein_id gnl|my_center|LOCUS_22130 3582 2173 gene locus_tag LOCUS_22140 3582 2173 CDS product NADH-quinone oxidoreductase subunit N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545829.1 protein_id gnl|my_center|LOCUS_22140 5132 3585 gene locus_tag LOCUS_22150 5132 3585 CDS product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967804.1 protein_id gnl|my_center|LOCUS_22150 6909 5137 gene locus_tag LOCUS_22160 6909 5137 CDS product Na(+)/H(+) antiporter subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969263.1 protein_id gnl|my_center|LOCUS_22160 8480 6984 gene locus_tag LOCUS_22170 8480 6984 CDS product monovalent cation/H+ antiporter subunit D family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969265.1 protein_id gnl|my_center|LOCUS_22170 8794 8486 gene locus_tag LOCUS_22180 8794 8486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22180 9300 8791 gene locus_tag LOCUS_22190 9300 8791 CDS product NADH-quinone oxidoreductase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257850.1 protein_id gnl|my_center|LOCUS_22190 9917 9366 gene locus_tag LOCUS_22200 9917 9366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22200 10936 9965 gene locus_tag LOCUS_22210 gene nuoH 10936 9965 CDS product NADH-quinone oxidoreductase subunit NuoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392496.1 protein_id gnl|my_center|LOCUS_22210 12684 11035 gene locus_tag LOCUS_22220 12684 11035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22220 13211 12681 gene locus_tag LOCUS_22230 13211 12681 CDS product NADH-quinone oxidoreductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392493.1 protein_id gnl|my_center|LOCUS_22230 13567 13193 gene locus_tag LOCUS_22240 gene ndhC 13567 13193 CDS product NADH-quinone oxidoreductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257856.1 protein_id gnl|my_center|LOCUS_22240 >Feature sequence100 76 1 gene locus_tag LOCUS_t00250 76 1 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 177 101 gene locus_tag LOCUS_t00260 177 101 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 620 1048 gene locus_tag LOCUS_22250 gene rplM 620 1048 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943505.1 protein_id gnl|my_center|LOCUS_22250 1049 1441 gene locus_tag LOCUS_22260 gene rpsI 1049 1441 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943504.1 protein_id gnl|my_center|LOCUS_22260 1569 2312 gene locus_tag LOCUS_22270 gene truA 1569 2312 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393903.1 protein_id gnl|my_center|LOCUS_22270 2464 2309 gene locus_tag LOCUS_22280 2464 2309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22280 3638 2631 gene locus_tag LOCUS_22290 gene amrS 3638 2631 CDS product AmmeMemoRadiSam system radical SAM enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546747.1 protein_id gnl|my_center|LOCUS_22290 4431 3616 gene locus_tag LOCUS_22300 4431 3616 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940624.1 protein_id gnl|my_center|LOCUS_22300 5685 4456 gene locus_tag LOCUS_22310 5685 4456 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868852.1 protein_id gnl|my_center|LOCUS_22310 6601 5696 gene locus_tag LOCUS_22320 gene mpgP 6601 5696 CDS product mannosyl-3-phosphoglycerate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228324.1 protein_id gnl|my_center|LOCUS_22320 7832 6579 gene locus_tag LOCUS_22330 7832 6579 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124879.1 protein_id gnl|my_center|LOCUS_22330 8307 8870 gene locus_tag LOCUS_22340 8307 8870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22340 9318 8896 gene locus_tag LOCUS_22350 9318 8896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22350 12143 10269 gene locus_tag LOCUS_22360 12143 10269 CDS product ASKHA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811724.1 protein_id gnl|my_center|LOCUS_22360 12863 12246 gene locus_tag LOCUS_22370 12863 12246 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003356907.1 protein_id gnl|my_center|LOCUS_22370 13099 13344 gene locus_tag LOCUS_22380 13099 13344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22380 >Feature sequence101 717 292 gene locus_tag LOCUS_22390 717 292 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227761.1 protein_id gnl|my_center|LOCUS_22390 1000 692 gene locus_tag LOCUS_22400 1000 692 CDS product type II toxin-antitoxin system prevent-host-death family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227760.1 protein_id gnl|my_center|LOCUS_22400 1635 1264 gene locus_tag LOCUS_22410 1635 1264 CDS product DUF2784 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113117.1 protein_id gnl|my_center|LOCUS_22410 2138 2899 gene locus_tag LOCUS_22420 2138 2899 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940782.1 protein_id gnl|my_center|LOCUS_22420 2905 3702 gene locus_tag LOCUS_22430 2905 3702 CDS product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940783.1 protein_id gnl|my_center|LOCUS_22430 4319 3717 gene locus_tag LOCUS_22440 gene plsY 4319 3717 CDS product glycerol-3-phosphate 1-O-acyltransferase PlsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941175.1 protein_id gnl|my_center|LOCUS_22440 4524 4925 gene locus_tag LOCUS_22450 4524 4925 CDS product DUF3842 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545623.1 protein_id gnl|my_center|LOCUS_22450 4912 5064 gene locus_tag LOCUS_22460 4912 5064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22460 5068 5238 gene locus_tag LOCUS_22470 5068 5238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22470 5309 5935 gene locus_tag LOCUS_22480 5309 5935 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545344.1 protein_id gnl|my_center|LOCUS_22480 8121 6040 gene locus_tag LOCUS_22490 8121 6040 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064349.1 protein_id gnl|my_center|LOCUS_22490 9386 8226 gene locus_tag LOCUS_22500 9386 8226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22500 10765 9383 gene locus_tag LOCUS_22510 10765 9383 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066616.1 protein_id gnl|my_center|LOCUS_22510 11797 10784 gene locus_tag LOCUS_22520 11797 10784 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879345.1 protein_id gnl|my_center|LOCUS_22520 >Feature sequence102 201 440 gene locus_tag LOCUS_22530 201 440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22530 430 1491 gene locus_tag LOCUS_22540 430 1491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22540 1755 1498 gene locus_tag LOCUS_22550 1755 1498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_22550 2037 1801 gene locus_tag LOCUS_22560 2037 1801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22560 3102 2227 gene locus_tag LOCUS_22570 gene lsrF 3102 2227 CDS product 3-hydroxy-5-phosphonooxypentane-2,4-dione thiolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005175220.1 protein_id gnl|my_center|LOCUS_22570 3421 3197 gene locus_tag LOCUS_22580 3421 3197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22580 5355 3625 gene locus_tag LOCUS_22590 5355 3625 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681003.1 protein_id gnl|my_center|LOCUS_22590 5492 6199 gene locus_tag LOCUS_22600 gene fadR 5492 6199 CDS product fatty acid metabolism transcriptional regulator FadR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706276.1 protein_id gnl|my_center|LOCUS_22600 6199 7830 gene locus_tag LOCUS_22610 6199 7830 CDS product glycerol-3-phosphate dehydrogenase/oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113972.1 protein_id gnl|my_center|LOCUS_22610 8244 9806 gene locus_tag LOCUS_22620 8244 9806 CDS product FGGY-family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003109491.1 protein_id gnl|my_center|LOCUS_22620 10109 10480 gene locus_tag LOCUS_22630 10109 10480 CDS product DUF1992 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028842486.1 protein_id gnl|my_center|LOCUS_22630 10533 11582 gene locus_tag LOCUS_22640 10533 11582 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039704.1 protein_id gnl|my_center|LOCUS_22640 11744 12616 gene locus_tag LOCUS_22650 11744 12616 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090549.1 protein_id gnl|my_center|LOCUS_22650 >Feature sequence103 4002 2944 gene locus_tag LOCUS_22660 4002 2944 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546078.1 protein_id gnl|my_center|LOCUS_22660 5071 4004 gene locus_tag LOCUS_22670 gene ilvC 5071 4004 CDS product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962615.1 protein_id gnl|my_center|LOCUS_22670 5737 5240 gene locus_tag LOCUS_22680 gene ilvN 5737 5240 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545180.1 protein_id gnl|my_center|LOCUS_22680 7447 5759 gene locus_tag LOCUS_22690 gene ilvB 7447 5759 CDS product biosynthetic-type acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938671.1 protein_id gnl|my_center|LOCUS_22690 8046 7549 gene locus_tag LOCUS_22700 gene leuD 8046 7549 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868466.1 protein_id gnl|my_center|LOCUS_22700 9367 8108 gene locus_tag LOCUS_22710 gene leuC 9367 8108 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393737.1 protein_id gnl|my_center|LOCUS_22710 10960 9416 gene locus_tag LOCUS_22720 10960 9416 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546793.1 protein_id gnl|my_center|LOCUS_22720 11243 11016 gene locus_tag LOCUS_22730 11243 11016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22730 12823 11240 gene locus_tag LOCUS_22740 gene cimA 12823 11240 CDS product citramalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393734.1 protein_id gnl|my_center|LOCUS_22740 >Feature sequence104 1086 106 gene locus_tag LOCUS_22750 gene fabD 1086 106 CDS product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837457.1 protein_id gnl|my_center|LOCUS_22750 1335 2387 gene locus_tag LOCUS_22760 1335 2387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_22760 2290 2886 gene locus_tag LOCUS_22770 2290 2886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_22770 3006 4154 gene locus_tag LOCUS_22780 3006 4154 CDS product zinc-dependent alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_092772473.1 protein_id gnl|my_center|LOCUS_22780 4593 4688 gene locus_tag LOCUS_t00270 4593 4688 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 5947 4772 gene locus_tag LOCUS_22790 5947 4772 CDS product hydroxymethylglutaryl-CoA lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206797.1 protein_id gnl|my_center|LOCUS_22790 7831 6092 gene locus_tag LOCUS_22800 7831 6092 CDS product carboxyl transferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902654.1 protein_id gnl|my_center|LOCUS_22800 9046 7838 gene locus_tag LOCUS_22810 9046 7838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22810 9468 10619 gene locus_tag LOCUS_22820 9468 10619 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000397283.1 protein_id gnl|my_center|LOCUS_22820 10623 12509 gene locus_tag LOCUS_22830 gene msbA 10623 12509 CDS product lipid A export permease/ATP-binding protein MsbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942900.1 protein_id gnl|my_center|LOCUS_22830 12571 12921 gene locus_tag LOCUS_22840 12571 12921 CDS product integration host factor subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942168.1 protein_id gnl|my_center|LOCUS_22840 >Feature sequence105 54 659 gene locus_tag LOCUS_22850 54 659 CDS product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546460.1 protein_id gnl|my_center|LOCUS_22850 617 961 gene locus_tag LOCUS_22860 617 961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22860 1373 1531 gene locus_tag LOCUS_22870 1373 1531 CDS product rubredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392798.1 protein_id gnl|my_center|LOCUS_22870 1535 2722 gene locus_tag LOCUS_22880 1535 2722 CDS product FprA family A-type flavoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064402.1 protein_id gnl|my_center|LOCUS_22880 2787 4052 gene locus_tag LOCUS_22890 2787 4052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22890 4151 4354 gene locus_tag LOCUS_22900 4151 4354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22900 4351 5043 gene locus_tag LOCUS_22910 4351 5043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22910 5075 5584 gene locus_tag LOCUS_22920 5075 5584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22920 5584 6390 gene locus_tag LOCUS_22930 5584 6390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22930 6433 6834 gene locus_tag LOCUS_22940 6433 6834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22940 7773 6847 gene locus_tag LOCUS_22950 7773 6847 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203087.1 protein_id gnl|my_center|LOCUS_22950 8081 9262 gene locus_tag LOCUS_22960 8081 9262 CDS product TRC40/GET3/ArsA family transport-energizing ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880406.1 protein_id gnl|my_center|LOCUS_22960 9275 9505 gene locus_tag LOCUS_22970 9275 9505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22970 9520 10782 gene locus_tag LOCUS_22980 gene hisS 9520 10782 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545147.1 protein_id gnl|my_center|LOCUS_22980 10775 12187 gene locus_tag LOCUS_22990 gene aspS 10775 12187 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942109.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_22990 12123 12560 gene locus_tag LOCUS_23000 12123 12560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_23000 12172 12182 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence106 687 1199 gene locus_tag LOCUS_23010 687 1199 CDS product TRAP transporter small permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719485.1 protein_id gnl|my_center|LOCUS_23010 1189 2508 gene locus_tag LOCUS_23020 1189 2508 CDS product TRAP transporter large permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172863.1 protein_id gnl|my_center|LOCUS_23020 2912 4441 gene locus_tag LOCUS_23030 2912 4441 CDS product class I adenylate-forming enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921024.1 protein_id gnl|my_center|LOCUS_23030 4470 5447 gene locus_tag LOCUS_23040 4470 5447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23040 5551 7551 gene locus_tag LOCUS_23050 5551 7551 CDS product acetoacetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259232.1 protein_id gnl|my_center|LOCUS_23050 7598 8545 gene locus_tag LOCUS_23060 7598 8545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23060 8768 9181 gene locus_tag LOCUS_23070 8768 9181 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393155.1 protein_id gnl|my_center|LOCUS_23070 9213 9668 gene locus_tag LOCUS_23080 9213 9668 CDS product MOSC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943767.1 protein_id gnl|my_center|LOCUS_23080 10190 10372 gene locus_tag LOCUS_23090 10190 10372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23090 10405 10626 gene locus_tag LOCUS_23100 10405 10626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23100 10767 11219 gene locus_tag LOCUS_23110 10767 11219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23110 11853 11296 gene locus_tag LOCUS_23120 11853 11296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23120 >Feature sequence107 880 86 gene locus_tag LOCUS_23130 880 86 CDS product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228020.1 protein_id gnl|my_center|LOCUS_23130 1702 911 gene locus_tag LOCUS_23140 1702 911 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816058.1 protein_id gnl|my_center|LOCUS_23140 2788 1736 gene locus_tag LOCUS_23150 2788 1736 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002067912.1 protein_id gnl|my_center|LOCUS_23150 3946 2804 gene locus_tag LOCUS_23160 gene acdA 3946 2804 CDS product acyl-CoA dehydrogenase AcdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000545544.1 protein_id gnl|my_center|LOCUS_23160 4946 4089 gene locus_tag LOCUS_23170 4946 4089 CDS product 3-keto-5-aminohexanoate cleavage protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029490830.1 protein_id gnl|my_center|LOCUS_23170 5727 4948 gene locus_tag LOCUS_23180 5727 4948 CDS product short-chain-enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965999.1 protein_id gnl|my_center|LOCUS_23180 6898 5753 gene locus_tag LOCUS_23190 6898 5753 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227132.1 protein_id gnl|my_center|LOCUS_23190 7776 6925 gene locus_tag LOCUS_23200 7776 6925 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421145.1 protein_id gnl|my_center|LOCUS_23200 8597 7806 gene locus_tag LOCUS_23210 8597 7806 CDS product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064266.1 protein_id gnl|my_center|LOCUS_23210 9076 8627 gene locus_tag LOCUS_23220 9076 8627 CDS product Zn-ribbon domain-containing OB-fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052270458.1 protein_id gnl|my_center|LOCUS_23220 9571 9095 gene locus_tag LOCUS_23230 9571 9095 CDS product Zn-ribbon domain-containing OB-fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052270458.1 protein_id gnl|my_center|LOCUS_23230 10742 9582 gene locus_tag LOCUS_23240 10742 9582 CDS product thiolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877713.1 protein_id gnl|my_center|LOCUS_23240 11904 10762 gene locus_tag LOCUS_23250 11904 10762 CDS product thiolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064172.1 protein_id gnl|my_center|LOCUS_23250 12589 12026 gene locus_tag LOCUS_23260 12589 12026 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430090.1 protein_id gnl|my_center|LOCUS_23260 >Feature sequence108 767 9 gene locus_tag LOCUS_23270 767 9 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23270 1672 3414 gene locus_tag LOCUS_23280 1672 3414 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879268.1 protein_id gnl|my_center|LOCUS_23280 3569 3988 gene locus_tag LOCUS_23290 3569 3988 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546571.1 protein_id gnl|my_center|LOCUS_23290 4153 5628 gene locus_tag LOCUS_23300 4153 5628 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113001.1 protein_id gnl|my_center|LOCUS_23300 5792 6895 gene locus_tag LOCUS_23310 5792 6895 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532876.1 protein_id gnl|my_center|LOCUS_23310 6905 10063 gene locus_tag LOCUS_23320 6905 10063 CDS product multidrug efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532875.1 protein_id gnl|my_center|LOCUS_23320 10096 10578 gene locus_tag LOCUS_23330 10096 10578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23330 10599 11906 gene locus_tag LOCUS_23340 gene der 10599 11906 CDS product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392835.1 protein_id gnl|my_center|LOCUS_23340 11903 12295 gene locus_tag LOCUS_23350 11903 12295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23350 12430 12798 gene locus_tag LOCUS_23360 12430 12798 CDS product cyclophilin-like fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545617.1 protein_id gnl|my_center|LOCUS_23360 >Feature sequence109 2368 50 gene locus_tag LOCUS_23370 2368 50 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23370 2597 3565 gene locus_tag LOCUS_23380 2597 3565 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081431.1 protein_id gnl|my_center|LOCUS_23380 3933 4220 gene locus_tag LOCUS_23390 gene groES 3933 4220 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388344.1 protein_id gnl|my_center|LOCUS_23390 4284 5930 gene locus_tag LOCUS_23400 gene groL 4284 5930 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939262.1 protein_id gnl|my_center|LOCUS_23400 6144 7118 gene locus_tag LOCUS_23410 6144 7118 CDS product NAD-dependent epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141070.1 protein_id gnl|my_center|LOCUS_23410 8279 7119 gene locus_tag LOCUS_23420 8279 7119 CDS product TraB/GumN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811492.1 protein_id gnl|my_center|LOCUS_23420 8323 8342 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 8425 9693 gene locus_tag LOCUS_23430 8425 9693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23430 9732 11549 gene locus_tag LOCUS_23440 9732 11549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23440 12032 11784 gene locus_tag LOCUS_23450 12032 11784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23450 >Feature sequence110 408 58 gene locus_tag LOCUS_23460 408 58 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23460 978 478 gene locus_tag LOCUS_23470 978 478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23470 1442 975 gene locus_tag LOCUS_23480 gene greA 1442 975 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530066.1 protein_id gnl|my_center|LOCUS_23480 3977 1605 gene locus_tag LOCUS_23490 3977 1605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23490 4478 5254 gene locus_tag LOCUS_23500 4478 5254 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338959.1 protein_id gnl|my_center|LOCUS_23500 5661 5317 gene locus_tag LOCUS_23510 5661 5317 CDS product CGGC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064455.1 protein_id gnl|my_center|LOCUS_23510 6037 5702 gene locus_tag LOCUS_23520 6037 5702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23520 6322 6128 gene locus_tag LOCUS_23530 6322 6128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23530 6596 6423 gene locus_tag LOCUS_23540 6596 6423 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937335.1 protein_id gnl|my_center|LOCUS_23540 6990 6631 gene locus_tag LOCUS_23550 6990 6631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938073.1 protein_id gnl|my_center|LOCUS_23550 7604 7059 gene locus_tag LOCUS_23560 7604 7059 CDS product NADH peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003483406.1 protein_id gnl|my_center|LOCUS_23560 7847 7644 gene locus_tag LOCUS_23570 7847 7644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23570 8719 9096 gene locus_tag LOCUS_23580 8719 9096 CDS product YkgJ family cysteine cluster protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938301.1 protein_id gnl|my_center|LOCUS_23580 9093 9830 gene locus_tag LOCUS_23590 9093 9830 CDS product ComF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940800.1 protein_id gnl|my_center|LOCUS_23590 9856 10356 gene locus_tag LOCUS_23600 9856 10356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23600 10730 10806 gene locus_tag LOCUS_t00280 10730 10806 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 11238 11005 gene locus_tag LOCUS_23610 11238 11005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23610 11555 11226 gene locus_tag LOCUS_23620 11555 11226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23620 >Feature sequence111 360 1718 gene locus_tag LOCUS_23630 360 1718 CDS product B12-binding domain-containing radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545411.1 protein_id gnl|my_center|LOCUS_23630 2627 1878 gene locus_tag LOCUS_23640 gene larB 2627 1878 CDS product nickel pincer cofactor biosynthesis protein LarB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940816.1 protein_id gnl|my_center|LOCUS_23640 3129 2647 gene locus_tag LOCUS_23650 3129 2647 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582732.1 protein_id gnl|my_center|LOCUS_23650 3614 3258 gene locus_tag LOCUS_23660 3614 3258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23660 4299 3646 gene locus_tag LOCUS_23670 4299 3646 CDS product protein-L-isoaspartate(D-aspartate) O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942171.1 protein_id gnl|my_center|LOCUS_23670 5618 5055 gene locus_tag LOCUS_23680 5618 5055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23680 6302 5757 gene locus_tag LOCUS_23690 6302 5757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23690 6427 6242 gene locus_tag LOCUS_23700 6427 6242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23700 7086 6853 gene locus_tag LOCUS_23710 7086 6853 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331460.1 protein_id gnl|my_center|LOCUS_23710 7638 7141 gene locus_tag LOCUS_23720 7638 7141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23720 8945 7773 gene locus_tag LOCUS_23730 8945 7773 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870216.1 protein_id gnl|my_center|LOCUS_23730 9888 9541 gene locus_tag LOCUS_23740 9888 9541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23740 10117 11292 gene locus_tag LOCUS_23750 10117 11292 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010871084.1 protein_id gnl|my_center|LOCUS_23750 11296 11520 gene locus_tag LOCUS_23760 11296 11520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23760 11531 12295 gene locus_tag LOCUS_23770 11531 12295 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942121.1 protein_id gnl|my_center|LOCUS_23770 >Feature sequence112 187 924 gene locus_tag LOCUS_23780 187 924 CDS product SagB/ThcOx family dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867364.1 protein_id gnl|my_center|LOCUS_23780 1394 1999 gene locus_tag LOCUS_23790 1394 1999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099663.1 protein_id gnl|my_center|LOCUS_23790 2058 3017 gene locus_tag LOCUS_23800 2058 3017 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868714.1 protein_id gnl|my_center|LOCUS_23800 3050 3523 gene locus_tag LOCUS_23810 gene purE 3050 3523 CDS product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582680.1 protein_id gnl|my_center|LOCUS_23810 3516 4544 gene locus_tag LOCUS_23820 gene purC 3516 4544 CDS product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582681.1 protein_id gnl|my_center|LOCUS_23820 4783 6336 gene locus_tag LOCUS_23830 4783 6336 CDS product acyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387814.1 protein_id gnl|my_center|LOCUS_23830 6345 8354 gene locus_tag LOCUS_23840 6345 8354 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140126.1 protein_id gnl|my_center|LOCUS_23840 8642 8349 gene locus_tag LOCUS_23850 8642 8349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23850 9424 8582 gene locus_tag LOCUS_23860 9424 8582 CDS product FAD/NAD(P)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940762.1 protein_id gnl|my_center|LOCUS_23860 10673 9633 gene locus_tag LOCUS_23870 10673 9633 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011791853.1 protein_id gnl|my_center|LOCUS_23870 11804 10854 gene locus_tag LOCUS_23880 11804 10854 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392333.1 protein_id gnl|my_center|LOCUS_23880 12235 12035 gene locus_tag LOCUS_23890 12235 12035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_23890 >Feature sequence113 2225 222 gene locus_tag LOCUS_23900 gene lon 2225 222 CDS product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545787.1 protein_id gnl|my_center|LOCUS_23900 2617 2802 gene locus_tag LOCUS_23910 2617 2802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23910 2814 3320 gene locus_tag LOCUS_23920 2814 3320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23920 3372 3926 gene locus_tag LOCUS_23930 3372 3926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23930 4404 6218 gene locus_tag LOCUS_23940 4404 6218 CDS product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839181.1 protein_id gnl|my_center|LOCUS_23940 6398 7249 gene locus_tag LOCUS_23950 6398 7249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23950 7351 8859 gene locus_tag LOCUS_23960 7351 8859 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546582.1 protein_id gnl|my_center|LOCUS_23960 8843 10207 gene locus_tag LOCUS_23970 8843 10207 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164924829.1 protein_id gnl|my_center|LOCUS_23970 10237 11244 gene locus_tag LOCUS_23980 10237 11244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_23980 11355 11666 gene locus_tag LOCUS_23990 11355 11666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_23990 >Feature sequence114 167 1075 gene locus_tag LOCUS_24000 167 1075 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011791421.1 protein_id gnl|my_center|LOCUS_24000 1672 3156 gene locus_tag LOCUS_24010 1672 3156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_24010 3134 4477 gene locus_tag LOCUS_24020 3134 4477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_24020 4519 5574 gene locus_tag LOCUS_24030 gene argJ 4519 5574 CDS product bifunctional glutamate N-acetyltransferase/amino-acid acetyltransferase ArgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942692.1 protein_id gnl|my_center|LOCUS_24030 5546 5561 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 5887 6963 gene locus_tag LOCUS_24040 5887 6963 CDS product mannose-1-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426511.1 protein_id gnl|my_center|LOCUS_24040 7620 6958 gene locus_tag LOCUS_24050 7620 6958 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939484.1 protein_id gnl|my_center|LOCUS_24050 7872 9008 gene locus_tag LOCUS_24060 gene acdA 7872 9008 CDS product acyl-CoA dehydrogenase AcdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000545544.1 protein_id gnl|my_center|LOCUS_24060 9420 10190 gene locus_tag LOCUS_24070 9420 10190 CDS product electron transfer flavoprotein subunit beta/FixA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903461.1 protein_id gnl|my_center|LOCUS_24070 10529 12109 gene locus_tag LOCUS_24080 10529 12109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24080 >Feature sequence115 667 2247 gene locus_tag LOCUS_24090 gene serA 667 2247 CDS product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546680.1 protein_id gnl|my_center|LOCUS_24090 2339 2728 gene locus_tag LOCUS_24100 2339 2728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24100 2910 4349 gene locus_tag LOCUS_24110 2910 4349 CDS product DegQ family serine endoprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940999.1 protein_id gnl|my_center|LOCUS_24110 4463 5368 gene locus_tag LOCUS_24120 gene ispE 4463 5368 CDS product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941321.1 protein_id gnl|my_center|LOCUS_24120 5449 5523 gene locus_tag LOCUS_t00290 5449 5523 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 5608 6549 gene locus_tag LOCUS_24130 5608 6549 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941322.1 protein_id gnl|my_center|LOCUS_24130 6621 7301 gene locus_tag LOCUS_24140 6621 7301 CDS product 50S ribosomal protein L25/general stress protein Ctc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391493.1 protein_id gnl|my_center|LOCUS_24140 7310 7885 gene locus_tag LOCUS_24150 gene pth 7310 7885 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226727.1 protein_id gnl|my_center|LOCUS_24150 7901 9967 gene locus_tag LOCUS_24160 7901 9967 CDS product sodium-translocating pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392862.1 protein_id gnl|my_center|LOCUS_24160 10088 10567 gene locus_tag LOCUS_24170 10088 10567 CDS product CarD family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938863.1 protein_id gnl|my_center|LOCUS_24170 10642 11628 gene locus_tag LOCUS_24180 10642 11628 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940759.1 protein_id gnl|my_center|LOCUS_24180 >Feature sequence116 380 1627 gene locus_tag LOCUS_24190 gene rho 380 1627 CDS product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943729.1 protein_id gnl|my_center|LOCUS_24190 1657 1890 gene locus_tag LOCUS_24200 gene rpmE 1657 1890 CDS product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669000.1 protein_id gnl|my_center|LOCUS_24200 2286 3359 gene locus_tag LOCUS_24210 gene prfA 2286 3359 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940174.1 protein_id gnl|my_center|LOCUS_24210 3602 4390 gene locus_tag LOCUS_24220 gene prmC 3602 4390 CDS product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943724.1 protein_id gnl|my_center|LOCUS_24220 4569 6446 gene locus_tag LOCUS_24230 4569 6446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24230 6452 6991 gene locus_tag LOCUS_24240 6452 6991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24240 7230 6973 gene locus_tag LOCUS_24250 7230 6973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24250 7993 7583 gene locus_tag LOCUS_24260 7993 7583 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203080.1 protein_id gnl|my_center|LOCUS_24260 8376 8041 gene locus_tag LOCUS_24270 8376 8041 CDS product STAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939281.1 protein_id gnl|my_center|LOCUS_24270 8736 9200 gene locus_tag LOCUS_24280 8736 9200 CDS product PaaI family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005061570.1 protein_id gnl|my_center|LOCUS_24280 10210 9197 gene locus_tag LOCUS_24290 10210 9197 CDS product DUF72 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403825.1 protein_id gnl|my_center|LOCUS_24290 10812 10285 gene locus_tag LOCUS_24300 10812 10285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24300 >Feature sequence117 2173 653 gene locus_tag LOCUS_24310 2173 653 CDS product methylenetetrahydrofolate reductase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015942559.1 protein_id gnl|my_center|LOCUS_24310 2421 2663 gene locus_tag LOCUS_24320 2421 2663 CDS product ferredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869340.1 protein_id gnl|my_center|LOCUS_24320 2653 3747 gene locus_tag LOCUS_24330 2653 3747 CDS product 3-methyl-2-oxobutanoate dehydrogenase subunit VorB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869339.1 protein_id gnl|my_center|LOCUS_24330 3744 4064 gene locus_tag LOCUS_24340 3744 4064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_24340 4093 4455 gene locus_tag LOCUS_24350 4093 4455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_24350 4452 4994 gene locus_tag LOCUS_24360 4452 4994 CDS product 2-oxoacid:acceptor oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869337.1 protein_id gnl|my_center|LOCUS_24360 6242 5016 gene locus_tag LOCUS_24370 gene manA 6242 5016 CDS product mannose-6-phosphate isomerase, class I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111913.1 protein_id gnl|my_center|LOCUS_24370 6887 6246 gene locus_tag LOCUS_24380 6887 6246 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389783.1 protein_id gnl|my_center|LOCUS_24380 7697 6912 gene locus_tag LOCUS_24390 gene pcaD 7697 6912 CDS product 3-oxoadipate enol-lactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088414.1 protein_id gnl|my_center|LOCUS_24390 7954 8682 gene locus_tag LOCUS_24400 7954 8682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24400 8950 9993 gene locus_tag LOCUS_24410 gene ychF 8950 9993 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256516.1 protein_id gnl|my_center|LOCUS_24410 10176 11237 gene locus_tag LOCUS_24420 gene argC 10176 11237 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000861219.1 protein_id gnl|my_center|LOCUS_24420 >Feature sequence118 <1 1485 gene locus_tag LOCUS_24430 <1 1485 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010967947.1:adenylate/guanylate cyclase domain-containing protein 1702 4923 gene locus_tag LOCUS_24440 1702 4923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_24440 5389 4937 gene locus_tag LOCUS_24450 5389 4937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24450 6434 5418 gene locus_tag LOCUS_24460 6434 5418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24460 8000 8494 gene locus_tag LOCUS_24470 8000 8494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24470 8491 11478 gene locus_tag LOCUS_24480 8491 11478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24480 >Feature sequence119 181 867 gene locus_tag LOCUS_24490 181 867 CDS product endonuclease III domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193360272.1 protein_id gnl|my_center|LOCUS_24490 1960 878 gene locus_tag LOCUS_24500 1960 878 CDS product mechanosensitive ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942278.1 protein_id gnl|my_center|LOCUS_24500 2704 1970 gene locus_tag LOCUS_24510 2704 1970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24510 3477 3043 gene locus_tag LOCUS_24520 3477 3043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24520 3710 3474 gene locus_tag LOCUS_24530 3710 3474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24530 4059 3972 gene locus_tag LOCUS_t00300 4059 3972 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 4213 4288 gene locus_tag LOCUS_t00310 4213 4288 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 5261 4473 gene locus_tag LOCUS_24540 gene surE 5261 4473 CDS product 5'/3'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404579.1 protein_id gnl|my_center|LOCUS_24540 5431 6264 gene locus_tag LOCUS_24550 5431 6264 CDS product fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393766.1 protein_id gnl|my_center|LOCUS_24550 6336 6896 gene locus_tag LOCUS_24560 6336 6896 CDS product Fe-S-containing hydro-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393765.1 protein_id gnl|my_center|LOCUS_24560 7014 8219 gene locus_tag LOCUS_24570 7014 8219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24570 9331 8756 gene locus_tag LOCUS_24580 9331 8756 CDS product LemA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682263.1 protein_id gnl|my_center|LOCUS_24580 10065 9334 gene locus_tag LOCUS_24590 10065 9334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24590 10874 10077 gene locus_tag LOCUS_24600 10874 10077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24600 10828 11022 gene locus_tag LOCUS_24610 10828 11022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24610 >Feature sequence120 3089 1188 gene locus_tag LOCUS_24620 3089 1188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24620 3700 3122 gene locus_tag LOCUS_24630 3700 3122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24630 5253 3697 gene locus_tag LOCUS_24640 5253 3697 CDS product protein-glutamate O-methyltransferase CheR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012660540.1 protein_id gnl|my_center|LOCUS_24640 5840 5388 gene locus_tag LOCUS_24650 5840 5388 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939190.1 protein_id gnl|my_center|LOCUS_24650 6307 6005 gene locus_tag LOCUS_24660 6307 6005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24660 6911 6624 gene locus_tag LOCUS_24670 6911 6624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24670 7069 6884 gene locus_tag LOCUS_24680 7069 6884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24680 7919 7056 gene locus_tag LOCUS_24690 7919 7056 CDS product sterol desaturase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000003105.1 protein_id gnl|my_center|LOCUS_24690 8406 7909 gene locus_tag LOCUS_24700 8406 7909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24700 8751 8530 gene locus_tag LOCUS_24710 8751 8530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_24710 9302 8775 gene locus_tag LOCUS_24720 9302 8775 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071247.1 protein_id gnl|my_center|LOCUS_24720 9477 9968 gene locus_tag LOCUS_24730 9477 9968 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937470.1 protein_id gnl|my_center|LOCUS_24730 10004 10918 gene locus_tag LOCUS_24740 10004 10918 CDS product phosphoribosylanthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018010902.1 protein_id gnl|my_center|LOCUS_24740 11162 11254 gene locus_tag LOCUS_t00320 11162 11254 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 11395 11583 gene locus_tag LOCUS_24750 11395 11583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24750 >Feature sequence121 181 636 gene locus_tag LOCUS_24760 181 636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24760 640 1041 gene locus_tag LOCUS_24770 640 1041 CDS product type II toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010928351.1 protein_id gnl|my_center|LOCUS_24770 1729 1046 gene locus_tag LOCUS_24780 1729 1046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24780 2189 1959 gene locus_tag LOCUS_24790 2189 1959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24790 2881 3753 gene locus_tag LOCUS_24800 2881 3753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24800 4592 6394 gene locus_tag LOCUS_24810 4592 6394 CDS product DNA topoisomerase IV subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002667902.1 protein_id gnl|my_center|LOCUS_24810 6394 8325 gene locus_tag LOCUS_24820 6394 8325 CDS product DNA topoisomerase IV subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679930.1 protein_id gnl|my_center|LOCUS_24820 10103 8382 gene locus_tag LOCUS_24830 10103 8382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24830 10044 10289 gene locus_tag LOCUS_24840 10044 10289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24840 10301 10498 gene locus_tag LOCUS_24850 10301 10498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24850 >Feature sequence122 356 135 gene locus_tag LOCUS_24860 356 135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24860 1260 379 gene locus_tag LOCUS_24870 1260 379 CDS product aldolase/citrate lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870112.1 protein_id gnl|my_center|LOCUS_24870 1852 1262 gene locus_tag LOCUS_24880 1852 1262 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249435.1 protein_id gnl|my_center|LOCUS_24880 2773 1880 gene locus_tag LOCUS_24890 gene sucD 2773 1880 CDS product succinate--CoA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083774550.1 protein_id gnl|my_center|LOCUS_24890 3984 2800 gene locus_tag LOCUS_24900 gene sucC 3984 2800 CDS product ADP-forming succinate--CoA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869705.1 protein_id gnl|my_center|LOCUS_24900 5407 3971 gene locus_tag LOCUS_24910 5407 3971 CDS product MmgE/PrpD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083638.1 protein_id gnl|my_center|LOCUS_24910 5765 6415 gene locus_tag LOCUS_24920 5765 6415 CDS product redox-sensing transcriptional repressor Rex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938215.1 protein_id gnl|my_center|LOCUS_24920 6438 6893 gene locus_tag LOCUS_24930 gene rnhA 6438 6893 CDS product ribonuclease HI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532769.1 protein_id gnl|my_center|LOCUS_24930 7240 7827 gene locus_tag LOCUS_24940 7240 7827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24940 7884 7959 gene locus_tag LOCUS_t00330 7884 7959 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 8485 8291 gene locus_tag LOCUS_24950 8485 8291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24950 9054 8842 gene locus_tag LOCUS_24960 9054 8842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24960 9440 9051 gene locus_tag LOCUS_24970 9440 9051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24970 >Feature sequence123 153 848 gene locus_tag LOCUS_24980 153 848 CDS product WbqC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390554.1 protein_id gnl|my_center|LOCUS_24980 860 1915 gene locus_tag LOCUS_24990 860 1915 CDS product KamA family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942398.1 protein_id gnl|my_center|LOCUS_24990 2129 3736 gene locus_tag LOCUS_25000 2129 3736 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938822.1 protein_id gnl|my_center|LOCUS_25000 3921 5132 gene locus_tag LOCUS_25010 3921 5132 CDS product TrpB-like pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583619.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_25010 5119 5337 gene locus_tag LOCUS_25020 5119 5337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_25020 5423 5668 gene locus_tag LOCUS_25030 5423 5668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25030 6418 5699 gene locus_tag LOCUS_25040 6418 5699 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000567984.1 protein_id gnl|my_center|LOCUS_25040 6540 8567 gene locus_tag LOCUS_25050 6540 8567 CDS product thiamine pyrophosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942696.1 protein_id gnl|my_center|LOCUS_25050 8586 9143 gene locus_tag LOCUS_25060 8586 9143 CDS product indolepyruvate oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942695.1 protein_id gnl|my_center|LOCUS_25060 9151 9774 gene locus_tag LOCUS_25070 9151 9774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25070 9850 11160 gene locus_tag LOCUS_25080 9850 11160 CDS product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940462.1 protein_id gnl|my_center|LOCUS_25080 >Feature sequence124 25 3087 gene locus_tag LOCUS_25090 gene fdnG 25 3087 CDS product formate dehydrogenase-N subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021760008.1 transl_except (pos:598..600,aa:Sec) note codon on position 192 is selenocysteine opal codon. protein_id gnl|my_center|LOCUS_25090 3101 3856 gene locus_tag LOCUS_25100 3101 3856 CDS product formate dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937891.1 protein_id gnl|my_center|LOCUS_25100 4115 5059 gene locus_tag LOCUS_25110 4115 5059 CDS product hydrogenase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939207.1 protein_id gnl|my_center|LOCUS_25110 5121 5312 gene locus_tag LOCUS_25120 5121 5312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_25120 5346 6767 gene locus_tag LOCUS_25130 5346 6767 CDS product nickel-dependent hydrogenase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939208.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_25130 6865 10080 gene locus_tag LOCUS_25140 6865 10080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25140 10088 10642 gene locus_tag LOCUS_25150 10088 10642 CDS product HyaD/HybD family hydrogenase maturation endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939209.1 protein_id gnl|my_center|LOCUS_25150 10645 10878 gene locus_tag LOCUS_25160 10645 10878 CDS product HypC/HybG/HupF family hydrogenase formation chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545287.1 protein_id gnl|my_center|LOCUS_25160 >Feature sequence125 511 215 gene locus_tag LOCUS_25170 511 215 CDS product integration host factor subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942168.1 protein_id gnl|my_center|LOCUS_25170 1041 1541 gene locus_tag LOCUS_25180 1041 1541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25180 1538 2860 gene locus_tag LOCUS_25190 1538 2860 CDS product TRAP transporter large permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258192.1 protein_id gnl|my_center|LOCUS_25190 2978 4615 gene locus_tag LOCUS_25200 2978 4615 CDS product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004534776.1 protein_id gnl|my_center|LOCUS_25200 5293 4808 gene locus_tag LOCUS_25210 5293 4808 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087770.1 protein_id gnl|my_center|LOCUS_25210 5482 5781 gene locus_tag LOCUS_25220 5482 5781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25220 5925 7181 gene locus_tag LOCUS_25230 gene larA 5925 7181 CDS product nickel-dependent lactate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438088.1 protein_id gnl|my_center|LOCUS_25230 7516 8310 gene locus_tag LOCUS_25240 7516 8310 CDS product methyltetrahydrofolate cobalamin methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393605.1 protein_id gnl|my_center|LOCUS_25240 8483 8806 gene locus_tag LOCUS_25250 8483 8806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25250 8968 9165 gene locus_tag LOCUS_25260 8968 9165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25260 9137 9991 gene locus_tag LOCUS_25270 9137 9991 CDS product MtaA/CmuA family methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_054938010.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_25270 10032 11108 gene locus_tag LOCUS_25280 10032 11108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25280 >Feature sequence126 556 1863 gene locus_tag LOCUS_25290 gene thiC 556 1863 CDS product phosphomethylpyrimidine synthase ThiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392914.1 protein_id gnl|my_center|LOCUS_25290 1868 2221 gene locus_tag LOCUS_25300 1868 2221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25300 2605 4584 gene locus_tag LOCUS_25310 2605 4584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25310 4577 5242 gene locus_tag LOCUS_25320 4577 5242 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941948.1 protein_id gnl|my_center|LOCUS_25320 5530 6441 gene locus_tag LOCUS_25330 gene mtrH 5530 6441 CDS product tetrahydromethanopterin S-methyltransferase subunit H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876780.1 protein_id gnl|my_center|LOCUS_25330 6611 7666 gene locus_tag LOCUS_25340 6611 7666 CDS product methylcobamide--CoM methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003388243.1 protein_id gnl|my_center|LOCUS_25340 7773 8450 gene locus_tag LOCUS_25350 7773 8450 CDS product corrinoid protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949054.1 protein_id gnl|my_center|LOCUS_25350 8529 10601 gene locus_tag LOCUS_25360 8529 10601 CDS product ASKHA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975924.1 protein_id gnl|my_center|LOCUS_25360 >Feature sequence127 1550 1870 gene locus_tag LOCUS_25370 gene trxA 1550 1870 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000020199.1 protein_id gnl|my_center|LOCUS_25370 1928 3838 gene locus_tag LOCUS_25380 1928 3838 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877962.1 protein_id gnl|my_center|LOCUS_25380 3899 4555 gene locus_tag LOCUS_25390 3899 4555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25390 4638 5135 gene locus_tag LOCUS_25400 4638 5135 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941779.1 protein_id gnl|my_center|LOCUS_25400 5139 5846 gene locus_tag LOCUS_25410 gene cdaS 5139 5846 CDS product sporulation-specific diadenylate cyclase CdaS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001158737.1 protein_id gnl|my_center|LOCUS_25410 5827 6006 gene locus_tag LOCUS_25420 5827 6006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25420 6099 7250 gene locus_tag LOCUS_25430 6099 7250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25430 7284 8324 gene locus_tag LOCUS_25440 7284 8324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25440 8492 9298 gene locus_tag LOCUS_25450 8492 9298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25450 9447 9833 gene locus_tag LOCUS_25460 gene trxA 9447 9833 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027416.1 protein_id gnl|my_center|LOCUS_25460 10703 9921 gene locus_tag LOCUS_25470 10703 9921 CDS product D-2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707005.1 protein_id gnl|my_center|LOCUS_25470 10864 10727 gene locus_tag LOCUS_25480 10864 10727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25480 >Feature sequence128 633 88 gene locus_tag LOCUS_25490 633 88 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25490 1241 786 gene locus_tag LOCUS_25500 1241 786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25500 3067 1334 gene locus_tag LOCUS_25510 3067 1334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25510 6628 3158 gene locus_tag LOCUS_25520 6628 3158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25520 8018 6639 gene locus_tag LOCUS_25530 8018 6639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25530 9577 8015 gene locus_tag LOCUS_25540 9577 8015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25540 10914 9574 gene locus_tag LOCUS_25550 10914 9574 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946753.1 protein_id gnl|my_center|LOCUS_25550 >Feature sequence129 530 1339 gene locus_tag LOCUS_25560 gene glyQ 530 1339 CDS product glycine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939184.1 protein_id gnl|my_center|LOCUS_25560 1416 3497 gene locus_tag LOCUS_25570 gene glyS 1416 3497 CDS product glycine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941242.1 protein_id gnl|my_center|LOCUS_25570 3566 4231 gene locus_tag LOCUS_25580 3566 4231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25580 4244 4939 gene locus_tag LOCUS_25590 4244 4939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25590 4939 5766 gene locus_tag LOCUS_25600 4939 5766 CDS product 1,4-dihydroxy-6-naphthoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941121.1 protein_id gnl|my_center|LOCUS_25600 6007 8046 gene locus_tag LOCUS_25610 6007 8046 CDS product 3-hydroxyacyl-CoA dehydrogenase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978008.1 protein_id gnl|my_center|LOCUS_25610 8629 10350 gene locus_tag LOCUS_25620 8629 10350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25620 >Feature sequence130 958 990 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2503 1277 gene locus_tag LOCUS_25630 2503 1277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25630 3310 2516 gene locus_tag LOCUS_25640 3310 2516 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256968.1 protein_id gnl|my_center|LOCUS_25640 5240 3342 gene locus_tag LOCUS_25650 5240 3342 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256972.1 protein_id gnl|my_center|LOCUS_25650 6064 5288 gene locus_tag LOCUS_25660 6064 5288 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807268.1 protein_id gnl|my_center|LOCUS_25660 7442 6180 gene locus_tag LOCUS_25670 7442 6180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25670 8690 7623 gene locus_tag LOCUS_25680 8690 7623 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005463596.1 protein_id gnl|my_center|LOCUS_25680 9558 8692 gene locus_tag LOCUS_25690 9558 8692 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256971.1 protein_id gnl|my_center|LOCUS_25690 10313 9876 gene locus_tag LOCUS_25700 10313 9876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25700 >Feature sequence131 1231 1491 gene locus_tag LOCUS_25710 1231 1491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25710 1550 2617 gene locus_tag LOCUS_25720 1550 2617 CDS product epoxyqueuosine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064942.1 protein_id gnl|my_center|LOCUS_25720 2893 2705 gene locus_tag LOCUS_25730 2893 2705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25730 3018 4025 gene locus_tag LOCUS_25740 3018 4025 CDS product ornithine cyclodeaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986893.1 protein_id gnl|my_center|LOCUS_25740 4209 5498 gene locus_tag LOCUS_25750 4209 5498 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944012.1 protein_id gnl|my_center|LOCUS_25750 5501 6370 gene locus_tag LOCUS_25760 5501 6370 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942649.1 protein_id gnl|my_center|LOCUS_25760 6367 7338 gene locus_tag LOCUS_25770 6367 7338 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965773.1 protein_id gnl|my_center|LOCUS_25770 7349 8080 gene locus_tag LOCUS_25780 7349 8080 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942651.1 protein_id gnl|my_center|LOCUS_25780 8067 8771 gene locus_tag LOCUS_25790 8067 8771 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_081214215.1 protein_id gnl|my_center|LOCUS_25790 8804 9124 gene locus_tag LOCUS_25800 8804 9124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25800 9420 9199 gene locus_tag LOCUS_25810 9420 9199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25810 10015 10575 gene locus_tag LOCUS_25820 10015 10575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25820 >Feature sequence132 1307 828 gene locus_tag LOCUS_25830 1307 828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25830 2157 1351 gene locus_tag LOCUS_25840 2157 1351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25840 2533 2760 gene locus_tag LOCUS_25850 2533 2760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25850 3325 4002 gene locus_tag LOCUS_25860 3325 4002 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940040.1 protein_id gnl|my_center|LOCUS_25860 4257 6089 gene locus_tag LOCUS_25870 4257 6089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25870 6115 6933 gene locus_tag LOCUS_25880 6115 6933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25880 7063 7281 gene locus_tag LOCUS_25890 7063 7281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25890 7449 7967 gene locus_tag LOCUS_25900 7449 7967 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087770.1 protein_id gnl|my_center|LOCUS_25900 8734 8252 gene locus_tag LOCUS_25910 8734 8252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25910 9308 10213 gene locus_tag LOCUS_25920 9308 10213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25920 >Feature sequence133 364 699 gene locus_tag LOCUS_25930 364 699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25930 1193 894 gene locus_tag LOCUS_25940 1193 894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25940 1744 1466 gene locus_tag LOCUS_25950 1744 1466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25950 2685 1963 gene locus_tag LOCUS_25960 2685 1963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25960 3295 2882 gene locus_tag LOCUS_25970 3295 2882 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_207691809.1 protein_id gnl|my_center|LOCUS_25970 3789 3319 gene locus_tag LOCUS_25980 3789 3319 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546682.1 protein_id gnl|my_center|LOCUS_25980 4240 5274 gene locus_tag LOCUS_25990 4240 5274 CDS product medium chain dehydrogenase/reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001189850.1 protein_id gnl|my_center|LOCUS_25990 5495 5785 gene locus_tag LOCUS_26000 gene groES 5495 5785 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939263.1 protein_id gnl|my_center|LOCUS_26000 5804 7426 gene locus_tag LOCUS_26010 gene groL 5804 7426 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939262.1 protein_id gnl|my_center|LOCUS_26010 7486 7836 gene locus_tag LOCUS_26020 7486 7836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26020 9157 7868 gene locus_tag LOCUS_26030 9157 7868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26030 10410 9145 gene locus_tag LOCUS_26040 10410 9145 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037226281.1 protein_id gnl|my_center|LOCUS_26040 >Feature sequence134 482 1690 gene locus_tag LOCUS_26050 482 1690 CDS product DUF362 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808433.1 protein_id gnl|my_center|LOCUS_26050 2051 1734 gene locus_tag LOCUS_26060 2051 1734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26060 3987 2551 gene locus_tag LOCUS_26070 3987 2551 CDS product pyridoxal-dependent decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258696.1 protein_id gnl|my_center|LOCUS_26070 4180 5379 gene locus_tag LOCUS_26080 4180 5379 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393453.1 protein_id gnl|my_center|LOCUS_26080 5562 5936 gene locus_tag LOCUS_26090 5562 5936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26090 6071 6739 gene locus_tag LOCUS_26100 6071 6739 CDS product nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966804.1 protein_id gnl|my_center|LOCUS_26100 6803 7420 gene locus_tag LOCUS_26110 6803 7420 CDS product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546050.1 protein_id gnl|my_center|LOCUS_26110 8024 7368 gene locus_tag LOCUS_26120 8024 7368 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046463348.1 protein_id gnl|my_center|LOCUS_26120 8812 8024 gene locus_tag LOCUS_26130 8812 8024 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390005.1 protein_id gnl|my_center|LOCUS_26130 10423 8864 gene locus_tag LOCUS_26140 10423 8864 CDS product fatty acid--CoA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001055172.1 protein_id gnl|my_center|LOCUS_26140 >Feature sequence135 739 35 gene locus_tag LOCUS_26150 739 35 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391621.1 protein_id gnl|my_center|LOCUS_26150 2051 918 gene locus_tag LOCUS_26160 2051 918 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259419.1 protein_id gnl|my_center|LOCUS_26160 3252 2062 gene locus_tag LOCUS_26170 3252 2062 CDS product electron transfer flavoprotein subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048235.1 protein_id gnl|my_center|LOCUS_26170 4106 3315 gene locus_tag LOCUS_26180 4106 3315 CDS product electron transfer flavoprotein subunit beta/FixA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048185.1 protein_id gnl|my_center|LOCUS_26180 5347 4160 gene locus_tag LOCUS_26190 5347 4160 CDS product CaiB/BaiF CoA-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048095472.1 protein_id gnl|my_center|LOCUS_26190 5689 6174 gene locus_tag LOCUS_26200 5689 6174 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393684.1 protein_id gnl|my_center|LOCUS_26200 6239 7525 gene locus_tag LOCUS_26210 gene hemL 6239 7525 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392758.1 protein_id gnl|my_center|LOCUS_26210 7636 7854 gene locus_tag LOCUS_26220 7636 7854 CDS product AtpZ/AtpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941004.1 protein_id gnl|my_center|LOCUS_26220 7851 8243 gene locus_tag LOCUS_26230 7851 8243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26230 8247 8933 gene locus_tag LOCUS_26240 8247 8933 CDS product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941002.1 protein_id gnl|my_center|LOCUS_26240 9091 9471 gene locus_tag LOCUS_26250 gene atpE 9091 9471 CDS product ATP synthase F0 subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792634.1 protein_id gnl|my_center|LOCUS_26250 9579 10244 gene locus_tag LOCUS_26260 9579 10244 CDS product redox-sensing transcriptional repressor Rex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938215.1 protein_id gnl|my_center|LOCUS_26260 >Feature sequence136 619 1650 gene locus_tag LOCUS_26270 619 1650 CDS product homocysteine biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940198.1 protein_id gnl|my_center|LOCUS_26270 2655 1723 gene locus_tag LOCUS_26280 2655 1723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26280 3007 2669 gene locus_tag LOCUS_26290 3007 2669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26290 3345 4640 gene locus_tag LOCUS_26300 3345 4640 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583493.1 protein_id gnl|my_center|LOCUS_26300 4722 5525 gene locus_tag LOCUS_26310 gene purN 4722 5525 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583769.1 protein_id gnl|my_center|LOCUS_26310 6053 6499 gene locus_tag LOCUS_26320 6053 6499 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770670.1 protein_id gnl|my_center|LOCUS_26320 6686 9169 gene locus_tag LOCUS_26330 6686 9169 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792370.1 protein_id gnl|my_center|LOCUS_26330 9166 9687 gene locus_tag LOCUS_26340 9166 9687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26340 9672 10283 gene locus_tag LOCUS_26350 9672 10283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26350 >Feature sequence137 23 409 gene locus_tag LOCUS_26360 23 409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26360 420 1091 gene locus_tag LOCUS_26370 420 1091 CDS product methylenetetrahydrofolate reductase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392706.1 protein_id gnl|my_center|LOCUS_26370 1733 2026 gene locus_tag LOCUS_26380 1733 2026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26380 2028 3968 gene locus_tag LOCUS_26390 2028 3968 CDS product aldehyde ferredoxin oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391701.1 protein_id gnl|my_center|LOCUS_26390 4086 4583 gene locus_tag LOCUS_26400 4086 4583 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392242.1 protein_id gnl|my_center|LOCUS_26400 4952 6382 gene locus_tag LOCUS_26410 gene eutA 4952 6382 CDS product ethanolamine ammonia-lyase reactivating factor EutA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861388.1 protein_id gnl|my_center|LOCUS_26410 7287 6430 gene locus_tag LOCUS_26420 7287 6430 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836413.1 protein_id gnl|my_center|LOCUS_26420 8794 7373 gene locus_tag LOCUS_26430 8794 7373 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939857.1 protein_id gnl|my_center|LOCUS_26430 9449 8772 gene locus_tag LOCUS_26440 9449 8772 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390663.1 protein_id gnl|my_center|LOCUS_26440 <10623 9430 gene locus_tag LOCUS_26450 <10623 9430 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_235045002.1:PAS domain S-box protein >Feature sequence138 2670 2984 gene locus_tag LOCUS_26460 2670 2984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26460 2985 4013 gene locus_tag LOCUS_26470 2985 4013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26470 4133 6043 gene locus_tag LOCUS_26480 gene dnaK 4133 6043 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582444.1 protein_id gnl|my_center|LOCUS_26480 6043 6306 gene locus_tag LOCUS_26490 6043 6306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26490 6730 8775 gene locus_tag LOCUS_26500 6730 8775 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000517762.1 protein_id gnl|my_center|LOCUS_26500 9050 10399 gene locus_tag LOCUS_26510 9050 10399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26510 >Feature sequence139 1119 211 gene locus_tag LOCUS_26520 gene fabK 1119 211 CDS product enoyl-[acyl-carrier-protein] reductase FabK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966839.1 protein_id gnl|my_center|LOCUS_26520 2349 1249 gene locus_tag LOCUS_26530 2349 1249 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878191.1 protein_id gnl|my_center|LOCUS_26530 2926 2483 gene locus_tag LOCUS_26540 2926 2483 CDS product oxidation-sensing regulator MosR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405595.1 protein_id gnl|my_center|LOCUS_26540 3098 2928 gene locus_tag LOCUS_26550 3098 2928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26550 3456 4115 gene locus_tag LOCUS_26560 3456 4115 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878079.1 protein_id gnl|my_center|LOCUS_26560 4127 4375 gene locus_tag LOCUS_26570 4127 4375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26570 4582 6333 gene locus_tag LOCUS_26580 4582 6333 CDS product chloride channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189745032.1 protein_id gnl|my_center|LOCUS_26580 8258 6339 gene locus_tag LOCUS_26590 gene metG 8258 6339 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939333.1 protein_id gnl|my_center|LOCUS_26590 9258 8395 gene locus_tag LOCUS_26600 9258 8395 CDS product stage 0 sporulation family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942871.1 protein_id gnl|my_center|LOCUS_26600 10415 9387 gene locus_tag LOCUS_26610 gene holB 10415 9387 CDS product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942870.1 protein_id gnl|my_center|LOCUS_26610 >Feature sequence140 257 988 gene locus_tag LOCUS_26620 257 988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26620 1761 1012 gene locus_tag LOCUS_26630 1761 1012 CDS product YkgJ family cysteine cluster protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545667.1 protein_id gnl|my_center|LOCUS_26630 1652 1906 gene locus_tag LOCUS_26640 1652 1906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26640 2023 2727 gene locus_tag LOCUS_26650 gene rnc 2023 2727 CDS product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989817.1 protein_id gnl|my_center|LOCUS_26650 2943 3860 gene locus_tag LOCUS_26660 2943 3860 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942867.1 protein_id gnl|my_center|LOCUS_26660 3857 4741 gene locus_tag LOCUS_26670 gene era 3857 4741 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193360270.1 protein_id gnl|my_center|LOCUS_26670 4923 5201 gene locus_tag LOCUS_26680 4923 5201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26680 7051 5678 gene locus_tag LOCUS_26690 7051 5678 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940478.1 protein_id gnl|my_center|LOCUS_26690 8540 7092 gene locus_tag LOCUS_26700 8540 7092 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011791433.1 protein_id gnl|my_center|LOCUS_26700 8769 10043 gene locus_tag LOCUS_26710 8769 10043 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941550.1 protein_id gnl|my_center|LOCUS_26710 >Feature sequence141 <1 1821 gene locus_tag LOCUS_26720 <1 1821 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_except (pos:190..192,aa:Sec) note codon on position 64 is selenocysteine opal codon. note partial CDS similar to WP_080510933.1:formate dehydrogenase subunit alpha 4834 2282 gene locus_tag LOCUS_26730 4834 2282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26730 5427 5969 gene locus_tag LOCUS_26740 5427 5969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26740 6061 7083 gene locus_tag LOCUS_26750 gene dctP 6061 7083 CDS product TRAP transporter substrate-binding protein DctP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967084.1 protein_id gnl|my_center|LOCUS_26750 7213 7809 gene locus_tag LOCUS_26760 7213 7809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26760 7843 9180 gene locus_tag LOCUS_26770 7843 9180 CDS product TRAP transporter large permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970023.1 protein_id gnl|my_center|LOCUS_26770 >Feature sequence142 280 591 gene locus_tag LOCUS_26780 280 591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26780 1986 1033 gene locus_tag LOCUS_26790 1986 1033 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545566.1 protein_id gnl|my_center|LOCUS_26790 3406 2030 gene locus_tag LOCUS_26800 3406 2030 CDS product nucleotide sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963427.1 protein_id gnl|my_center|LOCUS_26800 3847 4164 gene locus_tag LOCUS_26810 3847 4164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26810 4233 4859 gene locus_tag LOCUS_26820 4233 4859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26820 5244 5332 gene locus_tag LOCUS_t00340 5244 5332 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 6518 5448 gene locus_tag LOCUS_26830 6518 5448 CDS product DUF362 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808433.1 protein_id gnl|my_center|LOCUS_26830 7030 6626 gene locus_tag LOCUS_26840 7030 6626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26840 7446 8471 gene locus_tag LOCUS_26850 7446 8471 CDS product zinc-dependent alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164931000.1 protein_id gnl|my_center|LOCUS_26850 8474 8860 gene locus_tag LOCUS_26860 8474 8860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938981.1 protein_id gnl|my_center|LOCUS_26860 9924 8824 gene locus_tag LOCUS_26870 gene mtnA 9924 8824 CDS product S-methyl-5-thioribose-1-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943990.1 protein_id gnl|my_center|LOCUS_26870 8920 8937 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence143 339 1442 gene locus_tag LOCUS_26880 339 1442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26880 3582 1480 gene locus_tag LOCUS_26890 3582 1480 CDS product DUF4139 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404730.1 protein_id gnl|my_center|LOCUS_26890 3810 4154 gene locus_tag LOCUS_26900 3810 4154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26900 4169 4561 gene locus_tag LOCUS_26910 gene queD 4169 4561 CDS product 6-carboxytetrahydropterin synthase QueD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942365.1 protein_id gnl|my_center|LOCUS_26910 4797 5531 gene locus_tag LOCUS_26920 gene kdsB 4797 5531 CDS product 3-deoxy-manno-octulosonate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072444.1 protein_id gnl|my_center|LOCUS_26920 5605 7329 gene locus_tag LOCUS_26930 gene recJ 5605 7329 CDS product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943252.1 protein_id gnl|my_center|LOCUS_26930 7808 7326 gene locus_tag LOCUS_26940 7808 7326 CDS product ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879168.1 protein_id gnl|my_center|LOCUS_26940 8868 7924 gene locus_tag LOCUS_26950 gene hflC 8868 7924 CDS product protease modulator HflC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002655940.1 protein_id gnl|my_center|LOCUS_26950 9920 8865 gene locus_tag LOCUS_26960 gene hflK 9920 8865 CDS product FtsH protease activity modulator HflK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678884.1 protein_id gnl|my_center|LOCUS_26960 >Feature sequence144 3 887 gene locus_tag LOCUS_26970 3 887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26970 1145 1357 gene locus_tag LOCUS_26980 1145 1357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26980 1514 1828 gene locus_tag LOCUS_26990 1514 1828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26990 1816 2061 gene locus_tag LOCUS_27000 1816 2061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27000 2267 2509 gene locus_tag LOCUS_27010 2267 2509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27010 2473 4107 gene locus_tag LOCUS_27020 2473 4107 CDS product nucleoside-diphosphate sugar epimerase/dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582947.1 protein_id gnl|my_center|LOCUS_27020 4451 6616 gene locus_tag LOCUS_27030 4451 6616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27030 6688 7524 gene locus_tag LOCUS_27040 6688 7524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27040 7645 8775 gene locus_tag LOCUS_27050 7645 8775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27050 >Feature sequence145 158 2191 gene locus_tag LOCUS_27060 gene fusA 158 2191 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393940.1 protein_id gnl|my_center|LOCUS_27060 3164 2226 gene locus_tag LOCUS_27070 3164 2226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27070 4851 3154 gene locus_tag LOCUS_27080 4851 3154 CDS product ExeA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071510.1 protein_id gnl|my_center|LOCUS_27080 5716 4937 gene locus_tag LOCUS_27090 5716 4937 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729714.1 protein_id gnl|my_center|LOCUS_27090 5957 6958 gene locus_tag LOCUS_27100 gene moaA 5957 6958 CDS product GTP 3',8-cyclase MoaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393625.1 protein_id gnl|my_center|LOCUS_27100 7814 6975 gene locus_tag LOCUS_27110 7814 6975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27110 8353 7835 gene locus_tag LOCUS_27120 8353 7835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27120 >Feature sequence146 264 599 gene locus_tag LOCUS_27130 264 599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27130 609 1502 gene locus_tag LOCUS_27140 609 1502 CDS product cytochrome bc complex cytochrome b subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942293.1 protein_id gnl|my_center|LOCUS_27140 2470 1700 gene locus_tag LOCUS_27150 2470 1700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27150 3681 2491 gene locus_tag LOCUS_27160 3681 2491 CDS product thiolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224501.1 protein_id gnl|my_center|LOCUS_27160 4939 3698 gene locus_tag LOCUS_27170 4939 3698 CDS product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010925892.1 protein_id gnl|my_center|LOCUS_27170 6736 4952 gene locus_tag LOCUS_27180 6736 4952 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004533897.1 protein_id gnl|my_center|LOCUS_27180 8486 7293 gene locus_tag LOCUS_27190 8486 7293 CDS product TRAP transporter large permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172863.1 protein_id gnl|my_center|LOCUS_27190 9014 8490 gene locus_tag LOCUS_27200 9014 8490 CDS product TRAP transporter small permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172862.1 protein_id gnl|my_center|LOCUS_27200 <9828 9069 gene locus_tag LOCUS_27210 <9828 9069 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012870197.1:TRAP transporter substrate-binding protein >Feature sequence147 363 287 gene locus_tag LOCUS_t00350 363 287 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 1162 659 gene locus_tag LOCUS_27220 1162 659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27220 2902 1199 gene locus_tag LOCUS_27230 2902 1199 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940470.1 protein_id gnl|my_center|LOCUS_27230 4554 2998 gene locus_tag LOCUS_27240 gene guaA 4554 2998 CDS product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545424.1 protein_id gnl|my_center|LOCUS_27240 6036 4573 gene locus_tag LOCUS_27250 gene guaB 6036 4573 CDS product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942835.1 protein_id gnl|my_center|LOCUS_27250 7085 6165 gene locus_tag LOCUS_27260 7085 6165 CDS product exopolyphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942386.1 protein_id gnl|my_center|LOCUS_27260 7447 7818 gene locus_tag LOCUS_27270 7447 7818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27270 7876 9153 gene locus_tag LOCUS_27280 gene rsxC 7876 9153 CDS product electron transport complex subunit RsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_144393375.1 protein_id gnl|my_center|LOCUS_27280 >Feature sequence148 281 628 gene locus_tag LOCUS_27290 281 628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27290 615 1004 gene locus_tag LOCUS_27300 615 1004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27300 1001 2296 gene locus_tag LOCUS_27310 1001 2296 CDS product spore maturation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007247215.1 protein_id gnl|my_center|LOCUS_27310 2346 2903 gene locus_tag LOCUS_27320 2346 2903 CDS product YbhB/YbcL family Raf kinase inhibitor-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875912.1 protein_id gnl|my_center|LOCUS_27320 4120 2909 gene locus_tag LOCUS_27330 4120 2909 CDS product 6-phosphofructo-2-kinase/fructose-2,6-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011791484.1 protein_id gnl|my_center|LOCUS_27330 4420 5124 gene locus_tag LOCUS_27340 4420 5124 CDS product Bax inhibitor-1/YccA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939740.1 protein_id gnl|my_center|LOCUS_27340 5215 6150 gene locus_tag LOCUS_27350 5215 6150 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545758.1 protein_id gnl|my_center|LOCUS_27350 6150 6800 gene locus_tag LOCUS_27360 6150 6800 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005772758.1 protein_id gnl|my_center|LOCUS_27360 7866 6826 gene locus_tag LOCUS_27370 gene fbp 7866 6826 CDS product class 1 fructose-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939127.1 protein_id gnl|my_center|LOCUS_27370 8461 7973 gene locus_tag LOCUS_27380 8461 7973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27380 9570 8473 gene locus_tag LOCUS_27390 9570 8473 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001290820.1 protein_id gnl|my_center|LOCUS_27390 >Feature sequence149 936 100 gene locus_tag LOCUS_27400 936 100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27400 1906 1112 gene locus_tag LOCUS_27410 1906 1112 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065531.1 protein_id gnl|my_center|LOCUS_27410 3783 1903 gene locus_tag LOCUS_27420 3783 1903 CDS product RiPP maturation radical SAM C-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084777.1 protein_id gnl|my_center|LOCUS_27420 4635 3790 gene locus_tag LOCUS_27430 4635 3790 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931881.1 protein_id gnl|my_center|LOCUS_27430 4904 4683 gene locus_tag LOCUS_27440 4904 4683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27440 5886 5020 gene locus_tag LOCUS_27450 5886 5020 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392921.1 protein_id gnl|my_center|LOCUS_27450 6737 5883 gene locus_tag LOCUS_27460 6737 5883 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392922.1 protein_id gnl|my_center|LOCUS_27460 7291 6806 gene locus_tag LOCUS_27470 7291 6806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27470 7853 8242 gene locus_tag LOCUS_27480 7853 8242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27480 9192 8263 gene locus_tag LOCUS_27490 9192 8263 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968517.1 protein_id gnl|my_center|LOCUS_27490 >Feature sequence150 1314 1637 gene locus_tag LOCUS_27500 1314 1637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27500 1634 2755 gene locus_tag LOCUS_27510 gene dnaJ 1634 2755 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392123.1 protein_id gnl|my_center|LOCUS_27510 2897 3262 gene locus_tag LOCUS_27520 gene dksA 2897 3262 CDS product RNA polymerase-binding protein DksA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940956.1 protein_id gnl|my_center|LOCUS_27520 3445 6144 gene locus_tag LOCUS_27530 3445 6144 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942226.1 protein_id gnl|my_center|LOCUS_27530 6156 7178 gene locus_tag LOCUS_27540 gene trpS 6156 7178 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583821.1 protein_id gnl|my_center|LOCUS_27540 7313 8068 gene locus_tag LOCUS_27550 7313 8068 CDS product segregation/condensation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942476.1 protein_id gnl|my_center|LOCUS_27550 8052 8708 gene locus_tag LOCUS_27560 gene scpB 8052 8708 CDS product SMC-Scp complex subunit ScpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942475.1 protein_id gnl|my_center|LOCUS_27560 8776 9417 gene locus_tag LOCUS_27570 8776 9417 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392865.1 protein_id gnl|my_center|LOCUS_27570 9610 9684 gene locus_tag LOCUS_t00360 9610 9684 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence151 <1 3245 gene locus_tag LOCUS_27580 <1 3245 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001093846.1:cyclic nucleotide-binding domain-containing protein 3477 6155 gene locus_tag LOCUS_27590 3477 6155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27590 6452 6276 gene locus_tag LOCUS_27600 6452 6276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27600 8410 6488 gene locus_tag LOCUS_27610 8410 6488 CDS product ASKHA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811724.1 protein_id gnl|my_center|LOCUS_27610 9367 8423 gene locus_tag LOCUS_27620 gene trxB 9367 8423 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393897.1 protein_id gnl|my_center|LOCUS_27620 >Feature sequence152 946 1860 gene locus_tag LOCUS_27630 946 1860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27630 3043 1943 gene locus_tag LOCUS_27640 3043 1943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27640 3579 3079 gene locus_tag LOCUS_27650 3579 3079 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062284418.1 protein_id gnl|my_center|LOCUS_27650 5894 3576 gene locus_tag LOCUS_27660 5894 3576 CDS product xanthine dehydrogenase family protein molybdopterin-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987122.1 protein_id gnl|my_center|LOCUS_27660 6857 5907 gene locus_tag LOCUS_27670 6857 5907 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528958.1 protein_id gnl|my_center|LOCUS_27670 7915 6854 gene locus_tag LOCUS_27680 7915 6854 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528957.1 protein_id gnl|my_center|LOCUS_27680 9431 7908 gene locus_tag LOCUS_27690 9431 7908 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010865052.1 protein_id gnl|my_center|LOCUS_27690 >Feature sequence153 1159 176 gene locus_tag LOCUS_27700 1159 176 CDS product BMP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528955.1 protein_id gnl|my_center|LOCUS_27700 2554 1343 gene locus_tag LOCUS_27710 2554 1343 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090011.1 protein_id gnl|my_center|LOCUS_27710 2744 2568 gene locus_tag LOCUS_27720 2744 2568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27720 3624 2752 gene locus_tag LOCUS_27730 3624 2752 CDS product cyclase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869167.1 protein_id gnl|my_center|LOCUS_27730 4886 3639 gene locus_tag LOCUS_27740 4886 3639 CDS product DUF1116 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393611.1 protein_id gnl|my_center|LOCUS_27740 5078 4899 gene locus_tag LOCUS_27750 5078 4899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27750 6633 5080 gene locus_tag LOCUS_27760 gene fdrA 6633 5080 CDS product acyl-CoA synthetase FdrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000111846.1 protein_id gnl|my_center|LOCUS_27760 7579 6710 gene locus_tag LOCUS_27770 7579 6710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27770 8088 7681 gene locus_tag LOCUS_27780 8088 7681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27780 <9439 8501 gene locus_tag LOCUS_27790 <9439 8501 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013228885.1:long-chain fatty acid--CoA ligase >Feature sequence154 95 2731 gene locus_tag LOCUS_27800 95 2731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27800 2835 4448 gene locus_tag LOCUS_27810 2835 4448 CDS product ASKHA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877524.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_27810 4418 4693 gene locus_tag LOCUS_27820 4418 4693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27820 4677 6077 gene locus_tag LOCUS_27830 4677 6077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27830 6222 7064 gene locus_tag LOCUS_27840 6222 7064 CDS product crotonase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088350.1 protein_id gnl|my_center|LOCUS_27840 7196 7933 gene locus_tag LOCUS_27850 7196 7933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27850 8319 7999 gene locus_tag LOCUS_27860 gene mazF9 8319 7999 CDS product type II toxin-antitoxin system toxin endoribonuclease MazF9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414166.1 protein_id gnl|my_center|LOCUS_27860 8536 8306 gene locus_tag LOCUS_27870 8536 8306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27870 >Feature sequence155 1423 110 gene locus_tag LOCUS_27880 1423 110 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682344.1 protein_id gnl|my_center|LOCUS_27880 1984 2571 gene locus_tag LOCUS_27890 1984 2571 CDS product HDIG domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943410.1 protein_id gnl|my_center|LOCUS_27890 2673 3674 gene locus_tag LOCUS_27900 2673 3674 CDS product D-cysteine desulfhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001046594.1 protein_id gnl|my_center|LOCUS_27900 3836 6127 gene locus_tag LOCUS_27910 3836 6127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27910 6364 7179 gene locus_tag LOCUS_27920 6364 7179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27920 7820 7167 gene locus_tag LOCUS_27930 7820 7167 CDS product HAD-IA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193360256.1 protein_id gnl|my_center|LOCUS_27930 8149 7877 gene locus_tag LOCUS_27940 8149 7877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27940 8858 8217 gene locus_tag LOCUS_27950 8858 8217 CDS product acyloxyacyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944026.1 protein_id gnl|my_center|LOCUS_27950 8867 8884 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence156 326 1012 gene locus_tag LOCUS_27960 326 1012 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938382.1 protein_id gnl|my_center|LOCUS_27960 1328 2794 gene locus_tag LOCUS_27970 1328 2794 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722633.1 protein_id gnl|my_center|LOCUS_27970 2970 2821 gene locus_tag LOCUS_27980 2970 2821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27980 3031 3183 gene locus_tag LOCUS_27990 3031 3183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27990 3699 5000 gene locus_tag LOCUS_28000 3699 5000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28000 5245 6063 gene locus_tag LOCUS_28010 5245 6063 CDS product phosphate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868851.1 protein_id gnl|my_center|LOCUS_28010 6368 7279 gene locus_tag LOCUS_28020 gene pstC 6368 7279 CDS product phosphate ABC transporter permease subunit PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011791822.1 protein_id gnl|my_center|LOCUS_28020 7387 8205 gene locus_tag LOCUS_28030 gene pstA 7387 8205 CDS product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939749.1 protein_id gnl|my_center|LOCUS_28030 8303 9064 gene locus_tag LOCUS_28040 gene pstB 8303 9064 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938383.1 protein_id gnl|my_center|LOCUS_28040 >Feature sequence157 1191 337 gene locus_tag LOCUS_28050 1191 337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28050 3114 1192 gene locus_tag LOCUS_28060 3114 1192 CDS product heterodisulfide reductase-related iron-sulfur binding cluster inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257680.1 protein_id gnl|my_center|LOCUS_28060 3943 3119 gene locus_tag LOCUS_28070 3943 3119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28070 5095 4034 gene locus_tag LOCUS_28080 5095 4034 CDS product electron transfer flavoprotein subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048235.1 protein_id gnl|my_center|LOCUS_28080 7279 5321 gene locus_tag LOCUS_28090 gene dgcA 7279 5321 CDS product dimethylglycine demethylation protein DgcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114446.1 protein_id gnl|my_center|LOCUS_28090 9102 7276 gene locus_tag LOCUS_28100 9102 7276 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114537.1 protein_id gnl|my_center|LOCUS_28100 >Feature sequence158 1764 1351 gene locus_tag LOCUS_28110 1764 1351 CDS product PIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679685.1 protein_id gnl|my_center|LOCUS_28110 2011 1751 gene locus_tag LOCUS_28120 2011 1751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28120 3721 2402 gene locus_tag LOCUS_28130 3721 2402 CDS product DUF362 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272661.1 protein_id gnl|my_center|LOCUS_28130 4515 3748 gene locus_tag LOCUS_28140 4515 3748 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804111.1 protein_id gnl|my_center|LOCUS_28140 5379 4738 gene locus_tag LOCUS_28150 5379 4738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28150 7193 6081 gene locus_tag LOCUS_28160 7193 6081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28160 7482 8771 gene locus_tag LOCUS_28170 gene hisD 7482 8771 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728086.1 protein_id gnl|my_center|LOCUS_28170 >Feature sequence159 375 899 gene locus_tag LOCUS_28180 375 899 CDS product HNH endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583256.1 protein_id gnl|my_center|LOCUS_28180 1350 931 gene locus_tag LOCUS_28190 1350 931 CDS product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259444.1 protein_id gnl|my_center|LOCUS_28190 1768 1466 gene locus_tag LOCUS_28200 1768 1466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28200 2862 1816 gene locus_tag LOCUS_28210 2862 1816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28210 3761 2859 gene locus_tag LOCUS_28220 3761 2859 CDS product NDP-sugar synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143692.1 protein_id gnl|my_center|LOCUS_28220 4058 5134 gene locus_tag LOCUS_28230 4058 5134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28230 6423 5149 gene locus_tag LOCUS_28240 6423 5149 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392350.1 protein_id gnl|my_center|LOCUS_28240 7170 6433 gene locus_tag LOCUS_28250 7170 6433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28250 7772 7167 gene locus_tag LOCUS_28260 7772 7167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28260 8807 7854 gene locus_tag LOCUS_28270 8807 7854 CDS product integron integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035598.1 protein_id gnl|my_center|LOCUS_28270 >Feature sequence160 775 1293 gene locus_tag LOCUS_28280 775 1293 CDS product DJ-1/PfpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000981419.1 protein_id gnl|my_center|LOCUS_28280 1381 1599 gene locus_tag LOCUS_28290 1381 1599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28290 1530 1549 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3560 1722 gene locus_tag LOCUS_28300 3560 1722 CDS product TRAP transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878489.1 protein_id gnl|my_center|LOCUS_28300 4902 3823 gene locus_tag LOCUS_28310 4902 3823 CDS product TAXI family TRAP transporter solute-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878488.1 protein_id gnl|my_center|LOCUS_28310 6125 5406 gene locus_tag LOCUS_28320 6125 5406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28320 7936 6140 gene locus_tag LOCUS_28330 gene sdhA 7936 6140 CDS product succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776149.1 protein_id gnl|my_center|LOCUS_28330 8761 7961 gene locus_tag LOCUS_28340 8761 7961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28340 >Feature sequence161 635 255 gene locus_tag LOCUS_28350 635 255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28350 2539 1247 gene locus_tag LOCUS_28360 2539 1247 CDS product ATP-dependent 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000448293.1 protein_id gnl|my_center|LOCUS_28360 3230 4228 gene locus_tag LOCUS_28370 3230 4228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28370 4327 5256 gene locus_tag LOCUS_28380 4327 5256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28380 5852 5292 gene locus_tag LOCUS_28390 5852 5292 CDS product archaemetzincin family Zn-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584147.1 protein_id gnl|my_center|LOCUS_28390 7224 5875 gene locus_tag LOCUS_28400 7224 5875 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943546.1 protein_id gnl|my_center|LOCUS_28400 8914 7355 gene locus_tag LOCUS_28410 8914 7355 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939667.1 protein_id gnl|my_center|LOCUS_28410 >Feature sequence162 1544 699 gene locus_tag LOCUS_28420 1544 699 CDS product ARMT1-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582978.1 protein_id gnl|my_center|LOCUS_28420 1855 1556 gene locus_tag LOCUS_28430 1855 1556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28430 2115 1954 gene locus_tag LOCUS_28440 2115 1954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28440 3025 2165 gene locus_tag LOCUS_28450 3025 2165 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392921.1 protein_id gnl|my_center|LOCUS_28450 3877 3041 gene locus_tag LOCUS_28460 3877 3041 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392922.1 protein_id gnl|my_center|LOCUS_28460 4402 3947 gene locus_tag LOCUS_28470 4402 3947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28470 5766 4534 gene locus_tag LOCUS_28480 5766 4534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28480 6429 5833 gene locus_tag LOCUS_28490 6429 5833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28490 6936 6568 gene locus_tag LOCUS_28500 6936 6568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28500 8519 7134 gene locus_tag LOCUS_28510 gene orpR 8519 7134 CDS product sigma 54-interacting transcriptional regulator OrpR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939383.1 protein_id gnl|my_center|LOCUS_28510 >Feature sequence163 271 441 gene locus_tag LOCUS_28520 271 441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28520 526 657 gene locus_tag LOCUS_28530 526 657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28530 805 1398 gene locus_tag LOCUS_28540 805 1398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28540 1376 1756 gene locus_tag LOCUS_28550 1376 1756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28550 1788 1970 gene locus_tag LOCUS_28560 1788 1970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28560 2412 2050 gene locus_tag LOCUS_28570 2412 2050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28570 2951 2448 gene locus_tag LOCUS_28580 2951 2448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28580 3297 3605 gene locus_tag LOCUS_28590 3297 3605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28590 3671 5548 gene locus_tag LOCUS_28600 gene aor 3671 5548 CDS product aldehyde ferredoxin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868080.1 protein_id gnl|my_center|LOCUS_28600 5587 7281 gene locus_tag LOCUS_28610 5587 7281 CDS product long-chain-fatty-acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000414744.1 protein_id gnl|my_center|LOCUS_28610 7347 7643 gene locus_tag LOCUS_28620 7347 7643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28620 7648 7845 gene locus_tag LOCUS_28630 7648 7845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28630 7924 8058 gene locus_tag LOCUS_28640 7924 8058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28640 >Feature sequence164 461 976 gene locus_tag LOCUS_28650 461 976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28650 2310 1045 gene locus_tag LOCUS_28660 2310 1045 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944609.1 protein_id gnl|my_center|LOCUS_28660 3464 2400 gene locus_tag LOCUS_28670 3464 2400 CDS product phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267697.1 protein_id gnl|my_center|LOCUS_28670 3645 3475 gene locus_tag LOCUS_28680 3645 3475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28680 4911 3703 gene locus_tag LOCUS_28690 4911 3703 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225003.1 protein_id gnl|my_center|LOCUS_28690 5121 5903 gene locus_tag LOCUS_28700 5121 5903 CDS product electron transfer flavoprotein subunit beta/FixA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390825.1 protein_id gnl|my_center|LOCUS_28700 5913 6902 gene locus_tag LOCUS_28710 5913 6902 CDS product electron transfer flavoprotein subunit alpha/FixB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000072965.1 protein_id gnl|my_center|LOCUS_28710 7431 8498 gene locus_tag LOCUS_28720 7431 8498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28720 >Feature sequence165 2550 730 gene locus_tag LOCUS_28730 2550 730 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_072773675.1 protein_id gnl|my_center|LOCUS_28730 3790 2579 gene locus_tag LOCUS_28740 3790 2579 CDS product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878528.1 protein_id gnl|my_center|LOCUS_28740 5981 3852 gene locus_tag LOCUS_28750 5981 3852 CDS product 3-hydroxyacyl-CoA dehydrogenase NAD-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480226.1 protein_id gnl|my_center|LOCUS_28750 7679 6012 gene locus_tag LOCUS_28760 7679 6012 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228698.1 protein_id gnl|my_center|LOCUS_28760 8027 8743 gene locus_tag LOCUS_28770 8027 8743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28770 >Feature sequence166 908 96 gene locus_tag LOCUS_28780 908 96 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_28780 2582 909 gene locus_tag LOCUS_28790 2582 909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_28790 3249 2587 gene locus_tag LOCUS_28800 3249 2587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_28800 5208 3526 gene locus_tag LOCUS_28810 5208 3526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_28810 6742 5201 gene locus_tag LOCUS_28820 6742 5201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_except (pos:complement(6575..6577),aa:Sec) note codon on position 56 is selenocysteine opal codon. protein_id gnl|my_center|LOCUS_28820 7895 6774 gene locus_tag LOCUS_28830 7895 6774 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066036.1 protein_id gnl|my_center|LOCUS_28830 8099 7926 gene locus_tag LOCUS_28840 8099 7926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_28840 8310 8107 gene locus_tag LOCUS_28850 8310 8107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_28850 >Feature sequence167 850 488 gene locus_tag LOCUS_28860 850 488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28860 1480 899 gene locus_tag LOCUS_28870 1480 899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28870 2085 1393 gene locus_tag LOCUS_28880 2085 1393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_28880 3223 2120 gene locus_tag LOCUS_28890 3223 2120 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066036.1 protein_id gnl|my_center|LOCUS_28890 4603 3224 gene locus_tag LOCUS_28900 gene glcD 4603 3224 CDS product glycolate oxidase subunit GlcD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398865.1 protein_id gnl|my_center|LOCUS_28900 4973 4626 gene locus_tag LOCUS_28910 4973 4626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28910 5130 5789 gene locus_tag LOCUS_28920 5130 5789 CDS product aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251082.1 protein_id gnl|my_center|LOCUS_28920 5970 6476 gene locus_tag LOCUS_28930 5970 6476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28930 7777 6599 gene locus_tag LOCUS_28940 7777 6599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28940 8067 8621 gene locus_tag LOCUS_28950 8067 8621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28950 >Feature sequence168 249 173 gene locus_tag LOCUS_t00370 249 173 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 471 395 gene locus_tag LOCUS_t00380 471 395 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 838 754 gene locus_tag LOCUS_t00390 838 754 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 946 871 gene locus_tag LOCUS_t00400 946 871 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 1487 1765 gene locus_tag LOCUS_28960 1487 1765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28960 2273 1851 gene locus_tag LOCUS_28970 gene ndk 2273 1851 CDS product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545240.1 protein_id gnl|my_center|LOCUS_28970 2426 3202 gene locus_tag LOCUS_28980 2426 3202 CDS product YkgJ family cysteine cluster protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932553.1 protein_id gnl|my_center|LOCUS_28980 3199 3972 gene locus_tag LOCUS_28990 3199 3972 CDS product YkgJ family cysteine cluster protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932553.1 protein_id gnl|my_center|LOCUS_28990 4639 6309 gene locus_tag LOCUS_29000 4639 6309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29000 6299 8377 gene locus_tag LOCUS_29010 6299 8377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_29010 >Feature sequence169 147 404 gene locus_tag LOCUS_29020 147 404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_29020 720 1565 gene locus_tag LOCUS_29030 gene kdsA 720 1565 CDS product 3-deoxy-8-phosphooctulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942539.1 protein_id gnl|my_center|LOCUS_29030 1796 2317 gene locus_tag LOCUS_29040 1796 2317 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003413390.1 protein_id gnl|my_center|LOCUS_29040 2384 2911 gene locus_tag LOCUS_29050 2384 2911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29050 2908 3474 gene locus_tag LOCUS_29060 2908 3474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29060 3458 4192 gene locus_tag LOCUS_29070 gene lptB 3458 4192 CDS product LPS export ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938918.1 protein_id gnl|my_center|LOCUS_29070 4488 5936 gene locus_tag LOCUS_29080 gene rpoN 4488 5936 CDS product RNA polymerase factor sigma-54 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942532.1 protein_id gnl|my_center|LOCUS_29080 5972 6487 gene locus_tag LOCUS_29090 gene raiA 5972 6487 CDS product ribosome-associated translation inhibitor RaiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546709.1 protein_id gnl|my_center|LOCUS_29090 6705 7166 gene locus_tag LOCUS_29100 6705 7166 CDS product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938921.1 protein_id gnl|my_center|LOCUS_29100 7219 7620 gene locus_tag LOCUS_29110 7219 7620 CDS product PTS sugar transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942528.1 protein_id gnl|my_center|LOCUS_29110 7830 8072 gene locus_tag LOCUS_29120 7830 8072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29120 >Feature sequence170 2229 268 gene locus_tag LOCUS_29130 2229 268 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877962.1 protein_id gnl|my_center|LOCUS_29130 3451 2243 gene locus_tag LOCUS_29140 3451 2243 CDS product thiolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392774.1 protein_id gnl|my_center|LOCUS_29140 4358 3510 gene locus_tag LOCUS_29150 4358 3510 CDS product citryl-CoA lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930317.1 protein_id gnl|my_center|LOCUS_29150 5614 4487 gene locus_tag LOCUS_29160 5614 4487 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546471.1 protein_id gnl|my_center|LOCUS_29160 6769 5693 gene locus_tag LOCUS_29170 6769 5693 CDS product DUF362 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272661.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_29170 7775 6912 gene locus_tag LOCUS_29180 gene couO 7775 6912 CDS product 4-hydroxyphenyl-beta-ketoacyl-CoA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225127.1 protein_id gnl|my_center|LOCUS_29180 8179 7772 gene locus_tag LOCUS_29190 8179 7772 CDS product cobalamin B12-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255952.1 protein_id gnl|my_center|LOCUS_29190 >Feature sequence171 884 150 gene locus_tag LOCUS_29200 884 150 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062387006.1 protein_id gnl|my_center|LOCUS_29200 1873 881 gene locus_tag LOCUS_29210 1873 881 CDS product daunorubicin resistance protein DrrA family ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021606.1 protein_id gnl|my_center|LOCUS_29210 2322 1849 gene locus_tag LOCUS_29220 2322 1849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29220 2610 3314 gene locus_tag LOCUS_29230 2610 3314 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004523242.1 protein_id gnl|my_center|LOCUS_29230 3307 4497 gene locus_tag LOCUS_29240 3307 4497 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261735.1 protein_id gnl|my_center|LOCUS_29240 4606 5337 gene locus_tag LOCUS_29250 4606 5337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29250 5334 6650 gene locus_tag LOCUS_29260 5334 6650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29260 7007 6780 gene locus_tag LOCUS_29270 7007 6780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29270 7464 8168 gene locus_tag LOCUS_29280 7464 8168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29280 >Feature sequence172 1033 584 gene locus_tag LOCUS_29290 1033 584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_29290 1689 1030 gene locus_tag LOCUS_29300 gene radC 1689 1030 CDS product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769555.1 protein_id gnl|my_center|LOCUS_29300 2299 1988 gene locus_tag LOCUS_29310 2299 1988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29310 2685 2984 gene locus_tag LOCUS_29320 2685 2984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29320 4416 3028 gene locus_tag LOCUS_29330 4416 3028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29330 6890 4761 gene locus_tag LOCUS_29340 6890 4761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29340 7108 6887 gene locus_tag LOCUS_29350 7108 6887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29350 <8234 7178 gene locus_tag LOCUS_29360 <8234 7178 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011028831.1:anthranilate phosphoribosyltransferase >Feature sequence173 133 441 gene locus_tag LOCUS_29370 133 441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29370 1150 422 gene locus_tag LOCUS_29380 1150 422 CDS product tRNA1(Val) (adenine(37)-N6)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_087456344.1 protein_id gnl|my_center|LOCUS_29380 2483 1128 gene locus_tag LOCUS_29390 2483 1128 CDS product DUF1015 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921547.1 protein_id gnl|my_center|LOCUS_29390 2966 2748 gene locus_tag LOCUS_29400 2966 2748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29400 2853 4154 gene locus_tag LOCUS_29410 2853 4154 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392478.1 protein_id gnl|my_center|LOCUS_29410 4720 4211 gene locus_tag LOCUS_29420 4720 4211 CDS product TIGR00725 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022480.1 protein_id gnl|my_center|LOCUS_29420 4853 6229 gene locus_tag LOCUS_29430 4853 6229 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939137.1 protein_id gnl|my_center|LOCUS_29430 6767 6204 gene locus_tag LOCUS_29440 gene orn 6767 6204 CDS product oligoribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770781.1 protein_id gnl|my_center|LOCUS_29440 7137 6925 gene locus_tag LOCUS_29450 7137 6925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29450 7317 7997 gene locus_tag LOCUS_29460 7317 7997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29460 >Feature sequence174 351 1 gene locus_tag LOCUS_29470 351 1 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29470 1934 408 gene locus_tag LOCUS_29480 1934 408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29480 2366 2070 gene locus_tag LOCUS_29490 2366 2070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29490 2778 2984 gene locus_tag LOCUS_29500 2778 2984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29500 2974 3393 gene locus_tag LOCUS_29510 2974 3393 CDS product PIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142893.1 protein_id gnl|my_center|LOCUS_29510 4739 3405 gene locus_tag LOCUS_29520 gene orpR 4739 3405 CDS product sigma 54-interacting transcriptional regulator OrpR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939383.1 protein_id gnl|my_center|LOCUS_29520 4999 4850 gene locus_tag LOCUS_29530 4999 4850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29530 5503 5012 gene locus_tag LOCUS_29540 5503 5012 CDS product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061181.1 protein_id gnl|my_center|LOCUS_29540 6067 5711 gene locus_tag LOCUS_29550 6067 5711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29550 6567 6073 gene locus_tag LOCUS_29560 6567 6073 CDS product DoxX family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941174.1 protein_id gnl|my_center|LOCUS_29560 7561 6560 gene locus_tag LOCUS_29570 7561 6560 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048053764.1 protein_id gnl|my_center|LOCUS_29570 8016 7564 gene locus_tag LOCUS_29580 8016 7564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29580 >Feature sequence175 823 608 gene locus_tag LOCUS_29590 823 608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29590 1357 923 gene locus_tag LOCUS_29600 1357 923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_29600 1541 2038 gene locus_tag LOCUS_29610 1541 2038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29610 2079 3344 gene locus_tag LOCUS_29620 2079 3344 CDS product DNA repair exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389026.1 protein_id gnl|my_center|LOCUS_29620 3341 6865 gene locus_tag LOCUS_29630 3341 6865 CDS product YhaN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922355.1 protein_id gnl|my_center|LOCUS_29630 6961 7836 gene locus_tag LOCUS_29640 6961 7836 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918244.1 protein_id gnl|my_center|LOCUS_29640 >Feature sequence176 1531 497 gene locus_tag LOCUS_29650 1531 497 CDS product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546283.1 protein_id gnl|my_center|LOCUS_29650 3052 1733 gene locus_tag LOCUS_29660 3052 1733 CDS product phenylacetate--CoA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023751.1 protein_id gnl|my_center|LOCUS_29660 5395 3065 gene locus_tag LOCUS_29670 5395 3065 CDS product xanthine dehydrogenase family protein molybdopterin-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975050.1 protein_id gnl|my_center|LOCUS_29670 5903 5388 gene locus_tag LOCUS_29680 5903 5388 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062284418.1 protein_id gnl|my_center|LOCUS_29680 6950 5955 gene locus_tag LOCUS_29690 6950 5955 CDS product xanthine dehydrogenase family protein subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087966.1 protein_id gnl|my_center|LOCUS_29690 <7878 7129 gene locus_tag LOCUS_29700 <7878 7129 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_169351683.1:sigma 54-interacting transcriptional regulator >Feature sequence177 1273 563 gene locus_tag LOCUS_29710 1273 563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29710 1661 1254 gene locus_tag LOCUS_29720 1661 1254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29720 2193 1651 gene locus_tag LOCUS_29730 2193 1651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29730 2630 2190 gene locus_tag LOCUS_29740 gene gspG 2630 2190 CDS product type II secretion system major pseudopilin GspG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196811.1 protein_id gnl|my_center|LOCUS_29740 3871 2642 gene locus_tag LOCUS_29750 3871 2642 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142659.1 protein_id gnl|my_center|LOCUS_29750 5390 3873 gene locus_tag LOCUS_29760 gene gspE 5390 3873 CDS product type II secretion system ATPase GspE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_070691812.1 protein_id gnl|my_center|LOCUS_29760 6417 5458 gene locus_tag LOCUS_29770 6417 5458 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000037020.1 protein_id gnl|my_center|LOCUS_29770 7145 6585 gene locus_tag LOCUS_29780 7145 6585 CDS product UpxY family transcription antiterminator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546650.1 protein_id gnl|my_center|LOCUS_29780 7759 7181 gene locus_tag LOCUS_29790 7759 7181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29790 >Feature sequence178 1855 677 gene locus_tag LOCUS_29800 1855 677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_29800 3593 1773 gene locus_tag LOCUS_29810 3593 1773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_29810 4355 7573 gene locus_tag LOCUS_29820 4355 7573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29820 >Feature sequence179 <1 3114 gene locus_tag LOCUS_29830 <1 3114 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011706758.1:multidrug efflux RND transporter permease subunit 3258 4619 gene locus_tag LOCUS_29840 3258 4619 CDS product efflux transporter outer membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937373.1 protein_id gnl|my_center|LOCUS_29840 4616 5356 gene locus_tag LOCUS_29850 4616 5356 CDS product potassium channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122349.1 protein_id gnl|my_center|LOCUS_29850 5948 6394 gene locus_tag LOCUS_29860 5948 6394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29860 6431 6640 gene locus_tag LOCUS_29870 6431 6640 CDS product rubredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940352.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_29870 6644 6841 gene locus_tag LOCUS_29880 6644 6841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29880 6894 7496 gene locus_tag LOCUS_29890 6894 7496 CDS product rubrerythrin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943440.1 protein_id gnl|my_center|LOCUS_29890 >Feature sequence180 1596 388 gene locus_tag LOCUS_29900 1596 388 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788929.1 protein_id gnl|my_center|LOCUS_29900 1793 2074 gene locus_tag LOCUS_29910 1793 2074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29910 4849 2552 gene locus_tag LOCUS_29920 4849 2552 CDS product amino acid transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879109.1 protein_id gnl|my_center|LOCUS_29920 5468 6259 gene locus_tag LOCUS_29930 5468 6259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29930 7625 6315 gene locus_tag LOCUS_29940 7625 6315 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812135.1 protein_id gnl|my_center|LOCUS_29940 >Feature sequence181 <1 1158 gene locus_tag LOCUS_29950 <1 1158 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010880300.1:glycosyltransferase family 4 protein 1606 1142 gene locus_tag LOCUS_29960 1606 1142 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392135.1 protein_id gnl|my_center|LOCUS_29960 1839 3977 gene locus_tag LOCUS_29970 1839 3977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29970 3964 5277 gene locus_tag LOCUS_29980 3964 5277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29980 6556 5429 gene locus_tag LOCUS_29990 6556 5429 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048395.1 protein_id gnl|my_center|LOCUS_29990 7430 6618 gene locus_tag LOCUS_30000 7430 6618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30000 >Feature sequence182 1334 270 gene locus_tag LOCUS_30010 gene thiL 1334 270 CDS product thiamine-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943812.1 protein_id gnl|my_center|LOCUS_30010 1794 2975 gene locus_tag LOCUS_30020 1794 2975 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938728.1 protein_id gnl|my_center|LOCUS_30020 3273 4439 gene locus_tag LOCUS_30030 3273 4439 CDS product thiolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763169.1 protein_id gnl|my_center|LOCUS_30030 4445 4882 gene locus_tag LOCUS_30040 4445 4882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30040 5037 5720 gene locus_tag LOCUS_30050 5037 5720 CDS product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941114.1 protein_id gnl|my_center|LOCUS_30050 5750 6199 gene locus_tag LOCUS_30060 5750 6199 CDS product PaaI family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403909.1 protein_id gnl|my_center|LOCUS_30060 6260 7408 gene locus_tag LOCUS_30070 6260 7408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30070 >Feature sequence183 1660 719 gene locus_tag LOCUS_30080 1660 719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30080 2579 1701 gene locus_tag LOCUS_30090 2579 1701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30090 5790 2563 gene locus_tag LOCUS_30100 5790 2563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30100 6532 7197 gene locus_tag LOCUS_30110 6532 7197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30110 >Feature sequence184 <1 1194 gene locus_tag LOCUS_30120 <1 1194 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_048064616.1:4-hydroxyphenylacetate 3-hydroxylase family protein 1368 2411 gene locus_tag LOCUS_30130 1368 2411 CDS product methylcobamide--CoM methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003388243.1 protein_id gnl|my_center|LOCUS_30130 1755 1662 gene locus_tag LOCUS_t00410 1755 1662 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 2850 2374 gene locus_tag LOCUS_30140 2850 2374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30140 3736 2945 gene locus_tag LOCUS_30150 3736 2945 CDS product DUF169 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048095636.1 protein_id gnl|my_center|LOCUS_30150 5278 3833 gene locus_tag LOCUS_30160 5278 3833 CDS product 4-hydroxyphenylacetate 3-hydroxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064616.1 protein_id gnl|my_center|LOCUS_30160 6313 5297 gene locus_tag LOCUS_30170 6313 5297 CDS product aliphatic nitrilase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877947.1 protein_id gnl|my_center|LOCUS_30170 >Feature sequence185 156 1244 gene locus_tag LOCUS_30180 156 1244 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330234.1 protein_id gnl|my_center|LOCUS_30180 1295 2206 gene locus_tag LOCUS_30190 1295 2206 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761572.1 protein_id gnl|my_center|LOCUS_30190 2206 3069 gene locus_tag LOCUS_30200 2206 3069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30200 3069 4067 gene locus_tag LOCUS_30210 3069 4067 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107514.1 protein_id gnl|my_center|LOCUS_30210 4258 6261 gene locus_tag LOCUS_30220 4258 6261 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922174.1 protein_id gnl|my_center|LOCUS_30220 >Feature sequence186 151 696 gene locus_tag LOCUS_30230 151 696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_30230 707 2050 gene locus_tag LOCUS_30240 707 2050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_30240 2159 2467 gene locus_tag LOCUS_30250 2159 2467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30250 2547 2849 gene locus_tag LOCUS_30260 2547 2849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30260 2851 3012 gene locus_tag LOCUS_30270 2851 3012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30270 3023 3667 gene locus_tag LOCUS_30280 3023 3667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_30280 3523 3527 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3828 4196 gene locus_tag LOCUS_30290 3828 4196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30290 4309 5625 gene locus_tag LOCUS_30300 4309 5625 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941598.1 transl_except (pos:4870..4872,aa:Sec) note codon on position 188 is selenocysteine opal codon. protein_id gnl|my_center|LOCUS_30300 5776 6195 gene locus_tag LOCUS_30310 5776 6195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30310 >Feature sequence187 1530 40 gene locus_tag LOCUS_30320 1530 40 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30320 2909 1608 gene locus_tag LOCUS_30330 gene cadB 2909 1608 CDS product cadaverine/lysine antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000097429.1 protein_id gnl|my_center|LOCUS_30330 5445 3139 gene locus_tag LOCUS_30340 gene ldcA 5445 3139 CDS product lysine-specific pyridoxal 5'-phosphate-dependent carboxylase LdcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113592.1 protein_id gnl|my_center|LOCUS_30340 6861 5842 gene locus_tag LOCUS_30350 6861 5842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_30350 >Feature sequence188 <1 682 gene locus_tag LOCUS_30360 <1 682 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_064243008.1:iron-containing alcohol dehydrogenase 730 2505 gene locus_tag LOCUS_30370 730 2505 CDS product aldehyde ferredoxin oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_202319085.1 protein_id gnl|my_center|LOCUS_30370 6659 3147 gene locus_tag LOCUS_30380 6659 3147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30380 >Feature sequence189 <1 624 gene locus_tag LOCUS_30390 <1 624 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013532983.1:branched-chain amino acid ABC transporter permease 621 1613 gene locus_tag LOCUS_30400 621 1613 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809683.1 protein_id gnl|my_center|LOCUS_30400 1606 2367 gene locus_tag LOCUS_30410 1606 2367 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938016.1 protein_id gnl|my_center|LOCUS_30410 2360 3064 gene locus_tag LOCUS_30420 2360 3064 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_081214215.1 protein_id gnl|my_center|LOCUS_30420 4071 3592 gene locus_tag LOCUS_30430 4071 3592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_30430 5048 4068 gene locus_tag LOCUS_30440 5048 4068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_30440 5186 5443 gene locus_tag LOCUS_30450 5186 5443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30450 5636 5653 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 5995 6234 gene locus_tag LOCUS_30460 gene tusA 5995 6234 CDS product sulfurtransferase TusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024015099.1 protein_id gnl|my_center|LOCUS_30460 6255 6563 gene locus_tag LOCUS_30470 6255 6563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30470 >Feature sequence190 462 55 gene locus_tag LOCUS_30480 462 55 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30480 481 807 gene locus_tag LOCUS_30490 481 807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30490 4035 841 gene locus_tag LOCUS_30500 4035 841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30500 4423 4698 gene locus_tag LOCUS_30510 4423 4698 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942391.1 protein_id gnl|my_center|LOCUS_30510 4725 5063 gene locus_tag LOCUS_30520 4725 5063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30520 5108 5314 gene locus_tag LOCUS_30530 5108 5314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30530 5497 5327 gene locus_tag LOCUS_30540 5497 5327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30540 6377 5673 gene locus_tag LOCUS_30550 6377 5673 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392690.1 protein_id gnl|my_center|LOCUS_30550 >Feature sequence191 865 1071 gene locus_tag LOCUS_30560 865 1071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30560 1417 2118 gene locus_tag LOCUS_30570 1417 2118 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943910.1 protein_id gnl|my_center|LOCUS_30570 2120 2980 gene locus_tag LOCUS_30580 2120 2980 CDS product deoxyribonuclease IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941197.1 protein_id gnl|my_center|LOCUS_30580 2998 3423 gene locus_tag LOCUS_30590 2998 3423 CDS product DUF1178 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970077.1 protein_id gnl|my_center|LOCUS_30590 3501 4097 gene locus_tag LOCUS_30600 3501 4097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30600 4292 4104 gene locus_tag LOCUS_30610 4292 4104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30610 5192 4296 gene locus_tag LOCUS_30620 gene queG 5192 4296 CDS product tRNA epoxyqueuosine(34) reductase QueG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384813.1 protein_id gnl|my_center|LOCUS_30620 6192 5302 gene locus_tag LOCUS_30630 gene map 6192 5302 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947446.1 protein_id gnl|my_center|LOCUS_30630 >Feature sequence192 107 688 gene locus_tag LOCUS_30640 107 688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30640 799 1656 gene locus_tag LOCUS_30650 799 1656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30650 1846 3768 gene locus_tag LOCUS_30660 1846 3768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30660 4059 4835 gene locus_tag LOCUS_30670 4059 4835 CDS product crotonase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091874.1 protein_id gnl|my_center|LOCUS_30670 5368 4844 gene locus_tag LOCUS_30680 5368 4844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30680 5720 6304 gene locus_tag LOCUS_30690 5720 6304 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000169640.1 protein_id gnl|my_center|LOCUS_30690 >Feature sequence193 318 1007 gene locus_tag LOCUS_30700 318 1007 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272485.1 protein_id gnl|my_center|LOCUS_30700 1008 2786 gene locus_tag LOCUS_30710 gene phoR 1008 2786 CDS product phosphate regulon sensor histidine kinase PhoR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941762.1 protein_id gnl|my_center|LOCUS_30710 3118 3936 gene locus_tag LOCUS_30720 3118 3936 CDS product phosphate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868851.1 protein_id gnl|my_center|LOCUS_30720 4127 4969 gene locus_tag LOCUS_30730 gene pstC 4127 4969 CDS product phosphate ABC transporter permease subunit PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011791822.1 protein_id gnl|my_center|LOCUS_30730 5149 6033 gene locus_tag LOCUS_30740 gene pstA 5149 6033 CDS product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939749.1 protein_id gnl|my_center|LOCUS_30740 >Feature sequence194 380 2137 gene locus_tag LOCUS_30750 380 2137 CDS product sigma 54-interacting transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940093.1 protein_id gnl|my_center|LOCUS_30750 2568 2206 gene locus_tag LOCUS_30760 2568 2206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30760 2815 2549 gene locus_tag LOCUS_30770 2815 2549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30770 3176 3475 gene locus_tag LOCUS_30780 3176 3475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30780 3575 4873 gene locus_tag LOCUS_30790 gene gabT 3575 4873 CDS product 4-aminobutyrate--2-oxoglutarate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964736.1 protein_id gnl|my_center|LOCUS_30790 4933 6198 gene locus_tag LOCUS_30800 4933 6198 CDS product ArgE/DapE family deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063173608.1 protein_id gnl|my_center|LOCUS_30800 >Feature sequence195 253 474 gene locus_tag LOCUS_30810 253 474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30810 611 793 gene locus_tag LOCUS_30820 611 793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30820 1863 1489 gene locus_tag LOCUS_30830 1863 1489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30830 3078 2098 gene locus_tag LOCUS_30840 gene moaA 3078 2098 CDS product GTP 3',8-cyclase MoaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546124.1 protein_id gnl|my_center|LOCUS_30840 3332 3132 gene locus_tag LOCUS_30850 3332 3132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30850 4016 3342 gene locus_tag LOCUS_30860 4016 3342 CDS product P-loop NTPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869576.1 protein_id gnl|my_center|LOCUS_30860 4348 4163 gene locus_tag LOCUS_30870 4348 4163 CDS product ferredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940534.1 protein_id gnl|my_center|LOCUS_30870 5098 4727 gene locus_tag LOCUS_30880 5098 4727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30880 6172 5603 gene locus_tag LOCUS_30890 6172 5603 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249655.1 protein_id gnl|my_center|LOCUS_30890 >Feature sequence196 305 871 gene locus_tag LOCUS_30900 305 871 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002122280.1 protein_id gnl|my_center|LOCUS_30900 1005 1793 gene locus_tag LOCUS_30910 1005 1793 CDS product dihydroorotate dehydrogenase electron transfer subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393618.1 protein_id gnl|my_center|LOCUS_30910 1798 2715 gene locus_tag LOCUS_30920 1798 2715 CDS product dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393617.1 protein_id gnl|my_center|LOCUS_30920 2958 3716 gene locus_tag LOCUS_30930 2958 3716 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022348.1 protein_id gnl|my_center|LOCUS_30930 4777 3794 gene locus_tag LOCUS_30940 4777 3794 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941971.1 protein_id gnl|my_center|LOCUS_30940 <6342 4993 gene locus_tag LOCUS_30950 <6342 4993 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943823.1:30S ribosomal protein S12 methylthiotransferase RimO >Feature sequence197 314 499 gene locus_tag LOCUS_30960 314 499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30960 2372 552 gene locus_tag LOCUS_30970 2372 552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30970 3628 2378 gene locus_tag LOCUS_30980 3628 2378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30980 <6279 3630 gene locus_tag LOCUS_30990 <6279 3630 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_045801381.1:TIGR04283 family arsenosugar biosynthesis glycosyltransferase >Feature sequence198 972 1166 gene locus_tag LOCUS_31000 972 1166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31000 1436 1594 gene locus_tag LOCUS_31010 1436 1594 CDS product DUF5989 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975331.1 protein_id gnl|my_center|LOCUS_31010 1842 3656 gene locus_tag LOCUS_31020 1842 3656 CDS product carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976109.1 protein_id gnl|my_center|LOCUS_31020 3643 4038 gene locus_tag LOCUS_31030 3643 4038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31030 >Feature sequence199 217 843 gene locus_tag LOCUS_31040 217 843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_31040 1586 1146 gene locus_tag LOCUS_31050 1586 1146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31050 3092 1599 gene locus_tag LOCUS_31060 3092 1599 CDS product CoA-acylating methylmalonate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979130.1 protein_id gnl|my_center|LOCUS_31060 3861 3142 gene locus_tag LOCUS_31070 3861 3142 CDS product FadR/GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944007.1 protein_id gnl|my_center|LOCUS_31070 4320 4796 gene locus_tag LOCUS_31080 gene cobO 4320 4796 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392864.1 protein_id gnl|my_center|LOCUS_31080 5943 4810 gene locus_tag LOCUS_31090 5943 4810 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938041.1 protein_id gnl|my_center|LOCUS_31090 >Feature sequence200 982 107 gene locus_tag LOCUS_31100 982 107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31100 1814 1557 gene locus_tag LOCUS_31110 1814 1557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31110 1929 2726 gene locus_tag LOCUS_31120 1929 2726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31120 2816 4231 gene locus_tag LOCUS_31130 2816 4231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31130 4500 4832 gene locus_tag LOCUS_31140 4500 4832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31140 4863 5786 gene locus_tag LOCUS_31150 gene hflK 4863 5786 CDS product FtsH protease activity modulator HflK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678884.1 protein_id gnl|my_center|LOCUS_31150 >Feature sequence201 644 1144 gene locus_tag LOCUS_31160 644 1144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31160 1128 1766 gene locus_tag LOCUS_31170 1128 1766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31170 1781 2335 gene locus_tag LOCUS_31180 1781 2335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31180 2310 2981 gene locus_tag LOCUS_31190 2310 2981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31190 3460 4224 gene locus_tag LOCUS_31200 3460 4224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31200 >Feature sequence202 979 212 gene locus_tag LOCUS_31210 979 212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31210 1416 1054 gene locus_tag LOCUS_31220 1416 1054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_31220 2033 1347 gene locus_tag LOCUS_31230 2033 1347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_31230 2280 2035 gene locus_tag LOCUS_31240 2280 2035 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533122.1 protein_id gnl|my_center|LOCUS_31240 3382 2363 gene locus_tag LOCUS_31250 3382 2363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021064.1 protein_id gnl|my_center|LOCUS_31250 4020 3451 gene locus_tag LOCUS_31260 4020 3451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31260 3982 4131 gene locus_tag LOCUS_31270 3982 4131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31270 5096 4224 gene locus_tag LOCUS_31280 5096 4224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31280 >Feature sequence203 1876 3378 gene locus_tag LOCUS_31290 1876 3378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31290 3392 4174 gene locus_tag LOCUS_31300 3392 4174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31300 <5765 4263 gene locus_tag LOCUS_31310 <5765 4263 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005797373.1:YfhO family protein >Feature sequence204 598 2364 gene locus_tag LOCUS_31320 gene typA 598 2364 CDS product translational GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393394.1 protein_id gnl|my_center|LOCUS_31320 2519 3013 gene locus_tag LOCUS_31330 2519 3013 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258683.1 protein_id gnl|my_center|LOCUS_31330 3057 5318 gene locus_tag LOCUS_31340 3057 5318 CDS product Tex family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202602.1 protein_id gnl|my_center|LOCUS_31340 5744 5451 gene locus_tag LOCUS_31350 5744 5451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31350 >Feature sequence205 404 553 gene locus_tag LOCUS_31360 404 553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31360 831 2120 gene locus_tag LOCUS_31370 gene orpR 831 2120 CDS product sigma 54-interacting transcriptional regulator OrpR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939383.1 protein_id gnl|my_center|LOCUS_31370 2379 3431 gene locus_tag LOCUS_31380 2379 3431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31380 3482 3823 gene locus_tag LOCUS_31390 3482 3823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31390 4229 4408 gene locus_tag LOCUS_31400 4229 4408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31400 >Feature sequence206 1732 413 gene locus_tag LOCUS_31410 1732 413 CDS product phenylacetate--CoA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879167.1 protein_id gnl|my_center|LOCUS_31410 2311 1916 gene locus_tag LOCUS_31420 2311 1916 CDS product cobalamin B12-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846721.1 protein_id gnl|my_center|LOCUS_31420 4155 2395 gene locus_tag LOCUS_31430 4155 2395 CDS product methylmalonyl-CoA mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879704.1 protein_id gnl|my_center|LOCUS_31430 4743 5453 gene locus_tag LOCUS_31440 4743 5453 CDS product FadR/GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393787.1 protein_id gnl|my_center|LOCUS_31440 >Feature sequence207 <1 1677 gene locus_tag LOCUS_31450 <1 1677 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010871138.1:adenosylcobinamide amidohydrolase 1757 2860 gene locus_tag LOCUS_31460 gene cobD 1757 2860 CDS product threonine-phosphate decarboxylase CobD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932619.1 protein_id gnl|my_center|LOCUS_31460 2857 3855 gene locus_tag LOCUS_31470 gene cbiB 2857 3855 CDS product adenosylcobinamide-phosphate synthase CbiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000153666.1 protein_id gnl|my_center|LOCUS_31470 3989 5494 gene locus_tag LOCUS_31480 3989 5494 CDS product cobyric acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932618.1 protein_id gnl|my_center|LOCUS_31480 >Feature sequence208 <1 1603 gene locus_tag LOCUS_31490 <1 1603 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012258557.1:helicase-related protein note possible pseudo, frameshifted 1600 2643 gene locus_tag LOCUS_31500 1600 2643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_31500 3101 3406 gene locus_tag LOCUS_31510 3101 3406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31510 3399 4427 gene locus_tag LOCUS_31520 3399 4427 CDS product nucleotidyl transferase AbiEii/AbiGii toxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013448020.1 protein_id gnl|my_center|LOCUS_31520 >Feature sequence209 284 63 gene locus_tag LOCUS_31530 284 63 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31530 3023 1008 gene locus_tag LOCUS_31540 3023 1008 CDS product putative cobaltochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020921.1 protein_id gnl|my_center|LOCUS_31540 4140 3061 gene locus_tag LOCUS_31550 4140 3061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31550 5291 4152 gene locus_tag LOCUS_31560 5291 4152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31560 >Feature sequence210 597 1559 gene locus_tag LOCUS_31570 597 1559 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957791.1 protein_id gnl|my_center|LOCUS_31570 1755 3095 gene locus_tag LOCUS_31580 1755 3095 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980072.1 protein_id gnl|my_center|LOCUS_31580 4635 3670 gene locus_tag LOCUS_31590 4635 3670 CDS product WYL domain-containing transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582487.1 protein_id gnl|my_center|LOCUS_31590 >Feature sequence211 1550 624 gene locus_tag LOCUS_31600 1550 624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31600 1707 1567 gene locus_tag LOCUS_31610 1707 1567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31610 2240 1713 gene locus_tag LOCUS_31620 2240 1713 CDS product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582959.1 protein_id gnl|my_center|LOCUS_31620 2686 2525 gene locus_tag LOCUS_31630 2686 2525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31630 3338 3138 gene locus_tag LOCUS_31640 3338 3138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31640 3633 3343 gene locus_tag LOCUS_31650 3633 3343 CDS product BrnT family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005772654.1 protein_id gnl|my_center|LOCUS_31650 3785 3630 gene locus_tag LOCUS_31660 3785 3630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31660 4868 3936 gene locus_tag LOCUS_31670 4868 3936 CDS product ISAzo13 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_218132780.1 protein_id gnl|my_center|LOCUS_31670 >Feature sequence212 1284 262 gene locus_tag LOCUS_31680 1284 262 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065845.1 protein_id gnl|my_center|LOCUS_31680 2320 1448 gene locus_tag LOCUS_31690 2320 1448 CDS product iron ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_157860356.1 protein_id gnl|my_center|LOCUS_31690 4698 2503 gene locus_tag LOCUS_31700 4698 2503 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545674.1 protein_id gnl|my_center|LOCUS_31700 >Feature sequence213 <1 786 gene locus_tag LOCUS_31710 <1 786 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011861887.1:sigma 54-interacting transcriptional regulator note possible pseudo, frameshifted 852 1070 gene locus_tag LOCUS_31720 852 1070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_31720 1010 1177 gene locus_tag LOCUS_31730 1010 1177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31730 1438 2592 gene locus_tag LOCUS_31740 1438 2592 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005069932.1 protein_id gnl|my_center|LOCUS_31740 2724 3422 gene locus_tag LOCUS_31750 2724 3422 CDS product 3-hydroxyacyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030215.1 protein_id gnl|my_center|LOCUS_31750 3489 4751 gene locus_tag LOCUS_31760 3489 4751 CDS product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010925892.1 protein_id gnl|my_center|LOCUS_31760 >Feature sequence214 <1 1044 gene locus_tag LOCUS_31770 <1 1044 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015337756.1:response regulator 1101 2246 gene locus_tag LOCUS_31780 1101 2246 CDS product chemotaxis protein CheB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256737.1 protein_id gnl|my_center|LOCUS_31780 2246 3001 gene locus_tag LOCUS_31790 2246 3001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31790 3066 5171 gene locus_tag LOCUS_31800 3066 5171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31800 >Feature sequence215 1210 995 gene locus_tag LOCUS_31810 1210 995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31810 2582 1245 gene locus_tag LOCUS_31820 2582 1245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31820 3706 2744 gene locus_tag LOCUS_31830 3706 2744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31830 4865 3708 gene locus_tag LOCUS_31840 4865 3708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31840 >Feature sequence216 440 673 gene locus_tag LOCUS_31850 440 673 CDS product type II toxin-antitoxin system Phd/YefM family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143788.1 protein_id gnl|my_center|LOCUS_31850 670 1068 gene locus_tag LOCUS_31860 670 1068 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258116.1 protein_id gnl|my_center|LOCUS_31860 1401 2678 gene locus_tag LOCUS_31870 gene mftF 1401 2678 CDS product mycofactocin biosynthesis glycosyltransferase MftF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403501.1 protein_id gnl|my_center|LOCUS_31870 2788 3948 gene locus_tag LOCUS_31880 gene ahbD 2788 3948 CDS product heme b synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020622.1 protein_id gnl|my_center|LOCUS_31880 3945 5087 gene locus_tag LOCUS_31890 3945 5087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31890 >Feature sequence217 168 1664 gene locus_tag LOCUS_31900 168 1664 CDS product bifunctional UDP-sugar hydrolase/5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584140.1 protein_id gnl|my_center|LOCUS_31900 1661 2158 gene locus_tag LOCUS_31910 gene trmL 1661 2158 CDS product tRNA (uridine(34)/cytosine(34)/5-carboxymethylaminomethyluridine(34)-2'-O)-methyltransferase TrmL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393380.1 protein_id gnl|my_center|LOCUS_31910 2354 2596 gene locus_tag LOCUS_31920 2354 2596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31920 2654 2974 gene locus_tag LOCUS_31930 2654 2974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31930 3341 3730 gene locus_tag LOCUS_31940 3341 3730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31940 3769 4212 gene locus_tag LOCUS_31950 3769 4212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31950 4222 4581 gene locus_tag LOCUS_31960 4222 4581 CDS product NifB/NifX family molybdenum-iron cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939385.1 protein_id gnl|my_center|LOCUS_31960 4967 4632 gene locus_tag LOCUS_31970 4967 4632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31970 >Feature sequence218 322 777 gene locus_tag LOCUS_31980 322 777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31980 1901 1005 gene locus_tag LOCUS_31990 1901 1005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_31990 3159 2284 gene locus_tag LOCUS_32000 3159 2284 CDS product CoB--CoM heterodisulfide reductase iron-sulfur subunit B family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391978.1 protein_id gnl|my_center|LOCUS_32000 3727 3260 gene locus_tag LOCUS_32010 3727 3260 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391977.1 protein_id gnl|my_center|LOCUS_32010 <5138 3935 gene locus_tag LOCUS_32020 <5138 3935 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011392708.1:FAD-dependent oxidoreductase >Feature sequence219 1679 123 gene locus_tag LOCUS_32030 1679 123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32030 2514 1684 gene locus_tag LOCUS_32040 2514 1684 CDS product outer membrane lipoprotein-sorting protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679769.1 protein_id gnl|my_center|LOCUS_32040 4939 2516 gene locus_tag LOCUS_32050 4939 2516 CDS product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679762.1 protein_id gnl|my_center|LOCUS_32050 >Feature sequence220 876 31 gene locus_tag LOCUS_32060 876 31 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532185.1 protein_id gnl|my_center|LOCUS_32060 1751 876 gene locus_tag LOCUS_32070 1751 876 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014331879.1 protein_id gnl|my_center|LOCUS_32070 3379 1835 gene locus_tag LOCUS_32080 3379 1835 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391605.1 protein_id gnl|my_center|LOCUS_32080 4471 3431 gene locus_tag LOCUS_32090 4471 3431 CDS product NAD(P)-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966229.1 protein_id gnl|my_center|LOCUS_32090 >Feature sequence221 257 350 gene locus_tag LOCUS_t00420 257 350 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 586 2286 gene locus_tag LOCUS_32100 gene dnaX 586 2286 CDS product DNA polymerase III subunit gamma/tau inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940771.1 protein_id gnl|my_center|LOCUS_32100 2270 2599 gene locus_tag LOCUS_32110 2270 2599 CDS product YbaB/EbfC family nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001996460.1 protein_id gnl|my_center|LOCUS_32110 2679 3290 gene locus_tag LOCUS_32120 gene recR 2679 3290 CDS product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421618.1 protein_id gnl|my_center|LOCUS_32120 3287 4678 gene locus_tag LOCUS_32130 3287 4678 CDS product FAD-linked oxidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943908.1 protein_id gnl|my_center|LOCUS_32130 >Feature sequence222 185 1006 gene locus_tag LOCUS_32140 185 1006 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546196.1 protein_id gnl|my_center|LOCUS_32140 1003 1230 gene locus_tag LOCUS_32150 1003 1230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32150 1462 1596 gene locus_tag LOCUS_32160 1462 1596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32160 1598 1783 gene locus_tag LOCUS_32170 1598 1783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32170 2118 2363 gene locus_tag LOCUS_32180 2118 2363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32180 2338 4272 gene locus_tag LOCUS_32190 2338 4272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32190 >Feature sequence223 3968 12 gene locus_tag LOCUS_32200 3968 12 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392708.1 protein_id gnl|my_center|LOCUS_32200 4448 4269 gene locus_tag LOCUS_32210 4448 4269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_32210 >Feature sequence224 1727 69 gene locus_tag LOCUS_32220 1727 69 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32220 2270 1749 gene locus_tag LOCUS_32230 2270 1749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32230 3161 2634 gene locus_tag LOCUS_32240 3161 2634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32240 3312 3124 gene locus_tag LOCUS_32250 3312 3124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32250 4273 3383 gene locus_tag LOCUS_32260 4273 3383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32260 4725 4273 gene locus_tag LOCUS_32270 4725 4273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32270 >Feature sequence225 241 3486 gene locus_tag LOCUS_32280 241 3486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32280 >Feature sequence226 595 209 gene locus_tag LOCUS_32290 595 209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32290 1839 595 gene locus_tag LOCUS_32300 1839 595 CDS product flagellar basal body P-ring protein FlgI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943673.1 protein_id gnl|my_center|LOCUS_32300 2777 2028 gene locus_tag LOCUS_32310 2777 2028 CDS product flagellar basal body L-ring protein FlgH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943674.1 protein_id gnl|my_center|LOCUS_32310 3788 2802 gene locus_tag LOCUS_32320 3788 2802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32320 4586 3798 gene locus_tag LOCUS_32330 gene flgG 4586 3798 CDS product flagellar basal-body rod protein FlgG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943676.1 protein_id gnl|my_center|LOCUS_32330 >Feature sequence227 1430 681 gene locus_tag LOCUS_32340 gene cbiQ 1430 681 CDS product cobalt ECF transporter T component CbiQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938356.1 protein_id gnl|my_center|LOCUS_32340 2047 1427 gene locus_tag LOCUS_32350 2047 1427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32350 2703 2107 gene locus_tag LOCUS_32360 gene cbiM 2703 2107 CDS product cobalt transporter CbiM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938357.1 protein_id gnl|my_center|LOCUS_32360 4211 3045 gene locus_tag LOCUS_32370 4211 3045 CDS product carbohydrate porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545746.1 protein_id gnl|my_center|LOCUS_32370 >Feature sequence228 1387 659 gene locus_tag LOCUS_32380 1387 659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32380 3126 1462 gene locus_tag LOCUS_32390 gene hcp 3126 1462 CDS product hydroxylamine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939296.1 protein_id gnl|my_center|LOCUS_32390 <4533 3250 gene locus_tag LOCUS_32400 <4533 3250 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011403947.1:TIGR04283 family arsenosugar biosynthesis glycosyltransferase >Feature sequence229 2194 1301 gene locus_tag LOCUS_32410 2194 1301 CDS product DUF89 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880542.1 protein_id gnl|my_center|LOCUS_32410 2749 2240 gene locus_tag LOCUS_32420 2749 2240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32420 3513 2791 gene locus_tag LOCUS_32430 3513 2791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_32430 3870 3580 gene locus_tag LOCUS_32440 3870 3580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_32440 4164 4496 gene locus_tag LOCUS_32450 4164 4496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32450 >Feature sequence230 152 613 gene locus_tag LOCUS_32460 gene sixA 152 613 CDS product phosphohistidine phosphatase SixA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878502.1 protein_id gnl|my_center|LOCUS_32460 959 738 gene locus_tag LOCUS_32470 959 738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32470 1883 987 gene locus_tag LOCUS_32480 1883 987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32480 2861 1920 gene locus_tag LOCUS_32490 2861 1920 CDS product 3-hydroxyacyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011067939.1 protein_id gnl|my_center|LOCUS_32490 3924 3016 gene locus_tag LOCUS_32500 3924 3016 CDS product 3-keto-5-aminohexanoate cleavage protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878705.1 protein_id gnl|my_center|LOCUS_32500 >Feature sequence231 401 1534 gene locus_tag LOCUS_32510 401 1534 CDS product carbohydrate porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546257.1 protein_id gnl|my_center|LOCUS_32510 1764 2360 gene locus_tag LOCUS_32520 gene cbiM 1764 2360 CDS product cobalt transporter CbiM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546305.1 protein_id gnl|my_center|LOCUS_32520 2390 3043 gene locus_tag LOCUS_32530 2390 3043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938371.1 protein_id gnl|my_center|LOCUS_32530 3040 3798 gene locus_tag LOCUS_32540 gene cbiQ 3040 3798 CDS product cobalt ECF transporter T component CbiQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938356.1 protein_id gnl|my_center|LOCUS_32540 >Feature sequence232 2164 278 gene locus_tag LOCUS_32550 gene asnB 2164 278 CDS product asparagine synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010927303.1 protein_id gnl|my_center|LOCUS_32550 3312 2206 gene locus_tag LOCUS_32560 3312 2206 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807055.1 protein_id gnl|my_center|LOCUS_32560 4346 3354 gene locus_tag LOCUS_32570 4346 3354 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957832.1 protein_id gnl|my_center|LOCUS_32570 >Feature sequence233 612 97 gene locus_tag LOCUS_32580 gene cobO 612 97 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002666509.1 protein_id gnl|my_center|LOCUS_32580 1017 670 gene locus_tag LOCUS_32590 1017 670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32590 2439 1039 gene locus_tag LOCUS_32600 2439 1039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32600 3446 2436 gene locus_tag LOCUS_32610 3446 2436 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405433.1 protein_id gnl|my_center|LOCUS_32610 4351 3443 gene locus_tag LOCUS_32620 4351 3443 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948944.1 protein_id gnl|my_center|LOCUS_32620 >Feature sequence234 838 1017 gene locus_tag LOCUS_32630 838 1017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32630 4139 2952 gene locus_tag LOCUS_32640 4139 2952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32640 >Feature sequence235 492 1709 gene locus_tag LOCUS_32650 gene ilvA 492 1709 CDS product threonine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272642.1 protein_id gnl|my_center|LOCUS_32650 2881 1739 gene locus_tag LOCUS_32660 gene acdA 2881 1739 CDS product acyl-CoA dehydrogenase AcdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000545544.1 protein_id gnl|my_center|LOCUS_32660 3452 2904 gene locus_tag LOCUS_32670 3452 2904 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112674.1 protein_id gnl|my_center|LOCUS_32670 >Feature sequence236 327 163 gene locus_tag LOCUS_32680 327 163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32680 2324 648 gene locus_tag LOCUS_32690 2324 648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32690 4054 2522 gene locus_tag LOCUS_32700 4054 2522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_except (pos:complement(3887..3889),aa:Sec) note codon on position 56 is selenocysteine opal codon. protein_id gnl|my_center|LOCUS_32700 >Feature sequence237 423 1343 gene locus_tag LOCUS_32710 423 1343 CDS product DUF3524 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257632.1 protein_id gnl|my_center|LOCUS_32710 1300 2229 gene locus_tag LOCUS_32720 1300 2229 CDS product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461122.1 protein_id gnl|my_center|LOCUS_32720 2397 3734 gene locus_tag LOCUS_32730 2397 3734 CDS product 3-deoxy-D-manno-octulosonic acid transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942899.1 protein_id gnl|my_center|LOCUS_32730 >Feature sequence238 36 112 gene locus_tag LOCUS_t00430 36 112 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 1162 3636 gene locus_tag LOCUS_32740 1162 3636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32740 >Feature sequence239 1381 86 gene locus_tag LOCUS_32750 1381 86 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947133.1 protein_id gnl|my_center|LOCUS_32750 2510 1374 gene locus_tag LOCUS_32760 2510 1374 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020733.1 protein_id gnl|my_center|LOCUS_32760 3931 2552 gene locus_tag LOCUS_32770 gene glcD 3931 2552 CDS product glycolate oxidase subunit GlcD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398865.1 protein_id gnl|my_center|LOCUS_32770 >Feature sequence240 324 1346 gene locus_tag LOCUS_32780 gene dsrM 324 1346 CDS product sulfate reduction electron transfer complex DsrMKJOP subunit DsrM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810497.1 protein_id gnl|my_center|LOCUS_32780 1351 2991 gene locus_tag LOCUS_32790 1351 2991 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393112.1 protein_id gnl|my_center|LOCUS_32790 2984 3433 gene locus_tag LOCUS_32800 gene dsrJ 2984 3433 CDS product sulfate reduction electron transfer complex DsrMKJOP subunit DsrJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938584.1 protein_id gnl|my_center|LOCUS_32800 >Feature sequence241 1318 362 gene locus_tag LOCUS_32810 1318 362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32810 2546 2274 gene locus_tag LOCUS_32820 2546 2274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32820 >Feature sequence242 226 1986 gene locus_tag LOCUS_32830 gene ade 226 1986 CDS product adenine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392001.1 protein_id gnl|my_center|LOCUS_32830 2196 2008 gene locus_tag LOCUS_32840 2196 2008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32840 2340 2849 gene locus_tag LOCUS_32850 2340 2849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32850 3396 2908 gene locus_tag LOCUS_32860 3396 2908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32860 3856 4089 gene locus_tag LOCUS_32870 3856 4089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32870 >Feature sequence243 897 1289 gene locus_tag LOCUS_32880 897 1289 CDS product TM2 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769424.1 protein_id gnl|my_center|LOCUS_32880 1349 1657 gene locus_tag LOCUS_32890 1349 1657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32890 2067 1669 gene locus_tag LOCUS_32900 2067 1669 CDS product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932629.1 protein_id gnl|my_center|LOCUS_32900 2521 2706 gene locus_tag LOCUS_32910 2521 2706 CDS product DUF2065 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940433.1 protein_id gnl|my_center|LOCUS_32910 2722 4041 gene locus_tag LOCUS_32920 2722 4041 CDS product YihY/virulence factor BrkB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107706.1 protein_id gnl|my_center|LOCUS_32920 >Feature sequence244 2313 2002 gene locus_tag LOCUS_32930 2313 2002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32930 2673 2380 gene locus_tag LOCUS_32940 2673 2380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32940 2943 2728 gene locus_tag LOCUS_32950 2943 2728 CDS product FeoA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582917.1 protein_id gnl|my_center|LOCUS_32950 3484 2924 gene locus_tag LOCUS_32960 3484 2924 CDS product metal-dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_044348005.1 protein_id gnl|my_center|LOCUS_32960 >Feature sequence245 162 1811 gene locus_tag LOCUS_32970 162 1811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32970 1900 3561 gene locus_tag LOCUS_32980 1900 3561 CDS product PAS domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940474.1 protein_id gnl|my_center|LOCUS_32980 >Feature sequence246 966 520 gene locus_tag LOCUS_32990 966 520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32990 1145 2794 gene locus_tag LOCUS_33000 1145 2794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103407.1 protein_id gnl|my_center|LOCUS_33000 2895 3413 gene locus_tag LOCUS_33010 2895 3413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33010 3429 3626 gene locus_tag LOCUS_33020 3429 3626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33020 >Feature sequence247 3 167 gene locus_tag LOCUS_33030 3 167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33030 734 1156 gene locus_tag LOCUS_33040 734 1156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33040 1236 1664 gene locus_tag LOCUS_33050 1236 1664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33050 1691 2404 gene locus_tag LOCUS_33060 1691 2404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33060 3902 2508 gene locus_tag LOCUS_33070 3902 2508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33070 >Feature sequence248 <1 1038 gene locus_tag LOCUS_33080 <1 1038 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_066666688.1:NADH-quinone oxidoreductase subunit NuoF 1035 1643 gene locus_tag LOCUS_33090 1035 1643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33090 3613 1784 gene locus_tag LOCUS_33100 3613 1784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33100 3830 3906 gene locus_tag LOCUS_t00440 3830 3906 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence249 2184 538 gene locus_tag LOCUS_33110 2184 538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33110 3518 3709 gene locus_tag LOCUS_33120 3518 3709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33120 >Feature sequence250 3 500 gene locus_tag LOCUS_33130 3 500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33130 704 1408 gene locus_tag LOCUS_33140 704 1408 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990612.1 protein_id gnl|my_center|LOCUS_33140 >Feature sequence251 579 16 gene locus_tag LOCUS_33150 579 16 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_33150 760 560 gene locus_tag LOCUS_33160 760 560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_33160 1935 787 gene locus_tag LOCUS_33170 gene acdA 1935 787 CDS product acyl-CoA dehydrogenase AcdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000545544.1 protein_id gnl|my_center|LOCUS_33170 2975 2121 gene locus_tag LOCUS_33180 2975 2121 CDS product 3-hydroxybutyryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000538869.1 protein_id gnl|my_center|LOCUS_33180 >Feature sequence252 37 408 gene locus_tag LOCUS_33190 37 408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33190 424 1653 gene locus_tag LOCUS_33200 424 1653 CDS product NEW3 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107521.1 protein_id gnl|my_center|LOCUS_33200 1655 2401 gene locus_tag LOCUS_33210 1655 2401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33210 2403 3362 gene locus_tag LOCUS_33220 2403 3362 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761587.1 protein_id gnl|my_center|LOCUS_33220 >Feature sequence253 35 931 gene locus_tag LOCUS_33230 35 931 CDS product nitronate monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003702985.1 protein_id gnl|my_center|LOCUS_33230 977 3019 gene locus_tag LOCUS_33240 977 3019 CDS product molybdopterin oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941543.1 protein_id gnl|my_center|LOCUS_33240 >Feature sequence254 2071 500 gene locus_tag LOCUS_33250 gene glpA 2071 500 CDS product anaerobic glycerol-3-phosphate dehydrogenase subunit GlpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939226.1 protein_id gnl|my_center|LOCUS_33250 2420 3238 gene locus_tag LOCUS_33260 2420 3238 CDS product DeoR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012437127.1 protein_id gnl|my_center|LOCUS_33260 >Feature sequence255 2242 341 gene locus_tag LOCUS_33270 2242 341 CDS product cation-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946745.1 protein_id gnl|my_center|LOCUS_33270 3003 2623 gene locus_tag LOCUS_33280 3003 2623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33280 >Feature sequence256 1049 207 gene locus_tag LOCUS_33290 1049 207 CDS product ARMT1-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582978.1 protein_id gnl|my_center|LOCUS_33290 1432 1052 gene locus_tag LOCUS_33300 1432 1052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33300 1608 1533 gene locus_tag LOCUS_t00450 1608 1533 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 1800 2519 gene locus_tag LOCUS_33310 gene pyrF 1800 2519 CDS product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942107.1 protein_id gnl|my_center|LOCUS_33310 2954 2508 gene locus_tag LOCUS_33320 2954 2508 CDS product PaaI family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012660532.1 protein_id gnl|my_center|LOCUS_33320 >Feature sequence257 504 43 gene locus_tag LOCUS_33330 504 43 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902326.1 protein_id gnl|my_center|LOCUS_33330 1393 488 gene locus_tag LOCUS_33340 1393 488 CDS product RsmB/NOP family class I SAM-dependent RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902327.1 protein_id gnl|my_center|LOCUS_33340 2958 1390 gene locus_tag LOCUS_33350 2958 1390 CDS product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108495.1 protein_id gnl|my_center|LOCUS_33350 >Feature sequence258 <1 1453 gene locus_tag LOCUS_33360 <1 1453 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003430738.1:4-hydroxybutyryl-CoA dehydratase/vinylacetyl-CoA-Delta-isomerase 1560 1865 gene locus_tag LOCUS_33370 1560 1865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33370 1870 2802 gene locus_tag LOCUS_33380 1870 2802 CDS product 3-keto-5-aminohexanoate cleavage protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878705.1 protein_id gnl|my_center|LOCUS_33380 3093 2815 gene locus_tag LOCUS_33390 3093 2815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33390 3208 3056 gene locus_tag LOCUS_33400 3208 3056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33400 >Feature sequence259 432 1088 gene locus_tag LOCUS_33410 432 1088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33410 1950 1117 gene locus_tag LOCUS_33420 1950 1117 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939089.1 protein_id gnl|my_center|LOCUS_33420 2151 2759 gene locus_tag LOCUS_33430 2151 2759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33430 2819 3409 gene locus_tag LOCUS_33440 2819 3409 CDS product polyhydroxyalkanoate synthesis regulator DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015909395.1 protein_id gnl|my_center|LOCUS_33440 >Feature sequence260 720 2366 gene locus_tag LOCUS_33450 720 2366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33450 3186 2359 gene locus_tag LOCUS_33460 3186 2359 CDS product formate dehydrogenase accessory protein FdhE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937880.1 protein_id gnl|my_center|LOCUS_33460 >Feature sequence261 330 58 gene locus_tag LOCUS_33470 330 58 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33470 1119 352 gene locus_tag LOCUS_33480 1119 352 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389261.1 protein_id gnl|my_center|LOCUS_33480 2358 1192 gene locus_tag LOCUS_33490 2358 1192 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727137.1 protein_id gnl|my_center|LOCUS_33490 3094 2468 gene locus_tag LOCUS_33500 3094 2468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33500 >Feature sequence262 390 1337 gene locus_tag LOCUS_33510 gene trxB 390 1337 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393897.1 protein_id gnl|my_center|LOCUS_33510 1349 1621 gene locus_tag LOCUS_33520 1349 1621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33520 3182 1653 gene locus_tag LOCUS_33530 3182 1653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33530 >Feature sequence263 <1 2141 gene locus_tag LOCUS_33540 <1 2141 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_078404016.1:penicillin acylase family protein 3048 2221 gene locus_tag LOCUS_33550 3048 2221 CDS product crotonase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226825.1 protein_id gnl|my_center|LOCUS_33550 >Feature sequence264 1759 1331 gene locus_tag LOCUS_33560 1759 1331 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009896384.1 protein_id gnl|my_center|LOCUS_33560 2330 1719 gene locus_tag LOCUS_33570 2330 1719 CDS product putative ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009898025.1 protein_id gnl|my_center|LOCUS_33570 2959 2327 gene locus_tag LOCUS_33580 2959 2327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33580 >Feature sequence265 296 532 gene locus_tag LOCUS_33590 296 532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_33590 429 1412 gene locus_tag LOCUS_33600 429 1412 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257503.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_33600 1518 2555 gene locus_tag LOCUS_33610 1518 2555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33610 >Feature sequence266 1517 678 gene locus_tag LOCUS_33620 1517 678 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143776.1 protein_id gnl|my_center|LOCUS_33620 2663 1539 gene locus_tag LOCUS_33630 2663 1539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33630 3012 2704 gene locus_tag LOCUS_33640 3012 2704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33640 >Feature sequence267 2219 1176 gene locus_tag LOCUS_33650 2219 1176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33650 >Feature sequence268 140 1378 gene locus_tag LOCUS_33660 gene waaC 140 1378 CDS product lipopolysaccharide heptosyltransferase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546021.1 protein_id gnl|my_center|LOCUS_33660 1375 1860 gene locus_tag LOCUS_33670 1375 1860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33670 3006 1867 gene locus_tag LOCUS_33680 3006 1867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33680 >Feature sequence269 <1 504 gene locus_tag LOCUS_33690 <1 504 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012546788.1:glycosyltransferase family 4 protein 824 1081 gene locus_tag LOCUS_33700 824 1081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33700 1072 1467 gene locus_tag LOCUS_33710 1072 1467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33710 2217 1579 gene locus_tag LOCUS_33720 2217 1579 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938652.1 protein_id gnl|my_center|LOCUS_33720 2509 2354 gene locus_tag LOCUS_33730 2509 2354 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_092374840.1 protein_id gnl|my_center|LOCUS_33730 >Feature sequence270 869 2683 gene locus_tag LOCUS_33740 869 2683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33740 >Feature sequence271 2323 131 gene locus_tag LOCUS_33750 gene ppsA 2323 131 CDS product phosphoenolpyruvate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201372230.1 protein_id gnl|my_center|LOCUS_33750 2700 2323 gene locus_tag LOCUS_33760 2700 2323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33760 >Feature sequence272 904 116 gene locus_tag LOCUS_33770 904 116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33770 1886 2515 gene locus_tag LOCUS_33780 1886 2515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33780 2837 2508 gene locus_tag LOCUS_33790 2837 2508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33790 >Feature sequence273 1112 237 gene locus_tag LOCUS_33800 1112 237 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259484.1 protein_id gnl|my_center|LOCUS_33800 2243 1329 gene locus_tag LOCUS_33810 2243 1329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33810 2809 2336 gene locus_tag LOCUS_33820 gene feR 2809 2336 CDS product ferric-chelate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878333.1 protein_id gnl|my_center|LOCUS_33820 >Feature sequence274 1307 654 gene locus_tag LOCUS_33830 gene nth 1307 654 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057478.1 protein_id gnl|my_center|LOCUS_33830 1789 1932 gene locus_tag LOCUS_33840 1789 1932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33840 1946 2686 gene locus_tag LOCUS_33850 1946 2686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33850 >Feature sequence275 202 597 gene locus_tag LOCUS_33860 202 597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33860 853 1545 gene locus_tag LOCUS_33870 gene pgl 853 1545 CDS product 6-phosphogluconolactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143172.1 protein_id gnl|my_center|LOCUS_33870 1526 2530 gene locus_tag LOCUS_33880 gene glk 1526 2530 CDS product glucokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259043.1 protein_id gnl|my_center|LOCUS_33880 2546 2860 gene locus_tag LOCUS_33890 2546 2860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33890 >Feature sequence276 331 339 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 539 1654 gene locus_tag LOCUS_33900 gene asd 539 1654 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003111187.1 protein_id gnl|my_center|LOCUS_33900 1750 1847 gene locus_tag LOCUS_t00460 1750 1847 tRNA product tRNA-SeC inference COORDINATES:profile:Aragorn:1.2.38 <2912 2253 gene locus_tag LOCUS_33910 <2912 2253 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010889002.1:TetR/AcrR family transcriptional regulator >Feature sequence277 99 1322 gene locus_tag LOCUS_33920 99 1322 CDS product AmpG family muropeptide MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004523086.1 protein_id gnl|my_center|LOCUS_33920 1828 1421 gene locus_tag LOCUS_33930 1828 1421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33930 2395 1865 gene locus_tag LOCUS_33940 2395 1865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33940 >Feature sequence278 1175 450 gene locus_tag LOCUS_33950 1175 450 CDS product MlaE family lipid ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545987.1 protein_id gnl|my_center|LOCUS_33950 1559 2029 gene locus_tag LOCUS_33960 gene rlmH 1559 2029 CDS product 23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435703.1 protein_id gnl|my_center|LOCUS_33960 2418 2047 gene locus_tag LOCUS_33970 2418 2047 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937449.1 protein_id gnl|my_center|LOCUS_33970 >Feature sequence279 304 122 gene locus_tag LOCUS_33980 304 122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33980 438 1235 gene locus_tag LOCUS_33990 438 1235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33990 >Feature sequence280 344 1003 gene locus_tag LOCUS_34000 344 1003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34000 1051 2196 gene locus_tag LOCUS_34010 1051 2196 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546471.1 protein_id gnl|my_center|LOCUS_34010 >Feature sequence281 91 1137 gene locus_tag LOCUS_34020 91 1137 CDS product molybdopterin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948644.1 protein_id gnl|my_center|LOCUS_34020 2094 1159 gene locus_tag LOCUS_34030 2094 1159 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943691.1 protein_id gnl|my_center|LOCUS_34030 >Feature sequence282 413 697 gene locus_tag LOCUS_34040 413 697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34040 711 893 gene locus_tag LOCUS_34050 711 893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34050 1371 2420 gene locus_tag LOCUS_34060 1371 2420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_34060 >Feature sequence283 1714 1565 gene locus_tag LOCUS_34070 1714 1565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34070 2329 1814 gene locus_tag LOCUS_34080 2329 1814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34080 >Feature sequence284 1319 153 gene locus_tag LOCUS_34090 gene wecB 1319 153 CDS product UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010871027.1 protein_id gnl|my_center|LOCUS_34090 2055 1654 gene locus_tag LOCUS_34100 2055 1654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063921.1 protein_id gnl|my_center|LOCUS_34100 >Feature sequence285 1212 1352 gene locus_tag LOCUS_34110 1212 1352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34110 2329 1355 gene locus_tag LOCUS_34120 2329 1355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34120 >Feature sequence286 2 277 gene locus_tag LOCUS_34130 2 277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34130 >Feature sequence287 <1 942 gene locus_tag LOCUS_34140 <1 942 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164921874.1:type II secretion system protein GspK 1019 2398 gene locus_tag LOCUS_34150 1019 2398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34150 >Feature sequence288 <1 1875 gene locus_tag LOCUS_34160 <1 1875 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164927081.1:TonB-dependent receptor >Feature sequence289 794 1807 gene locus_tag LOCUS_34170 794 1807 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958343.1 protein_id gnl|my_center|LOCUS_34170 2106 2444 gene locus_tag LOCUS_34180 2106 2444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34180 >Feature sequence290 243 836 gene locus_tag LOCUS_34190 243 836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34190 906 2273 gene locus_tag LOCUS_34200 906 2273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34200 >Feature sequence291 43 936 gene locus_tag LOCUS_34210 43 936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34210 1068 1973 gene locus_tag LOCUS_34220 1068 1973 CDS product zinc ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938638.1 protein_id gnl|my_center|LOCUS_34220 >Feature sequence292 <1 622 gene locus_tag LOCUS_34230 <1 622 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943589.1:cytochrome c biogenesis CcdA family protein 1005 2102 gene locus_tag LOCUS_34240 gene acr3 1005 2102 CDS product arsenite efflux transporter Acr3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398718.1 protein_id gnl|my_center|LOCUS_34240 >Feature sequence293 327 998 gene locus_tag LOCUS_34250 327 998 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943067.1 protein_id gnl|my_center|LOCUS_34250 1036 2100 gene locus_tag LOCUS_34260 gene pyrB 1036 2100 CDS product aspartate carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000013042.1 protein_id gnl|my_center|LOCUS_34260 2264 2112 gene locus_tag LOCUS_34270 2264 2112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34270 >Feature sequence294 1136 309 gene locus_tag LOCUS_34280 1136 309 CDS product formylglycine-generating enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020696.1 protein_id gnl|my_center|LOCUS_34280 2066 1353 gene locus_tag LOCUS_34290 2066 1353 CDS product N-formylglutamate amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090455.1 protein_id gnl|my_center|LOCUS_34290 >Feature sequence295 1910 1194 gene locus_tag LOCUS_34300 1910 1194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34300 >Feature sequence296 92 244 gene locus_tag LOCUS_34310 92 244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34310 785 2116 gene locus_tag LOCUS_34320 785 2116 CDS product L-serine ammonia-lyase, iron-sulfur-dependent, subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021359871.1 protein_id gnl|my_center|LOCUS_34320 >Feature sequence297 2006 1590 gene locus_tag LOCUS_34330 2006 1590 CDS product secondary thiamine-phosphate synthase enzyme YjbQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010945922.1 protein_id gnl|my_center|LOCUS_34330 >Feature sequence298 88 711 gene locus_tag LOCUS_34340 88 711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34340 714 1262 gene locus_tag LOCUS_34350 714 1262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011791831.1 protein_id gnl|my_center|LOCUS_34350 <2127 1301 gene locus_tag LOCUS_34360 <2127 1301 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011404314.1:putative molybdenum carrier protein >Feature sequence299 850 539 gene locus_tag LOCUS_34370 850 539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34370 >Feature sequence300 160 1794 gene locus_tag LOCUS_34380 160 1794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34380 >Feature sequence301 106 1458 gene locus_tag LOCUS_34390 106 1458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34390 >Feature sequence302 <1 666 gene locus_tag LOCUS_34400 <1 666 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001973414.1:2,3-bisphosphoglycerate-independent phosphoglycerate mutase >Feature sequence303 577 783 gene locus_tag LOCUS_34410 577 783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34410 780 1157 gene locus_tag LOCUS_34420 780 1157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34420