>Feature sequence001 2165 882 gene locus_tag LOCUS_00010 2165 882 CDS product 3-deoxy-D-manno-octulosonic acid transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942899.1 protein_id gnl|my_center|LOCUS_00010 2857 2174 gene locus_tag LOCUS_00020 2857 2174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00020 3768 2854 gene locus_tag LOCUS_00030 3768 2854 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944030.1 protein_id gnl|my_center|LOCUS_00030 5516 3765 gene locus_tag LOCUS_00040 gene msbA 5516 3765 CDS product lipid A export permease/ATP-binding protein MsbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942900.1 protein_id gnl|my_center|LOCUS_00040 6661 5513 gene locus_tag LOCUS_00050 gene lpxB 6661 5513 CDS product lipid-A-disaccharide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942901.1 protein_id gnl|my_center|LOCUS_00050 7748 6654 gene locus_tag LOCUS_00060 7748 6654 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942902.1 protein_id gnl|my_center|LOCUS_00060 8770 7745 gene locus_tag LOCUS_00070 8770 7745 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942903.1 protein_id gnl|my_center|LOCUS_00070 9546 8767 gene locus_tag LOCUS_00080 gene lpxA 9546 8767 CDS product acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942904.1 protein_id gnl|my_center|LOCUS_00080 10035 9592 gene locus_tag LOCUS_00090 gene fabZ 10035 9592 CDS product 3-hydroxyacyl-ACP dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942905.1 protein_id gnl|my_center|LOCUS_00090 11089 10037 gene locus_tag LOCUS_00100 gene lpxD 11089 10037 CDS product UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942906.1 protein_id gnl|my_center|LOCUS_00100 11609 11094 gene locus_tag LOCUS_00110 11609 11094 CDS product OmpH family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942907.1 protein_id gnl|my_center|LOCUS_00110 14040 11734 gene locus_tag LOCUS_00120 gene bamA 14040 11734 CDS product outer membrane protein assembly factor BamA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942908.1 protein_id gnl|my_center|LOCUS_00120 14735 14055 gene locus_tag LOCUS_00130 14735 14055 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942909.1 protein_id gnl|my_center|LOCUS_00130 15996 14728 gene locus_tag LOCUS_00140 15996 14728 CDS product lipoprotein-releasing ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942910.1 protein_id gnl|my_center|LOCUS_00140 17478 16000 gene locus_tag LOCUS_00150 gene lysS 17478 16000 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942911.1 protein_id gnl|my_center|LOCUS_00150 18807 17620 gene locus_tag LOCUS_00160 18807 17620 CDS product SBBP repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990858.1 protein_id gnl|my_center|LOCUS_00160 21060 18847 gene locus_tag LOCUS_00170 21060 18847 CDS product Rne/Rng family ribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941589.1 protein_id gnl|my_center|LOCUS_00170 23277 21205 gene locus_tag LOCUS_00180 23277 21205 CDS product sodium-translocating pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943902.1 protein_id gnl|my_center|LOCUS_00180 23510 24343 gene locus_tag LOCUS_00190 gene ybgF 23510 24343 CDS product tol-pal system protein YbgF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940701.1 protein_id gnl|my_center|LOCUS_00190 25015 24428 gene locus_tag LOCUS_00200 gene hisB 25015 24428 CDS product imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943719.1 protein_id gnl|my_center|LOCUS_00200 25433 24948 gene locus_tag LOCUS_00210 25433 24948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943184.1 protein_id gnl|my_center|LOCUS_00210 26498 25446 gene locus_tag LOCUS_00220 gene hisC 26498 25446 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943720.1 protein_id gnl|my_center|LOCUS_00220 27792 26500 gene locus_tag LOCUS_00230 gene hisD 27792 26500 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943721.1 protein_id gnl|my_center|LOCUS_00230 28452 27805 gene locus_tag LOCUS_00240 gene hisG 28452 27805 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943722.1 protein_id gnl|my_center|LOCUS_00240 29702 28449 gene locus_tag LOCUS_00250 gene murA 29702 28449 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943723.1 protein_id gnl|my_center|LOCUS_00250 29927 32200 gene locus_tag LOCUS_00260 29927 32200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00260 32193 33281 gene locus_tag LOCUS_00270 32193 33281 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942536.1 protein_id gnl|my_center|LOCUS_00270 35687 33315 gene locus_tag LOCUS_00280 35687 33315 CDS product NADH-quinone oxidoreductase subunit B/C/D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944054.1 protein_id gnl|my_center|LOCUS_00280 36069 35680 gene locus_tag LOCUS_00290 gene ndhC 36069 35680 CDS product NADH-quinone oxidoreductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944055.1 protein_id gnl|my_center|LOCUS_00290 36672 37187 gene locus_tag LOCUS_00300 36672 37187 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943199.1 protein_id gnl|my_center|LOCUS_00300 37508 40183 gene locus_tag LOCUS_00310 37508 40183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00310 41085 40300 gene locus_tag LOCUS_00320 41085 40300 CDS product FRG domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017872006.1 protein_id gnl|my_center|LOCUS_00320 41536 43971 gene locus_tag LOCUS_00330 41536 43971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00330 43940 44944 gene locus_tag LOCUS_00340 43940 44944 CDS product phosphatidylserine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016325.1 protein_id gnl|my_center|LOCUS_00340 44941 45993 gene locus_tag LOCUS_00350 44941 45993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00350 46034 46486 gene locus_tag LOCUS_00360 46034 46486 CDS product DUF2062 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001009543.1 protein_id gnl|my_center|LOCUS_00360 46517 47452 gene locus_tag LOCUS_00370 46517 47452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00370 47500 48258 gene locus_tag LOCUS_00380 47500 48258 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932563.1 protein_id gnl|my_center|LOCUS_00380 48309 48500 gene locus_tag LOCUS_00390 48309 48500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942210.1 protein_id gnl|my_center|LOCUS_00390 48747 49040 gene locus_tag LOCUS_00400 48747 49040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00400 49245 53087 gene locus_tag LOCUS_00410 49245 53087 CDS product Eco57I restriction-modification methylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766276.1 protein_id gnl|my_center|LOCUS_00410 53084 53977 gene locus_tag LOCUS_00420 53084 53977 CDS product KilA-N domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004804477.1 protein_id gnl|my_center|LOCUS_00420 54278 54141 gene locus_tag LOCUS_00430 54278 54141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00430 56053 54332 gene locus_tag LOCUS_00440 56053 54332 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943573.1 protein_id gnl|my_center|LOCUS_00440 56491 56835 gene locus_tag LOCUS_00450 56491 56835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00450 57138 58220 gene locus_tag LOCUS_00460 57138 58220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00460 58178 59209 gene locus_tag LOCUS_00470 58178 59209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00470 59446 59889 gene locus_tag LOCUS_00480 59446 59889 CDS product arsenate reductase ArsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582904.1 protein_id gnl|my_center|LOCUS_00480 60000 60197 gene locus_tag LOCUS_00490 60000 60197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00490 60203 61024 gene locus_tag LOCUS_00500 60203 61024 CDS product RMD1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943194.1 protein_id gnl|my_center|LOCUS_00500 61284 61093 gene locus_tag LOCUS_00510 61284 61093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00510 61472 61287 gene locus_tag LOCUS_00520 61472 61287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00520 61703 62386 gene locus_tag LOCUS_00530 61703 62386 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941763.1 protein_id gnl|my_center|LOCUS_00530 62394 64154 gene locus_tag LOCUS_00540 gene phoR 62394 64154 CDS product phosphate regulon sensor histidine kinase PhoR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941762.1 protein_id gnl|my_center|LOCUS_00540 64261 65283 gene locus_tag LOCUS_00550 gene pstS 64261 65283 CDS product phosphate ABC transporter substrate-binding protein PstS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582618.1 protein_id gnl|my_center|LOCUS_00550 65365 66363 gene locus_tag LOCUS_00560 gene pstC 65365 66363 CDS product phosphate ABC transporter permease subunit PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582860.1 protein_id gnl|my_center|LOCUS_00560 66360 67199 gene locus_tag LOCUS_00570 gene pstA 66360 67199 CDS product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889419.1 protein_id gnl|my_center|LOCUS_00570 67266 68024 gene locus_tag LOCUS_00580 gene pstB 67266 68024 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962535.1 protein_id gnl|my_center|LOCUS_00580 68208 68879 gene locus_tag LOCUS_00590 gene phoU 68208 68879 CDS product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941756.1 protein_id gnl|my_center|LOCUS_00590 70100 69147 gene locus_tag LOCUS_00600 70100 69147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00600 70409 71848 gene locus_tag LOCUS_00610 70409 71848 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943740.1 protein_id gnl|my_center|LOCUS_00610 71845 72525 gene locus_tag LOCUS_00620 71845 72525 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943739.1 protein_id gnl|my_center|LOCUS_00620 72740 73141 gene locus_tag LOCUS_00630 72740 73141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00630 73552 73238 gene locus_tag LOCUS_00640 73552 73238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00640 73963 76434 gene locus_tag LOCUS_00650 73963 76434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00650 76945 77100 gene locus_tag LOCUS_00660 76945 77100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00660 77116 77874 gene locus_tag LOCUS_00670 77116 77874 CDS product DUF169 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012468436.1 protein_id gnl|my_center|LOCUS_00670 79232 78000 gene locus_tag LOCUS_00680 79232 78000 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235044964.1 protein_id gnl|my_center|LOCUS_00680 79641 80456 gene locus_tag LOCUS_00690 79641 80456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00690 82855 80597 gene locus_tag LOCUS_00700 82855 80597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00700 84502 82862 gene locus_tag LOCUS_00710 84502 82862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00710 85918 84689 gene locus_tag LOCUS_00720 85918 84689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00720 86622 85915 gene locus_tag LOCUS_00730 86622 85915 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529057.1 protein_id gnl|my_center|LOCUS_00730 88326 86872 gene locus_tag LOCUS_00740 88326 86872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00740 >Feature sequence002 272 1531 gene locus_tag LOCUS_00750 272 1531 CDS product DUF445 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037502.1 protein_id gnl|my_center|LOCUS_00750 1736 2074 gene locus_tag LOCUS_00760 1736 2074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00760 2421 4040 gene locus_tag LOCUS_00770 2421 4040 CDS product NADP-dependent glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115067.1 protein_id gnl|my_center|LOCUS_00770 4062 4862 gene locus_tag LOCUS_00780 gene larE 4062 4862 CDS product ATP-dependent sacrificial sulfur transferase LarE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941204.1 protein_id gnl|my_center|LOCUS_00780 4972 5047 gene locus_tag LOCUS_t00010 4972 5047 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 5072 7609 gene locus_tag LOCUS_00790 gene hrpB 5072 7609 CDS product ATP-dependent helicase HrpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942482.1 protein_id gnl|my_center|LOCUS_00790 9240 7648 gene locus_tag LOCUS_00800 9240 7648 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941965.1 protein_id gnl|my_center|LOCUS_00800 10602 9313 gene locus_tag LOCUS_00810 gene eno 10602 9313 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942923.1 protein_id gnl|my_center|LOCUS_00810 10827 12041 gene locus_tag LOCUS_00820 10827 12041 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941822.1 protein_id gnl|my_center|LOCUS_00820 12043 12744 gene locus_tag LOCUS_00830 12043 12744 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941823.1 protein_id gnl|my_center|LOCUS_00830 12731 13888 gene locus_tag LOCUS_00840 12731 13888 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941824.1 protein_id gnl|my_center|LOCUS_00840 13898 15277 gene locus_tag LOCUS_00850 13898 15277 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942141.1 protein_id gnl|my_center|LOCUS_00850 16123 15302 gene locus_tag LOCUS_00860 16123 15302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00860 16354 16578 gene locus_tag LOCUS_00870 16354 16578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00870 16816 16604 gene locus_tag LOCUS_00880 16816 16604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00880 17006 18400 gene locus_tag LOCUS_00890 17006 18400 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812135.1 protein_id gnl|my_center|LOCUS_00890 17990 17999 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 21103 18500 gene locus_tag LOCUS_00900 gene clpB 21103 18500 CDS product ATP-dependent chaperone ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869824.1 protein_id gnl|my_center|LOCUS_00900 21323 23410 gene locus_tag LOCUS_00910 21323 23410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00910 23471 26728 gene locus_tag LOCUS_00920 23471 26728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00920 26740 27192 gene locus_tag LOCUS_00930 26740 27192 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259372.1 protein_id gnl|my_center|LOCUS_00930 27194 29182 gene locus_tag LOCUS_00940 27194 29182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00940 29179 30399 gene locus_tag LOCUS_00950 29179 30399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00950 30408 31220 gene locus_tag LOCUS_00960 30408 31220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00960 31268 32596 gene locus_tag LOCUS_00970 31268 32596 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203793.1 protein_id gnl|my_center|LOCUS_00970 32606 33259 gene locus_tag LOCUS_00980 32606 33259 CDS product ADP-ribosylation factor-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228461.1 protein_id gnl|my_center|LOCUS_00980 33288 34568 gene locus_tag LOCUS_00990 33288 34568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00990 34565 36988 gene locus_tag LOCUS_01000 34565 36988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01000 36985 37548 gene locus_tag LOCUS_01010 36985 37548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01010 38749 37598 gene locus_tag LOCUS_01020 38749 37598 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941360.1 protein_id gnl|my_center|LOCUS_01020 40932 38746 gene locus_tag LOCUS_01030 40932 38746 CDS product HEAT repeat domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941359.1 protein_id gnl|my_center|LOCUS_01030 41086 41646 gene locus_tag LOCUS_01040 gene rsmD 41086 41646 CDS product 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941900.1 protein_id gnl|my_center|LOCUS_01040 41646 42131 gene locus_tag LOCUS_01050 gene coaD 41646 42131 CDS product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941899.1 protein_id gnl|my_center|LOCUS_01050 42192 42386 gene locus_tag LOCUS_01060 42192 42386 CDS product DUF1858 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941897.1 protein_id gnl|my_center|LOCUS_01060 42415 43518 gene locus_tag LOCUS_01070 42415 43518 CDS product DUF5634 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941896.1 protein_id gnl|my_center|LOCUS_01070 47097 43522 gene locus_tag LOCUS_01080 gene recB 47097 43522 CDS product exodeoxyribonuclease V subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942181.1 protein_id gnl|my_center|LOCUS_01080 48122 47184 gene locus_tag LOCUS_01090 48122 47184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01090 48317 48658 gene locus_tag LOCUS_01100 48317 48658 CDS product YtxH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941828.1 protein_id gnl|my_center|LOCUS_01100 49423 48740 gene locus_tag LOCUS_01110 gene yrfG 49423 48740 CDS product GMP/IMP nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942337.1 protein_id gnl|my_center|LOCUS_01110 49579 50892 gene locus_tag LOCUS_01120 gene miaB 49579 50892 CDS product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942838.1 protein_id gnl|my_center|LOCUS_01120 50915 52597 gene locus_tag LOCUS_01130 50915 52597 CDS product glutamine--tRNA ligase/YqeY domain fusion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943977.1 protein_id gnl|my_center|LOCUS_01130 52579 53514 gene locus_tag LOCUS_01140 gene era 52579 53514 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193360270.1 protein_id gnl|my_center|LOCUS_01140 53511 54866 gene locus_tag LOCUS_01150 gene der 53511 54866 CDS product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942865.1 protein_id gnl|my_center|LOCUS_01150 55007 56677 gene locus_tag LOCUS_01160 55007 56677 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942864.1 protein_id gnl|my_center|LOCUS_01160 56674 57054 gene locus_tag LOCUS_01170 56674 57054 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942863.1 protein_id gnl|my_center|LOCUS_01170 57078 59186 gene locus_tag LOCUS_01180 57078 59186 CDS product chemotaxis protein CheA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942862.1 protein_id gnl|my_center|LOCUS_01180 59192 59992 gene locus_tag LOCUS_01190 59192 59992 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942861.1 protein_id gnl|my_center|LOCUS_01190 60004 60777 gene locus_tag LOCUS_01200 60004 60777 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942860.1 protein_id gnl|my_center|LOCUS_01200 60808 61260 gene locus_tag LOCUS_01210 60808 61260 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942858.1 protein_id gnl|my_center|LOCUS_01210 61377 63206 gene locus_tag LOCUS_01220 61377 63206 CDS product HEAT repeat domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942856.1 protein_id gnl|my_center|LOCUS_01220 63244 64092 gene locus_tag LOCUS_01230 63244 64092 CDS product protein-glutamate O-methyltransferase CheR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942855.1 protein_id gnl|my_center|LOCUS_01230 64089 65159 gene locus_tag LOCUS_01240 64089 65159 CDS product chemotaxis response regulator protein-glutamate methylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942854.1 protein_id gnl|my_center|LOCUS_01240 65171 67708 gene locus_tag LOCUS_01250 gene leuS 65171 67708 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942849.1 protein_id gnl|my_center|LOCUS_01250 67712 68233 gene locus_tag LOCUS_01260 67712 68233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01260 68230 69234 gene locus_tag LOCUS_01270 gene holA 68230 69234 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942847.1 protein_id gnl|my_center|LOCUS_01270 69347 69772 gene locus_tag LOCUS_01280 69347 69772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01280 >Feature sequence003 579 5339 gene locus_tag LOCUS_01290 579 5339 CDS product filamentous hemagglutinin N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816940.1 protein_id gnl|my_center|LOCUS_01290 5860 5384 gene locus_tag LOCUS_01300 gene ispF 5860 5384 CDS product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943978.1 protein_id gnl|my_center|LOCUS_01300 6910 5873 gene locus_tag LOCUS_01310 6910 5873 CDS product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940684.1 protein_id gnl|my_center|LOCUS_01310 8477 6888 gene locus_tag LOCUS_01320 8477 6888 CDS product HEAT repeat domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940683.1 protein_id gnl|my_center|LOCUS_01320 11154 8599 gene locus_tag LOCUS_01330 11154 8599 CDS product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941123.1 protein_id gnl|my_center|LOCUS_01330 11859 11161 gene locus_tag LOCUS_01340 11859 11161 CDS product outer membrane lipoprotein LolB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941124.1 protein_id gnl|my_center|LOCUS_01340 12516 11884 gene locus_tag LOCUS_01350 12516 11884 CDS product outer membrane lipoprotein carrier protein LolA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941125.1 protein_id gnl|my_center|LOCUS_01350 12788 12513 gene locus_tag LOCUS_01360 12788 12513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01360 13932 12889 gene locus_tag LOCUS_01370 13932 12889 CDS product beta-ketoacyl synthase N-terminal-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941127.1 protein_id gnl|my_center|LOCUS_01370 15134 13929 gene locus_tag LOCUS_01380 15134 13929 CDS product beta-ketoacyl-[acyl-carrier-protein] synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941128.1 protein_id gnl|my_center|LOCUS_01380 15871 15131 gene locus_tag LOCUS_01390 15871 15131 CDS product 3-oxoacyl-ACP reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941129.1 protein_id gnl|my_center|LOCUS_01390 17355 15973 gene locus_tag LOCUS_01400 17355 15973 CDS product B12-binding domain-containing radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940912.1 protein_id gnl|my_center|LOCUS_01400 17774 17352 gene locus_tag LOCUS_01410 17774 17352 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940913.1 protein_id gnl|my_center|LOCUS_01410 18607 17771 gene locus_tag LOCUS_01420 18607 17771 CDS product acyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_039647780.1 protein_id gnl|my_center|LOCUS_01420 19836 18604 gene locus_tag LOCUS_01430 19836 18604 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940915.1 protein_id gnl|my_center|LOCUS_01430 20144 19887 gene locus_tag LOCUS_01440 20144 19887 CDS product phosphopantetheine-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940916.1 protein_id gnl|my_center|LOCUS_01440 21110 20202 gene locus_tag LOCUS_01450 21110 20202 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940917.1 protein_id gnl|my_center|LOCUS_01450 22521 21166 gene locus_tag LOCUS_01460 22521 21166 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081919.1 protein_id gnl|my_center|LOCUS_01460 23897 22521 gene locus_tag LOCUS_01470 23897 22521 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940918.1 protein_id gnl|my_center|LOCUS_01470 24575 23913 gene locus_tag LOCUS_01480 24575 23913 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940919.1 protein_id gnl|my_center|LOCUS_01480 25225 24557 gene locus_tag LOCUS_01490 25225 24557 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940920.1 protein_id gnl|my_center|LOCUS_01490 26221 25436 gene locus_tag LOCUS_01500 26221 25436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01500 27440 26175 gene locus_tag LOCUS_01510 27440 26175 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940922.1 protein_id gnl|my_center|LOCUS_01510 27934 28452 gene locus_tag LOCUS_01520 27934 28452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01520 28413 29042 gene locus_tag LOCUS_01530 28413 29042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01530 29075 29665 gene locus_tag LOCUS_01540 29075 29665 CDS product acyloxyacyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944026.1 protein_id gnl|my_center|LOCUS_01540 32331 29767 gene locus_tag LOCUS_01550 gene gyrA 32331 29767 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940682.1 protein_id gnl|my_center|LOCUS_01550 33112 32552 gene locus_tag LOCUS_01560 33112 32552 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065644.1 protein_id gnl|my_center|LOCUS_01560 33445 33918 gene locus_tag LOCUS_01570 33445 33918 CDS product ferritin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942833.1 protein_id gnl|my_center|LOCUS_01570 33940 34146 gene locus_tag LOCUS_01580 33940 34146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940754.1 protein_id gnl|my_center|LOCUS_01580 34364 34200 gene locus_tag LOCUS_01590 34364 34200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01590 34656 35282 gene locus_tag LOCUS_01600 34656 35282 CDS product cysteine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729782.1 protein_id gnl|my_center|LOCUS_01600 36332 35307 gene locus_tag LOCUS_01610 36332 35307 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943459.1 protein_id gnl|my_center|LOCUS_01610 37326 36631 gene locus_tag LOCUS_01620 37326 36631 CDS product Bax inhibitor-1/YccA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210775.1 protein_id gnl|my_center|LOCUS_01620 40119 37717 gene locus_tag LOCUS_01630 gene gyrB 40119 37717 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940681.1 protein_id gnl|my_center|LOCUS_01630 41224 40124 gene locus_tag LOCUS_01640 gene recF 41224 40124 CDS product DNA replication/repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940680.1 protein_id gnl|my_center|LOCUS_01640 42355 41234 gene locus_tag LOCUS_01650 gene dnaN 42355 41234 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940679.1 protein_id gnl|my_center|LOCUS_01650 43880 42576 gene locus_tag LOCUS_01660 gene dnaA 43880 42576 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940678.1 protein_id gnl|my_center|LOCUS_01660 45038 46645 gene locus_tag LOCUS_01670 gene yidC 45038 46645 CDS product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944075.1 protein_id gnl|my_center|LOCUS_01670 46670 48037 gene locus_tag LOCUS_01680 gene mnmE 46670 48037 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944074.1 protein_id gnl|my_center|LOCUS_01680 48071 49972 gene locus_tag LOCUS_01690 gene mnmG 48071 49972 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944073.1 protein_id gnl|my_center|LOCUS_01690 49972 50634 gene locus_tag LOCUS_01700 gene rsmG 49972 50634 CDS product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944072.1 protein_id gnl|my_center|LOCUS_01700 50870 51271 gene locus_tag LOCUS_01710 50870 51271 CDS product YbgC/FadM family acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944070.1 protein_id gnl|my_center|LOCUS_01710 51291 52343 gene locus_tag LOCUS_01720 gene mqnC 51291 52343 CDS product cyclic dehypoxanthinyl futalosine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235044953.1 protein_id gnl|my_center|LOCUS_01720 52340 53488 gene locus_tag LOCUS_01730 52340 53488 CDS product ribonuclease D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941112.1 protein_id gnl|my_center|LOCUS_01730 53475 54047 gene locus_tag LOCUS_01740 53475 54047 CDS product prepilin-type N-terminal cleavage/methylation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940993.1 protein_id gnl|my_center|LOCUS_01740 54044 54376 gene locus_tag LOCUS_01750 54044 54376 CDS product prepilin-type N-terminal cleavage/methylation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940992.1 protein_id gnl|my_center|LOCUS_01750 54354 54971 gene locus_tag LOCUS_01760 54354 54971 CDS product type II secretion system protein GspJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940991.1 protein_id gnl|my_center|LOCUS_01760 54968 55900 gene locus_tag LOCUS_01770 gene gspK 54968 55900 CDS product type II secretion system minor pseudopilin GspK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940990.1 protein_id gnl|my_center|LOCUS_01770 55940 57250 gene locus_tag LOCUS_01780 gene gspL 55940 57250 CDS product type II secretion system protein GspL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940989.1 protein_id gnl|my_center|LOCUS_01780 57247 57795 gene locus_tag LOCUS_01790 57247 57795 CDS product type II secretion system protein GspM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940988.1 protein_id gnl|my_center|LOCUS_01790 57795 58634 gene locus_tag LOCUS_01800 gene gspN 57795 58634 CDS product type II secretion system protein GspN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940987.1 protein_id gnl|my_center|LOCUS_01800 58658 59785 gene locus_tag LOCUS_01810 58658 59785 CDS product general secretion pathway protein GspE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940982.1 protein_id gnl|my_center|LOCUS_01810 59782 60432 gene locus_tag LOCUS_01820 gene nadD 59782 60432 CDS product nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943828.1 protein_id gnl|my_center|LOCUS_01820 60423 60836 gene locus_tag LOCUS_01830 gene rsfS 60423 60836 CDS product ribosome silencing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943827.1 protein_id gnl|my_center|LOCUS_01830 60833 61291 gene locus_tag LOCUS_01840 60833 61291 CDS product 23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943826.1 protein_id gnl|my_center|LOCUS_01840 61309 62829 gene locus_tag LOCUS_01850 gene gpmI 61309 62829 CDS product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943825.1 protein_id gnl|my_center|LOCUS_01850 62999 65782 gene locus_tag LOCUS_01860 62999 65782 CDS product type I restriction-modification enzyme R subunit C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022108.1 protein_id gnl|my_center|LOCUS_01860 65914 66429 gene locus_tag LOCUS_01870 65914 66429 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694149.1 protein_id gnl|my_center|LOCUS_01870 >Feature sequence004 275 1663 gene locus_tag LOCUS_01880 gene selA 275 1663 CDS product L-seryl-tRNA(Sec) selenium transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943980.1 protein_id gnl|my_center|LOCUS_01880 3757 1844 gene locus_tag LOCUS_01890 gene selB 3757 1844 CDS product selenocysteine-specific translation elongation factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940778.1 protein_id gnl|my_center|LOCUS_01890 4326 4679 gene locus_tag LOCUS_01900 4326 4679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01900 5051 5251 gene locus_tag LOCUS_01910 5051 5251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01910 5248 5427 gene locus_tag LOCUS_01920 5248 5427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01920 5424 5579 gene locus_tag LOCUS_01930 5424 5579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01930 5584 5835 gene locus_tag LOCUS_01940 5584 5835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01940 5912 6328 gene locus_tag LOCUS_01950 5912 6328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01950 7624 6788 gene locus_tag LOCUS_01960 7624 6788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01960 8300 7752 gene locus_tag LOCUS_01970 8300 7752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01970 10467 8887 gene locus_tag LOCUS_01980 10467 8887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01980 10645 10460 gene locus_tag LOCUS_01990 10645 10460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01990 10892 10638 gene locus_tag LOCUS_02000 10892 10638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02000 11545 11168 gene locus_tag LOCUS_02010 11545 11168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02010 12881 11634 gene locus_tag LOCUS_02020 12881 11634 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000772650.1 protein_id gnl|my_center|LOCUS_02020 13239 13142 gene locus_tag LOCUS_t00020 13239 13142 tRNA product tRNA-SeC inference COORDINATES:profile:Aragorn:1.2.38 14209 13265 gene locus_tag LOCUS_02030 14209 13265 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942842.1 protein_id gnl|my_center|LOCUS_02030 14657 15103 gene locus_tag LOCUS_02040 14657 15103 CDS product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940812.1 protein_id gnl|my_center|LOCUS_02040 15189 16772 gene locus_tag LOCUS_02050 15189 16772 CDS product peptide chain release factor 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940814.1 protein_id gnl|my_center|LOCUS_02050 16776 17006 gene locus_tag LOCUS_02060 16776 17006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02060 18159 17071 gene locus_tag LOCUS_02070 18159 17071 CDS product chemotaxis response regulator protein-glutamate methylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940965.1 protein_id gnl|my_center|LOCUS_02070 19085 18186 gene locus_tag LOCUS_02080 19085 18186 CDS product HDOD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940966.1 protein_id gnl|my_center|LOCUS_02080 19931 19104 gene locus_tag LOCUS_02090 19931 19104 CDS product protein-glutamate O-methyltransferase CheR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940967.1 protein_id gnl|my_center|LOCUS_02090 21829 20003 gene locus_tag LOCUS_02100 21829 20003 CDS product chemotaxis protein CheA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940968.1 protein_id gnl|my_center|LOCUS_02100 22363 21869 gene locus_tag LOCUS_02110 22363 21869 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940969.1 protein_id gnl|my_center|LOCUS_02110 22628 24028 gene locus_tag LOCUS_02120 22628 24028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02120 24028 24849 gene locus_tag LOCUS_02130 24028 24849 CDS product lytic transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940970.1 protein_id gnl|my_center|LOCUS_02130 24961 27297 gene locus_tag LOCUS_02140 24961 27297 CDS product cobyric acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943622.1 protein_id gnl|my_center|LOCUS_02140 27284 28255 gene locus_tag LOCUS_02150 gene cbiB 27284 28255 CDS product adenosylcobinamide-phosphate synthase CbiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943620.1 protein_id gnl|my_center|LOCUS_02150 28239 29315 gene locus_tag LOCUS_02160 gene cobD 28239 29315 CDS product threonine-phosphate decarboxylase CobD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943619.1 protein_id gnl|my_center|LOCUS_02160 30592 29351 gene locus_tag LOCUS_02170 gene glgC 30592 29351 CDS product glucose-1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479907.1 protein_id gnl|my_center|LOCUS_02170 30782 31624 gene locus_tag LOCUS_02180 gene murI 30782 31624 CDS product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943554.1 protein_id gnl|my_center|LOCUS_02180 31624 32229 gene locus_tag LOCUS_02190 31624 32229 CDS product GerMN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943553.1 protein_id gnl|my_center|LOCUS_02190 32226 34664 gene locus_tag LOCUS_02200 32226 34664 CDS product homocysteine S-methyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943552.1 protein_id gnl|my_center|LOCUS_02200 34740 35261 gene locus_tag LOCUS_02210 34740 35261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943551.1 protein_id gnl|my_center|LOCUS_02210 36136 35366 gene locus_tag LOCUS_02220 36136 35366 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941936.1 protein_id gnl|my_center|LOCUS_02220 36945 36133 gene locus_tag LOCUS_02230 gene cbiQ 36945 36133 CDS product cobalt ECF transporter T component CbiQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941935.1 protein_id gnl|my_center|LOCUS_02230 37116 37532 gene locus_tag LOCUS_02240 gene nikR 37116 37532 CDS product nickel-responsive transcriptional regulator NikR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943609.1 protein_id gnl|my_center|LOCUS_02240 37548 37925 gene locus_tag LOCUS_02250 gene crcB 37548 37925 CDS product fluoride efflux transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941171.1 protein_id gnl|my_center|LOCUS_02250 37939 38286 gene locus_tag LOCUS_02260 37939 38286 CDS product DUF190 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941172.1 protein_id gnl|my_center|LOCUS_02260 38346 39329 gene locus_tag LOCUS_02270 38346 39329 CDS product GDP-L-fucose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941290.1 protein_id gnl|my_center|LOCUS_02270 39391 40005 gene locus_tag LOCUS_02280 39391 40005 CDS product winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941288.1 protein_id gnl|my_center|LOCUS_02280 40046 41005 gene locus_tag LOCUS_02290 gene gmd 40046 41005 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056481.1 protein_id gnl|my_center|LOCUS_02290 41086 42570 gene locus_tag LOCUS_02300 41086 42570 CDS product lipopolysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765891.1 protein_id gnl|my_center|LOCUS_02300 42581 43411 gene locus_tag LOCUS_02310 42581 43411 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546558.1 protein_id gnl|my_center|LOCUS_02310 43564 44460 gene locus_tag LOCUS_02320 43564 44460 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966350.1 protein_id gnl|my_center|LOCUS_02320 44480 45244 gene locus_tag LOCUS_02330 44480 45244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02330 45249 46472 gene locus_tag LOCUS_02340 45249 46472 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545872.1 protein_id gnl|my_center|LOCUS_02340 46469 47455 gene locus_tag LOCUS_02350 46469 47455 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875811.1 protein_id gnl|my_center|LOCUS_02350 47471 48478 gene locus_tag LOCUS_02360 47471 48478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02360 48475 49443 gene locus_tag LOCUS_02370 48475 49443 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257103.1 protein_id gnl|my_center|LOCUS_02370 49508 50308 gene locus_tag LOCUS_02380 49508 50308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_02380 50396 51982 gene locus_tag LOCUS_02390 50396 51982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_02390 52108 53730 gene locus_tag LOCUS_02400 52108 53730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02400 53778 54725 gene locus_tag LOCUS_02410 53778 54725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02410 54751 55464 gene locus_tag LOCUS_02420 54751 55464 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941299.1 protein_id gnl|my_center|LOCUS_02420 56403 55537 gene locus_tag LOCUS_02430 56403 55537 CDS product chemotaxis protein CheX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942263.1 protein_id gnl|my_center|LOCUS_02430 56799 56440 gene locus_tag LOCUS_02440 56799 56440 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942264.1 protein_id gnl|my_center|LOCUS_02440 56982 58001 gene locus_tag LOCUS_02450 56982 58001 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943066.1 protein_id gnl|my_center|LOCUS_02450 58212 61010 gene locus_tag LOCUS_02460 58212 61010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02460 61007 62422 gene locus_tag LOCUS_02470 61007 62422 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941905.1 protein_id gnl|my_center|LOCUS_02470 62689 64332 gene locus_tag LOCUS_02480 62689 64332 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941068.1 protein_id gnl|my_center|LOCUS_02480 64382 64753 gene locus_tag LOCUS_02490 64382 64753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02490 >Feature sequence005 2853 1468 gene locus_tag LOCUS_02500 2853 1468 CDS product outer membrane protein transport protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940349.1 protein_id gnl|my_center|LOCUS_02500 3483 5291 gene locus_tag LOCUS_02510 3483 5291 CDS product AMP-dependent synthetase/ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926994.1 protein_id gnl|my_center|LOCUS_02510 5328 7715 gene locus_tag LOCUS_02520 5328 7715 CDS product 3-hydroxyacyl-CoA dehydrogenase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272544.1 protein_id gnl|my_center|LOCUS_02520 7844 9016 gene locus_tag LOCUS_02530 7844 9016 CDS product thiolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259064.1 protein_id gnl|my_center|LOCUS_02530 9085 10863 gene locus_tag LOCUS_02540 9085 10863 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172981.1 protein_id gnl|my_center|LOCUS_02540 10883 11860 gene locus_tag LOCUS_02550 10883 11860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02550 11857 12801 gene locus_tag LOCUS_02560 11857 12801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02560 12717 12726 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 12821 13921 gene locus_tag LOCUS_02570 12821 13921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02570 13946 14500 gene locus_tag LOCUS_02580 13946 14500 CDS product chalcone isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073158.1 protein_id gnl|my_center|LOCUS_02580 14521 14907 gene locus_tag LOCUS_02590 14521 14907 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114776.1 protein_id gnl|my_center|LOCUS_02590 14937 15713 gene locus_tag LOCUS_02600 14937 15713 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004201757.1 protein_id gnl|my_center|LOCUS_02600 16242 15844 gene locus_tag LOCUS_02610 gene zntR 16242 15844 CDS product Zn(2+)-responsive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456436.1 protein_id gnl|my_center|LOCUS_02610 16888 16478 gene locus_tag LOCUS_02620 16888 16478 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878176.1 protein_id gnl|my_center|LOCUS_02620 17210 17755 gene locus_tag LOCUS_02630 17210 17755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02630 17782 21033 gene locus_tag LOCUS_02640 17782 21033 CDS product methylmalonyl-CoA mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224369.1 protein_id gnl|my_center|LOCUS_02640 21088 21864 gene locus_tag LOCUS_02650 21088 21864 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815367.1 protein_id gnl|my_center|LOCUS_02650 22003 23181 gene locus_tag LOCUS_02660 22003 23181 CDS product thiolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207591.1 protein_id gnl|my_center|LOCUS_02660 23191 24036 gene locus_tag LOCUS_02670 23191 24036 CDS product 3-hydroxybutyryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529423.1 protein_id gnl|my_center|LOCUS_02670 24176 25315 gene locus_tag LOCUS_02680 24176 25315 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048186.1 protein_id gnl|my_center|LOCUS_02680 25683 26840 gene locus_tag LOCUS_02690 25683 26840 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816049.1 protein_id gnl|my_center|LOCUS_02690 26854 27822 gene locus_tag LOCUS_02700 26854 27822 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811552.1 protein_id gnl|my_center|LOCUS_02700 27824 28639 gene locus_tag LOCUS_02710 27824 28639 CDS product glutaconate CoA-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272325.1 protein_id gnl|my_center|LOCUS_02710 28666 29604 gene locus_tag LOCUS_02720 28666 29604 CDS product nucleoside recognition domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015706000.1 protein_id gnl|my_center|LOCUS_02720 29745 31730 gene locus_tag LOCUS_02730 29745 31730 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226986815.1 protein_id gnl|my_center|LOCUS_02730 31878 32654 gene locus_tag LOCUS_02740 31878 32654 CDS product electron transfer flavoprotein subunit beta/FixA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226986814.1 protein_id gnl|my_center|LOCUS_02740 32664 33578 gene locus_tag LOCUS_02750 32664 33578 CDS product electron transfer flavoprotein subunit alpha/FixB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933795.1 protein_id gnl|my_center|LOCUS_02750 33611 34783 gene locus_tag LOCUS_02760 gene sucC 33611 34783 CDS product ADP-forming succinate--CoA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001020785.1 protein_id gnl|my_center|LOCUS_02760 34780 35652 gene locus_tag LOCUS_02770 gene sucD 34780 35652 CDS product succinate--CoA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327387.1 protein_id gnl|my_center|LOCUS_02770 35667 36479 gene locus_tag LOCUS_02780 35667 36479 CDS product electron transfer flavoprotein subunit beta/FixA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943424.1 protein_id gnl|my_center|LOCUS_02780 36510 37862 gene locus_tag LOCUS_02790 36510 37862 CDS product electron transfer flavoprotein subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943423.1 protein_id gnl|my_center|LOCUS_02790 38092 37925 gene locus_tag LOCUS_02800 38092 37925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02800 38033 39871 gene locus_tag LOCUS_02810 38033 39871 CDS product heterodisulfide reductase-related iron-sulfur binding cluster inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943422.1 protein_id gnl|my_center|LOCUS_02810 41491 39962 gene locus_tag LOCUS_02820 41491 39962 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943060.1 protein_id gnl|my_center|LOCUS_02820 41958 41491 gene locus_tag LOCUS_02830 41958 41491 CDS product hydrogenase maturation protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193360257.1 protein_id gnl|my_center|LOCUS_02830 42386 41931 gene locus_tag LOCUS_02840 42386 41931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943058.1 protein_id gnl|my_center|LOCUS_02840 42637 42383 gene locus_tag LOCUS_02850 42637 42383 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943057.1 protein_id gnl|my_center|LOCUS_02850 44058 42643 gene locus_tag LOCUS_02860 44058 42643 CDS product Ni/Fe hydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943056.1 protein_id gnl|my_center|LOCUS_02860 45005 44055 gene locus_tag LOCUS_02870 45005 44055 CDS product methyl viologen-reducing hydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943055.1 protein_id gnl|my_center|LOCUS_02870 45496 45002 gene locus_tag LOCUS_02880 45496 45002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943054.1 protein_id gnl|my_center|LOCUS_02880 45931 45506 gene locus_tag LOCUS_02890 45931 45506 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940969.1 protein_id gnl|my_center|LOCUS_02890 49049 46362 gene locus_tag LOCUS_02900 49049 46362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02900 50311 49688 gene locus_tag LOCUS_02910 50311 49688 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919061.1 protein_id gnl|my_center|LOCUS_02910 50511 50762 gene locus_tag LOCUS_02920 50511 50762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02920 50763 51170 gene locus_tag LOCUS_02930 50763 51170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_02930 51337 52458 gene locus_tag LOCUS_02940 51337 52458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02940 53250 53873 gene locus_tag LOCUS_02950 53250 53873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02950 53866 55395 gene locus_tag LOCUS_02960 53866 55395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02960 55409 56941 gene locus_tag LOCUS_02970 55409 56941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02970 56938 57378 gene locus_tag LOCUS_02980 56938 57378 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259372.1 protein_id gnl|my_center|LOCUS_02980 57472 59418 gene locus_tag LOCUS_02990 57472 59418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02990 >Feature sequence006 1014 1820 gene locus_tag LOCUS_03000 1014 1820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03000 2327 2914 gene locus_tag LOCUS_03010 2327 2914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03010 2918 3898 gene locus_tag LOCUS_03020 2918 3898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03020 4198 4019 gene locus_tag LOCUS_03030 4198 4019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03030 4525 4334 gene locus_tag LOCUS_03040 4525 4334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03040 5106 6164 gene locus_tag LOCUS_03050 5106 6164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03050 6378 6169 gene locus_tag LOCUS_03060 6378 6169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03060 6269 6877 gene locus_tag LOCUS_03070 6269 6877 CDS product DapH/DapD/GlmU-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000601187.1 protein_id gnl|my_center|LOCUS_03070 6874 7983 gene locus_tag LOCUS_03080 6874 7983 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009039953.1 protein_id gnl|my_center|LOCUS_03080 7976 8758 gene locus_tag LOCUS_03090 7976 8758 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107719.1 protein_id gnl|my_center|LOCUS_03090 8728 10413 gene locus_tag LOCUS_03100 8728 10413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03100 10527 12200 gene locus_tag LOCUS_03110 10527 12200 CDS product capsule assembly Wzi family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942489.1 protein_id gnl|my_center|LOCUS_03110 12351 15260 gene locus_tag LOCUS_03120 12351 15260 CDS product SLBB domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942486.1 protein_id gnl|my_center|LOCUS_03120 15269 16504 gene locus_tag LOCUS_03130 15269 16504 CDS product Wzz/FepE/Etk N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942498.1 protein_id gnl|my_center|LOCUS_03130 16622 18103 gene locus_tag LOCUS_03140 gene cysS 16622 18103 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943976.1 protein_id gnl|my_center|LOCUS_03140 18233 19861 gene locus_tag LOCUS_03150 18233 19861 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943864.1 protein_id gnl|my_center|LOCUS_03150 19858 20238 gene locus_tag LOCUS_03160 19858 20238 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943865.1 protein_id gnl|my_center|LOCUS_03160 20299 22803 gene locus_tag LOCUS_03170 20299 22803 CDS product mannose-1-phosphate guanyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943866.1 protein_id gnl|my_center|LOCUS_03170 22846 24999 gene locus_tag LOCUS_03180 22846 24999 CDS product glycoside hydrolase family 57 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943867.1 protein_id gnl|my_center|LOCUS_03180 25092 26117 gene locus_tag LOCUS_03190 gene galT 25092 26117 CDS product galactose-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943868.1 protein_id gnl|my_center|LOCUS_03190 26110 26973 gene locus_tag LOCUS_03200 26110 26973 CDS product TIGR02757 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941192.1 protein_id gnl|my_center|LOCUS_03200 27220 28575 gene locus_tag LOCUS_03210 27220 28575 CDS product DUF3426 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943347.1 protein_id gnl|my_center|LOCUS_03210 29186 28671 gene locus_tag LOCUS_03220 29186 28671 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940903.1 protein_id gnl|my_center|LOCUS_03220 29593 29273 gene locus_tag LOCUS_03230 29593 29273 CDS product DUF167 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041914001.1 protein_id gnl|my_center|LOCUS_03230 30032 29580 gene locus_tag LOCUS_03240 30032 29580 CDS product DivIVA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941529.1 protein_id gnl|my_center|LOCUS_03240 30969 30148 gene locus_tag LOCUS_03250 30969 30148 CDS product LysM peptidoglycan-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943888.1 protein_id gnl|my_center|LOCUS_03250 33583 30971 gene locus_tag LOCUS_03260 33583 30971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235045036.1 protein_id gnl|my_center|LOCUS_03260 35074 33854 gene locus_tag LOCUS_03270 35074 33854 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941878.1 protein_id gnl|my_center|LOCUS_03270 35306 37138 gene locus_tag LOCUS_03280 gene uvrC 35306 37138 CDS product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943890.1 protein_id gnl|my_center|LOCUS_03280 37131 38066 gene locus_tag LOCUS_03290 gene miaA 37131 38066 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795937.1 protein_id gnl|my_center|LOCUS_03290 38225 38425 gene locus_tag LOCUS_03300 38225 38425 CDS product cold shock domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940866.1 protein_id gnl|my_center|LOCUS_03300 38870 38544 gene locus_tag LOCUS_03310 38870 38544 CDS product YggT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941530.1 protein_id gnl|my_center|LOCUS_03310 39027 39347 gene locus_tag LOCUS_03320 39027 39347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940961.1 protein_id gnl|my_center|LOCUS_03320 39461 40444 gene locus_tag LOCUS_03330 39461 40444 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940962.1 protein_id gnl|my_center|LOCUS_03330 40569 41384 gene locus_tag LOCUS_03340 40569 41384 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942484.1 protein_id gnl|my_center|LOCUS_03340 42525 41476 gene locus_tag LOCUS_03350 42525 41476 CDS product chemotaxis protein CheR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940963.1 protein_id gnl|my_center|LOCUS_03350 43604 42525 gene locus_tag LOCUS_03360 gene mqnE 43604 42525 CDS product aminofutalosine synthase MqnE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941110.1 protein_id gnl|my_center|LOCUS_03360 44657 43656 gene locus_tag LOCUS_03370 gene pdxA 44657 43656 CDS product 4-hydroxythreonine-4-phosphate dehydrogenase PdxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940791.1 protein_id gnl|my_center|LOCUS_03370 45727 44657 gene locus_tag LOCUS_03380 45727 44657 CDS product cobalt-precorrin 5A hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943623.1 protein_id gnl|my_center|LOCUS_03380 46499 45720 gene locus_tag LOCUS_03390 gene cobM 46499 45720 CDS product precorrin-4 C(11)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943624.1 protein_id gnl|my_center|LOCUS_03390 46691 47533 gene locus_tag LOCUS_03400 46691 47533 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941678.1 protein_id gnl|my_center|LOCUS_03400 47539 48243 gene locus_tag LOCUS_03410 47539 48243 CDS product Smr/MutS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941679.1 protein_id gnl|my_center|LOCUS_03410 48330 48620 gene locus_tag LOCUS_03420 48330 48620 CDS product Dabb family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943600.1 protein_id gnl|my_center|LOCUS_03420 48821 50416 gene locus_tag LOCUS_03430 48821 50416 CDS product acetyl-CoA hydrolase/transferase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941158.1 protein_id gnl|my_center|LOCUS_03430 50568 51269 gene locus_tag LOCUS_03440 50568 51269 CDS product DUF4388 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943279.1 protein_id gnl|my_center|LOCUS_03440 51282 51968 gene locus_tag LOCUS_03450 51282 51968 CDS product roadblock/LC7 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943278.1 protein_id gnl|my_center|LOCUS_03450 52920 52015 gene locus_tag LOCUS_03460 gene xerC 52920 52015 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941160.1 protein_id gnl|my_center|LOCUS_03460 53347 52937 gene locus_tag LOCUS_03470 53347 52937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03470 55188 53344 gene locus_tag LOCUS_03480 55188 53344 CDS product bifunctional homocysteine S-methyltransferase/methylenetetrahydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943603.1 protein_id gnl|my_center|LOCUS_03480 55268 55876 gene locus_tag LOCUS_03490 55268 55876 CDS product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943605.1 protein_id gnl|my_center|LOCUS_03490 >Feature sequence007 459 151 gene locus_tag LOCUS_03500 459 151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_03500 3309 466 gene locus_tag LOCUS_03510 3309 466 CDS product type I restriction endonuclease subunit R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103421.1 protein_id gnl|my_center|LOCUS_03510 4814 3303 gene locus_tag LOCUS_03520 4814 3303 CDS product putative DNA binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109168.1 protein_id gnl|my_center|LOCUS_03520 6142 4811 gene locus_tag LOCUS_03530 6142 4811 CDS product restriction endonuclease subunit S inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926902.1 protein_id gnl|my_center|LOCUS_03530 7838 6132 gene locus_tag LOCUS_03540 7838 6132 CDS product class I SAM-dependent DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039057.1 protein_id gnl|my_center|LOCUS_03540 8561 7878 gene locus_tag LOCUS_03550 8561 7878 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941164.1 protein_id gnl|my_center|LOCUS_03550 9815 8562 gene locus_tag LOCUS_03560 9815 8562 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941163.1 protein_id gnl|my_center|LOCUS_03560 10383 12698 gene locus_tag LOCUS_03570 gene lon 10383 12698 CDS product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941591.1 protein_id gnl|my_center|LOCUS_03570 12705 13478 gene locus_tag LOCUS_03580 12705 13478 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941592.1 protein_id gnl|my_center|LOCUS_03580 13480 13962 gene locus_tag LOCUS_03590 13480 13962 CDS product EVE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942915.1 protein_id gnl|my_center|LOCUS_03590 13959 14711 gene locus_tag LOCUS_03600 13959 14711 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941593.1 protein_id gnl|my_center|LOCUS_03600 14758 15840 gene locus_tag LOCUS_03610 14758 15840 CDS product MlaD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941594.1 protein_id gnl|my_center|LOCUS_03610 15853 17337 gene locus_tag LOCUS_03620 15853 17337 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941595.1 protein_id gnl|my_center|LOCUS_03620 17334 18773 gene locus_tag LOCUS_03630 17334 18773 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941596.1 protein_id gnl|my_center|LOCUS_03630 20348 18774 gene locus_tag LOCUS_03640 20348 18774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941782.1 protein_id gnl|my_center|LOCUS_03640 20751 20353 gene locus_tag LOCUS_03650 20751 20353 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941781.1 protein_id gnl|my_center|LOCUS_03650 21291 20842 gene locus_tag LOCUS_03660 21291 20842 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941779.1 protein_id gnl|my_center|LOCUS_03660 21696 21322 gene locus_tag LOCUS_03670 21696 21322 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941778.1 protein_id gnl|my_center|LOCUS_03670 22703 21816 gene locus_tag LOCUS_03680 22703 21816 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941776.1 protein_id gnl|my_center|LOCUS_03680 23464 22700 gene locus_tag LOCUS_03690 23464 22700 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941775.1 protein_id gnl|my_center|LOCUS_03690 24369 23461 gene locus_tag LOCUS_03700 24369 23461 CDS product PfkB family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941774.1 protein_id gnl|my_center|LOCUS_03700 25521 24535 gene locus_tag LOCUS_03710 gene flhB 25521 24535 CDS product flagellar biosynthesis protein FlhB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941095.1 protein_id gnl|my_center|LOCUS_03710 26406 25612 gene locus_tag LOCUS_03720 gene fliR 26406 25612 CDS product flagellar biosynthetic protein FliR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941094.1 protein_id gnl|my_center|LOCUS_03720 26682 26413 gene locus_tag LOCUS_03730 gene fliQ 26682 26413 CDS product flagellar biosynthesis protein FliQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941093.1 protein_id gnl|my_center|LOCUS_03730 27460 26693 gene locus_tag LOCUS_03740 gene fliP 27460 26693 CDS product flagellar type III secretion system pore protein FliP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941092.1 protein_id gnl|my_center|LOCUS_03740 27876 27457 gene locus_tag LOCUS_03750 gene fliO 27876 27457 CDS product flagellar biosynthetic protein FliO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941091.1 protein_id gnl|my_center|LOCUS_03750 28172 27873 gene locus_tag LOCUS_03760 gene fliN 28172 27873 CDS product flagellar motor switch protein FliN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941090.1 protein_id gnl|my_center|LOCUS_03760 29161 28172 gene locus_tag LOCUS_03770 gene fliM 29161 28172 CDS product flagellar motor switch protein FliM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941089.1 protein_id gnl|my_center|LOCUS_03770 29723 29169 gene locus_tag LOCUS_03780 29723 29169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03780 31209 29887 gene locus_tag LOCUS_03790 31209 29887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03790 31700 31314 gene locus_tag LOCUS_03800 31700 31314 CDS product TIGR02530 family flagellar biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941086.1 protein_id gnl|my_center|LOCUS_03800 32365 31706 gene locus_tag LOCUS_03810 32365 31706 CDS product flagellar hook assembly protein FlgD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941085.1 protein_id gnl|my_center|LOCUS_03810 34113 32380 gene locus_tag LOCUS_03820 34113 32380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03820 34728 34177 gene locus_tag LOCUS_03830 34728 34177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03830 35168 34725 gene locus_tag LOCUS_03840 gene fliJ 35168 34725 CDS product flagellar export protein FliJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941082.1 protein_id gnl|my_center|LOCUS_03840 36517 35198 gene locus_tag LOCUS_03850 36517 35198 CDS product FliI/YscN family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941081.1 protein_id gnl|my_center|LOCUS_03850 37260 36535 gene locus_tag LOCUS_03860 37260 36535 CDS product FliH/SctL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941080.1 protein_id gnl|my_center|LOCUS_03860 38239 37247 gene locus_tag LOCUS_03870 gene fliG 38239 37247 CDS product flagellar motor switch protein FliG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941079.1 protein_id gnl|my_center|LOCUS_03870 39887 38307 gene locus_tag LOCUS_03880 gene fliF 39887 38307 CDS product flagellar basal-body MS-ring/collar protein FliF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941078.1 protein_id gnl|my_center|LOCUS_03880 40263 39961 gene locus_tag LOCUS_03890 gene fliE 40263 39961 CDS product flagellar hook-basal body complex protein FliE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941077.1 protein_id gnl|my_center|LOCUS_03890 40819 40382 gene locus_tag LOCUS_03900 gene flgC 40819 40382 CDS product flagellar basal body rod protein FlgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941076.1 protein_id gnl|my_center|LOCUS_03900 41257 40823 gene locus_tag LOCUS_03910 gene flgB 41257 40823 CDS product flagellar basal body rod protein FlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941075.1 protein_id gnl|my_center|LOCUS_03910 43563 41464 gene locus_tag LOCUS_03920 43563 41464 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941074.1 protein_id gnl|my_center|LOCUS_03920 44649 43582 gene locus_tag LOCUS_03930 44649 43582 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941073.1 protein_id gnl|my_center|LOCUS_03930 45232 44726 gene locus_tag LOCUS_03940 45232 44726 CDS product chemotaxis protein CheX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941072.1 protein_id gnl|my_center|LOCUS_03940 45594 45229 gene locus_tag LOCUS_03950 45594 45229 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941071.1 protein_id gnl|my_center|LOCUS_03950 47154 45745 gene locus_tag LOCUS_03960 47154 45745 CDS product phosphoglucomutase/phosphomannomutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943934.1 protein_id gnl|my_center|LOCUS_03960 47449 47177 gene locus_tag LOCUS_03970 47449 47177 CDS product EscU/YscU/HrcU family type III secretion system export apparatus switch protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941037.1 protein_id gnl|my_center|LOCUS_03970 49664 47433 gene locus_tag LOCUS_03980 49664 47433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03980 52230 49666 gene locus_tag LOCUS_03990 52230 49666 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941039.1 protein_id gnl|my_center|LOCUS_03990 53452 52241 gene locus_tag LOCUS_04000 gene gspF 53452 52241 CDS product type II secretion system inner membrane protein GspF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940995.1 protein_id gnl|my_center|LOCUS_04000 >Feature sequence008 323 658 gene locus_tag LOCUS_04010 323 658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943272.1 protein_id gnl|my_center|LOCUS_04010 777 986 gene locus_tag LOCUS_04020 777 986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04020 2916 1042 gene locus_tag LOCUS_04030 2916 1042 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941590.1 protein_id gnl|my_center|LOCUS_04030 3746 3216 gene locus_tag LOCUS_04040 3746 3216 CDS product O-acetyl-ADP-ribose deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941194.1 protein_id gnl|my_center|LOCUS_04040 4663 3911 gene locus_tag LOCUS_04050 4663 3911 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943860.1 protein_id gnl|my_center|LOCUS_04050 5070 4726 gene locus_tag LOCUS_04060 5070 4726 CDS product nitrous oxide-stimulated promoter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943861.1 protein_id gnl|my_center|LOCUS_04060 5202 5714 gene locus_tag LOCUS_04070 5202 5714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04070 5896 5699 gene locus_tag LOCUS_04080 5896 5699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04080 6042 8378 gene locus_tag LOCUS_04090 6042 8378 CDS product DNA translocase FtsK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943733.1 protein_id gnl|my_center|LOCUS_04090 8766 8602 gene locus_tag LOCUS_04100 8766 8602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04100 9440 8835 gene locus_tag LOCUS_04110 9440 8835 CDS product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938929.1 protein_id gnl|my_center|LOCUS_04110 9615 9947 gene locus_tag LOCUS_04120 9615 9947 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_045599895.1 protein_id gnl|my_center|LOCUS_04120 9937 10251 gene locus_tag LOCUS_04130 9937 10251 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770554.1 protein_id gnl|my_center|LOCUS_04130 10502 10311 gene locus_tag LOCUS_04140 10502 10311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04140 11920 11447 gene locus_tag LOCUS_04150 gene greB 11920 11447 CDS product transcription elongation factor GreB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941858.1 protein_id gnl|my_center|LOCUS_04150 12439 11999 gene locus_tag LOCUS_04160 12439 11999 CDS product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942914.1 protein_id gnl|my_center|LOCUS_04160 12971 12624 gene locus_tag LOCUS_04170 12971 12624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04170 13337 14737 gene locus_tag LOCUS_04180 13337 14737 CDS product FAD-linked oxidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943908.1 protein_id gnl|my_center|LOCUS_04180 14727 15035 gene locus_tag LOCUS_04190 14727 15035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04190 15025 15609 gene locus_tag LOCUS_04200 15025 15609 CDS product Maf family nucleotide pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943181.1 protein_id gnl|my_center|LOCUS_04200 15616 16299 gene locus_tag LOCUS_04210 15616 16299 CDS product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943180.1 protein_id gnl|my_center|LOCUS_04210 17067 16303 gene locus_tag LOCUS_04220 gene mqnB 17067 16303 CDS product futalosine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941120.1 protein_id gnl|my_center|LOCUS_04220 17696 17064 gene locus_tag LOCUS_04230 17696 17064 CDS product TIGR04282 family arsenosugar biosynthesis glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235044955.1 protein_id gnl|my_center|LOCUS_04230 18499 17693 gene locus_tag LOCUS_04240 gene folE2 18499 17693 CDS product GTP cyclohydrolase FolE2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941152.1 protein_id gnl|my_center|LOCUS_04240 19104 18496 gene locus_tag LOCUS_04250 gene yihA 19104 18496 CDS product ribosome biogenesis GTP-binding protein YihA/YsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943641.1 protein_id gnl|my_center|LOCUS_04250 19294 20283 gene locus_tag LOCUS_04260 gene nuoH 19294 20283 CDS product NADH-quinone oxidoreductase subunit NuoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944046.1 protein_id gnl|my_center|LOCUS_04260 20335 20745 gene locus_tag LOCUS_04270 20335 20745 CDS product ankyrin repeat domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944045.1 protein_id gnl|my_center|LOCUS_04270 20742 21272 gene locus_tag LOCUS_04280 gene nuoI 20742 21272 CDS product NADH-quinone oxidoreductase subunit NuoI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944044.1 protein_id gnl|my_center|LOCUS_04280 21269 21775 gene locus_tag LOCUS_04290 21269 21775 CDS product NADH-quinone oxidoreductase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944043.1 protein_id gnl|my_center|LOCUS_04290 21772 22080 gene locus_tag LOCUS_04300 gene nuoK 21772 22080 CDS product NADH-quinone oxidoreductase subunit NuoK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944042.1 protein_id gnl|my_center|LOCUS_04300 22082 23974 gene locus_tag LOCUS_04310 gene nuoL 22082 23974 CDS product NADH-quinone oxidoreductase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944041.1 protein_id gnl|my_center|LOCUS_04310 24439 24041 gene locus_tag LOCUS_04320 24439 24041 CDS product aspartate 1-decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887363.1 protein_id gnl|my_center|LOCUS_04320 25293 24442 gene locus_tag LOCUS_04330 gene panC 25293 24442 CDS product pantoate--beta-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942350.1 protein_id gnl|my_center|LOCUS_04330 25738 25301 gene locus_tag LOCUS_04340 25738 25301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_04340 26191 25808 gene locus_tag LOCUS_04350 26191 25808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_04350 25812 25821 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 28500 26524 gene locus_tag LOCUS_04360 28500 26524 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942348.1 protein_id gnl|my_center|LOCUS_04360 28904 28533 gene locus_tag LOCUS_04370 28904 28533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04370 29920 28943 gene locus_tag LOCUS_04380 29920 28943 CDS product class II fructose-1,6-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798895.1 protein_id gnl|my_center|LOCUS_04380 30625 30792 gene locus_tag LOCUS_04390 30625 30792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04390 30807 31073 gene locus_tag LOCUS_04400 30807 31073 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546355.1 protein_id gnl|my_center|LOCUS_04400 31436 31143 gene locus_tag LOCUS_04410 31436 31143 CDS product DUF2164 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550097.1 protein_id gnl|my_center|LOCUS_04410 32517 31477 gene locus_tag LOCUS_04420 32517 31477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04420 33797 32703 gene locus_tag LOCUS_04430 33797 32703 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046463959.1 protein_id gnl|my_center|LOCUS_04430 34167 34080 gene locus_tag LOCUS_t00030 34167 34080 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 34736 34251 gene locus_tag LOCUS_04440 34736 34251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04440 36068 34797 gene locus_tag LOCUS_04450 gene serS 36068 34797 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940715.1 protein_id gnl|my_center|LOCUS_04450 36149 37252 gene locus_tag LOCUS_04460 36149 37252 CDS product CapA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940714.1 protein_id gnl|my_center|LOCUS_04460 37265 38989 gene locus_tag LOCUS_04470 37265 38989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04470 39258 38992 gene locus_tag LOCUS_04480 39258 38992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04480 39607 41424 gene locus_tag LOCUS_04490 39607 41424 CDS product KUP/HAK/KT family potassium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943122.1 protein_id gnl|my_center|LOCUS_04490 41430 42443 gene locus_tag LOCUS_04500 41430 42443 CDS product sodium:calcium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392337.1 protein_id gnl|my_center|LOCUS_04500 43344 42427 gene locus_tag LOCUS_04510 43344 42427 CDS product TIGR01212 family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941035.1 protein_id gnl|my_center|LOCUS_04510 43870 43349 gene locus_tag LOCUS_04520 43870 43349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04520 44931 44200 gene locus_tag LOCUS_04530 44931 44200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04530 <48800 44900 gene locus_tag LOCUS_04540 <48800 44900 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_104543246.1:autotransporter-associated beta strand repeat-containing protein >Feature sequence009 1312 770 gene locus_tag LOCUS_04550 gene atpH 1312 770 CDS product ATP synthase F1 subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940786.1 protein_id gnl|my_center|LOCUS_04550 1914 1309 gene locus_tag LOCUS_04560 1914 1309 CDS product ATP synthase F0 subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940785.1 protein_id gnl|my_center|LOCUS_04560 2342 1917 gene locus_tag LOCUS_04570 2342 1917 CDS product ATP synthase F0 subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940784.1 protein_id gnl|my_center|LOCUS_04570 3511 2657 gene locus_tag LOCUS_04580 3511 2657 CDS product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940783.1 protein_id gnl|my_center|LOCUS_04580 4286 3504 gene locus_tag LOCUS_04590 4286 3504 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940782.1 protein_id gnl|my_center|LOCUS_04590 6029 4557 gene locus_tag LOCUS_04600 6029 4557 CDS product VCBS repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943918.1 protein_id gnl|my_center|LOCUS_04600 7502 6138 gene locus_tag LOCUS_04610 7502 6138 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943916.1 protein_id gnl|my_center|LOCUS_04610 9449 8175 gene locus_tag LOCUS_04620 9449 8175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04620 10576 9599 gene locus_tag LOCUS_04630 10576 9599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04630 11131 10727 gene locus_tag LOCUS_04640 gene mce 11131 10727 CDS product methylmalonyl-CoA epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943915.1 protein_id gnl|my_center|LOCUS_04640 12812 11160 gene locus_tag LOCUS_04650 12812 11160 CDS product methylmalonyl-CoA mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943914.1 protein_id gnl|my_center|LOCUS_04650 15820 12911 gene locus_tag LOCUS_04660 15820 12911 CDS product biotin carboxylase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943912.1 protein_id gnl|my_center|LOCUS_04660 17578 15854 gene locus_tag LOCUS_04670 17578 15854 CDS product carboxyl transferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943911.1 protein_id gnl|my_center|LOCUS_04670 18240 17677 gene locus_tag LOCUS_04680 18240 17677 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943910.1 protein_id gnl|my_center|LOCUS_04680 19663 18383 gene locus_tag LOCUS_04690 19663 18383 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943909.1 protein_id gnl|my_center|LOCUS_04690 21149 19827 gene locus_tag LOCUS_04700 gene trmFO 21149 19827 CDS product methylenetetrahydrofolate--tRNA-(uracil(54)-C(5))-methyltransferase (FADH(2)-oxidizing) TrmFO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943183.1 protein_id gnl|my_center|LOCUS_04700 22080 21361 gene locus_tag LOCUS_04710 22080 21361 CDS product BRO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962647.1 protein_id gnl|my_center|LOCUS_04710 22258 22070 gene locus_tag LOCUS_04720 22258 22070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04720 24539 22239 gene locus_tag LOCUS_04730 gene topA 24539 22239 CDS product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943185.1 protein_id gnl|my_center|LOCUS_04730 25682 24591 gene locus_tag LOCUS_04740 gene dprA 25682 24591 CDS product DNA-processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943186.1 protein_id gnl|my_center|LOCUS_04740 26771 25752 gene locus_tag LOCUS_04750 26771 25752 CDS product LysM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041914065.1 protein_id gnl|my_center|LOCUS_04750 27573 26845 gene locus_tag LOCUS_04760 gene ybgF 27573 26845 CDS product tol-pal system protein YbgF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943188.1 protein_id gnl|my_center|LOCUS_04760 27732 28967 gene locus_tag LOCUS_04770 27732 28967 CDS product U32 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943192.1 protein_id gnl|my_center|LOCUS_04770 29101 32820 gene locus_tag LOCUS_04780 29101 32820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04780 32817 33359 gene locus_tag LOCUS_04790 32817 33359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04790 33331 33570 gene locus_tag LOCUS_04800 33331 33570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04800 33567 35930 gene locus_tag LOCUS_04810 33567 35930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04810 35927 36757 gene locus_tag LOCUS_04820 35927 36757 CDS product protein-glutamate O-methyltransferase CheR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002079012.1 protein_id gnl|my_center|LOCUS_04820 36747 37337 gene locus_tag LOCUS_04830 36747 37337 CDS product chemotaxis protein CheB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001105137.1 protein_id gnl|my_center|LOCUS_04830 37334 39487 gene locus_tag LOCUS_04840 37334 39487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04840 39579 40940 gene locus_tag LOCUS_04850 gene dnaB 39579 40940 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941663.1 protein_id gnl|my_center|LOCUS_04850 40979 42628 gene locus_tag LOCUS_04860 40979 42628 CDS product ATPase, T2SS/T4P/T4SS family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941104.1 protein_id gnl|my_center|LOCUS_04860 42720 43781 gene locus_tag LOCUS_04870 42720 43781 CDS product type IV pilus twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941105.1 protein_id gnl|my_center|LOCUS_04870 43849 43858 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 44146 46413 gene locus_tag LOCUS_04880 44146 46413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04880 46538 47026 gene locus_tag LOCUS_04890 gene moaC 46538 47026 CDS product cyclic pyranopterin monophosphate synthase MoaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943342.1 protein_id gnl|my_center|LOCUS_04890 47039 47827 gene locus_tag LOCUS_04900 47039 47827 CDS product sterol desaturase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005453865.1 protein_id gnl|my_center|LOCUS_04900 >Feature sequence010 322 161 gene locus_tag LOCUS_04910 322 161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04910 349 1851 gene locus_tag LOCUS_04920 349 1851 CDS product lytic transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941675.1 protein_id gnl|my_center|LOCUS_04920 1895 2635 gene locus_tag LOCUS_04930 1895 2635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941676.1 protein_id gnl|my_center|LOCUS_04930 2746 3243 gene locus_tag LOCUS_04940 2746 3243 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940969.1 protein_id gnl|my_center|LOCUS_04940 4648 3335 gene locus_tag LOCUS_04950 4648 3335 CDS product DUF512 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942640.1 protein_id gnl|my_center|LOCUS_04950 5063 4839 gene locus_tag LOCUS_04960 gene hfq 5063 4839 CDS product RNA chaperone Hfq inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942642.1 protein_id gnl|my_center|LOCUS_04960 6010 5078 gene locus_tag LOCUS_04970 gene miaA 6010 5078 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942643.1 protein_id gnl|my_center|LOCUS_04970 7827 6007 gene locus_tag LOCUS_04980 gene mutL 7827 6007 CDS product DNA mismatch repair endonuclease MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942644.1 protein_id gnl|my_center|LOCUS_04980 8477 7902 gene locus_tag LOCUS_04990 8477 7902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941113.1 protein_id gnl|my_center|LOCUS_04990 9248 8502 gene locus_tag LOCUS_05000 9248 8502 CDS product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941114.1 protein_id gnl|my_center|LOCUS_05000 10174 9245 gene locus_tag LOCUS_05010 gene prmA 10174 9245 CDS product 50S ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941115.1 protein_id gnl|my_center|LOCUS_05010 11784 10300 gene locus_tag LOCUS_05020 11784 10300 CDS product tetrathionate reductase family octaheme c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942936.1 protein_id gnl|my_center|LOCUS_05020 12279 12061 gene locus_tag LOCUS_05030 12279 12061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941352.1 protein_id gnl|my_center|LOCUS_05030 12688 12392 gene locus_tag LOCUS_05040 12688 12392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05040 13653 12940 gene locus_tag LOCUS_05050 13653 12940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05050 15123 13849 gene locus_tag LOCUS_05060 15123 13849 CDS product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941810.1 protein_id gnl|my_center|LOCUS_05060 16264 15188 gene locus_tag LOCUS_05070 16264 15188 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870115.1 protein_id gnl|my_center|LOCUS_05070 17290 16619 gene locus_tag LOCUS_05080 17290 16619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05080 18007 17462 gene locus_tag LOCUS_05090 18007 17462 CDS product hypoxanthine-guanine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941682.1 protein_id gnl|my_center|LOCUS_05090 18867 18004 gene locus_tag LOCUS_05100 gene prmC 18867 18004 CDS product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943724.1 protein_id gnl|my_center|LOCUS_05100 20425 18968 gene locus_tag LOCUS_05110 20425 18968 CDS product NADH-quinone oxidoreductase subunit N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941019.1 protein_id gnl|my_center|LOCUS_05110 22118 20463 gene locus_tag LOCUS_05120 22118 20463 CDS product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941018.1 protein_id gnl|my_center|LOCUS_05120 24151 22157 gene locus_tag LOCUS_05130 gene nuoL 24151 22157 CDS product NADH-quinone oxidoreductase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941017.1 protein_id gnl|my_center|LOCUS_05130 24509 24207 gene locus_tag LOCUS_05140 gene nuoK 24509 24207 CDS product NADH-quinone oxidoreductase subunit NuoK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941016.1 protein_id gnl|my_center|LOCUS_05140 25027 24524 gene locus_tag LOCUS_05150 25027 24524 CDS product NADH-quinone oxidoreductase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941015.1 protein_id gnl|my_center|LOCUS_05150 25443 25042 gene locus_tag LOCUS_05160 gene nuoI 25443 25042 CDS product NADH-quinone oxidoreductase subunit NuoI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941014.1 protein_id gnl|my_center|LOCUS_05160 26553 25489 gene locus_tag LOCUS_05170 gene nuoH 26553 25489 CDS product NADH-quinone oxidoreductase subunit NuoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941013.1 protein_id gnl|my_center|LOCUS_05170 29089 26615 gene locus_tag LOCUS_05180 29089 26615 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941012.1 protein_id gnl|my_center|LOCUS_05180 30914 29133 gene locus_tag LOCUS_05190 gene nuoF 30914 29133 CDS product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941011.1 protein_id gnl|my_center|LOCUS_05190 31466 30954 gene locus_tag LOCUS_05200 31466 30954 CDS product NAD(P)H-dependent oxidoreductase subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941010.1 protein_id gnl|my_center|LOCUS_05200 32668 31496 gene locus_tag LOCUS_05210 gene nuoD 32668 31496 CDS product NADH dehydrogenase (quinone) subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941009.1 protein_id gnl|my_center|LOCUS_05210 33201 32713 gene locus_tag LOCUS_05220 33201 32713 CDS product NADH-quinone oxidoreductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941008.1 protein_id gnl|my_center|LOCUS_05220 33773 33258 gene locus_tag LOCUS_05230 33773 33258 CDS product NADH-quinone oxidoreductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941007.1 protein_id gnl|my_center|LOCUS_05230 34120 33764 gene locus_tag LOCUS_05240 34120 33764 CDS product NADH-quinone oxidoreductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941006.1 protein_id gnl|my_center|LOCUS_05240 34356 35642 gene locus_tag LOCUS_05250 gene hemL 34356 35642 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941005.1 protein_id gnl|my_center|LOCUS_05250 35729 35965 gene locus_tag LOCUS_05260 35729 35965 CDS product AtpZ/AtpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941004.1 protein_id gnl|my_center|LOCUS_05260 35949 36329 gene locus_tag LOCUS_05270 35949 36329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05270 36334 37023 gene locus_tag LOCUS_05280 36334 37023 CDS product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941002.1 protein_id gnl|my_center|LOCUS_05280 37084 37359 gene locus_tag LOCUS_05290 gene atpE 37084 37359 CDS product ATP synthase F0 subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941001.1 protein_id gnl|my_center|LOCUS_05290 38219 37449 gene locus_tag LOCUS_05300 38219 37449 CDS product fibronectin type III domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940833.1 protein_id gnl|my_center|LOCUS_05300 38917 38216 gene locus_tag LOCUS_05310 38917 38216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942183.1 protein_id gnl|my_center|LOCUS_05310 39790 38927 gene locus_tag LOCUS_05320 39790 38927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05320 41173 39797 gene locus_tag LOCUS_05330 gene argH 41173 39797 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940832.1 protein_id gnl|my_center|LOCUS_05330 42461 41292 gene locus_tag LOCUS_05340 42461 41292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940831.1 protein_id gnl|my_center|LOCUS_05340 42915 42454 gene locus_tag LOCUS_05350 42915 42454 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940830.1 protein_id gnl|my_center|LOCUS_05350 44148 42919 gene locus_tag LOCUS_05360 44148 42919 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940829.1 protein_id gnl|my_center|LOCUS_05360 45090 44179 gene locus_tag LOCUS_05370 gene argF 45090 44179 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940828.1 protein_id gnl|my_center|LOCUS_05370 45222 45100 gene locus_tag LOCUS_05380 45222 45100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05380 >Feature sequence011 38 817 gene locus_tag LOCUS_05390 38 817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05390 831 1895 gene locus_tag LOCUS_05400 831 1895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05400 1924 5028 gene locus_tag LOCUS_05410 1924 5028 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144156.1 protein_id gnl|my_center|LOCUS_05410 5119 5781 gene locus_tag LOCUS_05420 5119 5781 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931888.1 protein_id gnl|my_center|LOCUS_05420 5757 7130 gene locus_tag LOCUS_05430 5757 7130 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931889.1 protein_id gnl|my_center|LOCUS_05430 7234 7488 gene locus_tag LOCUS_05440 7234 7488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05440 7488 7946 gene locus_tag LOCUS_05450 7488 7946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05450 8229 8606 gene locus_tag LOCUS_05460 8229 8606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05460 8603 10015 gene locus_tag LOCUS_05470 8603 10015 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036845.1 protein_id gnl|my_center|LOCUS_05470 10092 10976 gene locus_tag LOCUS_05480 10092 10976 CDS product YihY/virulence factor BrkB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808614.1 protein_id gnl|my_center|LOCUS_05480 11060 13606 gene locus_tag LOCUS_05490 gene glgP 11060 13606 CDS product alpha-glucan family phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939622.1 protein_id gnl|my_center|LOCUS_05490 13882 14406 gene locus_tag LOCUS_05500 13882 14406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140662.1 protein_id gnl|my_center|LOCUS_05500 14535 15026 gene locus_tag LOCUS_05510 14535 15026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05510 15046 17421 gene locus_tag LOCUS_05520 15046 17421 CDS product plasma-membrane proton-efflux P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011673989.1 protein_id gnl|my_center|LOCUS_05520 17434 18318 gene locus_tag LOCUS_05530 17434 18318 CDS product polyphosphate kinase 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118674.1 protein_id gnl|my_center|LOCUS_05530 18990 18394 gene locus_tag LOCUS_05540 18990 18394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942305.1 protein_id gnl|my_center|LOCUS_05540 21242 19164 gene locus_tag LOCUS_05550 21242 19164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05550 21539 22816 gene locus_tag LOCUS_05560 21539 22816 CDS product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943345.1 protein_id gnl|my_center|LOCUS_05560 22931 23506 gene locus_tag LOCUS_05570 22931 23506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05570 23610 23464 gene locus_tag LOCUS_05580 23610 23464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05580 23589 23598 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 23689 24822 gene locus_tag LOCUS_05590 23689 24822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05590 25795 24842 gene locus_tag LOCUS_05600 gene cysK 25795 24842 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000036918.1 protein_id gnl|my_center|LOCUS_05600 26443 26631 gene locus_tag LOCUS_05610 26443 26631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05610 26929 29013 gene locus_tag LOCUS_05620 26929 29013 CDS product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021779460.1 protein_id gnl|my_center|LOCUS_05620 29023 29217 gene locus_tag LOCUS_05630 29023 29217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05630 29214 31172 gene locus_tag LOCUS_05640 29214 31172 CDS product SMC family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016398.1 protein_id gnl|my_center|LOCUS_05640 31201 32508 gene locus_tag LOCUS_05650 gene dndC 31201 32508 CDS product DNA phosphorothioation system sulfurtransferase DndC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005109921.1 protein_id gnl|my_center|LOCUS_05650 32498 34507 gene locus_tag LOCUS_05660 gene dndD 32498 34507 CDS product DNA sulfur modification protein DndD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005109923.1 protein_id gnl|my_center|LOCUS_05660 34498 34878 gene locus_tag LOCUS_05670 34498 34878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05670 34887 35204 gene locus_tag LOCUS_05680 34887 35204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05680 35244 36086 gene locus_tag LOCUS_05690 gene dinD 35244 36086 CDS product DNA damage-inducible protein D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962420.1 protein_id gnl|my_center|LOCUS_05690 36092 37240 gene locus_tag LOCUS_05700 36092 37240 CDS product IscS subfamily cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144367.1 protein_id gnl|my_center|LOCUS_05700 37303 37509 gene locus_tag LOCUS_05710 37303 37509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05710 39687 38152 gene locus_tag LOCUS_05720 39687 38152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05720 40495 39680 gene locus_tag LOCUS_05730 40495 39680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05730 40830 40492 gene locus_tag LOCUS_05740 40830 40492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05740 41105 40863 gene locus_tag LOCUS_05750 41105 40863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05750 41342 41145 gene locus_tag LOCUS_05760 41342 41145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05760 41640 41443 gene locus_tag LOCUS_05770 41640 41443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05770 41789 42289 gene locus_tag LOCUS_05780 41789 42289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05780 42987 42481 gene locus_tag LOCUS_05790 42987 42481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05790 >Feature sequence012 26 1795 gene locus_tag LOCUS_05800 26 1795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05800 2773 1814 gene locus_tag LOCUS_05810 2773 1814 CDS product TIGR01212 family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941249.1 protein_id gnl|my_center|LOCUS_05810 3398 2757 gene locus_tag LOCUS_05820 gene thiE 3398 2757 CDS product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941250.1 protein_id gnl|my_center|LOCUS_05820 4192 3413 gene locus_tag LOCUS_05830 4192 3413 CDS product thiazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941251.1 protein_id gnl|my_center|LOCUS_05830 4397 4197 gene locus_tag LOCUS_05840 gene thiS 4397 4197 CDS product sulfur carrier protein ThiS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010432400.1 protein_id gnl|my_center|LOCUS_05840 4722 5108 gene locus_tag LOCUS_05850 4722 5108 CDS product PilZ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941712.1 protein_id gnl|my_center|LOCUS_05850 5087 6178 gene locus_tag LOCUS_05860 5087 6178 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941549.1 protein_id gnl|my_center|LOCUS_05860 6280 6603 gene locus_tag LOCUS_05870 6280 6603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05870 6607 7353 gene locus_tag LOCUS_05880 6607 7353 CDS product flagellar motor protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943654.1 protein_id gnl|my_center|LOCUS_05880 7360 8145 gene locus_tag LOCUS_05890 7360 8145 CDS product flagellar motor protein MotB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943655.1 protein_id gnl|my_center|LOCUS_05890 9134 8250 gene locus_tag LOCUS_05900 gene ttcA 9134 8250 CDS product tRNA 2-thiocytidine(32) synthetase TtcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940803.1 protein_id gnl|my_center|LOCUS_05900 10236 9139 gene locus_tag LOCUS_05910 10236 9139 CDS product homoserine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943101.1 protein_id gnl|my_center|LOCUS_05910 10678 11712 gene locus_tag LOCUS_05920 10678 11712 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943926.1 protein_id gnl|my_center|LOCUS_05920 11835 13163 gene locus_tag LOCUS_05930 11835 13163 CDS product ATP phosphoribosyltransferase regulatory subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943919.1 protein_id gnl|my_center|LOCUS_05930 13166 14458 gene locus_tag LOCUS_05940 13166 14458 CDS product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943920.1 protein_id gnl|my_center|LOCUS_05940 14635 15987 gene locus_tag LOCUS_05950 14635 15987 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943751.1 protein_id gnl|my_center|LOCUS_05950 18310 16019 gene locus_tag LOCUS_05960 18310 16019 CDS product UvrD-helicase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944022.1 protein_id gnl|my_center|LOCUS_05960 18293 18538 gene locus_tag LOCUS_05970 18293 18538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05970 18736 23316 gene locus_tag LOCUS_05980 gene gltB 18736 23316 CDS product glutamate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926853.1 protein_id gnl|my_center|LOCUS_05980 23392 24873 gene locus_tag LOCUS_05990 23392 24873 CDS product glutamate synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932093.1 protein_id gnl|my_center|LOCUS_05990 25195 26010 gene locus_tag LOCUS_06000 25195 26010 CDS product electron transfer flavoprotein subunit beta/FixA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943501.1 protein_id gnl|my_center|LOCUS_06000 26007 27335 gene locus_tag LOCUS_06010 26007 27335 CDS product electron transfer flavoprotein subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943423.1 protein_id gnl|my_center|LOCUS_06010 27377 29374 gene locus_tag LOCUS_06020 27377 29374 CDS product heterodisulfide reductase-related iron-sulfur binding cluster inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943422.1 protein_id gnl|my_center|LOCUS_06020 29632 31476 gene locus_tag LOCUS_06030 29632 31476 CDS product phosphoenolpyruvate carboxykinase (GTP) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943996.1 protein_id gnl|my_center|LOCUS_06030 31864 31529 gene locus_tag LOCUS_06040 gene hypA 31864 31529 CDS product hydrogenase maturation nickel metallochaperone HypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941042.1 protein_id gnl|my_center|LOCUS_06040 32122 31946 gene locus_tag LOCUS_06050 32122 31946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06050 32691 32236 gene locus_tag LOCUS_06060 32691 32236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06060 33958 32693 gene locus_tag LOCUS_06070 33958 32693 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943814.1 protein_id gnl|my_center|LOCUS_06070 34856 34005 gene locus_tag LOCUS_06080 34856 34005 CDS product protein-glutamate O-methyltransferase CheR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235044926.1 protein_id gnl|my_center|LOCUS_06080 35043 35879 gene locus_tag LOCUS_06090 35043 35879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944035.1 protein_id gnl|my_center|LOCUS_06090 35876 36772 gene locus_tag LOCUS_06100 35876 36772 CDS product C40 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944036.1 protein_id gnl|my_center|LOCUS_06100 36891 36968 gene locus_tag LOCUS_t00040 36891 36968 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 37147 38388 gene locus_tag LOCUS_06110 37147 38388 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938819.1 protein_id gnl|my_center|LOCUS_06110 38624 38394 gene locus_tag LOCUS_06120 38624 38394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06120 40225 38633 gene locus_tag LOCUS_06130 40225 38633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06130 40413 40225 gene locus_tag LOCUS_06140 40413 40225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06140 41495 40395 gene locus_tag LOCUS_06150 41495 40395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06150 42522 41563 gene locus_tag LOCUS_06160 42522 41563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06160 >Feature sequence013 103 405 gene locus_tag LOCUS_06170 103 405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06170 1445 417 gene locus_tag LOCUS_06180 gene gnd 1445 417 CDS product decarboxylating 6-phosphogluconate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528920.1 protein_id gnl|my_center|LOCUS_06180 2013 1564 gene locus_tag LOCUS_06190 2013 1564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06190 3086 2184 gene locus_tag LOCUS_06200 3086 2184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06200 4239 3559 gene locus_tag LOCUS_06210 4239 3559 CDS product outer membrane beta-barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941429.1 protein_id gnl|my_center|LOCUS_06210 5569 4457 gene locus_tag LOCUS_06220 5569 4457 CDS product NADH:flavin oxidoreductase/NADH oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942021.1 protein_id gnl|my_center|LOCUS_06220 6609 5608 gene locus_tag LOCUS_06230 6609 5608 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941435.1 protein_id gnl|my_center|LOCUS_06230 6827 7678 gene locus_tag LOCUS_06240 6827 7678 CDS product MaoC family dehydratase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010925894.1 protein_id gnl|my_center|LOCUS_06240 7795 8106 gene locus_tag LOCUS_06250 7795 8106 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070888.1 protein_id gnl|my_center|LOCUS_06250 8284 9240 gene locus_tag LOCUS_06260 8284 9240 CDS product homocysteine S-methyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941981.1 protein_id gnl|my_center|LOCUS_06260 10581 9232 gene locus_tag LOCUS_06270 10581 9232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06270 11704 10649 gene locus_tag LOCUS_06280 11704 10649 CDS product iron-containing alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011176676.1 protein_id gnl|my_center|LOCUS_06280 12357 11701 gene locus_tag LOCUS_06290 12357 11701 CDS product MtnX-like HAD-IB family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964933.1 protein_id gnl|my_center|LOCUS_06290 13530 12400 gene locus_tag LOCUS_06300 13530 12400 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339538.1 protein_id gnl|my_center|LOCUS_06300 14039 13527 gene locus_tag LOCUS_06310 14039 13527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06310 15543 14113 gene locus_tag LOCUS_06320 15543 14113 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941905.1 protein_id gnl|my_center|LOCUS_06320 15898 17832 gene locus_tag LOCUS_06330 15898 17832 CDS product aconitate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943084.1 protein_id gnl|my_center|LOCUS_06330 18136 18567 gene locus_tag LOCUS_06340 18136 18567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06340 18819 19184 gene locus_tag LOCUS_06350 18819 19184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06350 19260 19739 gene locus_tag LOCUS_06360 19260 19739 CDS product class II SORL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941381.1 protein_id gnl|my_center|LOCUS_06360 19816 20025 gene locus_tag LOCUS_06370 19816 20025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940754.1 protein_id gnl|my_center|LOCUS_06370 20307 20630 gene locus_tag LOCUS_06380 20307 20630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06380 20756 21733 gene locus_tag LOCUS_06390 gene pdhA 20756 21733 CDS product pyruvate dehydrogenase (acetyl-transferring) E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943082.1 protein_id gnl|my_center|LOCUS_06390 21726 22712 gene locus_tag LOCUS_06400 21726 22712 CDS product alpha-ketoacid dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943073.1 protein_id gnl|my_center|LOCUS_06400 22802 24052 gene locus_tag LOCUS_06410 22802 24052 CDS product dihydrolipoamide acetyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943072.1 protein_id gnl|my_center|LOCUS_06410 25526 24138 gene locus_tag LOCUS_06420 gene prsR 25526 24138 CDS product PEP-CTERM-box response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942585.1 protein_id gnl|my_center|LOCUS_06420 27599 25539 gene locus_tag LOCUS_06430 gene prsK 27599 25539 CDS product PEP-CTERM system histidine kinase PrsK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942586.1 protein_id gnl|my_center|LOCUS_06430 28128 29552 gene locus_tag LOCUS_06440 28128 29552 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941905.1 protein_id gnl|my_center|LOCUS_06440 29590 31008 gene locus_tag LOCUS_06450 29590 31008 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941905.1 protein_id gnl|my_center|LOCUS_06450 31176 30955 gene locus_tag LOCUS_06460 31176 30955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06460 31318 33147 gene locus_tag LOCUS_06470 gene glmS 31318 33147 CDS product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940943.1 protein_id gnl|my_center|LOCUS_06470 33490 36384 gene locus_tag LOCUS_06480 33490 36384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06480 37358 36390 gene locus_tag LOCUS_06490 37358 36390 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942842.1 protein_id gnl|my_center|LOCUS_06490 37886 39328 gene locus_tag LOCUS_06500 gene extH 37886 39328 CDS product selenite/tellurite reduction operon rhodanese-like protein ExtH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943571.1 protein_id gnl|my_center|LOCUS_06500 39398 40603 gene locus_tag LOCUS_06510 gene extI 39398 40603 CDS product selenite/tellurite reduction operon porin ExtI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943570.1 protein_id gnl|my_center|LOCUS_06510 40665 41018 gene locus_tag LOCUS_06520 40665 41018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06520 >Feature sequence014 3057 2494 gene locus_tag LOCUS_06530 3057 2494 CDS product pilus assembly protein PilP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942672.1 protein_id gnl|my_center|LOCUS_06530 3637 3035 gene locus_tag LOCUS_06540 3637 3035 CDS product type 4a pilus biogenesis protein PilO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942673.1 protein_id gnl|my_center|LOCUS_06540 4226 3663 gene locus_tag LOCUS_06550 4226 3663 CDS product PilN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942674.1 protein_id gnl|my_center|LOCUS_06550 5290 4223 gene locus_tag LOCUS_06560 gene pilM 5290 4223 CDS product type IV pilus assembly protein PilM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942675.1 protein_id gnl|my_center|LOCUS_06560 5496 5290 gene locus_tag LOCUS_06570 5496 5290 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942676.1 protein_id gnl|my_center|LOCUS_06570 6606 6259 gene locus_tag LOCUS_06580 6606 6259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06580 9877 6866 gene locus_tag LOCUS_06590 9877 6866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06590 10149 10328 gene locus_tag LOCUS_06600 10149 10328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06600 11580 10990 gene locus_tag LOCUS_06610 11580 10990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06610 12446 11577 gene locus_tag LOCUS_06620 12446 11577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06620 12964 12443 gene locus_tag LOCUS_06630 12964 12443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06630 13572 13045 gene locus_tag LOCUS_06640 13572 13045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06640 14449 13883 gene locus_tag LOCUS_06650 14449 13883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06650 15265 14492 gene locus_tag LOCUS_06660 15265 14492 CDS product DsbC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186871.1 protein_id gnl|my_center|LOCUS_06660 16664 15294 gene locus_tag LOCUS_06670 16664 15294 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942684.1 protein_id gnl|my_center|LOCUS_06670 18156 16657 gene locus_tag LOCUS_06680 18156 16657 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942685.1 protein_id gnl|my_center|LOCUS_06680 18946 18158 gene locus_tag LOCUS_06690 18946 18158 CDS product A24 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942686.1 protein_id gnl|my_center|LOCUS_06690 20688 18946 gene locus_tag LOCUS_06700 gene ptsP 20688 18946 CDS product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942526.1 protein_id gnl|my_center|LOCUS_06700 20956 20690 gene locus_tag LOCUS_06710 20956 20690 CDS product HPr family phosphocarrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942527.1 protein_id gnl|my_center|LOCUS_06710 21376 20984 gene locus_tag LOCUS_06720 21376 20984 CDS product PTS sugar transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942528.1 protein_id gnl|my_center|LOCUS_06720 22236 21373 gene locus_tag LOCUS_06730 gene rapZ 22236 21373 CDS product RNase adapter RapZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942529.1 protein_id gnl|my_center|LOCUS_06730 23199 22240 gene locus_tag LOCUS_06740 gene hprK 23199 22240 CDS product HPr(Ser) kinase/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942530.1 protein_id gnl|my_center|LOCUS_06740 23764 23216 gene locus_tag LOCUS_06750 gene raiA 23764 23216 CDS product ribosome-associated translation inhibitor RaiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942531.1 protein_id gnl|my_center|LOCUS_06750 25264 23822 gene locus_tag LOCUS_06760 gene rpoN 25264 23822 CDS product RNA polymerase factor sigma-54 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942532.1 protein_id gnl|my_center|LOCUS_06760 26131 25391 gene locus_tag LOCUS_06770 gene lptB 26131 25391 CDS product LPS export ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942533.1 protein_id gnl|my_center|LOCUS_06770 26636 26115 gene locus_tag LOCUS_06780 gene lptA 26636 26115 CDS product lipopolysaccharide transport periplasmic protein LptA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942534.1 protein_id gnl|my_center|LOCUS_06780 27260 26691 gene locus_tag LOCUS_06790 27260 26691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06790 27860 27345 gene locus_tag LOCUS_06800 27860 27345 CDS product HAD hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942537.1 protein_id gnl|my_center|LOCUS_06800 28828 27860 gene locus_tag LOCUS_06810 28828 27860 CDS product KpsF/GutQ family sugar-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942538.1 protein_id gnl|my_center|LOCUS_06810 29661 28825 gene locus_tag LOCUS_06820 gene kdsA 29661 28825 CDS product 3-deoxy-8-phosphooctulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942539.1 protein_id gnl|my_center|LOCUS_06820 31272 29665 gene locus_tag LOCUS_06830 31272 29665 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942540.1 protein_id gnl|my_center|LOCUS_06830 32075 31311 gene locus_tag LOCUS_06840 gene kdsB 32075 31311 CDS product 3-deoxy-manno-octulosonate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942541.1 protein_id gnl|my_center|LOCUS_06840 34185 32218 gene locus_tag LOCUS_06850 34185 32218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06850 38116 34247 gene locus_tag LOCUS_06860 38116 34247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06860 >Feature sequence015 26 454 gene locus_tag LOCUS_06870 26 454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06870 475 1545 gene locus_tag LOCUS_06880 475 1545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06880 1546 1761 gene locus_tag LOCUS_06890 1546 1761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06890 2197 3465 gene locus_tag LOCUS_06900 2197 3465 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228075.1 protein_id gnl|my_center|LOCUS_06900 3465 4142 gene locus_tag LOCUS_06910 3465 4142 CDS product RloB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002358972.1 protein_id gnl|my_center|LOCUS_06910 4208 4930 gene locus_tag LOCUS_06920 4208 4930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005115937.1 protein_id gnl|my_center|LOCUS_06920 5065 7062 gene locus_tag LOCUS_06930 5065 7062 CDS product proton-conducting transporter membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941399.1 protein_id gnl|my_center|LOCUS_06930 7119 8024 gene locus_tag LOCUS_06940 7119 8024 CDS product NADH-quinone oxidoreductase subunit H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941400.1 protein_id gnl|my_center|LOCUS_06940 8029 8670 gene locus_tag LOCUS_06950 8029 8670 CDS product hydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941401.1 protein_id gnl|my_center|LOCUS_06950 8675 10108 gene locus_tag LOCUS_06960 8675 10108 CDS product proton-conducting transporter membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941402.1 protein_id gnl|my_center|LOCUS_06960 10105 11625 gene locus_tag LOCUS_06970 10105 11625 CDS product NADH-quinone oxidoreductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941403.1 protein_id gnl|my_center|LOCUS_06970 11638 12402 gene locus_tag LOCUS_06980 11638 12402 CDS product hydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941404.1 protein_id gnl|my_center|LOCUS_06980 12453 13898 gene locus_tag LOCUS_06990 12453 13898 CDS product glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007244218.1 protein_id gnl|my_center|LOCUS_06990 13951 14664 gene locus_tag LOCUS_07000 13951 14664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07000 15023 14667 gene locus_tag LOCUS_07010 15023 14667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07010 15202 15600 gene locus_tag LOCUS_07020 15202 15600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07020 15706 16569 gene locus_tag LOCUS_07030 15706 16569 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545054.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_07030 16588 16962 gene locus_tag LOCUS_07040 16588 16962 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546622.1 protein_id gnl|my_center|LOCUS_07040 16995 17360 gene locus_tag LOCUS_07050 16995 17360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07050 17329 18522 gene locus_tag LOCUS_07060 17329 18522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07060 18519 20105 gene locus_tag LOCUS_07070 18519 20105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07070 20118 20636 gene locus_tag LOCUS_07080 20118 20636 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965515.1 protein_id gnl|my_center|LOCUS_07080 20633 21067 gene locus_tag LOCUS_07090 20633 21067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07090 21061 23109 gene locus_tag LOCUS_07100 21061 23109 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937405.1 protein_id gnl|my_center|LOCUS_07100 23106 24152 gene locus_tag LOCUS_07110 gene cheB 23106 24152 CDS product chemotaxis-specific protein-glutamate methyltransferase CheB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257541.1 protein_id gnl|my_center|LOCUS_07110 24149 25684 gene locus_tag LOCUS_07120 24149 25684 CDS product protein-glutamate O-methyltransferase CheR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257542.1 protein_id gnl|my_center|LOCUS_07120 25762 27981 gene locus_tag LOCUS_07130 25762 27981 CDS product hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257539.1 protein_id gnl|my_center|LOCUS_07130 27996 28373 gene locus_tag LOCUS_07140 27996 28373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07140 28433 29425 gene locus_tag LOCUS_07150 28433 29425 CDS product F420-non-reducing hydrogenase subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545939.1 protein_id gnl|my_center|LOCUS_07150 29425 30918 gene locus_tag LOCUS_07160 29425 30918 CDS product F420-non-reducing hydrogenase subunit A, selenocysteine-containing inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545782.1 protein_id gnl|my_center|LOCUS_07160 30915 31403 gene locus_tag LOCUS_07170 30915 31403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07170 31400 33352 gene locus_tag LOCUS_07180 gene hdrA 31400 33352 CDS product H(2):CoB-CoM heterodisulfide ferredoxin reductase subunit HdrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061038.1 protein_id gnl|my_center|LOCUS_07180 33349 33798 gene locus_tag LOCUS_07190 33349 33798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07190 33819 34040 gene locus_tag LOCUS_07200 33819 34040 CDS product sulfurtransferase TusA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545978.1 protein_id gnl|my_center|LOCUS_07200 34085 35764 gene locus_tag LOCUS_07210 34085 35764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07210 37503 35839 gene locus_tag LOCUS_07220 gene recN 37503 35839 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942706.1 protein_id gnl|my_center|LOCUS_07220 <38181 37510 gene locus_tag LOCUS_07230 <38181 37510 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942707.1:NAD(+)/NADH kinase >Feature sequence016 81 1772 gene locus_tag LOCUS_07240 gene argS 81 1772 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_039648220.1 protein_id gnl|my_center|LOCUS_07240 1784 2575 gene locus_tag LOCUS_07250 1784 2575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07250 2668 2744 gene locus_tag LOCUS_t00050 2668 2744 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 2795 2871 gene locus_tag LOCUS_t00060 2795 2871 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 2966 4414 gene locus_tag LOCUS_07260 2966 4414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07260 5538 5732 gene locus_tag LOCUS_07270 5538 5732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07270 5744 5950 gene locus_tag LOCUS_07280 5744 5950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07280 5959 6471 gene locus_tag LOCUS_07290 gene radC 5959 6471 CDS product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942813.1 protein_id gnl|my_center|LOCUS_07290 6529 6538 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 6782 7159 gene locus_tag LOCUS_07300 6782 7159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07300 7161 7604 gene locus_tag LOCUS_07310 7161 7604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07310 7597 8211 gene locus_tag LOCUS_07320 7597 8211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07320 8296 8430 gene locus_tag LOCUS_07330 8296 8430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07330 8625 9239 gene locus_tag LOCUS_07340 8625 9239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07340 9287 10453 gene locus_tag LOCUS_07350 9287 10453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07350 10824 11525 gene locus_tag LOCUS_07360 10824 11525 CDS product DUF2786 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072609.1 protein_id gnl|my_center|LOCUS_07360 11541 12023 gene locus_tag LOCUS_07370 11541 12023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07370 12224 12565 gene locus_tag LOCUS_07380 12224 12565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07380 13147 12635 gene locus_tag LOCUS_07390 13147 12635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07390 13419 13910 gene locus_tag LOCUS_07400 13419 13910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07400 13943 14716 gene locus_tag LOCUS_07410 13943 14716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_07410 15218 15000 gene locus_tag LOCUS_07420 15218 15000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07420 15594 16568 gene locus_tag LOCUS_07430 15594 16568 CDS product WYL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940727.1 protein_id gnl|my_center|LOCUS_07430 16739 19807 gene locus_tag LOCUS_07440 16739 19807 CDS product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020677315.1 protein_id gnl|my_center|LOCUS_07440 19807 20448 gene locus_tag LOCUS_07450 19807 20448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07450 20651 23431 gene locus_tag LOCUS_07460 20651 23431 CDS product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931302.1 protein_id gnl|my_center|LOCUS_07460 23473 25338 gene locus_tag LOCUS_07470 23473 25338 CDS product KAP family P-loop domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010884100.1 protein_id gnl|my_center|LOCUS_07470 25319 26173 gene locus_tag LOCUS_07480 25319 26173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_105374330.1 protein_id gnl|my_center|LOCUS_07480 26170 27447 gene locus_tag LOCUS_07490 26170 27447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010884099.1 protein_id gnl|my_center|LOCUS_07490 27444 28175 gene locus_tag LOCUS_07500 27444 28175 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010884094.1 protein_id gnl|my_center|LOCUS_07500 28231 30303 gene locus_tag LOCUS_07510 28231 30303 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036269.1 protein_id gnl|my_center|LOCUS_07510 30341 30523 gene locus_tag LOCUS_07520 30341 30523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_129052038.1 protein_id gnl|my_center|LOCUS_07520 30615 31064 gene locus_tag LOCUS_07530 30615 31064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07530 31141 31890 gene locus_tag LOCUS_07540 31141 31890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07540 31881 32714 gene locus_tag LOCUS_07550 31881 32714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07550 32684 34933 gene locus_tag LOCUS_07560 32684 34933 CDS product TerB N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816328.1 protein_id gnl|my_center|LOCUS_07560 34991 35779 gene locus_tag LOCUS_07570 34991 35779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07570 >Feature sequence017 1241 3 gene locus_tag LOCUS_07580 1241 3 CDS product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941810.1 protein_id gnl|my_center|LOCUS_07580 2269 1460 gene locus_tag LOCUS_07590 2269 1460 CDS product NAD(+)--dinitrogen-reductase ADP-D-ribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943429.1 protein_id gnl|my_center|LOCUS_07590 2636 2307 gene locus_tag LOCUS_07600 2636 2307 CDS product NifB/NifX family molybdenum-iron cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943430.1 protein_id gnl|my_center|LOCUS_07600 2981 2718 gene locus_tag LOCUS_07610 gene fdxB 2981 2718 CDS product ferredoxin III, nif-specific inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943431.1 protein_id gnl|my_center|LOCUS_07610 3432 3046 gene locus_tag LOCUS_07620 gene nifX 3432 3046 CDS product nitrogen fixation protein NifX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943432.1 protein_id gnl|my_center|LOCUS_07620 6515 3756 gene locus_tag LOCUS_07630 6515 3756 CDS product bifunctional nitrogenase iron-molybdenum cofactor biosynthesis protein NifEN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943433.1 protein_id gnl|my_center|LOCUS_07630 7628 6675 gene locus_tag LOCUS_07640 7628 6675 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942309.1 protein_id gnl|my_center|LOCUS_07640 10307 7689 gene locus_tag LOCUS_07650 10307 7689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07650 11703 10429 gene locus_tag LOCUS_07660 11703 10429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941247.1 protein_id gnl|my_center|LOCUS_07660 12493 12128 gene locus_tag LOCUS_07670 12493 12128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07670 13143 12526 gene locus_tag LOCUS_07680 13143 12526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07680 13516 13295 gene locus_tag LOCUS_07690 13516 13295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07690 17687 13503 gene locus_tag LOCUS_07700 17687 13503 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122252.1 protein_id gnl|my_center|LOCUS_07700 17772 18488 gene locus_tag LOCUS_07710 17772 18488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07710 20054 18585 gene locus_tag LOCUS_07720 gene nifK 20054 18585 CDS product nitrogenase molybdenum-iron protein subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943445.1 protein_id gnl|my_center|LOCUS_07720 20506 23616 gene locus_tag LOCUS_07730 20506 23616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07730 25163 23718 gene locus_tag LOCUS_07740 gene nifD 25163 23718 CDS product nitrogenase molybdenum-iron protein alpha chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943446.1 protein_id gnl|my_center|LOCUS_07740 26136 25270 gene locus_tag LOCUS_07750 gene nifH 26136 25270 CDS product nitrogenase iron protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943447.1 protein_id gnl|my_center|LOCUS_07750 26616 26464 gene locus_tag LOCUS_07760 26616 26464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07760 26905 26621 gene locus_tag LOCUS_07770 26905 26621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07770 27129 26815 gene locus_tag LOCUS_07780 27129 26815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07780 27862 27173 gene locus_tag LOCUS_07790 27862 27173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07790 28361 27891 gene locus_tag LOCUS_07800 28361 27891 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939932.1 protein_id gnl|my_center|LOCUS_07800 29619 28348 gene locus_tag LOCUS_07810 29619 28348 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226986828.1 protein_id gnl|my_center|LOCUS_07810 30958 29672 gene locus_tag LOCUS_07820 gene eno 30958 29672 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942923.1 protein_id gnl|my_center|LOCUS_07820 31802 31011 gene locus_tag LOCUS_07830 gene fetB 31802 31011 CDS product iron export ABC transporter permease subunit FetB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000679254.1 protein_id gnl|my_center|LOCUS_07830 32589 31795 gene locus_tag LOCUS_07840 32589 31795 CDS product phosphate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392686.1 protein_id gnl|my_center|LOCUS_07840 33832 32648 gene locus_tag LOCUS_07850 33832 32648 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545988.1 protein_id gnl|my_center|LOCUS_07850 35402 33864 gene locus_tag LOCUS_07860 35402 33864 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256247.1 protein_id gnl|my_center|LOCUS_07860 >Feature sequence018 867 442 gene locus_tag LOCUS_07870 867 442 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943738.1 protein_id gnl|my_center|LOCUS_07870 1396 1575 gene locus_tag LOCUS_07880 1396 1575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07880 1890 2558 gene locus_tag LOCUS_07890 1890 2558 CDS product CsbD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142260.1 protein_id gnl|my_center|LOCUS_07890 3344 3159 gene locus_tag LOCUS_07900 3344 3159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07900 3708 4592 gene locus_tag LOCUS_07910 3708 4592 CDS product DUF362 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943320.1 protein_id gnl|my_center|LOCUS_07910 4597 6147 gene locus_tag LOCUS_07920 4597 6147 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943319.1 protein_id gnl|my_center|LOCUS_07920 6400 6588 gene locus_tag LOCUS_07930 6400 6588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07930 6575 7165 gene locus_tag LOCUS_07940 6575 7165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07940 7586 7263 gene locus_tag LOCUS_07950 7586 7263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07950 7528 9612 gene locus_tag LOCUS_07960 gene flhA 7528 9612 CDS product flagellar biosynthesis protein FlhA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943681.1 protein_id gnl|my_center|LOCUS_07960 9602 10945 gene locus_tag LOCUS_07970 gene flhF 9602 10945 CDS product flagellar biosynthesis protein FlhF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943680.1 protein_id gnl|my_center|LOCUS_07970 10942 11868 gene locus_tag LOCUS_07980 10942 11868 CDS product MinD/ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943679.1 protein_id gnl|my_center|LOCUS_07980 11873 12619 gene locus_tag LOCUS_07990 11873 12619 CDS product FliA/WhiG family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943678.1 protein_id gnl|my_center|LOCUS_07990 12637 13374 gene locus_tag LOCUS_08000 gene flgF 12637 13374 CDS product flagellar basal-body rod protein FlgF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943677.1 protein_id gnl|my_center|LOCUS_08000 13408 14196 gene locus_tag LOCUS_08010 gene flgG 13408 14196 CDS product flagellar basal-body rod protein FlgG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943676.1 protein_id gnl|my_center|LOCUS_08010 14215 14928 gene locus_tag LOCUS_08020 gene flgA 14215 14928 CDS product flagellar basal body P-ring formation chaperone FlgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943675.1 protein_id gnl|my_center|LOCUS_08020 15051 15725 gene locus_tag LOCUS_08030 15051 15725 CDS product flagellar basal body L-ring protein FlgH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943674.1 protein_id gnl|my_center|LOCUS_08030 15765 16865 gene locus_tag LOCUS_08040 15765 16865 CDS product flagellar basal body P-ring protein FlgI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943673.1 protein_id gnl|my_center|LOCUS_08040 16904 17281 gene locus_tag LOCUS_08050 16904 17281 CDS product rod-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943672.1 protein_id gnl|my_center|LOCUS_08050 17321 17806 gene locus_tag LOCUS_08060 17321 17806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08060 17807 19207 gene locus_tag LOCUS_08070 gene flgK 17807 19207 CDS product flagellar hook-associated protein FlgK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943669.1 protein_id gnl|my_center|LOCUS_08070 19227 20336 gene locus_tag LOCUS_08080 gene flgL 19227 20336 CDS product flagellar hook-associated protein FlgL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943668.1 protein_id gnl|my_center|LOCUS_08080 23871 20350 gene locus_tag LOCUS_08090 23871 20350 CDS product alpha-amylase family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941263.1 protein_id gnl|my_center|LOCUS_08090 25821 23941 gene locus_tag LOCUS_08100 25821 23941 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943809.1 protein_id gnl|my_center|LOCUS_08100 26131 26979 gene locus_tag LOCUS_08110 26131 26979 CDS product HDOD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943642.1 protein_id gnl|my_center|LOCUS_08110 27219 27010 gene locus_tag LOCUS_08120 27219 27010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08120 27315 27821 gene locus_tag LOCUS_08130 gene def 27315 27821 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940805.1 protein_id gnl|my_center|LOCUS_08130 27818 28777 gene locus_tag LOCUS_08140 gene fmt 27818 28777 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940806.1 protein_id gnl|my_center|LOCUS_08140 28774 29574 gene locus_tag LOCUS_08150 28774 29574 CDS product DUF116 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940807.1 protein_id gnl|my_center|LOCUS_08150 32764 29594 gene locus_tag LOCUS_08160 gene glnE 32764 29594 CDS product bifunctional [glutamate--ammonia ligase]-adenylyl-L-tyrosine phosphorylase/[glutamate--ammonia-ligase] adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943989.1 protein_id gnl|my_center|LOCUS_08160 33806 32766 gene locus_tag LOCUS_08170 gene mtnA 33806 32766 CDS product S-methyl-5-thioribose-1-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943990.1 protein_id gnl|my_center|LOCUS_08170 33933 34490 gene locus_tag LOCUS_08180 33933 34490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08180 34490 35008 gene locus_tag LOCUS_08190 34490 35008 CDS product chromate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948277.1 protein_id gnl|my_center|LOCUS_08190 >Feature sequence019 2960 27 gene locus_tag LOCUS_08200 2960 27 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08200 3345 4727 gene locus_tag LOCUS_08210 3345 4727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08210 4694 5239 gene locus_tag LOCUS_08220 4694 5239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08220 5832 5557 gene locus_tag LOCUS_08230 5832 5557 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272449.1 protein_id gnl|my_center|LOCUS_08230 6221 5835 gene locus_tag LOCUS_08240 6221 5835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08240 6935 6282 gene locus_tag LOCUS_08250 6935 6282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08250 7430 7585 gene locus_tag LOCUS_08260 7430 7585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08260 7740 7665 gene locus_tag LOCUS_t00070 7740 7665 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 8869 7796 gene locus_tag LOCUS_08270 8869 7796 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944064.1 protein_id gnl|my_center|LOCUS_08270 9114 10697 gene locus_tag LOCUS_08280 9114 10697 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942732.1 protein_id gnl|my_center|LOCUS_08280 10711 11601 gene locus_tag LOCUS_08290 10711 11601 CDS product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942733.1 protein_id gnl|my_center|LOCUS_08290 11714 11893 gene locus_tag LOCUS_08300 11714 11893 CDS product SAP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941661.1 protein_id gnl|my_center|LOCUS_08300 12360 11953 gene locus_tag LOCUS_08310 12360 11953 CDS product hemerythrin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057828.1 protein_id gnl|my_center|LOCUS_08310 14818 12380 gene locus_tag LOCUS_08320 14818 12380 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943070.1 protein_id gnl|my_center|LOCUS_08320 15651 14875 gene locus_tag LOCUS_08330 15651 14875 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235044986.1 protein_id gnl|my_center|LOCUS_08330 15737 17779 gene locus_tag LOCUS_08340 gene ligA 15737 17779 CDS product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941554.1 protein_id gnl|my_center|LOCUS_08340 17795 18697 gene locus_tag LOCUS_08350 17795 18697 CDS product HDOD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940966.1 protein_id gnl|my_center|LOCUS_08350 18717 19442 gene locus_tag LOCUS_08360 18717 19442 CDS product DUF1847 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943939.1 protein_id gnl|my_center|LOCUS_08360 20836 19451 gene locus_tag LOCUS_08370 20836 19451 CDS product cobyrinate a,c-diamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943636.1 protein_id gnl|my_center|LOCUS_08370 21684 20833 gene locus_tag LOCUS_08380 21684 20833 CDS product energy transducer TonB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941522.1 protein_id gnl|my_center|LOCUS_08380 22584 21748 gene locus_tag LOCUS_08390 22584 21748 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941184.1 protein_id gnl|my_center|LOCUS_08390 23817 22591 gene locus_tag LOCUS_08400 23817 22591 CDS product putative nucleotidyltransferase substrate binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941185.1 protein_id gnl|my_center|LOCUS_08400 25355 23826 gene locus_tag LOCUS_08410 25355 23826 CDS product cation acetate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941186.1 protein_id gnl|my_center|LOCUS_08410 25704 25357 gene locus_tag LOCUS_08420 25704 25357 CDS product DUF4212 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941187.1 protein_id gnl|my_center|LOCUS_08420 26397 25774 gene locus_tag LOCUS_08430 gene trmB 26397 25774 CDS product tRNA (guanosine(46)-N7)-methyltransferase TrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941189.1 protein_id gnl|my_center|LOCUS_08430 27111 26539 gene locus_tag LOCUS_08440 27111 26539 CDS product DNA-3-methyladenine glycosylase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235045020.1 protein_id gnl|my_center|LOCUS_08440 27247 28254 gene locus_tag LOCUS_08450 27247 28254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08450 28441 29694 gene locus_tag LOCUS_08460 gene lysA 28441 29694 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940834.1 protein_id gnl|my_center|LOCUS_08460 29729 30604 gene locus_tag LOCUS_08470 gene dapA 29729 30604 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940835.1 protein_id gnl|my_center|LOCUS_08470 30742 31545 gene locus_tag LOCUS_08480 gene dapB 30742 31545 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940836.1 protein_id gnl|my_center|LOCUS_08480 31625 33235 gene locus_tag LOCUS_08490 31625 33235 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943967.1 protein_id gnl|my_center|LOCUS_08490 33335 34567 gene locus_tag LOCUS_08500 33335 34567 CDS product LL-diaminopimelate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940837.1 protein_id gnl|my_center|LOCUS_08500 >Feature sequence020 497 192 gene locus_tag LOCUS_08510 497 192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08510 835 581 gene locus_tag LOCUS_08520 835 581 CDS product Nif11-like leader peptide family natural product precursor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814917.1 protein_id gnl|my_center|LOCUS_08520 963 2396 gene locus_tag LOCUS_08530 gene nlpM 963 2396 CDS product nif11-like peptide radical SAM maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814916.1 protein_id gnl|my_center|LOCUS_08530 2652 2350 gene locus_tag LOCUS_08540 2652 2350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08540 3152 2652 gene locus_tag LOCUS_08550 3152 2652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08550 3490 3966 gene locus_tag LOCUS_08560 gene mraZ 3490 3966 CDS product division/cell wall cluster transcriptional repressor MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943703.1 protein_id gnl|my_center|LOCUS_08560 3966 4901 gene locus_tag LOCUS_08570 gene rsmH 3966 4901 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943702.1 protein_id gnl|my_center|LOCUS_08570 4930 5271 gene locus_tag LOCUS_08580 gene ftsL 4930 5271 CDS product cell division protein FtsL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943701.1 protein_id gnl|my_center|LOCUS_08580 5268 7235 gene locus_tag LOCUS_08590 5268 7235 CDS product penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943700.1 protein_id gnl|my_center|LOCUS_08590 7372 8895 gene locus_tag LOCUS_08600 7372 8895 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943699.1 protein_id gnl|my_center|LOCUS_08600 8895 10289 gene locus_tag LOCUS_08610 8895 10289 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943698.1 protein_id gnl|my_center|LOCUS_08610 10293 11369 gene locus_tag LOCUS_08620 gene mraY 10293 11369 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943697.1 protein_id gnl|my_center|LOCUS_08620 11371 12711 gene locus_tag LOCUS_08630 gene murD 11371 12711 CDS product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943696.1 protein_id gnl|my_center|LOCUS_08630 12771 13898 gene locus_tag LOCUS_08640 gene ftsW 12771 13898 CDS product putative lipid II flippase FtsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943695.1 protein_id gnl|my_center|LOCUS_08640 13895 15049 gene locus_tag LOCUS_08650 gene murG 13895 15049 CDS product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943694.1 protein_id gnl|my_center|LOCUS_08650 15034 16413 gene locus_tag LOCUS_08660 gene murC 15034 16413 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943693.1 protein_id gnl|my_center|LOCUS_08660 16461 17297 gene locus_tag LOCUS_08670 gene murB 16461 17297 CDS product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943692.1 protein_id gnl|my_center|LOCUS_08670 17416 18342 gene locus_tag LOCUS_08680 17416 18342 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943691.1 protein_id gnl|my_center|LOCUS_08680 18346 19170 gene locus_tag LOCUS_08690 18346 19170 CDS product FtsQ-type POTRA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943690.1 protein_id gnl|my_center|LOCUS_08690 19208 20446 gene locus_tag LOCUS_08700 gene ftsA 19208 20446 CDS product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943689.1 protein_id gnl|my_center|LOCUS_08700 20556 21725 gene locus_tag LOCUS_08710 gene ftsZ 20556 21725 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943688.1 protein_id gnl|my_center|LOCUS_08710 21986 22489 gene locus_tag LOCUS_08720 21986 22489 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940903.1 protein_id gnl|my_center|LOCUS_08720 23601 23338 gene locus_tag LOCUS_08730 23601 23338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08730 23667 25268 gene locus_tag LOCUS_08740 23667 25268 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338946.1 protein_id gnl|my_center|LOCUS_08740 25234 26100 gene locus_tag LOCUS_08750 25234 26100 CDS product plasmid partitioning protein RepB C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083696.1 protein_id gnl|my_center|LOCUS_08750 26106 26999 gene locus_tag LOCUS_08760 26106 26999 CDS product plasmid partitioning protein RepB C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083695.1 protein_id gnl|my_center|LOCUS_08760 28583 27393 gene locus_tag LOCUS_08770 28583 27393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08770 28876 28583 gene locus_tag LOCUS_08780 28876 28583 CDS product type II toxin-antitoxin system HigB family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390234.1 protein_id gnl|my_center|LOCUS_08780 32775 29047 gene locus_tag LOCUS_08790 32775 29047 CDS product DUF4020 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_106004657.1 protein_id gnl|my_center|LOCUS_08790 >Feature sequence021 967 38 gene locus_tag LOCUS_08800 967 38 CDS product selenium metabolism-associated LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943159.1 protein_id gnl|my_center|LOCUS_08800 1089 1505 gene locus_tag LOCUS_08810 1089 1505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08810 1469 2179 gene locus_tag LOCUS_08820 1469 2179 CDS product DUF3047 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941830.1 protein_id gnl|my_center|LOCUS_08820 4043 2229 gene locus_tag LOCUS_08830 4043 2229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08830 4304 7315 gene locus_tag LOCUS_08840 4304 7315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08840 7381 9039 gene locus_tag LOCUS_08850 gene cdr 7381 9039 CDS product CoA-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000087552.1 protein_id gnl|my_center|LOCUS_08850 9091 9588 gene locus_tag LOCUS_08860 gene mog 9091 9588 CDS product molybdopterin adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943343.1 protein_id gnl|my_center|LOCUS_08860 9604 10125 gene locus_tag LOCUS_08870 9604 10125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08870 10040 10813 gene locus_tag LOCUS_08880 10040 10813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08880 10821 11144 gene locus_tag LOCUS_08890 10821 11144 CDS product peptide chain release factor-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_039645979.1 protein_id gnl|my_center|LOCUS_08890 11232 11936 gene locus_tag LOCUS_08900 11232 11936 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943737.1 protein_id gnl|my_center|LOCUS_08900 11937 12119 gene locus_tag LOCUS_08910 11937 12119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943736.1 protein_id gnl|my_center|LOCUS_08910 12136 12537 gene locus_tag LOCUS_08920 12136 12537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943735.1 protein_id gnl|my_center|LOCUS_08920 12541 14214 gene locus_tag LOCUS_08930 12541 14214 CDS product ribonuclease J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943734.1 protein_id gnl|my_center|LOCUS_08930 15407 14289 gene locus_tag LOCUS_08940 15407 14289 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943777.1 protein_id gnl|my_center|LOCUS_08940 16568 15504 gene locus_tag LOCUS_08950 16568 15504 CDS product two-component system response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071150.1 protein_id gnl|my_center|LOCUS_08950 18370 16565 gene locus_tag LOCUS_08960 18370 16565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08960 19990 18413 gene locus_tag LOCUS_08970 19990 18413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08970 21492 20281 gene locus_tag LOCUS_08980 gene tyrS 21492 20281 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941800.1 protein_id gnl|my_center|LOCUS_08980 22301 21516 gene locus_tag LOCUS_08990 22301 21516 CDS product TIGR00282 family metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941799.1 protein_id gnl|my_center|LOCUS_08990 23862 22291 gene locus_tag LOCUS_09000 gene rny 23862 22291 CDS product ribonuclease Y inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941798.1 protein_id gnl|my_center|LOCUS_09000 24491 23910 gene locus_tag LOCUS_09010 24491 23910 CDS product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941797.1 protein_id gnl|my_center|LOCUS_09010 25040 24768 gene locus_tag LOCUS_09020 25040 24768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09020 25324 25061 gene locus_tag LOCUS_09030 25324 25061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09030 26438 25356 gene locus_tag LOCUS_09040 gene ftsY 26438 25356 CDS product signal recognition particle-docking protein FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941793.1 protein_id gnl|my_center|LOCUS_09040 26794 26438 gene locus_tag LOCUS_09050 26794 26438 CDS product roadblock/LC7 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941792.1 protein_id gnl|my_center|LOCUS_09050 27187 27819 gene locus_tag LOCUS_09060 27187 27819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09060 31481 27954 gene locus_tag LOCUS_09070 gene smc 31481 27954 CDS product chromosome segregation protein SMC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941791.1 protein_id gnl|my_center|LOCUS_09070 31630 32862 gene locus_tag LOCUS_09080 31630 32862 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946820.1 protein_id gnl|my_center|LOCUS_09080 >Feature sequence022 194 487 gene locus_tag LOCUS_09090 194 487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09090 921 742 gene locus_tag LOCUS_09100 921 742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_09100 2039 999 gene locus_tag LOCUS_09110 2039 999 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004528582.1 protein_id gnl|my_center|LOCUS_09110 2318 3238 gene locus_tag LOCUS_09120 2318 3238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09120 3228 4031 gene locus_tag LOCUS_09130 3228 4031 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941990.1 protein_id gnl|my_center|LOCUS_09130 4233 5120 gene locus_tag LOCUS_09140 4233 5120 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942785.1 protein_id gnl|my_center|LOCUS_09140 5221 5823 gene locus_tag LOCUS_09150 5221 5823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09150 6247 6113 gene locus_tag LOCUS_09160 6247 6113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09160 6594 6519 gene locus_tag LOCUS_t00080 6594 6519 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 7688 6996 gene locus_tag LOCUS_09170 gene rpe 7688 6996 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259044.1 protein_id gnl|my_center|LOCUS_09170 7844 7704 gene locus_tag LOCUS_09180 7844 7704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09180 9493 7841 gene locus_tag LOCUS_09190 gene pgm 9493 7841 CDS product phosphoglucomutase (alpha-D-glucose-1,6-bisphosphate-dependent) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268077.1 protein_id gnl|my_center|LOCUS_09190 10596 9784 gene locus_tag LOCUS_09200 10596 9784 CDS product aquaporin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933138.1 protein_id gnl|my_center|LOCUS_09200 11076 10753 gene locus_tag LOCUS_09210 11076 10753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09210 11318 11079 gene locus_tag LOCUS_09220 11318 11079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09220 13245 11329 gene locus_tag LOCUS_09230 13245 11329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09230 13791 13258 gene locus_tag LOCUS_09240 gene qcrA 13791 13258 CDS product menaquinol-cytochrome c reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001290418.1 protein_id gnl|my_center|LOCUS_09240 14191 13991 gene locus_tag LOCUS_09250 14191 13991 CDS product cold shock domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940866.1 protein_id gnl|my_center|LOCUS_09250 15713 14580 gene locus_tag LOCUS_09260 15713 14580 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943453.1 protein_id gnl|my_center|LOCUS_09260 16859 15726 gene locus_tag LOCUS_09270 16859 15726 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943452.1 protein_id gnl|my_center|LOCUS_09270 17818 16856 gene locus_tag LOCUS_09280 17818 16856 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943451.1 protein_id gnl|my_center|LOCUS_09280 18762 17815 gene locus_tag LOCUS_09290 18762 17815 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943450.1 protein_id gnl|my_center|LOCUS_09290 19762 18764 gene locus_tag LOCUS_09300 19762 18764 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943449.1 protein_id gnl|my_center|LOCUS_09300 21142 19805 gene locus_tag LOCUS_09310 21142 19805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09310 22340 21837 gene locus_tag LOCUS_09320 22340 21837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09320 22578 22285 gene locus_tag LOCUS_09330 22578 22285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09330 24231 22588 gene locus_tag LOCUS_09340 gene pgi 24231 22588 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141691.1 protein_id gnl|my_center|LOCUS_09340 25668 24250 gene locus_tag LOCUS_09350 gene zwf 25668 24250 CDS product glucose-6-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528919.1 protein_id gnl|my_center|LOCUS_09350 26247 25684 gene locus_tag LOCUS_09360 26247 25684 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888340.1 protein_id gnl|my_center|LOCUS_09360 27434 26292 gene locus_tag LOCUS_09370 gene tal 27434 26292 CDS product transaldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143366.1 protein_id gnl|my_center|LOCUS_09370 29734 27668 gene locus_tag LOCUS_09380 gene tkt 29734 27668 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142294.1 protein_id gnl|my_center|LOCUS_09380 30174 30698 gene locus_tag LOCUS_09390 30174 30698 CDS product DUF1269 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_202950645.1 protein_id gnl|my_center|LOCUS_09390 30824 31867 gene locus_tag LOCUS_09400 30824 31867 CDS product zinc-dependent alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004200942.1 protein_id gnl|my_center|LOCUS_09400 31991 32194 gene locus_tag LOCUS_09410 31991 32194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09410 >Feature sequence023 2600 1938 gene locus_tag LOCUS_09420 2600 1938 CDS product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086430.1 protein_id gnl|my_center|LOCUS_09420 3894 2776 gene locus_tag LOCUS_09430 3894 2776 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257505.1 protein_id gnl|my_center|LOCUS_09430 4303 3983 gene locus_tag LOCUS_09440 4303 3983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09440 4409 4582 gene locus_tag LOCUS_09450 4409 4582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09450 5572 4595 gene locus_tag LOCUS_09460 5572 4595 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061733.1 protein_id gnl|my_center|LOCUS_09460 6821 5598 gene locus_tag LOCUS_09470 6821 5598 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338289.1 protein_id gnl|my_center|LOCUS_09470 8240 6849 gene locus_tag LOCUS_09480 8240 6849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09480 9978 8293 gene locus_tag LOCUS_09490 9978 8293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09490 10979 9975 gene locus_tag LOCUS_09500 10979 9975 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257502.1 protein_id gnl|my_center|LOCUS_09500 12253 10976 gene locus_tag LOCUS_09510 12253 10976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09510 13115 12267 gene locus_tag LOCUS_09520 13115 12267 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257972.1 protein_id gnl|my_center|LOCUS_09520 13989 13138 gene locus_tag LOCUS_09530 13989 13138 CDS product DUF3473 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011176621.1 protein_id gnl|my_center|LOCUS_09530 15200 13998 gene locus_tag LOCUS_09540 15200 13998 CDS product TIGR03016 family PEP-CTERM system-associated outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942625.1 protein_id gnl|my_center|LOCUS_09540 16506 15340 gene locus_tag LOCUS_09550 16506 15340 CDS product XrtA-associated ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235044863.1 protein_id gnl|my_center|LOCUS_09550 17370 16558 gene locus_tag LOCUS_09560 17370 16558 CDS product XrtA-associated tyrosine autokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942627.1 protein_id gnl|my_center|LOCUS_09560 18911 17412 gene locus_tag LOCUS_09570 18911 17412 CDS product Wzz/FepE/Etk N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942628.1 protein_id gnl|my_center|LOCUS_09570 19769 18966 gene locus_tag LOCUS_09580 19769 18966 CDS product polysaccharide biosynthesis/export family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942629.1 protein_id gnl|my_center|LOCUS_09580 21195 19828 gene locus_tag LOCUS_09590 21195 19828 CDS product TIGR03013 family PEP-CTERM/XrtA system glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942630.1 protein_id gnl|my_center|LOCUS_09590 23880 21235 gene locus_tag LOCUS_09600 gene prsT 23880 21235 CDS product PEP-CTERM system TPR-repeat protein PrsT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942631.1 protein_id gnl|my_center|LOCUS_09600 24519 25067 gene locus_tag LOCUS_09610 24519 25067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09610 25185 26669 gene locus_tag LOCUS_09620 25185 26669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09620 26699 27391 gene locus_tag LOCUS_09630 26699 27391 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942636.1 protein_id gnl|my_center|LOCUS_09630 31057 27398 gene locus_tag LOCUS_09640 31057 27398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09640 >Feature sequence024 322 1635 gene locus_tag LOCUS_09650 322 1635 CDS product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942582.1 protein_id gnl|my_center|LOCUS_09650 1632 2159 gene locus_tag LOCUS_09660 1632 2159 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942583.1 protein_id gnl|my_center|LOCUS_09660 3281 2166 gene locus_tag LOCUS_09670 gene tgt 3281 2166 CDS product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941835.1 protein_id gnl|my_center|LOCUS_09670 3672 4361 gene locus_tag LOCUS_09680 3672 4361 CDS product succinate dehydrogenase cytochrome b subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941836.1 protein_id gnl|my_center|LOCUS_09680 4372 6288 gene locus_tag LOCUS_09690 4372 6288 CDS product fumarate reductase/succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941837.1 protein_id gnl|my_center|LOCUS_09690 6288 7046 gene locus_tag LOCUS_09700 6288 7046 CDS product succinate dehydrogenase/fumarate reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941838.1 protein_id gnl|my_center|LOCUS_09700 7126 8037 gene locus_tag LOCUS_09710 7126 8037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09710 8102 9295 gene locus_tag LOCUS_09720 8102 9295 CDS product cofactor-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942463.1 protein_id gnl|my_center|LOCUS_09720 9518 10297 gene locus_tag LOCUS_09730 gene mltG 9518 10297 CDS product endolytic transglycosylase MltG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941176.1 protein_id gnl|my_center|LOCUS_09730 11159 10314 gene locus_tag LOCUS_09740 11159 10314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09740 13051 11159 gene locus_tag LOCUS_09750 13051 11159 CDS product GspE/PulE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393063.1 protein_id gnl|my_center|LOCUS_09750 13891 13241 gene locus_tag LOCUS_09760 13891 13241 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941310.1 protein_id gnl|my_center|LOCUS_09760 14368 14009 gene locus_tag LOCUS_09770 gene rplS 14368 14009 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941309.1 protein_id gnl|my_center|LOCUS_09770 14983 14405 gene locus_tag LOCUS_09780 14983 14405 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941308.1 protein_id gnl|my_center|LOCUS_09780 15716 14973 gene locus_tag LOCUS_09790 gene trmD 15716 14973 CDS product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941307.1 protein_id gnl|my_center|LOCUS_09790 16234 15713 gene locus_tag LOCUS_09800 gene rimM 16234 15713 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_200858943.1 protein_id gnl|my_center|LOCUS_09800 16465 16235 gene locus_tag LOCUS_09810 16465 16235 CDS product KH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941305.1 protein_id gnl|my_center|LOCUS_09810 16789 16523 gene locus_tag LOCUS_09820 gene rpsP 16789 16523 CDS product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_039642952.1 protein_id gnl|my_center|LOCUS_09820 18216 16855 gene locus_tag LOCUS_09830 gene ffh 18216 16855 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941303.1 protein_id gnl|my_center|LOCUS_09830 18691 18404 gene locus_tag LOCUS_09840 18691 18404 CDS product DUF3343 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941302.1 protein_id gnl|my_center|LOCUS_09840 18797 19063 gene locus_tag LOCUS_09850 18797 19063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941301.1 protein_id gnl|my_center|LOCUS_09850 19047 19523 gene locus_tag LOCUS_09860 19047 19523 CDS product DUF721 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941300.1 protein_id gnl|my_center|LOCUS_09860 21279 19600 gene locus_tag LOCUS_09870 gene ettA 21279 19600 CDS product energy-dependent translational throttle protein EttA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942289.1 protein_id gnl|my_center|LOCUS_09870 21448 21939 gene locus_tag LOCUS_09880 21448 21939 CDS product ferritin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942287.1 protein_id gnl|my_center|LOCUS_09880 22052 22552 gene locus_tag LOCUS_09890 22052 22552 CDS product HyaD/HybD family hydrogenase maturation endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940796.1 protein_id gnl|my_center|LOCUS_09890 23031 22573 gene locus_tag LOCUS_09900 23031 22573 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942074.1 protein_id gnl|my_center|LOCUS_09900 23384 23046 gene locus_tag LOCUS_09910 23384 23046 CDS product STAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942075.1 protein_id gnl|my_center|LOCUS_09910 26647 23399 gene locus_tag LOCUS_09920 26647 23399 CDS product SpoIIE family protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942076.1 protein_id gnl|my_center|LOCUS_09920 26898 26644 gene locus_tag LOCUS_09930 26898 26644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942077.1 protein_id gnl|my_center|LOCUS_09930 28475 26895 gene locus_tag LOCUS_09940 28475 26895 CDS product bifunctional aminoglycoside phosphotransferase/ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942078.1 protein_id gnl|my_center|LOCUS_09940 29069 28626 gene locus_tag LOCUS_09950 gene rplI 29069 28626 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941329.1 protein_id gnl|my_center|LOCUS_09950 30061 29099 gene locus_tag LOCUS_09960 30061 29099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09960 30436 30248 gene locus_tag LOCUS_09970 30436 30248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09970 30848 30462 gene locus_tag LOCUS_09980 30848 30462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09980 >Feature sequence025 1486 1220 gene locus_tag LOCUS_09990 gene rpsO 1486 1220 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942237.1 protein_id gnl|my_center|LOCUS_09990 2516 1605 gene locus_tag LOCUS_10000 gene truB 2516 1605 CDS product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942236.1 protein_id gnl|my_center|LOCUS_10000 3472 2513 gene locus_tag LOCUS_10010 3472 2513 CDS product bifunctional oligoribonuclease/PAP phosphatase NrnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942235.1 protein_id gnl|my_center|LOCUS_10010 3815 3444 gene locus_tag LOCUS_10020 3815 3444 CDS product ribosome-binding factor A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942234.1 protein_id gnl|my_center|LOCUS_10020 6637 3899 gene locus_tag LOCUS_10030 gene infB 6637 3899 CDS product translation initiation factor IF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942233.1 protein_id gnl|my_center|LOCUS_10030 7245 6643 gene locus_tag LOCUS_10040 7245 6643 CDS product DUF448 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942232.1 protein_id gnl|my_center|LOCUS_10040 8453 7251 gene locus_tag LOCUS_10050 gene nusA 8453 7251 CDS product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942231.1 protein_id gnl|my_center|LOCUS_10050 8977 8492 gene locus_tag LOCUS_10060 gene rimP 8977 8492 CDS product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942230.1 protein_id gnl|my_center|LOCUS_10060 11034 9100 gene locus_tag LOCUS_10070 11034 9100 CDS product ATPase, T2SS/T4P/T4SS family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943246.1 protein_id gnl|my_center|LOCUS_10070 12660 11125 gene locus_tag LOCUS_10080 12660 11125 CDS product LysM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943247.1 protein_id gnl|my_center|LOCUS_10080 14328 12742 gene locus_tag LOCUS_10090 14328 12742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943248.1 protein_id gnl|my_center|LOCUS_10090 17122 14429 gene locus_tag LOCUS_10100 17122 14429 CDS product 2-oxoglutarate dehydrogenase E1 component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943088.1 protein_id gnl|my_center|LOCUS_10100 18507 17215 gene locus_tag LOCUS_10110 18507 17215 CDS product YihY/virulence factor BrkB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943098.1 protein_id gnl|my_center|LOCUS_10110 18909 18544 gene locus_tag LOCUS_10120 18909 18544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_039644963.1 protein_id gnl|my_center|LOCUS_10120 19533 18922 gene locus_tag LOCUS_10130 19533 18922 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942241.1 protein_id gnl|my_center|LOCUS_10130 20909 19530 gene locus_tag LOCUS_10140 gene rmuC 20909 19530 CDS product DNA recombination protein RmuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460041.1 protein_id gnl|my_center|LOCUS_10140 21749 20916 gene locus_tag LOCUS_10150 gene rsmA 21749 20916 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942509.1 protein_id gnl|my_center|LOCUS_10150 22768 21746 gene locus_tag LOCUS_10160 gene tsaD 22768 21746 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942510.1 protein_id gnl|my_center|LOCUS_10160 24114 22798 gene locus_tag LOCUS_10170 24114 22798 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942511.1 protein_id gnl|my_center|LOCUS_10170 25331 24180 gene locus_tag LOCUS_10180 25331 24180 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942513.1 protein_id gnl|my_center|LOCUS_10180 26422 25346 gene locus_tag LOCUS_10190 26422 25346 CDS product NosD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942514.1 protein_id gnl|my_center|LOCUS_10190 26707 28944 gene locus_tag LOCUS_10200 26707 28944 CDS product vitamin B12-dependent ribonucleotide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942516.1 protein_id gnl|my_center|LOCUS_10200 29028 29104 gene locus_tag LOCUS_t00090 29028 29104 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence026 47 1120 gene locus_tag LOCUS_10210 47 1120 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957791.1 protein_id gnl|my_center|LOCUS_10210 1284 1553 gene locus_tag LOCUS_10220 1284 1553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10220 1550 1960 gene locus_tag LOCUS_10230 1550 1960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10230 1963 2754 gene locus_tag LOCUS_10240 1963 2754 CDS product ABC-2 transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942145.1 protein_id gnl|my_center|LOCUS_10240 2758 3609 gene locus_tag LOCUS_10250 2758 3609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942146.1 protein_id gnl|my_center|LOCUS_10250 3708 3962 gene locus_tag LOCUS_10260 3708 3962 CDS product type II toxin-antitoxin system prevent-host-death family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388730.1 protein_id gnl|my_center|LOCUS_10260 3955 4215 gene locus_tag LOCUS_10270 3955 4215 CDS product Txe/YoeB family addiction module toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464459.1 protein_id gnl|my_center|LOCUS_10270 4513 5433 gene locus_tag LOCUS_10280 4513 5433 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942147.1 protein_id gnl|my_center|LOCUS_10280 5734 6291 gene locus_tag LOCUS_10290 5734 6291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10290 6309 7211 gene locus_tag LOCUS_10300 6309 7211 CDS product glycosyltransferase family A protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942149.1 protein_id gnl|my_center|LOCUS_10300 7213 8040 gene locus_tag LOCUS_10310 7213 8040 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942150.1 protein_id gnl|my_center|LOCUS_10310 8065 8352 gene locus_tag LOCUS_10320 8065 8352 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545356.1 protein_id gnl|my_center|LOCUS_10320 8345 8710 gene locus_tag LOCUS_10330 8345 8710 CDS product DUF86 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545111.1 protein_id gnl|my_center|LOCUS_10330 8710 10014 gene locus_tag LOCUS_10340 8710 10014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10340 10008 10820 gene locus_tag LOCUS_10350 10008 10820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10350 10830 11879 gene locus_tag LOCUS_10360 10830 11879 CDS product glycosyltransferase family A protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257990.1 protein_id gnl|my_center|LOCUS_10360 11876 13177 gene locus_tag LOCUS_10370 11876 13177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10370 13187 14011 gene locus_tag LOCUS_10380 13187 14011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10380 14068 15444 gene locus_tag LOCUS_10390 14068 15444 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096882.1 protein_id gnl|my_center|LOCUS_10390 15514 16635 gene locus_tag LOCUS_10400 15514 16635 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143959.1 protein_id gnl|my_center|LOCUS_10400 16821 17540 gene locus_tag LOCUS_10410 16821 17540 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942160.1 protein_id gnl|my_center|LOCUS_10410 17952 18590 gene locus_tag LOCUS_10420 17952 18590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10420 18946 18650 gene locus_tag LOCUS_10430 18946 18650 CDS product putative addiction module antidote protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389060.1 protein_id gnl|my_center|LOCUS_10430 19278 18934 gene locus_tag LOCUS_10440 19278 18934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10440 19455 19682 gene locus_tag LOCUS_10450 19455 19682 CDS product AbrB/MazE/SpoVT family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943111.1 protein_id gnl|my_center|LOCUS_10450 19682 20083 gene locus_tag LOCUS_10460 19682 20083 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943110.1 protein_id gnl|my_center|LOCUS_10460 20188 21543 gene locus_tag LOCUS_10470 20188 21543 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942159.1 protein_id gnl|my_center|LOCUS_10470 21540 22670 gene locus_tag LOCUS_10480 21540 22670 CDS product glycosyltransferase family 9 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942161.1 protein_id gnl|my_center|LOCUS_10480 22667 24481 gene locus_tag LOCUS_10490 gene ligA 22667 24481 CDS product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403650.1 protein_id gnl|my_center|LOCUS_10490 26004 24484 gene locus_tag LOCUS_10500 gene metG 26004 24484 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942872.1 protein_id gnl|my_center|LOCUS_10500 27112 26006 gene locus_tag LOCUS_10510 27112 26006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10510 28127 27147 gene locus_tag LOCUS_10520 gene holB 28127 27147 CDS product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942870.1 protein_id gnl|my_center|LOCUS_10520 <29172 28114 gene locus_tag LOCUS_10530 <29172 28114 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942869.1:dTMP kinase >Feature sequence027 1403 522 gene locus_tag LOCUS_10540 1403 522 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943684.1 protein_id gnl|my_center|LOCUS_10540 1930 1505 gene locus_tag LOCUS_10550 1930 1505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10550 2823 1984 gene locus_tag LOCUS_10560 2823 1984 CDS product serine protein kinase RIO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770085.1 protein_id gnl|my_center|LOCUS_10560 3694 3149 gene locus_tag LOCUS_10570 3694 3149 CDS product 2-oxoacid:acceptor oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942116.1 protein_id gnl|my_center|LOCUS_10570 4544 3723 gene locus_tag LOCUS_10580 4544 3723 CDS product 2-oxoacid:ferredoxin oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942115.1 protein_id gnl|my_center|LOCUS_10580 5680 4547 gene locus_tag LOCUS_10590 5680 4547 CDS product 2-oxoacid:acceptor oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942114.1 protein_id gnl|my_center|LOCUS_10590 5900 5703 gene locus_tag LOCUS_10600 5900 5703 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942113.1 protein_id gnl|my_center|LOCUS_10600 6969 6019 gene locus_tag LOCUS_10610 gene mdh 6969 6019 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942112.1 protein_id gnl|my_center|LOCUS_10610 8457 7045 gene locus_tag LOCUS_10620 gene icd 8457 7045 CDS product NADP-dependent isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229433.1 protein_id gnl|my_center|LOCUS_10620 10745 8514 gene locus_tag LOCUS_10630 10745 8514 CDS product NADP-dependent isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942111.1 protein_id gnl|my_center|LOCUS_10630 11559 11032 gene locus_tag LOCUS_10640 11559 11032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10640 13508 11724 gene locus_tag LOCUS_10650 gene aspS 13508 11724 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942109.1 protein_id gnl|my_center|LOCUS_10650 14202 13537 gene locus_tag LOCUS_10660 gene lepB 14202 13537 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941922.1 protein_id gnl|my_center|LOCUS_10660 16027 14231 gene locus_tag LOCUS_10670 gene lepA 16027 14231 CDS product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941921.1 protein_id gnl|my_center|LOCUS_10670 16292 16747 gene locus_tag LOCUS_10680 gene tadA 16292 16747 CDS product tRNA adenosine(34) deaminase TadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940742.1 protein_id gnl|my_center|LOCUS_10680 18082 16868 gene locus_tag LOCUS_10690 18082 16868 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942444.1 protein_id gnl|my_center|LOCUS_10690 18650 18159 gene locus_tag LOCUS_10700 gene tsaE 18650 18159 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235044854.1 protein_id gnl|my_center|LOCUS_10700 19099 18650 gene locus_tag LOCUS_10710 19099 18650 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942446.1 protein_id gnl|my_center|LOCUS_10710 20708 19149 gene locus_tag LOCUS_10720 20708 19149 CDS product bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942447.1 protein_id gnl|my_center|LOCUS_10720 21085 20705 gene locus_tag LOCUS_10730 21085 20705 CDS product holo-[acyl-carrier-protein] synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942448.1 protein_id gnl|my_center|LOCUS_10730 21801 21082 gene locus_tag LOCUS_10740 21801 21082 CDS product pyridoxine 5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942449.1 protein_id gnl|my_center|LOCUS_10740 23159 21801 gene locus_tag LOCUS_10750 gene glmM 23159 21801 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942450.1 protein_id gnl|my_center|LOCUS_10750 24002 23217 gene locus_tag LOCUS_10760 gene cdaA 24002 23217 CDS product diadenylate cyclase CdaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942452.1 protein_id gnl|my_center|LOCUS_10760 25141 24035 gene locus_tag LOCUS_10770 25141 24035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10770 27134 25245 gene locus_tag LOCUS_10780 gene ftsH 27134 25245 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_200858940.1 protein_id gnl|my_center|LOCUS_10780 28397 27309 gene locus_tag LOCUS_10790 28397 27309 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942347.1 protein_id gnl|my_center|LOCUS_10790 >Feature sequence028 342 974 gene locus_tag LOCUS_10800 342 974 CDS product paraquat-inducible protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194239.1 protein_id gnl|my_center|LOCUS_10800 971 1606 gene locus_tag LOCUS_10810 971 1606 CDS product paraquat-inducible protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522113.1 protein_id gnl|my_center|LOCUS_10810 1603 3276 gene locus_tag LOCUS_10820 1603 3276 CDS product MlaD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522112.1 protein_id gnl|my_center|LOCUS_10820 3276 3926 gene locus_tag LOCUS_10830 3276 3926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10830 3993 4673 gene locus_tag LOCUS_10840 3993 4673 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943050.1 protein_id gnl|my_center|LOCUS_10840 4636 7161 gene locus_tag LOCUS_10850 4636 7161 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943051.1 protein_id gnl|my_center|LOCUS_10850 7195 7857 gene locus_tag LOCUS_10860 7195 7857 CDS product arylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943052.1 protein_id gnl|my_center|LOCUS_10860 8714 7926 gene locus_tag LOCUS_10870 8714 7926 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195576.1 protein_id gnl|my_center|LOCUS_10870 8915 9286 gene locus_tag LOCUS_10880 8915 9286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10880 10299 9532 gene locus_tag LOCUS_10890 10299 9532 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444218.1 protein_id gnl|my_center|LOCUS_10890 10877 10491 gene locus_tag LOCUS_10900 10877 10491 CDS product DUF309 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942308.1 protein_id gnl|my_center|LOCUS_10900 11084 11488 gene locus_tag LOCUS_10910 11084 11488 CDS product DUF393 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940910.1 protein_id gnl|my_center|LOCUS_10910 11508 12008 gene locus_tag LOCUS_10920 11508 12008 CDS product DUF2127 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943318.1 protein_id gnl|my_center|LOCUS_10920 12686 12027 gene locus_tag LOCUS_10930 12686 12027 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943268.1 protein_id gnl|my_center|LOCUS_10930 12999 13994 gene locus_tag LOCUS_10940 12999 13994 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940885.1 protein_id gnl|my_center|LOCUS_10940 14066 14974 gene locus_tag LOCUS_10950 14066 14974 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940886.1 protein_id gnl|my_center|LOCUS_10950 14971 15765 gene locus_tag LOCUS_10960 14971 15765 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_039647756.1 protein_id gnl|my_center|LOCUS_10960 15873 16664 gene locus_tag LOCUS_10970 15873 16664 CDS product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941466.1 protein_id gnl|my_center|LOCUS_10970 16680 17690 gene locus_tag LOCUS_10980 16680 17690 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941465.1 protein_id gnl|my_center|LOCUS_10980 17677 18453 gene locus_tag LOCUS_10990 17677 18453 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941464.1 protein_id gnl|my_center|LOCUS_10990 18686 18477 gene locus_tag LOCUS_11000 18686 18477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11000 18591 19418 gene locus_tag LOCUS_11010 18591 19418 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072376.1 protein_id gnl|my_center|LOCUS_11010 19558 20244 gene locus_tag LOCUS_11020 19558 20244 CDS product DUF554 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941418.1 protein_id gnl|my_center|LOCUS_11020 20302 20997 gene locus_tag LOCUS_11030 20302 20997 CDS product VIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888239.1 protein_id gnl|my_center|LOCUS_11030 21891 21028 gene locus_tag LOCUS_11040 21891 21028 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942022.1 protein_id gnl|my_center|LOCUS_11040 22279 23829 gene locus_tag LOCUS_11050 22279 23829 CDS product tetrathionate reductase family octaheme c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942936.1 protein_id gnl|my_center|LOCUS_11050 26636 23988 gene locus_tag LOCUS_11060 gene pepN 26636 23988 CDS product aminopeptidase N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940973.1 protein_id gnl|my_center|LOCUS_11060 26814 27395 gene locus_tag LOCUS_11070 26814 27395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11070 27434 27913 gene locus_tag LOCUS_11080 27434 27913 CDS product DUF1456 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037422212.1 protein_id gnl|my_center|LOCUS_11080 >Feature sequence029 129 278 gene locus_tag LOCUS_11090 gene rpmG 129 278 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943500.1 protein_id gnl|my_center|LOCUS_11090 303 379 gene locus_tag LOCUS_t00100 303 379 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 468 650 gene locus_tag LOCUS_11100 gene secE 468 650 CDS product preprotein translocase subunit SecE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943499.1 protein_id gnl|my_center|LOCUS_11100 662 1189 gene locus_tag LOCUS_11110 gene nusG 662 1189 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943498.1 protein_id gnl|my_center|LOCUS_11110 1253 1675 gene locus_tag LOCUS_11120 gene rplK 1253 1675 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943497.1 protein_id gnl|my_center|LOCUS_11120 1720 2421 gene locus_tag LOCUS_11130 gene rplA 1720 2421 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943496.1 protein_id gnl|my_center|LOCUS_11130 2579 3103 gene locus_tag LOCUS_11140 gene rplJ 2579 3103 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943495.1 protein_id gnl|my_center|LOCUS_11140 3157 3534 gene locus_tag LOCUS_11150 gene rplL 3157 3534 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943494.1 protein_id gnl|my_center|LOCUS_11150 3688 8187 gene locus_tag LOCUS_11160 3688 8187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11160 8254 12450 gene locus_tag LOCUS_11170 gene rpoC 8254 12450 CDS product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943492.1 protein_id gnl|my_center|LOCUS_11170 14131 12515 gene locus_tag LOCUS_11180 14131 12515 CDS product thiolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943925.1 protein_id gnl|my_center|LOCUS_11180 14689 14219 gene locus_tag LOCUS_11190 gene msrA 14689 14219 CDS product peptide-methionine (S)-S-oxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060839.1 protein_id gnl|my_center|LOCUS_11190 15478 14735 gene locus_tag LOCUS_11200 15478 14735 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941735.1 protein_id gnl|my_center|LOCUS_11200 15718 16083 gene locus_tag LOCUS_11210 15718 16083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11210 16146 16219 gene locus_tag LOCUS_t00110 16146 16219 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 17311 16346 gene locus_tag LOCUS_11220 17311 16346 CDS product PATAN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942118.1 protein_id gnl|my_center|LOCUS_11220 19734 17485 gene locus_tag LOCUS_11230 19734 17485 CDS product NADP-dependent malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942344.1 protein_id gnl|my_center|LOCUS_11230 20013 19831 gene locus_tag LOCUS_11240 20013 19831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11240 20067 20405 gene locus_tag LOCUS_11250 20067 20405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942705.1 protein_id gnl|my_center|LOCUS_11250 20386 21231 gene locus_tag LOCUS_11260 20386 21231 CDS product HDOD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942704.1 protein_id gnl|my_center|LOCUS_11260 21495 22319 gene locus_tag LOCUS_11270 gene nadC 21495 22319 CDS product carboxylating nicotinate-nucleotide diphosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942581.1 protein_id gnl|my_center|LOCUS_11270 22356 23333 gene locus_tag LOCUS_11280 22356 23333 CDS product biotin--[acetyl-CoA-carboxylase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942580.1 protein_id gnl|my_center|LOCUS_11280 23334 24098 gene locus_tag LOCUS_11290 23334 24098 CDS product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942579.1 protein_id gnl|my_center|LOCUS_11290 24185 26284 gene locus_tag LOCUS_11300 gene fusA 24185 26284 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942578.1 protein_id gnl|my_center|LOCUS_11300 26305 27357 gene locus_tag LOCUS_11310 26305 27357 CDS product SPOR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942577.1 protein_id gnl|my_center|LOCUS_11310 >Feature sequence030 2374 2610 gene locus_tag LOCUS_11320 2374 2610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11320 3078 2629 gene locus_tag LOCUS_11330 3078 2629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11330 3232 3612 gene locus_tag LOCUS_11340 3232 3612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11340 3494 3503 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3672 4688 gene locus_tag LOCUS_11350 3672 4688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11350 4819 5730 gene locus_tag LOCUS_11360 4819 5730 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_153018271.1 protein_id gnl|my_center|LOCUS_11360 5727 6509 gene locus_tag LOCUS_11370 5727 6509 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392394.1 protein_id gnl|my_center|LOCUS_11370 8403 6562 gene locus_tag LOCUS_11380 8403 6562 CDS product UbiD family decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942647.1 protein_id gnl|my_center|LOCUS_11380 8817 9233 gene locus_tag LOCUS_11390 8817 9233 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940036.1 protein_id gnl|my_center|LOCUS_11390 10615 9473 gene locus_tag LOCUS_11400 10615 9473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11400 13954 10643 gene locus_tag LOCUS_11410 13954 10643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11410 18243 13960 gene locus_tag LOCUS_11420 18243 13960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11420 14045 14054 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 18369 18398 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 18569 18405 gene locus_tag LOCUS_11430 18569 18405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11430 18756 18947 gene locus_tag LOCUS_11440 18756 18947 CDS product type II toxin-antitoxin system prevent-host-death family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083755892.1 protein_id gnl|my_center|LOCUS_11440 18934 19200 gene locus_tag LOCUS_11450 18934 19200 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011171672.1 protein_id gnl|my_center|LOCUS_11450 20514 19267 gene locus_tag LOCUS_11460 20514 19267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11460 21350 20547 gene locus_tag LOCUS_11470 gene amrB 21350 20547 CDS product AmmeMemoRadiSam system protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942474.1 protein_id gnl|my_center|LOCUS_11470 21973 21368 gene locus_tag LOCUS_11480 gene scpB 21973 21368 CDS product SMC-Scp complex subunit ScpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942475.1 protein_id gnl|my_center|LOCUS_11480 22780 21980 gene locus_tag LOCUS_11490 22780 21980 CDS product segregation/condensation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942476.1 protein_id gnl|my_center|LOCUS_11490 23762 22782 gene locus_tag LOCUS_11500 gene trpS 23762 22782 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942477.1 protein_id gnl|my_center|LOCUS_11500 23844 24308 gene locus_tag LOCUS_11510 gene dut 23844 24308 CDS product dUTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001298007.1 protein_id gnl|my_center|LOCUS_11510 25865 24339 gene locus_tag LOCUS_11520 25865 24339 CDS product Ppx/GppA phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943196.1 protein_id gnl|my_center|LOCUS_11520 <27250 25987 gene locus_tag LOCUS_11530 <27250 25987 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_041914012.1:polyribonucleotide nucleotidyltransferase >Feature sequence031 994 266 gene locus_tag LOCUS_11540 994 266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11540 2489 1197 gene locus_tag LOCUS_11550 2489 1197 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943308.1 protein_id gnl|my_center|LOCUS_11550 3566 3207 gene locus_tag LOCUS_11560 3566 3207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11560 4164 5960 gene locus_tag LOCUS_11570 4164 5960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11570 6528 5971 gene locus_tag LOCUS_11580 6528 5971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11580 6709 6518 gene locus_tag LOCUS_11590 6709 6518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11590 8271 6859 gene locus_tag LOCUS_11600 gene glnA 8271 6859 CDS product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942479.1 protein_id gnl|my_center|LOCUS_11600 8639 8301 gene locus_tag LOCUS_11610 8639 8301 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942480.1 protein_id gnl|my_center|LOCUS_11610 9612 8899 gene locus_tag LOCUS_11620 9612 8899 CDS product PilZ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940813.1 protein_id gnl|my_center|LOCUS_11620 9675 10547 gene locus_tag LOCUS_11630 9675 10547 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942481.1 protein_id gnl|my_center|LOCUS_11630 10547 11722 gene locus_tag LOCUS_11640 10547 11722 CDS product class II aldolase/adducin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942830.1 protein_id gnl|my_center|LOCUS_11640 12456 11719 gene locus_tag LOCUS_11650 gene rlmB 12456 11719 CDS product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942108.1 protein_id gnl|my_center|LOCUS_11650 13178 12453 gene locus_tag LOCUS_11660 gene pyrF 13178 12453 CDS product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942107.1 protein_id gnl|my_center|LOCUS_11660 15051 13186 gene locus_tag LOCUS_11670 gene dxs 15051 13186 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941346.1 protein_id gnl|my_center|LOCUS_11670 16054 15065 gene locus_tag LOCUS_11680 16054 15065 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941347.1 protein_id gnl|my_center|LOCUS_11680 18179 16125 gene locus_tag LOCUS_11690 gene shc 18179 16125 CDS product squalene--hopene cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941348.1 protein_id gnl|my_center|LOCUS_11690 18489 18565 gene locus_tag LOCUS_t00120 18489 18565 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 18714 18790 gene locus_tag LOCUS_t00130 18714 18790 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 20341 18917 gene locus_tag LOCUS_11700 20341 18917 CDS product efflux transporter outer membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196794.1 protein_id gnl|my_center|LOCUS_11700 23457 20338 gene locus_tag LOCUS_11710 gene mdtC 23457 20338 CDS product multidrug efflux RND transporter permease subunit MdtC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015706066.1 protein_id gnl|my_center|LOCUS_11710 23918 23565 gene locus_tag LOCUS_11720 23918 23565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941417.1 protein_id gnl|my_center|LOCUS_11720 <26946 23989 gene locus_tag LOCUS_11730 <26946 23989 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003089920.1:multidrug efflux RND transporter permease subunit MuxB >Feature sequence032 879 136 gene locus_tag LOCUS_11740 879 136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11740 1108 1515 gene locus_tag LOCUS_11750 1108 1515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11750 1524 3314 gene locus_tag LOCUS_11760 1524 3314 CDS product GspE/PulE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266274.1 protein_id gnl|my_center|LOCUS_11760 3402 4394 gene locus_tag LOCUS_11770 gene bioB 3402 4394 CDS product biotin synthase BioB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942229.1 protein_id gnl|my_center|LOCUS_11770 4391 5107 gene locus_tag LOCUS_11780 gene bioD 4391 5107 CDS product dethiobiotin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942228.1 protein_id gnl|my_center|LOCUS_11780 6803 5076 gene locus_tag LOCUS_11790 6803 5076 CDS product SulP family inorganic anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086257.1 protein_id gnl|my_center|LOCUS_11790 7055 8341 gene locus_tag LOCUS_11800 7055 8341 CDS product O-acetylhomoserine aminocarboxypropyltransferase/cysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941843.1 protein_id gnl|my_center|LOCUS_11800 8448 8816 gene locus_tag LOCUS_11810 gene queD 8448 8816 CDS product 6-carboxytetrahydropterin synthase QueD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942365.1 protein_id gnl|my_center|LOCUS_11810 8809 9558 gene locus_tag LOCUS_11820 8809 9558 CDS product 7-carboxy-7-deazaguanine synthase QueE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942366.1 protein_id gnl|my_center|LOCUS_11820 9555 9935 gene locus_tag LOCUS_11830 9555 9935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942394.1 protein_id gnl|my_center|LOCUS_11830 9937 11250 gene locus_tag LOCUS_11840 gene rlmD 9937 11250 CDS product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942393.1 protein_id gnl|my_center|LOCUS_11840 11263 12285 gene locus_tag LOCUS_11850 11263 12285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11850 12373 12648 gene locus_tag LOCUS_11860 12373 12648 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942391.1 protein_id gnl|my_center|LOCUS_11860 12717 13622 gene locus_tag LOCUS_11870 12717 13622 CDS product exopolyphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942386.1 protein_id gnl|my_center|LOCUS_11870 13699 15192 gene locus_tag LOCUS_11880 gene malQ 13699 15192 CDS product 4-alpha-glucanotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941842.1 protein_id gnl|my_center|LOCUS_11880 15407 15817 gene locus_tag LOCUS_11890 15407 15817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11890 15863 16051 gene locus_tag LOCUS_11900 gene rpmF 15863 16051 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942244.1 protein_id gnl|my_center|LOCUS_11900 16064 17119 gene locus_tag LOCUS_11910 gene plsX 16064 17119 CDS product phosphate acyltransferase PlsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942245.1 protein_id gnl|my_center|LOCUS_11910 17133 18113 gene locus_tag LOCUS_11920 17133 18113 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942246.1 protein_id gnl|my_center|LOCUS_11920 18152 19084 gene locus_tag LOCUS_11930 gene fabD 18152 19084 CDS product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942247.1 protein_id gnl|my_center|LOCUS_11930 19084 19818 gene locus_tag LOCUS_11940 gene fabG 19084 19818 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942248.1 protein_id gnl|my_center|LOCUS_11940 19927 20160 gene locus_tag LOCUS_11950 gene acpP 19927 20160 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942249.1 protein_id gnl|my_center|LOCUS_11950 20244 21476 gene locus_tag LOCUS_11960 gene fabF 20244 21476 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942250.1 protein_id gnl|my_center|LOCUS_11960 21491 21934 gene locus_tag LOCUS_11970 gene rpiB 21491 21934 CDS product ribose 5-phosphate isomerase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942251.1 protein_id gnl|my_center|LOCUS_11970 22050 23297 gene locus_tag LOCUS_11980 22050 23297 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942252.1 protein_id gnl|my_center|LOCUS_11980 23379 24743 gene locus_tag LOCUS_11990 gene bioA 23379 24743 CDS product adenosylmethionine--8-amino-7-oxononanoate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942227.1 protein_id gnl|my_center|LOCUS_11990 24747 26138 gene locus_tag LOCUS_12000 24747 26138 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941790.1 protein_id gnl|my_center|LOCUS_12000 26260 26712 gene locus_tag LOCUS_12010 26260 26712 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941718.1 protein_id gnl|my_center|LOCUS_12010 >Feature sequence033 463 1554 gene locus_tag LOCUS_12020 463 1554 CDS product chemotaxis response regulator protein-glutamate methylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004200023.1 protein_id gnl|my_center|LOCUS_12020 1605 2243 gene locus_tag LOCUS_12030 1605 2243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12030 2159 2168 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2252 4273 gene locus_tag LOCUS_12040 2252 4273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12040 4266 4658 gene locus_tag LOCUS_12050 4266 4658 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943385.1 protein_id gnl|my_center|LOCUS_12050 4655 5251 gene locus_tag LOCUS_12060 4655 5251 CDS product CheB methylesterase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943384.1 protein_id gnl|my_center|LOCUS_12060 5320 6504 gene locus_tag LOCUS_12070 5320 6504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12070 6504 6893 gene locus_tag LOCUS_12080 6504 6893 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792460.1 protein_id gnl|my_center|LOCUS_12080 6893 9070 gene locus_tag LOCUS_12090 6893 9070 CDS product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937715.1 protein_id gnl|my_center|LOCUS_12090 9098 11368 gene locus_tag LOCUS_12100 9098 11368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12100 12364 11354 gene locus_tag LOCUS_12110 12364 11354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12110 12475 14025 gene locus_tag LOCUS_12120 12475 14025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12120 15197 14139 gene locus_tag LOCUS_12130 gene mnmA 15197 14139 CDS product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943205.1 protein_id gnl|my_center|LOCUS_12130 15997 15194 gene locus_tag LOCUS_12140 gene thiF 15997 15194 CDS product sulfur carrier protein ThiS adenylyltransferase ThiF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966206.1 protein_id gnl|my_center|LOCUS_12140 17136 16003 gene locus_tag LOCUS_12150 17136 16003 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941613.1 protein_id gnl|my_center|LOCUS_12150 18274 17138 gene locus_tag LOCUS_12160 18274 17138 CDS product PLP-dependent aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941612.1 protein_id gnl|my_center|LOCUS_12160 19079 18618 gene locus_tag LOCUS_12170 19079 18618 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941998.1 protein_id gnl|my_center|LOCUS_12170 19427 19221 gene locus_tag LOCUS_12180 19427 19221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12180 19666 21030 gene locus_tag LOCUS_12190 19666 21030 CDS product cytochrome c biogenesis protein ResB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941275.1 protein_id gnl|my_center|LOCUS_12190 21048 21908 gene locus_tag LOCUS_12200 gene ccsB 21048 21908 CDS product c-type cytochrome biogenesis protein CcsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941276.1 protein_id gnl|my_center|LOCUS_12200 22030 23007 gene locus_tag LOCUS_12210 22030 23007 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941284.1 protein_id gnl|my_center|LOCUS_12210 23058 24002 gene locus_tag LOCUS_12220 23058 24002 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941286.1 protein_id gnl|my_center|LOCUS_12220 23995 25170 gene locus_tag LOCUS_12230 23995 25170 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941287.1 protein_id gnl|my_center|LOCUS_12230 25262 25336 gene locus_tag LOCUS_t00140 25262 25336 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 26662 25430 gene locus_tag LOCUS_12240 26662 25430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12240 >Feature sequence034 106 531 gene locus_tag LOCUS_12250 106 531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12250 677 922 gene locus_tag LOCUS_12260 677 922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12260 919 1305 gene locus_tag LOCUS_12270 919 1305 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403014.1 protein_id gnl|my_center|LOCUS_12270 1396 2004 gene locus_tag LOCUS_12280 gene gmk 1396 2004 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942878.1 protein_id gnl|my_center|LOCUS_12280 2059 2265 gene locus_tag LOCUS_12290 gene rpoZ 2059 2265 CDS product DNA-directed RNA polymerase subunit omega inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942877.1 protein_id gnl|my_center|LOCUS_12290 2365 4515 gene locus_tag LOCUS_12300 2365 4515 CDS product bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942876.1 protein_id gnl|my_center|LOCUS_12300 4512 4892 gene locus_tag LOCUS_12310 4512 4892 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942875.1 protein_id gnl|my_center|LOCUS_12310 5242 5856 gene locus_tag LOCUS_12320 5242 5856 CDS product YdcF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942873.1 protein_id gnl|my_center|LOCUS_12320 5926 7311 gene locus_tag LOCUS_12330 gene thrC 5926 7311 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942338.1 protein_id gnl|my_center|LOCUS_12330 7323 8891 gene locus_tag LOCUS_12340 gene murJ 7323 8891 CDS product murein biosynthesis integral membrane protein MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941832.1 protein_id gnl|my_center|LOCUS_12340 8898 9455 gene locus_tag LOCUS_12350 8898 9455 CDS product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_039645658.1 protein_id gnl|my_center|LOCUS_12350 10479 9685 gene locus_tag LOCUS_12360 gene mazG 10479 9685 CDS product nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941834.1 protein_id gnl|my_center|LOCUS_12360 10841 10527 gene locus_tag LOCUS_12370 10841 10527 CDS product CcdB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529164.1 protein_id gnl|my_center|LOCUS_12370 11089 10841 gene locus_tag LOCUS_12380 11089 10841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12380 11432 13750 gene locus_tag LOCUS_12390 gene recG 11432 13750 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941980.1 protein_id gnl|my_center|LOCUS_12390 13759 14733 gene locus_tag LOCUS_12400 13759 14733 CDS product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942133.1 protein_id gnl|my_center|LOCUS_12400 14723 15733 gene locus_tag LOCUS_12410 14723 15733 CDS product lysylphosphatidylglycerol synthase transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942134.1 protein_id gnl|my_center|LOCUS_12410 15730 17598 gene locus_tag LOCUS_12420 15730 17598 CDS product DUF2723 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942135.1 protein_id gnl|my_center|LOCUS_12420 17603 18454 gene locus_tag LOCUS_12430 gene aroE 17603 18454 CDS product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942136.1 protein_id gnl|my_center|LOCUS_12430 18529 20235 gene locus_tag LOCUS_12440 gene pilB 18529 20235 CDS product type IV-A pilus assembly ATPase PilB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942137.1 protein_id gnl|my_center|LOCUS_12440 20250 21347 gene locus_tag LOCUS_12450 20250 21347 CDS product type IV pilus twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942138.1 protein_id gnl|my_center|LOCUS_12450 21368 22585 gene locus_tag LOCUS_12460 21368 22585 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942139.1 protein_id gnl|my_center|LOCUS_12460 22588 24195 gene locus_tag LOCUS_12470 22588 24195 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942140.1 protein_id gnl|my_center|LOCUS_12470 24199 25365 gene locus_tag LOCUS_12480 24199 25365 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941825.1 protein_id gnl|my_center|LOCUS_12480 25396 26142 gene locus_tag LOCUS_12490 25396 26142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875784.1 protein_id gnl|my_center|LOCUS_12490 >Feature sequence035 268 193 gene locus_tag LOCUS_t00150 268 193 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 914 1228 gene locus_tag LOCUS_12500 914 1228 CDS product DUF485 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942988.1 protein_id gnl|my_center|LOCUS_12500 1242 2681 gene locus_tag LOCUS_12510 1242 2681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12510 2657 3235 gene locus_tag LOCUS_12520 2657 3235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12520 3346 3657 gene locus_tag LOCUS_12530 3346 3657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12530 3584 4501 gene locus_tag LOCUS_12540 3584 4501 CDS product DUF362 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941162.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12540 3602 3611 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 5104 4496 gene locus_tag LOCUS_12550 5104 4496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12550 5949 5365 gene locus_tag LOCUS_12560 5949 5365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12560 7367 6087 gene locus_tag LOCUS_12570 gene tolB 7367 6087 CDS product Tol-Pal system beta propeller repeat protein TolB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940703.1 protein_id gnl|my_center|LOCUS_12570 8156 7383 gene locus_tag LOCUS_12580 8156 7383 CDS product TonB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940704.1 protein_id gnl|my_center|LOCUS_12580 8569 8156 gene locus_tag LOCUS_12590 gene tolR 8569 8156 CDS product protein TolR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940705.1 protein_id gnl|my_center|LOCUS_12590 9244 8573 gene locus_tag LOCUS_12600 gene tolQ 9244 8573 CDS product protein TolQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940706.1 protein_id gnl|my_center|LOCUS_12600 10545 9328 gene locus_tag LOCUS_12610 gene coaBC 10545 9328 CDS product bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941785.1 protein_id gnl|my_center|LOCUS_12610 11182 10559 gene locus_tag LOCUS_12620 11182 10559 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941784.1 protein_id gnl|my_center|LOCUS_12620 11318 11503 gene locus_tag LOCUS_12630 11318 11503 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943805.1 protein_id gnl|my_center|LOCUS_12630 11529 11687 gene locus_tag LOCUS_12640 11529 11687 CDS product rubredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943806.1 protein_id gnl|my_center|LOCUS_12640 11913 11737 gene locus_tag LOCUS_12650 11913 11737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943807.1 protein_id gnl|my_center|LOCUS_12650 13027 11954 gene locus_tag LOCUS_12660 13027 11954 CDS product alanine--glyoxylate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943872.1 protein_id gnl|my_center|LOCUS_12660 13241 14275 gene locus_tag LOCUS_12670 13241 14275 CDS product cytochrome c3 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942639.1 protein_id gnl|my_center|LOCUS_12670 14652 16505 gene locus_tag LOCUS_12680 14652 16505 CDS product cytochrome c3 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940947.1 protein_id gnl|my_center|LOCUS_12680 16530 16539 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 16686 18209 gene locus_tag LOCUS_12690 16686 18209 CDS product NapC/NirT family cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943871.1 protein_id gnl|my_center|LOCUS_12690 18451 18287 gene locus_tag LOCUS_12700 18451 18287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12700 19415 18462 gene locus_tag LOCUS_12710 gene trxB 19415 18462 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941156.1 protein_id gnl|my_center|LOCUS_12710 19533 20738 gene locus_tag LOCUS_12720 gene ilvA 19533 20738 CDS product threonine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941154.1 protein_id gnl|my_center|LOCUS_12720 20843 21085 gene locus_tag LOCUS_12730 20843 21085 CDS product DUF6364 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404326.1 protein_id gnl|my_center|LOCUS_12730 21082 21492 gene locus_tag LOCUS_12740 21082 21492 CDS product PIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404325.1 protein_id gnl|my_center|LOCUS_12740 22080 21649 gene locus_tag LOCUS_12750 gene flaF 22080 21649 CDS product flagellar biosynthesis regulator FlaF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626463.1 protein_id gnl|my_center|LOCUS_12750 22360 24234 gene locus_tag LOCUS_12760 22360 24234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12760 24327 24944 gene locus_tag LOCUS_12770 24327 24944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12770 24948 25337 gene locus_tag LOCUS_12780 gene flbT 24948 25337 CDS product flagellar biosynthesis repressor FlbT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088588.1 protein_id gnl|my_center|LOCUS_12780 >Feature sequence036 1598 237 gene locus_tag LOCUS_12790 1598 237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12790 594 681 gene locus_tag LOCUS_t00160 594 681 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 1789 2547 gene locus_tag LOCUS_12800 1789 2547 CDS product 3',5'-cyclic-nucleotide phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546308.1 protein_id gnl|my_center|LOCUS_12800 2685 3629 gene locus_tag LOCUS_12810 2685 3629 CDS product class 1 fructose-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942295.1 protein_id gnl|my_center|LOCUS_12810 3642 3941 gene locus_tag LOCUS_12820 3642 3941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12820 5043 3997 gene locus_tag LOCUS_12830 5043 3997 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942298.1 protein_id gnl|my_center|LOCUS_12830 5726 7795 gene locus_tag LOCUS_12840 5726 7795 CDS product DNA internalization-related competence protein ComEC/Rec2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942301.1 protein_id gnl|my_center|LOCUS_12840 7792 9234 gene locus_tag LOCUS_12850 7792 9234 CDS product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942302.1 protein_id gnl|my_center|LOCUS_12850 9319 10572 gene locus_tag LOCUS_12860 gene hisS 9319 10572 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942303.1 protein_id gnl|my_center|LOCUS_12860 10642 11661 gene locus_tag LOCUS_12870 gene ruvB 10642 11661 CDS product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941738.1 protein_id gnl|my_center|LOCUS_12870 11663 12355 gene locus_tag LOCUS_12880 11663 12355 CDS product DnaA/Hda family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941739.1 protein_id gnl|my_center|LOCUS_12880 12352 13674 gene locus_tag LOCUS_12890 12352 13674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943618.1 protein_id gnl|my_center|LOCUS_12890 13690 14538 gene locus_tag LOCUS_12900 13690 14538 CDS product S1-like domain-containing RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071980.1 protein_id gnl|my_center|LOCUS_12900 14535 15515 gene locus_tag LOCUS_12910 14535 15515 CDS product metal ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943615.1 protein_id gnl|my_center|LOCUS_12910 15500 16252 gene locus_tag LOCUS_12920 15500 16252 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943614.1 protein_id gnl|my_center|LOCUS_12920 16255 17088 gene locus_tag LOCUS_12930 16255 17088 CDS product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943613.1 protein_id gnl|my_center|LOCUS_12930 18232 17072 gene locus_tag LOCUS_12940 18232 17072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12940 18438 18235 gene locus_tag LOCUS_12950 18438 18235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12950 19730 18483 gene locus_tag LOCUS_12960 19730 18483 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943128.1 protein_id gnl|my_center|LOCUS_12960 20272 19727 gene locus_tag LOCUS_12970 gene rfbC 20272 19727 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096184.1 protein_id gnl|my_center|LOCUS_12970 21025 20306 gene locus_tag LOCUS_12980 21025 20306 CDS product FadR/GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942270.1 protein_id gnl|my_center|LOCUS_12980 22349 21105 gene locus_tag LOCUS_12990 22349 21105 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942269.1 protein_id gnl|my_center|LOCUS_12990 23721 22351 gene locus_tag LOCUS_13000 23721 22351 CDS product FAD-linked oxidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942268.1 protein_id gnl|my_center|LOCUS_13000 24058 24609 gene locus_tag LOCUS_13010 24058 24609 CDS product lactate utilization protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545973.1 protein_id gnl|my_center|LOCUS_13010 >Feature sequence037 <1 2172 gene locus_tag LOCUS_13020 <1 2172 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011122292.1:CHASE domain-containing protein 2322 2615 gene locus_tag LOCUS_13030 2322 2615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13030 2746 3231 gene locus_tag LOCUS_13040 2746 3231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13040 3137 3640 gene locus_tag LOCUS_13050 3137 3640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13050 4353 3733 gene locus_tag LOCUS_13060 4353 3733 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444701.1 protein_id gnl|my_center|LOCUS_13060 5641 4394 gene locus_tag LOCUS_13070 5641 4394 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257882.1 protein_id gnl|my_center|LOCUS_13070 6385 6969 gene locus_tag LOCUS_13080 6385 6969 CDS product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941475.1 protein_id gnl|my_center|LOCUS_13080 7286 7008 gene locus_tag LOCUS_13090 7286 7008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13090 7492 8040 gene locus_tag LOCUS_13100 7492 8040 CDS product YaeQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942734.1 protein_id gnl|my_center|LOCUS_13100 8283 9665 gene locus_tag LOCUS_13110 8283 9665 CDS product DUF3300 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941870.1 protein_id gnl|my_center|LOCUS_13110 9735 10709 gene locus_tag LOCUS_13120 9735 10709 CDS product DUF2950 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941869.1 protein_id gnl|my_center|LOCUS_13120 10724 11194 gene locus_tag LOCUS_13130 10724 11194 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940875.1 protein_id gnl|my_center|LOCUS_13130 11191 13362 gene locus_tag LOCUS_13140 11191 13362 CDS product xanthine dehydrogenase family protein molybdopterin-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940876.1 protein_id gnl|my_center|LOCUS_13140 13367 14134 gene locus_tag LOCUS_13150 13367 14134 CDS product XdhC/CoxI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940877.1 protein_id gnl|my_center|LOCUS_13150 14131 14718 gene locus_tag LOCUS_13160 14131 14718 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940878.1 protein_id gnl|my_center|LOCUS_13160 14747 15838 gene locus_tag LOCUS_13170 14747 15838 CDS product alkene reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114006.1 protein_id gnl|my_center|LOCUS_13170 15871 16773 gene locus_tag LOCUS_13180 15871 16773 CDS product pirin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941492.1 protein_id gnl|my_center|LOCUS_13180 16827 17735 gene locus_tag LOCUS_13190 16827 17735 CDS product YceI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941599.1 protein_id gnl|my_center|LOCUS_13190 17756 18370 gene locus_tag LOCUS_13200 gene wrbA 17756 18370 CDS product NAD(P)H:quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941470.1 protein_id gnl|my_center|LOCUS_13200 18400 18903 gene locus_tag LOCUS_13210 18400 18903 CDS product ferritin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932996.1 protein_id gnl|my_center|LOCUS_13210 19673 19212 gene locus_tag LOCUS_13220 19673 19212 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941779.1 protein_id gnl|my_center|LOCUS_13220 20635 19703 gene locus_tag LOCUS_13230 20635 19703 CDS product putative sulfate exporter family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943444.1 protein_id gnl|my_center|LOCUS_13230 20738 21640 gene locus_tag LOCUS_13240 20738 21640 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943443.1 protein_id gnl|my_center|LOCUS_13240 23535 21637 gene locus_tag LOCUS_13250 23535 21637 CDS product potassium transporter Kup inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942985.1 protein_id gnl|my_center|LOCUS_13250 <25986 23730 gene locus_tag LOCUS_13260 <25986 23730 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012067203.1:glycosyl transferase >Feature sequence038 1145 2545 gene locus_tag LOCUS_13270 1145 2545 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942412.1 protein_id gnl|my_center|LOCUS_13270 3512 2538 gene locus_tag LOCUS_13280 3512 2538 CDS product divergent polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942413.1 protein_id gnl|my_center|LOCUS_13280 4981 3608 gene locus_tag LOCUS_13290 4981 3608 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942416.1 protein_id gnl|my_center|LOCUS_13290 6205 5021 gene locus_tag LOCUS_13300 6205 5021 CDS product peptidoglycan DD-metalloendopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942417.1 protein_id gnl|my_center|LOCUS_13300 7177 6209 gene locus_tag LOCUS_13310 gene ftsX 7177 6209 CDS product permease-like cell division protein FtsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942418.1 protein_id gnl|my_center|LOCUS_13310 7823 7131 gene locus_tag LOCUS_13320 gene ftsE 7823 7131 CDS product cell division ATP-binding protein FtsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942419.1 protein_id gnl|my_center|LOCUS_13320 8321 7827 gene locus_tag LOCUS_13330 8321 7827 CDS product prepilin-type N-terminal cleavage/methylation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942420.1 protein_id gnl|my_center|LOCUS_13330 8784 8293 gene locus_tag LOCUS_13340 8784 8293 CDS product type II secretion system protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942421.1 protein_id gnl|my_center|LOCUS_13340 9343 8786 gene locus_tag LOCUS_13350 9343 8786 CDS product type II secretion system protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943548.1 protein_id gnl|my_center|LOCUS_13350 11820 9343 gene locus_tag LOCUS_13360 11820 9343 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942422.1 protein_id gnl|my_center|LOCUS_13360 12444 11845 gene locus_tag LOCUS_13370 12444 11845 CDS product type II secretion system protein PulP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942423.1 protein_id gnl|my_center|LOCUS_13370 12986 12441 gene locus_tag LOCUS_13380 12986 12441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13380 13522 12986 gene locus_tag LOCUS_13390 13522 12986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13390 14448 13522 gene locus_tag LOCUS_13400 gene pilM 14448 13522 CDS product pilus assembly protein PilM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942426.1 protein_id gnl|my_center|LOCUS_13400 16184 14466 gene locus_tag LOCUS_13410 16184 14466 CDS product GspE/PulE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942427.1 protein_id gnl|my_center|LOCUS_13410 17405 16197 gene locus_tag LOCUS_13420 17405 16197 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942428.1 protein_id gnl|my_center|LOCUS_13420 17690 17502 gene locus_tag LOCUS_13430 17690 17502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13430 18417 17677 gene locus_tag LOCUS_13440 18417 17677 CDS product polyprenol monophosphomannose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942433.1 protein_id gnl|my_center|LOCUS_13440 19827 18565 gene locus_tag LOCUS_13450 19827 18565 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941161.1 protein_id gnl|my_center|LOCUS_13450 20095 22050 gene locus_tag LOCUS_13460 20095 22050 CDS product cache domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941630.1 protein_id gnl|my_center|LOCUS_13460 22051 23442 gene locus_tag LOCUS_13470 22051 23442 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941631.1 protein_id gnl|my_center|LOCUS_13470 24572 23520 gene locus_tag LOCUS_13480 24572 23520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941634.1 protein_id gnl|my_center|LOCUS_13480 24891 24640 gene locus_tag LOCUS_13490 24891 24640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941633.1 protein_id gnl|my_center|LOCUS_13490 >Feature sequence039 1228 398 gene locus_tag LOCUS_13500 1228 398 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521971.1 protein_id gnl|my_center|LOCUS_13500 2413 1343 gene locus_tag LOCUS_13510 2413 1343 CDS product PilT/PilU family type 4a pilus ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940905.1 protein_id gnl|my_center|LOCUS_13510 4215 2461 gene locus_tag LOCUS_13520 4215 2461 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940906.1 protein_id gnl|my_center|LOCUS_13520 4656 4381 gene locus_tag LOCUS_13530 4656 4381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13530 4828 5418 gene locus_tag LOCUS_13540 gene pal 4828 5418 CDS product peptidoglycan-associated lipoprotein Pal inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940702.1 protein_id gnl|my_center|LOCUS_13540 5491 7395 gene locus_tag LOCUS_13550 5491 7395 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943809.1 protein_id gnl|my_center|LOCUS_13550 7576 8415 gene locus_tag LOCUS_13560 7576 8415 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003727947.1 protein_id gnl|my_center|LOCUS_13560 8412 8840 gene locus_tag LOCUS_13570 8412 8840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13570 8991 9830 gene locus_tag LOCUS_13580 8991 9830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13580 10768 9884 gene locus_tag LOCUS_13590 10768 9884 CDS product carbon-nitrogen hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941690.1 protein_id gnl|my_center|LOCUS_13590 11790 10765 gene locus_tag LOCUS_13600 11790 10765 CDS product agmatine deiminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941691.1 protein_id gnl|my_center|LOCUS_13600 12014 13072 gene locus_tag LOCUS_13610 gene trpX 12014 13072 CDS product tryptophan ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263096.1 protein_id gnl|my_center|LOCUS_13610 13132 15495 gene locus_tag LOCUS_13620 13132 15495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13620 15730 15945 gene locus_tag LOCUS_13630 gene infA 15730 15945 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942395.1 protein_id gnl|my_center|LOCUS_13630 16032 16595 gene locus_tag LOCUS_13640 gene efp 16032 16595 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942396.1 protein_id gnl|my_center|LOCUS_13640 16599 17510 gene locus_tag LOCUS_13650 gene epmA 16599 17510 CDS product EF-P lysine aminoacylase EpmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942397.1 protein_id gnl|my_center|LOCUS_13650 18177 17491 gene locus_tag LOCUS_13660 18177 17491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13660 18673 19332 gene locus_tag LOCUS_13670 18673 19332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13670 20019 20312 gene locus_tag LOCUS_13680 20019 20312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13680 20921 20322 gene locus_tag LOCUS_13690 gene pgsA 20921 20322 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942469.1 protein_id gnl|my_center|LOCUS_13690 21472 20918 gene locus_tag LOCUS_13700 21472 20918 CDS product lytic transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942470.1 protein_id gnl|my_center|LOCUS_13700 21683 22735 gene locus_tag LOCUS_13710 gene purM 21683 22735 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942402.1 protein_id gnl|my_center|LOCUS_13710 22738 23358 gene locus_tag LOCUS_13720 gene purN 22738 23358 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942403.1 protein_id gnl|my_center|LOCUS_13720 24419 23433 gene locus_tag LOCUS_13730 24419 23433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13730 <25216 24403 gene locus_tag LOCUS_13740 <25216 24403 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011036061.1:ATP-binding protein >Feature sequence040 627 286 gene locus_tag LOCUS_13750 627 286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13750 772 3993 gene locus_tag LOCUS_13760 772 3993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13760 3993 6467 gene locus_tag LOCUS_13770 3993 6467 CDS product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_143274421.1 protein_id gnl|my_center|LOCUS_13770 6464 7561 gene locus_tag LOCUS_13780 6464 7561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13780 7663 7953 gene locus_tag LOCUS_13790 7663 7953 CDS product type II toxin-antitoxin system Phd/YefM family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000086649.1 protein_id gnl|my_center|LOCUS_13790 7950 8285 gene locus_tag LOCUS_13800 7950 8285 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064244108.1 protein_id gnl|my_center|LOCUS_13800 8451 8681 gene locus_tag LOCUS_13810 8451 8681 CDS product AbrB/MazE/SpoVT family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064244189.1 protein_id gnl|my_center|LOCUS_13810 8678 9088 gene locus_tag LOCUS_13820 8678 9088 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064243822.1 protein_id gnl|my_center|LOCUS_13820 9130 9534 gene locus_tag LOCUS_13830 9130 9534 CDS product CoA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942259.1 protein_id gnl|my_center|LOCUS_13830 9824 10540 gene locus_tag LOCUS_13840 9824 10540 CDS product DUF4388 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943279.1 protein_id gnl|my_center|LOCUS_13840 10550 11347 gene locus_tag LOCUS_13850 10550 11347 CDS product roadblock/LC7 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943278.1 protein_id gnl|my_center|LOCUS_13850 11469 13274 gene locus_tag LOCUS_13860 gene typA 11469 13274 CDS product translational GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941168.1 protein_id gnl|my_center|LOCUS_13860 13471 14688 gene locus_tag LOCUS_13870 13471 14688 CDS product bifunctional cobalt-precorrin-7 (C(5))-methyltransferase/cobalt-precorrin-6B (C(15))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943626.1 protein_id gnl|my_center|LOCUS_13870 14688 15386 gene locus_tag LOCUS_13880 gene cobI 14688 15386 CDS product precorrin-2 C(20)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041914028.1 protein_id gnl|my_center|LOCUS_13880 15451 15471 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 18166 15515 gene locus_tag LOCUS_13890 gene ppdK 18166 15515 CDS product pyruvate, phosphate dikinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941243.1 protein_id gnl|my_center|LOCUS_13890 18750 18310 gene locus_tag LOCUS_13900 gene gspG 18750 18310 CDS product type II secretion system major pseudopilin GspG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940994.1 protein_id gnl|my_center|LOCUS_13900 19058 19339 gene locus_tag LOCUS_13910 19058 19339 CDS product cytochrome c3 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941274.1 protein_id gnl|my_center|LOCUS_13910 20270 19401 gene locus_tag LOCUS_13920 20270 19401 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942258.1 protein_id gnl|my_center|LOCUS_13920 22282 20267 gene locus_tag LOCUS_13930 gene uvrB 22282 20267 CDS product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943874.1 protein_id gnl|my_center|LOCUS_13930 22462 23202 gene locus_tag LOCUS_13940 22462 23202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13940 23225 23407 gene locus_tag LOCUS_13950 23225 23407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13950 24868 23465 gene locus_tag LOCUS_13960 gene gltX 24868 23465 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941876.1 protein_id gnl|my_center|LOCUS_13960 >Feature sequence041 1329 1922 gene locus_tag LOCUS_13970 1329 1922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13970 2210 3043 gene locus_tag LOCUS_13980 2210 3043 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021030.1 protein_id gnl|my_center|LOCUS_13980 3185 4684 gene locus_tag LOCUS_13990 3185 4684 CDS product B12-binding domain-containing radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941216.1 protein_id gnl|my_center|LOCUS_13990 5225 5881 gene locus_tag LOCUS_14000 5225 5881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14000 5914 6093 gene locus_tag LOCUS_14010 5914 6093 CDS product CsbD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974096.1 protein_id gnl|my_center|LOCUS_14010 6154 6909 gene locus_tag LOCUS_14020 gene osmY 6154 6909 CDS product molecular chaperone OsmY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005166907.1 protein_id gnl|my_center|LOCUS_14020 7368 7096 gene locus_tag LOCUS_14030 7368 7096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14030 7270 8415 gene locus_tag LOCUS_14040 7270 8415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14040 8493 9251 gene locus_tag LOCUS_14050 8493 9251 CDS product BON domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_091833887.1 protein_id gnl|my_center|LOCUS_14050 9383 10747 gene locus_tag LOCUS_14060 9383 10747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14060 12717 10762 gene locus_tag LOCUS_14070 12717 10762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14070 13446 12829 gene locus_tag LOCUS_14080 13446 12829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14080 13892 13443 gene locus_tag LOCUS_14090 13892 13443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14090 14153 14599 gene locus_tag LOCUS_14100 14153 14599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14100 14596 16083 gene locus_tag LOCUS_14110 14596 16083 CDS product ATPase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974732.1 protein_id gnl|my_center|LOCUS_14110 16080 17759 gene locus_tag LOCUS_14120 16080 17759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14120 17990 18304 gene locus_tag LOCUS_14130 17990 18304 CDS product BON domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389255.1 protein_id gnl|my_center|LOCUS_14130 18352 18966 gene locus_tag LOCUS_14140 18352 18966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14140 19092 19592 gene locus_tag LOCUS_14150 19092 19592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14150 21466 19727 gene locus_tag LOCUS_14160 21466 19727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14160 21813 22319 gene locus_tag LOCUS_14170 21813 22319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14170 23152 22352 gene locus_tag LOCUS_14180 23152 22352 CDS product zinc-dependent peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_039642892.1 protein_id gnl|my_center|LOCUS_14180 23337 23972 gene locus_tag LOCUS_14190 23337 23972 CDS product CDP-alcohol phosphatidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014507867.1 protein_id gnl|my_center|LOCUS_14190 <24872 24020 gene locus_tag LOCUS_14200 <24872 24020 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_016356901.1:ATP-binding protein >Feature sequence042 642 1208 gene locus_tag LOCUS_14210 642 1208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14210 1256 4090 gene locus_tag LOCUS_14220 1256 4090 CDS product N-6 DNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015613294.1 protein_id gnl|my_center|LOCUS_14220 4207 4461 gene locus_tag LOCUS_14230 4207 4461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14230 4442 4780 gene locus_tag LOCUS_14240 4442 4780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14240 4810 6009 gene locus_tag LOCUS_14250 gene truD 4810 6009 CDS product tRNA pseudouridine(13) synthase TruD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941188.1 protein_id gnl|my_center|LOCUS_14250 7364 6099 gene locus_tag LOCUS_14260 7364 6099 CDS product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943345.1 protein_id gnl|my_center|LOCUS_14260 7612 7779 gene locus_tag LOCUS_14270 7612 7779 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943346.1 protein_id gnl|my_center|LOCUS_14270 8074 7859 gene locus_tag LOCUS_14280 8074 7859 CDS product DUF2905 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941743.1 protein_id gnl|my_center|LOCUS_14280 8636 8088 gene locus_tag LOCUS_14290 8636 8088 CDS product epoxyqueuosine reductase QueH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941742.1 protein_id gnl|my_center|LOCUS_14290 9841 8636 gene locus_tag LOCUS_14300 9841 8636 CDS product bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942333.1 protein_id gnl|my_center|LOCUS_14300 10499 9858 gene locus_tag LOCUS_14310 10499 9858 CDS product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942332.1 protein_id gnl|my_center|LOCUS_14310 11590 10484 gene locus_tag LOCUS_14320 gene ribD 11590 10484 CDS product bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942331.1 protein_id gnl|my_center|LOCUS_14320 12039 11587 gene locus_tag LOCUS_14330 gene nrdR 12039 11587 CDS product transcriptional regulator NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942330.1 protein_id gnl|my_center|LOCUS_14330 12503 12036 gene locus_tag LOCUS_14340 12503 12036 CDS product cytidine/deoxycytidylate deaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942329.1 protein_id gnl|my_center|LOCUS_14340 12708 14420 gene locus_tag LOCUS_14350 12708 14420 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943144.1 protein_id gnl|my_center|LOCUS_14350 14508 15950 gene locus_tag LOCUS_14360 14508 15950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14360 16234 16704 gene locus_tag LOCUS_14370 16234 16704 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941803.1 protein_id gnl|my_center|LOCUS_14370 16766 19270 gene locus_tag LOCUS_14380 16766 19270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14380 19279 19731 gene locus_tag LOCUS_14390 19279 19731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14390 19728 20192 gene locus_tag LOCUS_14400 19728 20192 CDS product cytochrome P460 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941939.1 protein_id gnl|my_center|LOCUS_14400 20216 21442 gene locus_tag LOCUS_14410 20216 21442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14410 21439 21846 gene locus_tag LOCUS_14420 21439 21846 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941941.1 protein_id gnl|my_center|LOCUS_14420 21851 23671 gene locus_tag LOCUS_14430 21851 23671 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235044990.1 protein_id gnl|my_center|LOCUS_14430 23685 24032 gene locus_tag LOCUS_14440 23685 24032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14440 24032 24397 gene locus_tag LOCUS_14450 24032 24397 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941944.1 protein_id gnl|my_center|LOCUS_14450 >Feature sequence043 675 1424 gene locus_tag LOCUS_14460 675 1424 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941733.1 protein_id gnl|my_center|LOCUS_14460 1673 1984 gene locus_tag LOCUS_14470 1673 1984 CDS product DUF485 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039127.1 protein_id gnl|my_center|LOCUS_14470 1981 3696 gene locus_tag LOCUS_14480 1981 3696 CDS product cation acetate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010202721.1 protein_id gnl|my_center|LOCUS_14480 4005 5153 gene locus_tag LOCUS_14490 4005 5153 CDS product Na+/H+ antiporter NhaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942940.1 protein_id gnl|my_center|LOCUS_14490 5280 8000 gene locus_tag LOCUS_14500 5280 8000 CDS product cation-transporting P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939279.1 protein_id gnl|my_center|LOCUS_14500 8403 10226 gene locus_tag LOCUS_14510 gene treZ 8403 10226 CDS product malto-oligosyltrehalose trehalohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942994.1 protein_id gnl|my_center|LOCUS_14510 10230 12683 gene locus_tag LOCUS_14520 10230 12683 CDS product DUF3536 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942995.1 protein_id gnl|my_center|LOCUS_14520 12680 15703 gene locus_tag LOCUS_14530 12680 15703 CDS product malto-oligosyltrehalose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942996.1 protein_id gnl|my_center|LOCUS_14530 15785 17287 gene locus_tag LOCUS_14540 gene malQ 15785 17287 CDS product 4-alpha-glucanotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941842.1 protein_id gnl|my_center|LOCUS_14540 17277 20639 gene locus_tag LOCUS_14550 gene treS 17277 20639 CDS product maltose alpha-D-glucosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942997.1 protein_id gnl|my_center|LOCUS_14550 20684 22924 gene locus_tag LOCUS_14560 20684 22924 CDS product trehalose-6-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942973.1 protein_id gnl|my_center|LOCUS_14560 22940 23701 gene locus_tag LOCUS_14570 gene otsB 22940 23701 CDS product trehalose-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942972.1 protein_id gnl|my_center|LOCUS_14570 23783 24406 gene locus_tag LOCUS_14580 23783 24406 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546278.1 protein_id gnl|my_center|LOCUS_14580 >Feature sequence044 <1 1135 gene locus_tag LOCUS_14590 <1 1135 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943091.1:heavy metal translocating P-type ATPase 1264 1611 gene locus_tag LOCUS_14600 1264 1611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_14600 1591 1600 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1661 3373 gene locus_tag LOCUS_14610 1661 3373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14610 4249 3455 gene locus_tag LOCUS_14620 4249 3455 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_039648073.1 protein_id gnl|my_center|LOCUS_14620 4427 5752 gene locus_tag LOCUS_14630 4427 5752 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941550.1 protein_id gnl|my_center|LOCUS_14630 5929 6216 gene locus_tag LOCUS_14640 gene groES 5929 6216 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943951.1 protein_id gnl|my_center|LOCUS_14640 6293 7948 gene locus_tag LOCUS_14650 gene groL 6293 7948 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943952.1 protein_id gnl|my_center|LOCUS_14650 8083 8400 gene locus_tag LOCUS_14660 8083 8400 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940899.1 protein_id gnl|my_center|LOCUS_14660 8397 9356 gene locus_tag LOCUS_14670 gene hemH 8397 9356 CDS product ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943924.1 protein_id gnl|my_center|LOCUS_14670 9426 9998 gene locus_tag LOCUS_14680 9426 9998 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943932.1 protein_id gnl|my_center|LOCUS_14680 10004 10657 gene locus_tag LOCUS_14690 10004 10657 CDS product lactate utilization protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940801.1 protein_id gnl|my_center|LOCUS_14690 10658 11392 gene locus_tag LOCUS_14700 10658 11392 CDS product ComF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940800.1 protein_id gnl|my_center|LOCUS_14700 11617 12093 gene locus_tag LOCUS_14710 11617 12093 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941202.1 protein_id gnl|my_center|LOCUS_14710 12586 12137 gene locus_tag LOCUS_14720 12586 12137 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942702.1 protein_id gnl|my_center|LOCUS_14720 13084 12599 gene locus_tag LOCUS_14730 gene ybaK 13084 12599 CDS product Cys-tRNA(Pro) deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943709.1 protein_id gnl|my_center|LOCUS_14730 14099 13086 gene locus_tag LOCUS_14740 gene hypE 14099 13086 CDS product hydrogenase expression/formation protein HypE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940978.1 protein_id gnl|my_center|LOCUS_14740 14232 15560 gene locus_tag LOCUS_14750 14232 15560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941665.1 protein_id gnl|my_center|LOCUS_14750 15586 16320 gene locus_tag LOCUS_14760 15586 16320 CDS product outer membrane protein assembly factor BamD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941169.1 protein_id gnl|my_center|LOCUS_14760 16317 16922 gene locus_tag LOCUS_14770 gene plsY 16317 16922 CDS product glycerol-3-phosphate 1-O-acyltransferase PlsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941175.1 protein_id gnl|my_center|LOCUS_14770 17449 16955 gene locus_tag LOCUS_14780 17449 16955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14780 20225 17550 gene locus_tag LOCUS_14790 20225 17550 CDS product UPF0182 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942970.1 protein_id gnl|my_center|LOCUS_14790 21093 20347 gene locus_tag LOCUS_14800 21093 20347 CDS product TerC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941989.1 protein_id gnl|my_center|LOCUS_14800 22362 21538 gene locus_tag LOCUS_14810 22362 21538 CDS product cytochrome c3 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942292.1 protein_id gnl|my_center|LOCUS_14810 23462 22359 gene locus_tag LOCUS_14820 23462 22359 CDS product cytochrome bc complex cytochrome b subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942293.1 protein_id gnl|my_center|LOCUS_14820 23908 23486 gene locus_tag LOCUS_14830 23908 23486 CDS product Rieske (2Fe-2S) protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942294.1 protein_id gnl|my_center|LOCUS_14830 >Feature sequence045 1053 169 gene locus_tag LOCUS_14840 1053 169 CDS product NAD(P)H-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941053.1 protein_id gnl|my_center|LOCUS_14840 1908 1081 gene locus_tag LOCUS_14850 1908 1081 CDS product protoheme IX farnesyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940898.1 protein_id gnl|my_center|LOCUS_14850 2822 1905 gene locus_tag LOCUS_14860 gene coxB 2822 1905 CDS product cytochrome c oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940897.1 protein_id gnl|my_center|LOCUS_14860 3146 2865 gene locus_tag LOCUS_14870 3146 2865 CDS product cytochrome C oxidase subunit IV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940896.1 protein_id gnl|my_center|LOCUS_14870 3759 3157 gene locus_tag LOCUS_14880 3759 3157 CDS product cytochrome c oxidase subunit 3 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940895.1 protein_id gnl|my_center|LOCUS_14880 5385 3763 gene locus_tag LOCUS_14890 gene ctaD 5385 3763 CDS product cytochrome c oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940894.1 protein_id gnl|my_center|LOCUS_14890 6269 5382 gene locus_tag LOCUS_14900 6269 5382 CDS product SCO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940893.1 protein_id gnl|my_center|LOCUS_14900 7971 6262 gene locus_tag LOCUS_14910 gene recD 7971 6262 CDS product exodeoxyribonuclease V subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932748.1 protein_id gnl|my_center|LOCUS_14910 8102 7968 gene locus_tag LOCUS_14920 8102 7968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14920 8745 8116 gene locus_tag LOCUS_14930 8745 8116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14930 8914 10062 gene locus_tag LOCUS_14940 8914 10062 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941144.1 protein_id gnl|my_center|LOCUS_14940 10063 10758 gene locus_tag LOCUS_14950 10063 10758 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941145.1 protein_id gnl|my_center|LOCUS_14950 11650 10694 gene locus_tag LOCUS_14960 11650 10694 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940759.1 protein_id gnl|my_center|LOCUS_14960 12043 11780 gene locus_tag LOCUS_14970 12043 11780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940758.1 protein_id gnl|my_center|LOCUS_14970 13515 12085 gene locus_tag LOCUS_14980 13515 12085 CDS product DegQ family serine endoprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940757.1 protein_id gnl|my_center|LOCUS_14980 13712 14317 gene locus_tag LOCUS_14990 13712 14317 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940756.1 protein_id gnl|my_center|LOCUS_14990 15602 14343 gene locus_tag LOCUS_15000 15602 14343 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940986.1 protein_id gnl|my_center|LOCUS_15000 16342 15689 gene locus_tag LOCUS_15010 gene elbB 16342 15689 CDS product isoprenoid biosynthesis glyoxalase ElbB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940751.1 protein_id gnl|my_center|LOCUS_15010 17005 16610 gene locus_tag LOCUS_15020 17005 16610 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941887.1 protein_id gnl|my_center|LOCUS_15020 17580 17128 gene locus_tag LOCUS_15030 17580 17128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941882.1 protein_id gnl|my_center|LOCUS_15030 18628 17720 gene locus_tag LOCUS_15040 18628 17720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941881.1 protein_id gnl|my_center|LOCUS_15040 19467 18625 gene locus_tag LOCUS_15050 19467 18625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941880.1 protein_id gnl|my_center|LOCUS_15050 20497 19448 gene locus_tag LOCUS_15060 20497 19448 CDS product acetoin utilization protein AcuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941879.1 protein_id gnl|my_center|LOCUS_15060 20763 20688 gene locus_tag LOCUS_t00170 20763 20688 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 21386 21796 gene locus_tag LOCUS_15070 21386 21796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15070 22017 23642 gene locus_tag LOCUS_15080 22017 23642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15080 >Feature sequence046 721 906 gene locus_tag LOCUS_15090 721 906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15090 983 2824 gene locus_tag LOCUS_15100 983 2824 CDS product B12-binding domain-containing radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940946.1 protein_id gnl|my_center|LOCUS_15100 2967 3911 gene locus_tag LOCUS_15110 2967 3911 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941322.1 protein_id gnl|my_center|LOCUS_15110 3974 4579 gene locus_tag LOCUS_15120 3974 4579 CDS product 50S ribosomal protein L25 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941323.1 protein_id gnl|my_center|LOCUS_15120 4590 5177 gene locus_tag LOCUS_15130 gene pth 4590 5177 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941324.1 protein_id gnl|my_center|LOCUS_15130 5182 6276 gene locus_tag LOCUS_15140 gene ychF 5182 6276 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941325.1 protein_id gnl|my_center|LOCUS_15140 6562 6362 gene locus_tag LOCUS_15150 6562 6362 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940882.1 protein_id gnl|my_center|LOCUS_15150 6844 9537 gene locus_tag LOCUS_15160 gene secA 6844 9537 CDS product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942693.1 protein_id gnl|my_center|LOCUS_15160 9582 10763 gene locus_tag LOCUS_15170 gene argJ 9582 10763 CDS product bifunctional glutamate N-acetyltransferase/amino-acid acetyltransferase ArgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942692.1 protein_id gnl|my_center|LOCUS_15170 11009 12133 gene locus_tag LOCUS_15180 11009 12133 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942689.1 protein_id gnl|my_center|LOCUS_15180 12205 13260 gene locus_tag LOCUS_15190 gene trpD 12205 13260 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943017.1 protein_id gnl|my_center|LOCUS_15190 13374 14180 gene locus_tag LOCUS_15200 gene trpC 13374 14180 CDS product indole-3-glycerol phosphate synthase TrpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943016.1 protein_id gnl|my_center|LOCUS_15200 14201 14431 gene locus_tag LOCUS_15210 14201 14431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942095.1 protein_id gnl|my_center|LOCUS_15210 15824 14463 gene locus_tag LOCUS_15220 15824 14463 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941477.1 protein_id gnl|my_center|LOCUS_15220 18064 15848 gene locus_tag LOCUS_15230 18064 15848 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941478.1 protein_id gnl|my_center|LOCUS_15230 18219 18665 gene locus_tag LOCUS_15240 18219 18665 CDS product YaaR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942326.1 protein_id gnl|my_center|LOCUS_15240 18726 19523 gene locus_tag LOCUS_15250 18726 19523 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941827.1 protein_id gnl|my_center|LOCUS_15250 19526 20911 gene locus_tag LOCUS_15260 19526 20911 CDS product YchF/TatD family DNA exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943126.1 protein_id gnl|my_center|LOCUS_15260 21650 20919 gene locus_tag LOCUS_15270 21650 20919 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943290.1 protein_id gnl|my_center|LOCUS_15270 22434 21640 gene locus_tag LOCUS_15280 22434 21640 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943289.1 protein_id gnl|my_center|LOCUS_15280 23345 22524 gene locus_tag LOCUS_15290 23345 22524 CDS product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943288.1 protein_id gnl|my_center|LOCUS_15290 >Feature sequence047 375 226 gene locus_tag LOCUS_15300 375 226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15300 1059 412 gene locus_tag LOCUS_15310 1059 412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15310 1512 2588 gene locus_tag LOCUS_15320 1512 2588 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941518.1 protein_id gnl|my_center|LOCUS_15320 2771 3448 gene locus_tag LOCUS_15330 2771 3448 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942483.1 protein_id gnl|my_center|LOCUS_15330 3598 4476 gene locus_tag LOCUS_15340 gene glyQ 3598 4476 CDS product glycine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941241.1 protein_id gnl|my_center|LOCUS_15340 4476 6539 gene locus_tag LOCUS_15350 gene glyS 4476 6539 CDS product glycine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941242.1 protein_id gnl|my_center|LOCUS_15350 6582 8138 gene locus_tag LOCUS_15360 6582 8138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15360 8135 8758 gene locus_tag LOCUS_15370 gene hisH 8135 8758 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943718.1 protein_id gnl|my_center|LOCUS_15370 8755 9486 gene locus_tag LOCUS_15380 gene hisA 8755 9486 CDS product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino]imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943717.1 protein_id gnl|my_center|LOCUS_15380 9488 10249 gene locus_tag LOCUS_15390 gene hisF 9488 10249 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943716.1 protein_id gnl|my_center|LOCUS_15390 10246 10584 gene locus_tag LOCUS_15400 10246 10584 CDS product phosphoribosyl-ATP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943715.1 protein_id gnl|my_center|LOCUS_15400 10709 10906 gene locus_tag LOCUS_15410 gene rpsU 10709 10906 CDS product 30S ribosomal protein S21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943714.1 protein_id gnl|my_center|LOCUS_15410 10940 11383 gene locus_tag LOCUS_15420 10940 11383 CDS product GatB/YqeY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943713.1 protein_id gnl|my_center|LOCUS_15420 11488 11979 gene locus_tag LOCUS_15430 11488 11979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15430 11976 13727 gene locus_tag LOCUS_15440 gene dnaG 11976 13727 CDS product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943711.1 protein_id gnl|my_center|LOCUS_15440 13760 15508 gene locus_tag LOCUS_15450 gene rpoD 13760 15508 CDS product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943710.1 protein_id gnl|my_center|LOCUS_15450 15513 16796 gene locus_tag LOCUS_15460 15513 16796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15460 17971 16850 gene locus_tag LOCUS_15470 gene proB 17971 16850 CDS product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943830.1 protein_id gnl|my_center|LOCUS_15470 18987 17971 gene locus_tag LOCUS_15480 gene obgE 18987 17971 CDS product GTPase ObgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943831.1 protein_id gnl|my_center|LOCUS_15480 20161 18992 gene locus_tag LOCUS_15490 gene rdgC 20161 18992 CDS product recombination-associated protein RdgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940809.1 protein_id gnl|my_center|LOCUS_15490 21154 20180 gene locus_tag LOCUS_15500 21154 20180 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940802.1 protein_id gnl|my_center|LOCUS_15500 21932 21261 gene locus_tag LOCUS_15510 21932 21261 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941118.1 protein_id gnl|my_center|LOCUS_15510 22783 21974 gene locus_tag LOCUS_15520 22783 21974 CDS product pyruvate, water dikinase regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941117.1 protein_id gnl|my_center|LOCUS_15520 22985 23482 gene locus_tag LOCUS_15530 22985 23482 CDS product ferritin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943900.1 protein_id gnl|my_center|LOCUS_15530 >Feature sequence048 155 1009 gene locus_tag LOCUS_15540 gene accD 155 1009 CDS product acetyl-CoA carboxylase, carboxyltransferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943005.1 protein_id gnl|my_center|LOCUS_15540 1011 2288 gene locus_tag LOCUS_15550 1011 2288 CDS product folylpolyglutamate synthase/dihydrofolate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943004.1 protein_id gnl|my_center|LOCUS_15550 2536 2327 gene locus_tag LOCUS_15560 2536 2327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15560 2417 4405 gene locus_tag LOCUS_15570 gene lptD 2417 4405 CDS product LPS assembly protein LptD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943003.1 protein_id gnl|my_center|LOCUS_15570 5501 4416 gene locus_tag LOCUS_15580 5501 4416 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941708.1 protein_id gnl|my_center|LOCUS_15580 5642 6778 gene locus_tag LOCUS_15590 gene hemW 5642 6778 CDS product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940708.1 protein_id gnl|my_center|LOCUS_15590 6824 7318 gene locus_tag LOCUS_15600 gene nuoE 6824 7318 CDS product NADH-quinone oxidoreductase subunit NuoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944053.1 protein_id gnl|my_center|LOCUS_15600 7386 7685 gene locus_tag LOCUS_15610 7386 7685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15610 7748 9040 gene locus_tag LOCUS_15620 gene nuoF 7748 9040 CDS product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944051.1 protein_id gnl|my_center|LOCUS_15620 9045 10679 gene locus_tag LOCUS_15630 gene nuoG 9045 10679 CDS product NADH-quinone oxidoreductase subunit NuoG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944049.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15630 10595 10604 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 10681 10974 gene locus_tag LOCUS_15640 10681 10974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15640 10971 11354 gene locus_tag LOCUS_15650 10971 11354 CDS product CbiX/SirB N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943630.1 protein_id gnl|my_center|LOCUS_15650 11354 11995 gene locus_tag LOCUS_15660 11354 11995 CDS product precorrin-8X methylmutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943629.1 protein_id gnl|my_center|LOCUS_15660 11992 12900 gene locus_tag LOCUS_15670 11992 12900 CDS product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926866.1 protein_id gnl|my_center|LOCUS_15670 12897 14012 gene locus_tag LOCUS_15680 12897 14012 CDS product cobalt-precorrin-5B (C(1))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943627.1 protein_id gnl|my_center|LOCUS_15680 14113 14889 gene locus_tag LOCUS_15690 14113 14889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15690 15633 14911 gene locus_tag LOCUS_15700 15633 14911 CDS product PilZ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940813.1 protein_id gnl|my_center|LOCUS_15700 16761 15775 gene locus_tag LOCUS_15710 gene galE 16761 15775 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942880.1 protein_id gnl|my_center|LOCUS_15710 17592 16813 gene locus_tag LOCUS_15720 17592 16813 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943982.1 protein_id gnl|my_center|LOCUS_15720 18556 17582 gene locus_tag LOCUS_15730 18556 17582 CDS product potassium channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546063.1 protein_id gnl|my_center|LOCUS_15730 18829 19497 gene locus_tag LOCUS_15740 18829 19497 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943981.1 protein_id gnl|my_center|LOCUS_15740 19565 20287 gene locus_tag LOCUS_15750 gene ispD 19565 20287 CDS product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943979.1 protein_id gnl|my_center|LOCUS_15750 20281 21477 gene locus_tag LOCUS_15760 20281 21477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15760 21479 21958 gene locus_tag LOCUS_15770 21479 21958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15770 22810 21962 gene locus_tag LOCUS_15780 22810 21962 CDS product FAD/NAD(P)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940762.1 protein_id gnl|my_center|LOCUS_15780 <23533 22823 gene locus_tag LOCUS_15790 <23533 22823 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010940764.1:4Fe-4S dicluster domain-containing protein >Feature sequence049 3338 1395 gene locus_tag LOCUS_15800 gene gspD 3338 1395 CDS product type II secretion system secretin GspD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940997.1 protein_id gnl|my_center|LOCUS_15800 4244 3363 gene locus_tag LOCUS_15810 gene gspC 4244 3363 CDS product type II secretion system protein GspC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940998.1 protein_id gnl|my_center|LOCUS_15810 5154 4324 gene locus_tag LOCUS_15820 gene dapF 5154 4324 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941199.1 protein_id gnl|my_center|LOCUS_15820 5327 5896 gene locus_tag LOCUS_15830 5327 5896 CDS product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940698.1 protein_id gnl|my_center|LOCUS_15830 6080 6793 gene locus_tag LOCUS_15840 6080 6793 CDS product GPMC system MBL fold metallohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943103.1 protein_id gnl|my_center|LOCUS_15840 6811 8649 gene locus_tag LOCUS_15850 6811 8649 CDS product TIGR04442 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943104.1 protein_id gnl|my_center|LOCUS_15850 8946 9218 gene locus_tag LOCUS_15860 8946 9218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15860 9430 12243 gene locus_tag LOCUS_15870 9430 12243 CDS product GPMC system transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943112.1 protein_id gnl|my_center|LOCUS_15870 13892 12339 gene locus_tag LOCUS_15880 13892 12339 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942551.1 protein_id gnl|my_center|LOCUS_15880 14846 14250 gene locus_tag LOCUS_15890 14846 14250 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943859.1 protein_id gnl|my_center|LOCUS_15890 16074 14950 gene locus_tag LOCUS_15900 gene cls 16074 14950 CDS product cardiolipin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943983.1 protein_id gnl|my_center|LOCUS_15900 16090 16335 gene locus_tag LOCUS_15910 16090 16335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15910 16686 16387 gene locus_tag LOCUS_15920 16686 16387 CDS product Rieske (2Fe-2S) protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943852.1 protein_id gnl|my_center|LOCUS_15920 17062 17823 gene locus_tag LOCUS_15930 17062 17823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941606.1 protein_id gnl|my_center|LOCUS_15930 17919 18257 gene locus_tag LOCUS_15940 17919 18257 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941607.1 protein_id gnl|my_center|LOCUS_15940 18350 20071 gene locus_tag LOCUS_15950 18350 20071 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226986845.1 protein_id gnl|my_center|LOCUS_15950 20270 21553 gene locus_tag LOCUS_15960 gene nhaD 20270 21553 CDS product sodium:proton antiporter NhaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966224.1 protein_id gnl|my_center|LOCUS_15960 21864 23423 gene locus_tag LOCUS_15970 21864 23423 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941608.1 protein_id gnl|my_center|LOCUS_15970 >Feature sequence050 77 385 gene locus_tag LOCUS_15980 gene rpsJ 77 385 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943487.1 protein_id gnl|my_center|LOCUS_15980 414 1043 gene locus_tag LOCUS_15990 gene rplC 414 1043 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943486.1 protein_id gnl|my_center|LOCUS_15990 1061 1684 gene locus_tag LOCUS_16000 gene rplD 1061 1684 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943485.1 protein_id gnl|my_center|LOCUS_16000 1681 1965 gene locus_tag LOCUS_16010 1681 1965 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943484.1 protein_id gnl|my_center|LOCUS_16010 1987 2811 gene locus_tag LOCUS_16020 gene rplB 1987 2811 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943483.1 protein_id gnl|my_center|LOCUS_16020 2834 3112 gene locus_tag LOCUS_16030 gene rpsS 2834 3112 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943482.1 protein_id gnl|my_center|LOCUS_16030 3127 3462 gene locus_tag LOCUS_16040 gene rplV 3127 3462 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943481.1 protein_id gnl|my_center|LOCUS_16040 3485 4117 gene locus_tag LOCUS_16050 gene rpsC 3485 4117 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943480.1 protein_id gnl|my_center|LOCUS_16050 4149 4571 gene locus_tag LOCUS_16060 gene rplP 4149 4571 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943479.1 protein_id gnl|my_center|LOCUS_16060 4561 4764 gene locus_tag LOCUS_16070 gene rpmC 4561 4764 CDS product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943478.1 protein_id gnl|my_center|LOCUS_16070 4761 5018 gene locus_tag LOCUS_16080 gene rpsQ 4761 5018 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943477.1 protein_id gnl|my_center|LOCUS_16080 5037 5405 gene locus_tag LOCUS_16090 gene rplN 5037 5405 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943476.1 protein_id gnl|my_center|LOCUS_16090 5424 5744 gene locus_tag LOCUS_16100 gene rplX 5424 5744 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943475.1 protein_id gnl|my_center|LOCUS_16100 5769 6308 gene locus_tag LOCUS_16110 gene rplE 5769 6308 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943474.1 protein_id gnl|my_center|LOCUS_16110 6554 6952 gene locus_tag LOCUS_16120 gene rpsH 6554 6952 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943472.1 protein_id gnl|my_center|LOCUS_16120 6978 7517 gene locus_tag LOCUS_16130 gene rplF 6978 7517 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943471.1 protein_id gnl|my_center|LOCUS_16130 7536 7901 gene locus_tag LOCUS_16140 gene rplR 7536 7901 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943470.1 protein_id gnl|my_center|LOCUS_16140 7920 8408 gene locus_tag LOCUS_16150 gene rpsE 7920 8408 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943469.1 protein_id gnl|my_center|LOCUS_16150 8433 8609 gene locus_tag LOCUS_16160 gene rpmD 8433 8609 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004202755.1 protein_id gnl|my_center|LOCUS_16160 8628 9071 gene locus_tag LOCUS_16170 gene rplO 8628 9071 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943467.1 protein_id gnl|my_center|LOCUS_16170 9071 10378 gene locus_tag LOCUS_16180 gene secY 9071 10378 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943466.1 protein_id gnl|my_center|LOCUS_16180 10381 11046 gene locus_tag LOCUS_16190 10381 11046 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943465.1 protein_id gnl|my_center|LOCUS_16190 11033 11779 gene locus_tag LOCUS_16200 gene map 11033 11779 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943464.1 protein_id gnl|my_center|LOCUS_16200 11943 12311 gene locus_tag LOCUS_16210 gene rpsM 11943 12311 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943462.1 protein_id gnl|my_center|LOCUS_16210 12337 12732 gene locus_tag LOCUS_16220 gene rpsK 12337 12732 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943461.1 protein_id gnl|my_center|LOCUS_16220 12766 13392 gene locus_tag LOCUS_16230 gene rpsD 12766 13392 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943460.1 protein_id gnl|my_center|LOCUS_16230 13458 14480 gene locus_tag LOCUS_16240 13458 14480 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943459.1 protein_id gnl|my_center|LOCUS_16240 14519 14893 gene locus_tag LOCUS_16250 14519 14893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16250 15011 15175 gene locus_tag LOCUS_16260 15011 15175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16260 15317 15829 gene locus_tag LOCUS_16270 15317 15829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16270 16059 16583 gene locus_tag LOCUS_16280 16059 16583 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459068.1 protein_id gnl|my_center|LOCUS_16280 16633 17799 gene locus_tag LOCUS_16290 16633 17799 CDS product Xaa-Pro peptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927165.1 protein_id gnl|my_center|LOCUS_16290 18003 18785 gene locus_tag LOCUS_16300 18003 18785 CDS product short-chain-enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048188.1 protein_id gnl|my_center|LOCUS_16300 18915 19037 gene locus_tag LOCUS_16310 18915 19037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16310 19105 21090 gene locus_tag LOCUS_16320 19105 21090 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226986815.1 protein_id gnl|my_center|LOCUS_16320 21168 21944 gene locus_tag LOCUS_16330 21168 21944 CDS product electron transfer flavoprotein subunit beta/FixA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226986814.1 protein_id gnl|my_center|LOCUS_16330 21954 22865 gene locus_tag LOCUS_16340 21954 22865 CDS product electron transfer flavoprotein subunit alpha/FixB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933795.1 protein_id gnl|my_center|LOCUS_16340 >Feature sequence051 2240 27 gene locus_tag LOCUS_16350 2240 27 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16350 3290 2241 gene locus_tag LOCUS_16360 3290 2241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16360 4521 3649 gene locus_tag LOCUS_16370 gene dinD 4521 3649 CDS product DNA damage-inducible protein D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001297973.1 protein_id gnl|my_center|LOCUS_16370 5107 4928 gene locus_tag LOCUS_16380 5107 4928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943922.1 protein_id gnl|my_center|LOCUS_16380 6750 5104 gene locus_tag LOCUS_16390 6750 5104 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943687.1 protein_id gnl|my_center|LOCUS_16390 9447 6877 gene locus_tag LOCUS_16400 9447 6877 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941177.1 protein_id gnl|my_center|LOCUS_16400 11506 9482 gene locus_tag LOCUS_16410 11506 9482 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941178.1 protein_id gnl|my_center|LOCUS_16410 11744 12907 gene locus_tag LOCUS_16420 11744 12907 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941179.1 protein_id gnl|my_center|LOCUS_16420 14172 12982 gene locus_tag LOCUS_16430 14172 12982 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085426.1 protein_id gnl|my_center|LOCUS_16430 15008 14310 gene locus_tag LOCUS_16440 15008 14310 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943121.1 protein_id gnl|my_center|LOCUS_16440 17680 15005 gene locus_tag LOCUS_16450 17680 15005 CDS product sensor histidine kinase KdpD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943120.1 protein_id gnl|my_center|LOCUS_16450 18247 17684 gene locus_tag LOCUS_16460 gene kdpC 18247 17684 CDS product potassium-transporting ATPase subunit KdpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943119.1 protein_id gnl|my_center|LOCUS_16460 20421 18355 gene locus_tag LOCUS_16470 gene kdpB 20421 18355 CDS product potassium-transporting ATPase subunit KdpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943118.1 protein_id gnl|my_center|LOCUS_16470 22208 20424 gene locus_tag LOCUS_16480 gene kdpA 22208 20424 CDS product potassium-transporting ATPase subunit KdpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943117.1 protein_id gnl|my_center|LOCUS_16480 22438 22205 gene locus_tag LOCUS_16490 22438 22205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16490 >Feature sequence052 916 65 gene locus_tag LOCUS_16500 916 65 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942082.1 protein_id gnl|my_center|LOCUS_16500 1901 921 gene locus_tag LOCUS_16510 1901 921 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942081.1 protein_id gnl|my_center|LOCUS_16510 2979 1915 gene locus_tag LOCUS_16520 2979 1915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16520 3502 3116 gene locus_tag LOCUS_16530 3502 3116 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003413174.1 protein_id gnl|my_center|LOCUS_16530 3716 3477 gene locus_tag LOCUS_16540 3716 3477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16540 6622 3929 gene locus_tag LOCUS_16550 6622 3929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16550 8262 6619 gene locus_tag LOCUS_16560 8262 6619 CDS product peptide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942080.1 protein_id gnl|my_center|LOCUS_16560 9968 8259 gene locus_tag LOCUS_16570 9968 8259 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942079.1 protein_id gnl|my_center|LOCUS_16570 10096 11403 gene locus_tag LOCUS_16580 10096 11403 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888807.1 protein_id gnl|my_center|LOCUS_16580 11400 14630 gene locus_tag LOCUS_16590 11400 14630 CDS product AsmA-like C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941537.1 protein_id gnl|my_center|LOCUS_16590 15373 14624 gene locus_tag LOCUS_16600 gene lpxC 15373 14624 CDS product UDP-3-O-acyl-N-acetylglucosamine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941392.1 protein_id gnl|my_center|LOCUS_16600 16201 15503 gene locus_tag LOCUS_16610 gene cysE 16201 15503 CDS product serine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943208.1 protein_id gnl|my_center|LOCUS_16610 16368 17210 gene locus_tag LOCUS_16620 gene ispE 16368 17210 CDS product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941321.1 protein_id gnl|my_center|LOCUS_16620 20873 17631 gene locus_tag LOCUS_16630 20873 17631 CDS product beta-phosphoglucomutase family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932984.1 protein_id gnl|my_center|LOCUS_16630 >Feature sequence053 979 635 gene locus_tag LOCUS_16640 979 635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16640 1389 1063 gene locus_tag LOCUS_16650 1389 1063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16650 4295 1680 gene locus_tag LOCUS_16660 4295 1680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16660 5552 4362 gene locus_tag LOCUS_16670 5552 4362 CDS product PAS domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851243.1 protein_id gnl|my_center|LOCUS_16670 6140 5925 gene locus_tag LOCUS_16680 6140 5925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940743.1 protein_id gnl|my_center|LOCUS_16680 7522 6524 gene locus_tag LOCUS_16690 7522 6524 CDS product sugar phosphate nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_130541252.1 protein_id gnl|my_center|LOCUS_16690 10781 7902 gene locus_tag LOCUS_16700 10781 7902 CDS product Ig-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942590.1 protein_id gnl|my_center|LOCUS_16700 12583 11312 gene locus_tag LOCUS_16710 12583 11312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16710 12741 12971 gene locus_tag LOCUS_16720 12741 12971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16720 14113 12941 gene locus_tag LOCUS_16730 14113 12941 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257254.1 protein_id gnl|my_center|LOCUS_16730 15317 14196 gene locus_tag LOCUS_16740 15317 14196 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942621.1 protein_id gnl|my_center|LOCUS_16740 17225 15330 gene locus_tag LOCUS_16750 17225 15330 CDS product amidotransferase 1, exosortase A system-associated inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390869.1 protein_id gnl|my_center|LOCUS_16750 18221 17286 gene locus_tag LOCUS_16760 18221 17286 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965470.1 protein_id gnl|my_center|LOCUS_16760 19528 18581 gene locus_tag LOCUS_16770 19528 18581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16770 >Feature sequence054 217 834 gene locus_tag LOCUS_16780 gene coaE 217 834 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941181.1 protein_id gnl|my_center|LOCUS_16780 827 2086 gene locus_tag LOCUS_16790 827 2086 CDS product THUMP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943707.1 protein_id gnl|my_center|LOCUS_16790 2102 2974 gene locus_tag LOCUS_16800 gene ylqF 2102 2974 CDS product ribosome biogenesis GTPase YlqF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072540.1 protein_id gnl|my_center|LOCUS_16800 3289 2978 gene locus_tag LOCUS_16810 3289 2978 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943558.1 protein_id gnl|my_center|LOCUS_16810 3799 3461 gene locus_tag LOCUS_16820 3799 3461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943555.1 protein_id gnl|my_center|LOCUS_16820 5111 3981 gene locus_tag LOCUS_16830 gene dnaJ 5111 3981 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940712.1 protein_id gnl|my_center|LOCUS_16830 7115 5196 gene locus_tag LOCUS_16840 gene dnaK 7115 5196 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940711.1 protein_id gnl|my_center|LOCUS_16840 7746 7192 gene locus_tag LOCUS_16850 gene grpE 7746 7192 CDS product nucleotide exchange factor GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940710.1 protein_id gnl|my_center|LOCUS_16850 8825 7794 gene locus_tag LOCUS_16860 gene hrcA 8825 7794 CDS product heat-inducible transcriptional repressor HrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940709.1 protein_id gnl|my_center|LOCUS_16860 9226 9597 gene locus_tag LOCUS_16870 9226 9597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16870 9602 10240 gene locus_tag LOCUS_16880 9602 10240 CDS product chemotaxis protein CheC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004523925.1 protein_id gnl|my_center|LOCUS_16880 10237 11151 gene locus_tag LOCUS_16890 10237 11151 CDS product sensor domain-containing diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070909.1 protein_id gnl|my_center|LOCUS_16890 12455 11442 gene locus_tag LOCUS_16900 gene aroF 12455 11442 CDS product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943946.1 protein_id gnl|my_center|LOCUS_16900 13191 12502 gene locus_tag LOCUS_16910 13191 12502 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944031.1 protein_id gnl|my_center|LOCUS_16910 15211 13211 gene locus_tag LOCUS_16920 gene tkt 15211 13211 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944033.1 protein_id gnl|my_center|LOCUS_16920 16293 15232 gene locus_tag LOCUS_16930 gene thiL 16293 15232 CDS product thiamine-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943812.1 protein_id gnl|my_center|LOCUS_16930 16498 17436 gene locus_tag LOCUS_16940 16498 17436 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940694.1 protein_id gnl|my_center|LOCUS_16940 17523 18620 gene locus_tag LOCUS_16950 17523 18620 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940693.1 protein_id gnl|my_center|LOCUS_16950 19463 18723 gene locus_tag LOCUS_16960 19463 18723 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941751.1 protein_id gnl|my_center|LOCUS_16960 <20964 19651 gene locus_tag LOCUS_16970 <20964 19651 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942727.1:D-glycero-beta-D-manno-heptose-7-phosphate kinase >Feature sequence055 4725 3262 gene locus_tag LOCUS_16980 4725 3262 CDS product PfaD family polyunsaturated fatty acid/polyketide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026866.1 protein_id gnl|my_center|LOCUS_16980 5163 4954 gene locus_tag LOCUS_16990 5163 4954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942473.1 protein_id gnl|my_center|LOCUS_16990 5457 5179 gene locus_tag LOCUS_17000 5457 5179 CDS product chorismate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942472.1 protein_id gnl|my_center|LOCUS_17000 7065 5470 gene locus_tag LOCUS_17010 gene nadB 7065 5470 CDS product L-aspartate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942471.1 protein_id gnl|my_center|LOCUS_17010 7284 9044 gene locus_tag LOCUS_17020 gene iorA 7284 9044 CDS product indolepyruvate ferredoxin oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942384.1 protein_id gnl|my_center|LOCUS_17020 9041 9622 gene locus_tag LOCUS_17030 9041 9622 CDS product indolepyruvate oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942383.1 protein_id gnl|my_center|LOCUS_17030 9673 10974 gene locus_tag LOCUS_17040 9673 10974 CDS product phenylacetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942382.1 protein_id gnl|my_center|LOCUS_17040 11013 11444 gene locus_tag LOCUS_17050 11013 11444 CDS product ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942381.1 protein_id gnl|my_center|LOCUS_17050 11466 12608 gene locus_tag LOCUS_17060 11466 12608 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942380.1 protein_id gnl|my_center|LOCUS_17060 12635 13774 gene locus_tag LOCUS_17070 12635 13774 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942379.1 protein_id gnl|my_center|LOCUS_17070 13839 14720 gene locus_tag LOCUS_17080 13839 14720 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942378.1 protein_id gnl|my_center|LOCUS_17080 14725 15684 gene locus_tag LOCUS_17090 14725 15684 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942377.1 protein_id gnl|my_center|LOCUS_17090 15677 16432 gene locus_tag LOCUS_17100 15677 16432 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942376.1 protein_id gnl|my_center|LOCUS_17100 16432 17175 gene locus_tag LOCUS_17110 16432 17175 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942375.1 protein_id gnl|my_center|LOCUS_17110 17250 18248 gene locus_tag LOCUS_17120 gene hpnH 17250 18248 CDS product adenosyl-hopene transferase HpnH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941345.1 protein_id gnl|my_center|LOCUS_17120 19708 18584 gene locus_tag LOCUS_17130 19708 18584 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943323.1 protein_id gnl|my_center|LOCUS_17130 <20952 19711 gene locus_tag LOCUS_17140 <20952 19711 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943324.1:ribosome-associated ATPase/putative transporter RbbA >Feature sequence056 1226 945 gene locus_tag LOCUS_17150 1226 945 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938763.1 protein_id gnl|my_center|LOCUS_17150 1418 1813 gene locus_tag LOCUS_17160 gene mscL 1418 1813 CDS product large-conductance mechanosensitive channel protein MscL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003399960.1 protein_id gnl|my_center|LOCUS_17160 2837 1848 gene locus_tag LOCUS_17170 2837 1848 CDS product serine/threonine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005763737.1 protein_id gnl|my_center|LOCUS_17170 3011 3910 gene locus_tag LOCUS_17180 gene rsgA 3011 3910 CDS product small ribosomal subunit biogenesis GTPase RsgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113927.1 protein_id gnl|my_center|LOCUS_17180 3942 5588 gene locus_tag LOCUS_17190 3942 5588 CDS product putative manganese-dependent inorganic diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943604.1 protein_id gnl|my_center|LOCUS_17190 5592 6437 gene locus_tag LOCUS_17200 5592 6437 CDS product CHAD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943197.1 protein_id gnl|my_center|LOCUS_17200 9967 6512 gene locus_tag LOCUS_17210 gene metH 9967 6512 CDS product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000271582.1 protein_id gnl|my_center|LOCUS_17210 13369 10112 gene locus_tag LOCUS_17220 13369 10112 CDS product type I restriction endonuclease subunit R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014205999.1 protein_id gnl|my_center|LOCUS_17220 13778 13356 gene locus_tag LOCUS_17230 13778 13356 CDS product nucleotidyltransferase substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258723.1 protein_id gnl|my_center|LOCUS_17230 14268 16376 gene locus_tag LOCUS_17240 gene ovoA 14268 16376 CDS product 5-histidylcysteine sulfoxide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704222.1 protein_id gnl|my_center|LOCUS_17240 17784 16459 gene locus_tag LOCUS_17250 17784 16459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17250 <20343 18019 gene locus_tag LOCUS_17260 <20343 18019 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941215.1:endonuclease MutS2 >Feature sequence057 577 1140 gene locus_tag LOCUS_17270 gene gnfR 577 1140 CDS product nitrogen fixation two-component system response regulator GnfR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943448.1 protein_id gnl|my_center|LOCUS_17270 2055 1150 gene locus_tag LOCUS_17280 gene draG 2055 1150 CDS product ADP-ribosyl-[dinitrogen reductase] hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943427.1 protein_id gnl|my_center|LOCUS_17280 2381 3250 gene locus_tag LOCUS_17290 2381 3250 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943426.1 protein_id gnl|my_center|LOCUS_17290 3247 4071 gene locus_tag LOCUS_17300 3247 4071 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943425.1 protein_id gnl|my_center|LOCUS_17300 4335 5486 gene locus_tag LOCUS_17310 gene nifV 4335 5486 CDS product homocitrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941605.1 protein_id gnl|my_center|LOCUS_17310 5527 5760 gene locus_tag LOCUS_17320 5527 5760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17320 5791 6081 gene locus_tag LOCUS_17330 5791 6081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17330 6066 6497 gene locus_tag LOCUS_17340 6066 6497 CDS product macro domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943011.1 protein_id gnl|my_center|LOCUS_17340 6584 7267 gene locus_tag LOCUS_17350 6584 7267 CDS product type 1 glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941604.1 protein_id gnl|my_center|LOCUS_17350 7656 7309 gene locus_tag LOCUS_17360 7656 7309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17360 8060 9289 gene locus_tag LOCUS_17370 8060 9289 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021292.1 protein_id gnl|my_center|LOCUS_17370 9286 9972 gene locus_tag LOCUS_17380 9286 9972 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933416.1 protein_id gnl|my_center|LOCUS_17380 9976 11064 gene locus_tag LOCUS_17390 9976 11064 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933415.1 protein_id gnl|my_center|LOCUS_17390 12855 11044 gene locus_tag LOCUS_17400 gene sulP 12855 11044 CDS product sulfate permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085632.1 protein_id gnl|my_center|LOCUS_17400 13812 13156 gene locus_tag LOCUS_17410 13812 13156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17410 14718 16031 gene locus_tag LOCUS_17420 14718 16031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17420 16183 17007 gene locus_tag LOCUS_17430 16183 17007 CDS product TOBE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943595.1 protein_id gnl|my_center|LOCUS_17430 17098 17970 gene locus_tag LOCUS_17440 gene modD 17098 17970 CDS product ModD protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932141.1 protein_id gnl|my_center|LOCUS_17440 17967 18728 gene locus_tag LOCUS_17450 gene modA 17967 18728 CDS product molybdate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113613.1 protein_id gnl|my_center|LOCUS_17450 18741 19418 gene locus_tag LOCUS_17460 gene modB 18741 19418 CDS product molybdate ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003088068.1 protein_id gnl|my_center|LOCUS_17460 >Feature sequence058 3641 192 gene locus_tag LOCUS_17470 3641 192 CDS product pyruvate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943065.1 protein_id gnl|my_center|LOCUS_17470 3925 4998 gene locus_tag LOCUS_17480 3925 4998 CDS product branched-chain amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941317.1 protein_id gnl|my_center|LOCUS_17480 5576 6340 gene locus_tag LOCUS_17490 gene rpsB 5576 6340 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942566.1 protein_id gnl|my_center|LOCUS_17490 6391 7326 gene locus_tag LOCUS_17500 gene tsf 6391 7326 CDS product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003384678.1 protein_id gnl|my_center|LOCUS_17500 7443 8165 gene locus_tag LOCUS_17510 gene pyrH 7443 8165 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942564.1 protein_id gnl|my_center|LOCUS_17510 8165 8722 gene locus_tag LOCUS_17520 gene frr 8165 8722 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942563.1 protein_id gnl|my_center|LOCUS_17520 8722 9477 gene locus_tag LOCUS_17530 8722 9477 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942562.1 protein_id gnl|my_center|LOCUS_17530 9519 10259 gene locus_tag LOCUS_17540 9519 10259 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942561.1 protein_id gnl|my_center|LOCUS_17540 10263 11423 gene locus_tag LOCUS_17550 10263 11423 CDS product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942560.1 protein_id gnl|my_center|LOCUS_17550 11425 12567 gene locus_tag LOCUS_17560 gene rseP 11425 12567 CDS product RIP metalloprotease RseP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942559.1 protein_id gnl|my_center|LOCUS_17560 12617 13663 gene locus_tag LOCUS_17570 12617 13663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17570 13717 14415 gene locus_tag LOCUS_17580 gene tsaB 13717 14415 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942558.1 protein_id gnl|my_center|LOCUS_17580 14608 15798 gene locus_tag LOCUS_17590 gene sucC 14608 15798 CDS product ADP-forming succinate--CoA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941719.1 protein_id gnl|my_center|LOCUS_17590 15779 16729 gene locus_tag LOCUS_17600 gene sucD 15779 16729 CDS product succinate--CoA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941720.1 protein_id gnl|my_center|LOCUS_17600 18097 16877 gene locus_tag LOCUS_17610 18097 16877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17610 18758 18955 gene locus_tag LOCUS_17620 18758 18955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17620 19931 19023 gene locus_tag LOCUS_17630 19931 19023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17630 >Feature sequence059 547 293 gene locus_tag LOCUS_17640 547 293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17640 1133 750 gene locus_tag LOCUS_17650 1133 750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17650 2390 1230 gene locus_tag LOCUS_17660 2390 1230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17660 3390 3049 gene locus_tag LOCUS_17670 3390 3049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17670 3660 3442 gene locus_tag LOCUS_17680 3660 3442 CDS product prepilin-type N-terminal cleavage/methylation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049786599.1 protein_id gnl|my_center|LOCUS_17680 4430 3942 gene locus_tag LOCUS_17690 4430 3942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17690 4729 4406 gene locus_tag LOCUS_17700 4729 4406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17700 5237 5917 gene locus_tag LOCUS_17710 5237 5917 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942478.1 protein_id gnl|my_center|LOCUS_17710 5944 7044 gene locus_tag LOCUS_17720 5944 7044 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000654729.1 protein_id gnl|my_center|LOCUS_17720 7061 7558 gene locus_tag LOCUS_17730 7061 7558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17730 7581 7982 gene locus_tag LOCUS_17740 7581 7982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941888.1 protein_id gnl|my_center|LOCUS_17740 8069 8986 gene locus_tag LOCUS_17750 8069 8986 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942085.1 protein_id gnl|my_center|LOCUS_17750 8998 9843 gene locus_tag LOCUS_17760 8998 9843 CDS product HDOD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942933.1 protein_id gnl|my_center|LOCUS_17760 10078 9896 gene locus_tag LOCUS_17770 10078 9896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17770 10270 11343 gene locus_tag LOCUS_17780 gene rfbB 10270 11343 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943002.1 protein_id gnl|my_center|LOCUS_17780 11340 12179 gene locus_tag LOCUS_17790 gene rfbD 11340 12179 CDS product dTDP-4-dehydrorhamnose reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943001.1 protein_id gnl|my_center|LOCUS_17790 12191 12610 gene locus_tag LOCUS_17800 12191 12610 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943000.1 protein_id gnl|my_center|LOCUS_17800 12618 13151 gene locus_tag LOCUS_17810 12618 13151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17810 13167 14267 gene locus_tag LOCUS_17820 13167 14267 CDS product mannose-1-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941859.1 protein_id gnl|my_center|LOCUS_17820 14352 15092 gene locus_tag LOCUS_17830 14352 15092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17830 15054 15063 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 15094 15588 gene locus_tag LOCUS_17840 15094 15588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17840 15588 16415 gene locus_tag LOCUS_17850 15588 16415 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943266.1 protein_id gnl|my_center|LOCUS_17850 16399 17241 gene locus_tag LOCUS_17860 gene bioC 16399 17241 CDS product malonyl-ACP O-methyltransferase BioC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943265.1 protein_id gnl|my_center|LOCUS_17860 17539 17267 gene locus_tag LOCUS_17870 17539 17267 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943263.1 protein_id gnl|my_center|LOCUS_17870 18689 17715 gene locus_tag LOCUS_17880 18689 17715 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943262.1 protein_id gnl|my_center|LOCUS_17880 19504 18686 gene locus_tag LOCUS_17890 19504 18686 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943261.1 protein_id gnl|my_center|LOCUS_17890 >Feature sequence060 1 273 gene locus_tag LOCUS_17900 1 273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17900 403 999 gene locus_tag LOCUS_17910 403 999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17910 1043 2374 gene locus_tag LOCUS_17920 1043 2374 CDS product cytochrome ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_187263000.1 protein_id gnl|my_center|LOCUS_17920 2361 3368 gene locus_tag LOCUS_17930 2361 3368 CDS product cytochrome d ubiquinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897013.1 protein_id gnl|my_center|LOCUS_17930 3437 5164 gene locus_tag LOCUS_17940 gene poxB 3437 5164 CDS product ubiquinone-dependent pyruvate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704865.1 protein_id gnl|my_center|LOCUS_17940 5287 5733 gene locus_tag LOCUS_17950 5287 5733 CDS product DUF2147 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001043223.1 protein_id gnl|my_center|LOCUS_17950 5803 7152 gene locus_tag LOCUS_17960 5803 7152 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000163428.1 protein_id gnl|my_center|LOCUS_17960 7950 9776 gene locus_tag LOCUS_17970 7950 9776 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919618.1 protein_id gnl|my_center|LOCUS_17970 9942 10646 gene locus_tag LOCUS_17980 9942 10646 CDS product helical backbone metal receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545710.1 protein_id gnl|my_center|LOCUS_17980 10643 11617 gene locus_tag LOCUS_17990 10643 11617 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680276.1 protein_id gnl|my_center|LOCUS_17990 11643 12407 gene locus_tag LOCUS_18000 11643 12407 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002325771.1 protein_id gnl|my_center|LOCUS_18000 12883 13167 gene locus_tag LOCUS_18010 12883 13167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18010 13276 13545 gene locus_tag LOCUS_18020 13276 13545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18020 13538 14023 gene locus_tag LOCUS_18030 13538 14023 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807613.1 protein_id gnl|my_center|LOCUS_18030 15037 15402 gene locus_tag LOCUS_18040 15037 15402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18040 15408 16028 gene locus_tag LOCUS_18050 15408 16028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18050 16317 16619 gene locus_tag LOCUS_18060 16317 16619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18060 18618 16807 gene locus_tag LOCUS_18070 18618 16807 CDS product AMP-dependent synthetase/ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926994.1 protein_id gnl|my_center|LOCUS_18070 19601 18903 gene locus_tag LOCUS_18080 19601 18903 CDS product cytidylate kinase-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941332.1 protein_id gnl|my_center|LOCUS_18080 >Feature sequence061 1142 102 gene locus_tag LOCUS_18090 1142 102 CDS product TIGR00730 family Rossman fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942549.1 protein_id gnl|my_center|LOCUS_18090 1350 1841 gene locus_tag LOCUS_18100 1350 1841 CDS product roadblock/LC7 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940775.1 protein_id gnl|my_center|LOCUS_18100 1943 2530 gene locus_tag LOCUS_18110 1943 2530 CDS product GTPase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940776.1 protein_id gnl|my_center|LOCUS_18110 2695 2787 gene locus_tag LOCUS_t00180 2695 2787 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 3300 2857 gene locus_tag LOCUS_18120 gene rnhA 3300 2857 CDS product ribonuclease HI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942713.1 protein_id gnl|my_center|LOCUS_18120 3940 3287 gene locus_tag LOCUS_18130 3940 3287 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942714.1 protein_id gnl|my_center|LOCUS_18130 4133 4480 gene locus_tag LOCUS_18140 4133 4480 CDS product peptide chain release factor-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941214.1 protein_id gnl|my_center|LOCUS_18140 7310 4533 gene locus_tag LOCUS_18150 gene polA 7310 4533 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391261.1 protein_id gnl|my_center|LOCUS_18150 7498 7307 gene locus_tag LOCUS_18160 7498 7307 CDS product DUF4177 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941208.1 protein_id gnl|my_center|LOCUS_18160 8395 7613 gene locus_tag LOCUS_18170 8395 7613 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941182.1 protein_id gnl|my_center|LOCUS_18170 8627 9082 gene locus_tag LOCUS_18180 8627 9082 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941183.1 protein_id gnl|my_center|LOCUS_18180 9104 9895 gene locus_tag LOCUS_18190 9104 9895 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943179.1 protein_id gnl|my_center|LOCUS_18190 10232 10642 gene locus_tag LOCUS_18200 10232 10642 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941536.1 protein_id gnl|my_center|LOCUS_18200 12232 10691 gene locus_tag LOCUS_18210 12232 10691 CDS product B12-binding domain-containing radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941535.1 protein_id gnl|my_center|LOCUS_18210 13321 12293 gene locus_tag LOCUS_18220 13321 12293 CDS product C40 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941533.1 protein_id gnl|my_center|LOCUS_18220 14878 13460 gene locus_tag LOCUS_18230 gene cdaA 14878 13460 CDS product diadenylate cyclase CdaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941532.1 protein_id gnl|my_center|LOCUS_18230 14999 15709 gene locus_tag LOCUS_18240 gene ubiE 14999 15709 CDS product bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941531.1 protein_id gnl|my_center|LOCUS_18240 16331 15849 gene locus_tag LOCUS_18250 16331 15849 CDS product YchJ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941709.1 protein_id gnl|my_center|LOCUS_18250 16481 16705 gene locus_tag LOCUS_18260 16481 16705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18260 16761 17846 gene locus_tag LOCUS_18270 16761 17846 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943997.1 protein_id gnl|my_center|LOCUS_18270 17854 19356 gene locus_tag LOCUS_18280 17854 19356 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940888.1 protein_id gnl|my_center|LOCUS_18280 >Feature sequence062 2201 1197 gene locus_tag LOCUS_18290 gene gap 2201 1197 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942274.1 protein_id gnl|my_center|LOCUS_18290 3196 2378 gene locus_tag LOCUS_18300 3196 2378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18300 4484 3210 gene locus_tag LOCUS_18310 4484 3210 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943329.1 protein_id gnl|my_center|LOCUS_18310 4883 4614 gene locus_tag LOCUS_18320 4883 4614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18320 6177 4936 gene locus_tag LOCUS_18330 6177 4936 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918225.1 protein_id gnl|my_center|LOCUS_18330 6631 6245 gene locus_tag LOCUS_18340 6631 6245 CDS product DUF302 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946746.1 protein_id gnl|my_center|LOCUS_18340 9158 6684 gene locus_tag LOCUS_18350 9158 6684 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942320.1 protein_id gnl|my_center|LOCUS_18350 10407 9397 gene locus_tag LOCUS_18360 10407 9397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18360 11238 10858 gene locus_tag LOCUS_18370 11238 10858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18370 12390 11797 gene locus_tag LOCUS_18380 12390 11797 CDS product porin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940750.1 protein_id gnl|my_center|LOCUS_18380 12566 12748 gene locus_tag LOCUS_18390 12566 12748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18390 14215 12842 gene locus_tag LOCUS_18400 14215 12842 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941028.1 protein_id gnl|my_center|LOCUS_18400 15942 14629 gene locus_tag LOCUS_18410 15942 14629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18410 18082 16046 gene locus_tag LOCUS_18420 18082 16046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18420 >Feature sequence063 <1 1145 gene locus_tag LOCUS_18430 <1 1145 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164921330.1:PAS domain S-box protein 2206 1973 gene locus_tag LOCUS_18440 2206 1973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18440 2611 2249 gene locus_tag LOCUS_18450 2611 2249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18450 2511 3329 gene locus_tag LOCUS_18460 2511 3329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18460 3601 3443 gene locus_tag LOCUS_18470 3601 3443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18470 4772 3897 gene locus_tag LOCUS_18480 4772 3897 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942785.1 protein_id gnl|my_center|LOCUS_18480 5715 4798 gene locus_tag LOCUS_18490 5715 4798 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235044954.1 protein_id gnl|my_center|LOCUS_18490 6289 5756 gene locus_tag LOCUS_18500 6289 5756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941136.1 protein_id gnl|my_center|LOCUS_18500 7260 7003 gene locus_tag LOCUS_18510 7260 7003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_18510 8873 8013 gene locus_tag LOCUS_18520 8873 8013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18520 9364 9038 gene locus_tag LOCUS_18530 9364 9038 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008631113.1 protein_id gnl|my_center|LOCUS_18530 12550 9368 gene locus_tag LOCUS_18540 12550 9368 CDS product CusA/CzcA family heavy metal efflux RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482627.1 protein_id gnl|my_center|LOCUS_18540 13837 12554 gene locus_tag LOCUS_18550 13837 12554 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946829.1 protein_id gnl|my_center|LOCUS_18550 15358 14084 gene locus_tag LOCUS_18560 15358 14084 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941984.1 protein_id gnl|my_center|LOCUS_18560 16351 15677 gene locus_tag LOCUS_18570 16351 15677 CDS product isoprenylcysteine carboxylmethyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946775.1 protein_id gnl|my_center|LOCUS_18570 16418 16609 gene locus_tag LOCUS_18580 16418 16609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18580 17567 17142 gene locus_tag LOCUS_18590 17567 17142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18590 <19257 17672 gene locus_tag LOCUS_18600 <19257 17672 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_162006391.1:heavy metal translocating P-type ATPase >Feature sequence064 <1 746 gene locus_tag LOCUS_18610 <1 746 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942918.1:peptide chain release factor 2 1266 1191 gene locus_tag LOCUS_t00190 1266 1191 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 1507 2337 gene locus_tag LOCUS_18620 1507 2337 CDS product NlpC/P60 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942917.1 protein_id gnl|my_center|LOCUS_18620 2401 3642 gene locus_tag LOCUS_18630 2401 3642 CDS product DUF1015 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942916.1 protein_id gnl|my_center|LOCUS_18630 5023 3731 gene locus_tag LOCUS_18640 gene thiC 5023 3731 CDS product phosphomethylpyrimidine synthase ThiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941266.1 protein_id gnl|my_center|LOCUS_18640 6532 5057 gene locus_tag LOCUS_18650 gene thiD 6532 5057 CDS product bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941267.1 protein_id gnl|my_center|LOCUS_18650 7686 6820 gene locus_tag LOCUS_18660 7686 6820 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235044954.1 protein_id gnl|my_center|LOCUS_18660 8235 7708 gene locus_tag LOCUS_18670 8235 7708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941136.1 protein_id gnl|my_center|LOCUS_18670 8684 8346 gene locus_tag LOCUS_18680 8684 8346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18680 10217 8862 gene locus_tag LOCUS_18690 10217 8862 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941138.1 protein_id gnl|my_center|LOCUS_18690 11464 10214 gene locus_tag LOCUS_18700 11464 10214 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941139.1 protein_id gnl|my_center|LOCUS_18700 12842 11499 gene locus_tag LOCUS_18710 12842 11499 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942788.1 protein_id gnl|my_center|LOCUS_18710 13578 12832 gene locus_tag LOCUS_18720 13578 12832 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235044874.1 protein_id gnl|my_center|LOCUS_18720 14041 13625 gene locus_tag LOCUS_18730 14041 13625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18730 14525 14100 gene locus_tag LOCUS_18740 14525 14100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18740 16507 14822 gene locus_tag LOCUS_18750 16507 14822 CDS product AarF/UbiB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941749.1 protein_id gnl|my_center|LOCUS_18750 16807 16511 gene locus_tag LOCUS_18760 16807 16511 CDS product phasin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941748.1 protein_id gnl|my_center|LOCUS_18760 18609 16960 gene locus_tag LOCUS_18770 18609 16960 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941692.1 protein_id gnl|my_center|LOCUS_18770 >Feature sequence065 259 56 gene locus_tag LOCUS_18780 259 56 CDS product DUF1858 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941933.1 protein_id gnl|my_center|LOCUS_18780 773 297 gene locus_tag LOCUS_18790 gene greA 773 297 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941932.1 protein_id gnl|my_center|LOCUS_18790 4120 881 gene locus_tag LOCUS_18800 gene carB 4120 881 CDS product carbamoyl-phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941931.1 protein_id gnl|my_center|LOCUS_18800 4470 4144 gene locus_tag LOCUS_18810 4470 4144 CDS product DMT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941930.1 protein_id gnl|my_center|LOCUS_18810 4991 4491 gene locus_tag LOCUS_18820 4991 4491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18820 5926 5009 gene locus_tag LOCUS_18830 5926 5009 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193360266.1 protein_id gnl|my_center|LOCUS_18830 7054 5927 gene locus_tag LOCUS_18840 gene carA 7054 5927 CDS product glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941928.1 protein_id gnl|my_center|LOCUS_18840 8431 7157 gene locus_tag LOCUS_18850 8431 7157 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941927.1 protein_id gnl|my_center|LOCUS_18850 9526 8594 gene locus_tag LOCUS_18860 9526 8594 CDS product aspartate carbamoyltransferase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941926.1 protein_id gnl|my_center|LOCUS_18860 10080 9544 gene locus_tag LOCUS_18870 gene pyrR 10080 9544 CDS product bifunctional pyr operon transcriptional regulator/uracil phosphoribosyltransferase PyrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941925.1 protein_id gnl|my_center|LOCUS_18870 11565 10306 gene locus_tag LOCUS_18880 11565 10306 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942239.1 protein_id gnl|my_center|LOCUS_18880 11922 11683 gene locus_tag LOCUS_18890 11922 11683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18890 11976 13148 gene locus_tag LOCUS_18900 gene sucC 11976 13148 CDS product ADP-forming succinate--CoA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244732.1 protein_id gnl|my_center|LOCUS_18900 13145 14017 gene locus_tag LOCUS_18910 gene sucD 13145 14017 CDS product succinate--CoA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003238566.1 protein_id gnl|my_center|LOCUS_18910 15747 14224 gene locus_tag LOCUS_18920 15747 14224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18920 15882 16079 gene locus_tag LOCUS_18930 15882 16079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18930 16444 16184 gene locus_tag LOCUS_18940 16444 16184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18940 16593 16441 gene locus_tag LOCUS_18950 16593 16441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18950 16936 17124 gene locus_tag LOCUS_18960 16936 17124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18960 17210 18532 gene locus_tag LOCUS_18970 17210 18532 CDS product chloride channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528814.1 protein_id gnl|my_center|LOCUS_18970 >Feature sequence066 569 117 gene locus_tag LOCUS_18980 569 117 CDS product HPP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943771.1 protein_id gnl|my_center|LOCUS_18980 1708 704 gene locus_tag LOCUS_18990 1708 704 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943774.1 protein_id gnl|my_center|LOCUS_18990 3486 1885 gene locus_tag LOCUS_19000 gene hcp 3486 1885 CDS product hydroxylamine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941334.1 protein_id gnl|my_center|LOCUS_19000 5200 3749 gene locus_tag LOCUS_19010 5200 3749 CDS product ammonia-forming cytochrome c nitrite reductase subunit c552 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943775.1 protein_id gnl|my_center|LOCUS_19010 5938 5579 gene locus_tag LOCUS_19020 5938 5579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941583.1 protein_id gnl|my_center|LOCUS_19020 6257 6042 gene locus_tag LOCUS_19030 6257 6042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19030 6506 6300 gene locus_tag LOCUS_19040 6506 6300 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941512.1 protein_id gnl|my_center|LOCUS_19040 8889 6598 gene locus_tag LOCUS_19050 8889 6598 CDS product cbb3-type cytochrome c oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776827.1 protein_id gnl|my_center|LOCUS_19050 9135 8941 gene locus_tag LOCUS_19060 9135 8941 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944059.1 protein_id gnl|my_center|LOCUS_19060 9535 9176 gene locus_tag LOCUS_19070 9535 9176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19070 10938 9604 gene locus_tag LOCUS_19080 10938 9604 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941507.1 protein_id gnl|my_center|LOCUS_19080 11953 11027 gene locus_tag LOCUS_19090 11953 11027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19090 12582 12349 gene locus_tag LOCUS_19100 12582 12349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19100 13539 12928 gene locus_tag LOCUS_19110 13539 12928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19110 14446 13781 gene locus_tag LOCUS_19120 14446 13781 CDS product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022466.1 protein_id gnl|my_center|LOCUS_19120 14713 14889 gene locus_tag LOCUS_19130 14713 14889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19130 16051 15347 gene locus_tag LOCUS_19140 16051 15347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19140 16305 16048 gene locus_tag LOCUS_19150 16305 16048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19150 16774 16523 gene locus_tag LOCUS_19160 16774 16523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19160 17055 17213 gene locus_tag LOCUS_19170 17055 17213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19170 17501 18598 gene locus_tag LOCUS_19180 17501 18598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19180 >Feature sequence067 780 430 gene locus_tag LOCUS_19190 780 430 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943583.1 protein_id gnl|my_center|LOCUS_19190 939 1262 gene locus_tag LOCUS_19200 939 1262 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_084785422.1 protein_id gnl|my_center|LOCUS_19200 1462 1770 gene locus_tag LOCUS_19210 1462 1770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19210 1855 2217 gene locus_tag LOCUS_19220 1855 2217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080190.1 protein_id gnl|my_center|LOCUS_19220 2231 2512 gene locus_tag LOCUS_19230 2231 2512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19230 2509 2754 gene locus_tag LOCUS_19240 2509 2754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19240 2757 2984 gene locus_tag LOCUS_19250 2757 2984 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943587.1 protein_id gnl|my_center|LOCUS_19250 2981 3361 gene locus_tag LOCUS_19260 2981 3361 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943588.1 protein_id gnl|my_center|LOCUS_19260 3358 4050 gene locus_tag LOCUS_19270 3358 4050 CDS product cytochrome c biogenesis CcdA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943589.1 protein_id gnl|my_center|LOCUS_19270 4152 5471 gene locus_tag LOCUS_19280 4152 5471 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765009.1 protein_id gnl|my_center|LOCUS_19280 5468 6661 gene locus_tag LOCUS_19290 5468 6661 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057458.1 protein_id gnl|my_center|LOCUS_19290 6697 9810 gene locus_tag LOCUS_19300 6697 9810 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393846.1 protein_id gnl|my_center|LOCUS_19300 9849 11606 gene locus_tag LOCUS_19310 9849 11606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19310 11654 12664 gene locus_tag LOCUS_19320 11654 12664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19320 12768 14030 gene locus_tag LOCUS_19330 12768 14030 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941618.1 protein_id gnl|my_center|LOCUS_19330 14055 15227 gene locus_tag LOCUS_19340 14055 15227 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941617.1 protein_id gnl|my_center|LOCUS_19340 15224 16426 gene locus_tag LOCUS_19350 15224 16426 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941616.1 protein_id gnl|my_center|LOCUS_19350 16428 17132 gene locus_tag LOCUS_19360 16428 17132 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941615.1 protein_id gnl|my_center|LOCUS_19360 17290 18183 gene locus_tag LOCUS_19370 17290 18183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19370 >Feature sequence068 1731 364 gene locus_tag LOCUS_19380 1731 364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19380 2123 1767 gene locus_tag LOCUS_19390 gene dksA 2123 1767 CDS product RNA polymerase-binding protein DksA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940956.1 protein_id gnl|my_center|LOCUS_19390 2300 3376 gene locus_tag LOCUS_19400 2300 3376 CDS product nitronate monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942522.1 protein_id gnl|my_center|LOCUS_19400 3572 3799 gene locus_tag LOCUS_19410 3572 3799 CDS product DUF4160 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808730.1 protein_id gnl|my_center|LOCUS_19410 3807 4055 gene locus_tag LOCUS_19420 3807 4055 CDS product DUF2442 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391906.1 protein_id gnl|my_center|LOCUS_19420 4188 4484 gene locus_tag LOCUS_19430 4188 4484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19430 4795 4493 gene locus_tag LOCUS_19440 4795 4493 CDS product HigA family addiction module antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014062.1 protein_id gnl|my_center|LOCUS_19440 5949 7289 gene locus_tag LOCUS_19450 gene pcnB 5949 7289 CDS product polynucleotide adenylyltransferase PcnB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943862.1 protein_id gnl|my_center|LOCUS_19450 7307 7843 gene locus_tag LOCUS_19460 7307 7843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19460 9193 7919 gene locus_tag LOCUS_19470 9193 7919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19470 9850 9245 gene locus_tag LOCUS_19480 9850 9245 CDS product flavin prenyltransferase UbiX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941109.1 protein_id gnl|my_center|LOCUS_19480 10717 9854 gene locus_tag LOCUS_19490 gene ubiA 10717 9854 CDS product putative 4-hydroxybenzoate polyprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941108.1 protein_id gnl|my_center|LOCUS_19490 12114 10714 gene locus_tag LOCUS_19500 12114 10714 CDS product UbiD family decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941106.1 protein_id gnl|my_center|LOCUS_19500 13632 12118 gene locus_tag LOCUS_19510 13632 12118 CDS product glycogen/starch synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941686.1 protein_id gnl|my_center|LOCUS_19510 14340 13696 gene locus_tag LOCUS_19520 gene fsa 14340 13696 CDS product fructose-6-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943606.1 protein_id gnl|my_center|LOCUS_19520 14694 14440 gene locus_tag LOCUS_19530 14694 14440 CDS product YHS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943607.1 protein_id gnl|my_center|LOCUS_19530 15263 14691 gene locus_tag LOCUS_19540 gene folK 15263 14691 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943608.1 protein_id gnl|my_center|LOCUS_19540 16361 15477 gene locus_tag LOCUS_19550 16361 15477 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943285.1 protein_id gnl|my_center|LOCUS_19550 16645 16379 gene locus_tag LOCUS_19560 16645 16379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942312.1 protein_id gnl|my_center|LOCUS_19560 18308 16728 gene locus_tag LOCUS_19570 18308 16728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19570 >Feature sequence069 1729 344 gene locus_tag LOCUS_19580 1729 344 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941040.1 protein_id gnl|my_center|LOCUS_19580 3160 1748 gene locus_tag LOCUS_19590 3160 1748 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941041.1 protein_id gnl|my_center|LOCUS_19590 4604 3258 gene locus_tag LOCUS_19600 gene rimO 4604 3258 CDS product 30S ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943823.1 protein_id gnl|my_center|LOCUS_19600 5036 4824 gene locus_tag LOCUS_19610 5036 4824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19610 5608 5249 gene locus_tag LOCUS_19620 5608 5249 CDS product type II toxin-antitoxin system PemK/MazF family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817423.1 protein_id gnl|my_center|LOCUS_19620 5837 5601 gene locus_tag LOCUS_19630 5837 5601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19630 6469 5984 gene locus_tag LOCUS_19640 6469 5984 CDS product YajQ family cyclic di-GMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943822.1 protein_id gnl|my_center|LOCUS_19640 7198 6488 gene locus_tag LOCUS_19650 7198 6488 CDS product outer membrane lipoprotein carrier protein LolA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943821.1 protein_id gnl|my_center|LOCUS_19650 8948 7317 gene locus_tag LOCUS_19660 8948 7317 CDS product chemotaxis protein CheA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943817.1 protein_id gnl|my_center|LOCUS_19660 9314 8952 gene locus_tag LOCUS_19670 9314 8952 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943816.1 protein_id gnl|my_center|LOCUS_19670 10771 9329 gene locus_tag LOCUS_19680 gene gatB 10771 9329 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943991.1 protein_id gnl|my_center|LOCUS_19680 11169 10786 gene locus_tag LOCUS_19690 11169 10786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19690 12260 11091 gene locus_tag LOCUS_19700 12260 11091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19700 11258 11267 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 12567 12280 gene locus_tag LOCUS_19710 gene gatC 12567 12280 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943994.1 protein_id gnl|my_center|LOCUS_19710 12763 13191 gene locus_tag LOCUS_19720 gene rplM 12763 13191 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943505.1 protein_id gnl|my_center|LOCUS_19720 13212 13604 gene locus_tag LOCUS_19730 gene rpsI 13212 13604 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943504.1 protein_id gnl|my_center|LOCUS_19730 13736 14776 gene locus_tag LOCUS_19740 gene argC 13736 14776 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943503.1 protein_id gnl|my_center|LOCUS_19740 14780 16609 gene locus_tag LOCUS_19750 14780 16609 CDS product YgiQ family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943502.1 protein_id gnl|my_center|LOCUS_19750 >Feature sequence070 101 265 gene locus_tag LOCUS_19760 101 265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19760 667 2946 gene locus_tag LOCUS_19770 667 2946 CDS product sigma 54-interacting transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943974.1 protein_id gnl|my_center|LOCUS_19770 3207 3392 gene locus_tag LOCUS_19780 3207 3392 CDS product hydrogenase expression protein HypE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943975.1 protein_id gnl|my_center|LOCUS_19780 5009 3480 gene locus_tag LOCUS_19790 gene rng 5009 3480 CDS product ribonuclease G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943853.1 protein_id gnl|my_center|LOCUS_19790 7526 5055 gene locus_tag LOCUS_19800 7526 5055 CDS product TIGR03960 family B12-binding radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943854.1 protein_id gnl|my_center|LOCUS_19800 7730 8584 gene locus_tag LOCUS_19810 gene htpX 7730 8584 CDS product zinc metalloprotease HtpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942212.1 protein_id gnl|my_center|LOCUS_19810 8574 9947 gene locus_tag LOCUS_19820 gene rsmB 8574 9947 CDS product 16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943984.1 protein_id gnl|my_center|LOCUS_19820 9970 10635 gene locus_tag LOCUS_19830 gene rpe 9970 10635 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943985.1 protein_id gnl|my_center|LOCUS_19830 10709 11671 gene locus_tag LOCUS_19840 10709 11671 CDS product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943987.1 protein_id gnl|my_center|LOCUS_19840 11822 13267 gene locus_tag LOCUS_19850 11822 13267 CDS product transglutaminase-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943972.1 protein_id gnl|my_center|LOCUS_19850 13338 13841 gene locus_tag LOCUS_19860 13338 13841 CDS product chemotaxis protein CheX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941072.1 protein_id gnl|my_center|LOCUS_19860 13881 14048 gene locus_tag LOCUS_19870 13881 14048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19870 14081 14305 gene locus_tag LOCUS_19880 14081 14305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19880 15607 14318 gene locus_tag LOCUS_19890 15607 14318 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943971.1 protein_id gnl|my_center|LOCUS_19890 16017 15604 gene locus_tag LOCUS_19900 16017 15604 CDS product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941198.1 protein_id gnl|my_center|LOCUS_19900 17134 16019 gene locus_tag LOCUS_19910 17134 16019 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941165.1 protein_id gnl|my_center|LOCUS_19910 >Feature sequence071 <1 581 gene locus_tag LOCUS_19920 <1 581 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942073.1:prolipoprotein diacylglyceryl transferase 654 1175 gene locus_tag LOCUS_19930 654 1175 CDS product ferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941961.1 protein_id gnl|my_center|LOCUS_19930 1179 1415 gene locus_tag LOCUS_19940 1179 1415 CDS product DUF1450 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941962.1 protein_id gnl|my_center|LOCUS_19940 1965 1483 gene locus_tag LOCUS_19950 1965 1483 CDS product HyaD/HybD family hydrogenase maturation endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941451.1 protein_id gnl|my_center|LOCUS_19950 3645 1966 gene locus_tag LOCUS_19960 3645 1966 CDS product nickel-dependent hydrogenase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941450.1 protein_id gnl|my_center|LOCUS_19960 4998 3709 gene locus_tag LOCUS_19970 gene hybB 4998 3709 CDS product Ni/Fe-hydrogenase cytochrome b subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941449.1 protein_id gnl|my_center|LOCUS_19970 5963 4995 gene locus_tag LOCUS_19980 gene hybA 5963 4995 CDS product hydrogenase 2 operon protein HybA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941448.1 protein_id gnl|my_center|LOCUS_19980 7059 5947 gene locus_tag LOCUS_19990 7059 5947 CDS product hydrogenase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941447.1 protein_id gnl|my_center|LOCUS_19990 7360 8730 gene locus_tag LOCUS_20000 7360 8730 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941440.1 protein_id gnl|my_center|LOCUS_20000 8727 9911 gene locus_tag LOCUS_20010 8727 9911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20010 >Feature sequence072 1146 307 gene locus_tag LOCUS_20020 1146 307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_20020 1624 1097 gene locus_tag LOCUS_20030 1624 1097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_20030 1118 1127 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2976 1621 gene locus_tag LOCUS_20040 2976 1621 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930455.1 protein_id gnl|my_center|LOCUS_20040 3123 4691 gene locus_tag LOCUS_20050 gene cimA 3123 4691 CDS product citramalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942443.1 protein_id gnl|my_center|LOCUS_20050 4708 5265 gene locus_tag LOCUS_20060 4708 5265 CDS product helix-hairpin-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942442.1 protein_id gnl|my_center|LOCUS_20060 5673 6389 gene locus_tag LOCUS_20070 gene rph 5673 6389 CDS product ribonuclease PH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942439.1 protein_id gnl|my_center|LOCUS_20070 6386 6982 gene locus_tag LOCUS_20080 6386 6982 CDS product XTP/dITP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942438.1 protein_id gnl|my_center|LOCUS_20080 7034 8515 gene locus_tag LOCUS_20090 gene rlmD 7034 8515 CDS product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942098.1 protein_id gnl|my_center|LOCUS_20090 8559 8633 gene locus_tag LOCUS_t00200 8559 8633 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 8716 10626 gene locus_tag LOCUS_20100 gene thrS 8716 10626 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193360261.1 protein_id gnl|my_center|LOCUS_20100 10761 11195 gene locus_tag LOCUS_20110 gene infC 10761 11195 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942163.1 protein_id gnl|my_center|LOCUS_20110 11246 11443 gene locus_tag LOCUS_20120 gene rpmI 11246 11443 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942164.1 protein_id gnl|my_center|LOCUS_20120 11547 11900 gene locus_tag LOCUS_20130 gene rplT 11547 11900 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942165.1 protein_id gnl|my_center|LOCUS_20130 12008 13024 gene locus_tag LOCUS_20140 gene pheS 12008 13024 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942166.1 protein_id gnl|my_center|LOCUS_20140 13052 15460 gene locus_tag LOCUS_20150 gene pheT 13052 15460 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942167.1 protein_id gnl|my_center|LOCUS_20150 15544 15828 gene locus_tag LOCUS_20160 15544 15828 CDS product integration host factor subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942168.1 protein_id gnl|my_center|LOCUS_20160 15852 16205 gene locus_tag LOCUS_20170 15852 16205 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_082021182.1 protein_id gnl|my_center|LOCUS_20170 16217 16293 gene locus_tag LOCUS_t00210 16217 16293 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 16607 16299 gene locus_tag LOCUS_20180 16607 16299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20180 >Feature sequence073 839 1696 gene locus_tag LOCUS_20190 839 1696 CDS product ADP-ribosylation factor-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942575.1 protein_id gnl|my_center|LOCUS_20190 2095 1739 gene locus_tag LOCUS_20200 2095 1739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20200 2435 3265 gene locus_tag LOCUS_20210 2435 3265 CDS product cytidylate kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942570.1 protein_id gnl|my_center|LOCUS_20210 4133 3270 gene locus_tag LOCUS_20220 4133 3270 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942094.1 protein_id gnl|my_center|LOCUS_20220 4204 4860 gene locus_tag LOCUS_20230 4204 4860 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942096.1 protein_id gnl|my_center|LOCUS_20230 4970 5836 gene locus_tag LOCUS_20240 4970 5836 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942097.1 protein_id gnl|my_center|LOCUS_20240 5913 6449 gene locus_tag LOCUS_20250 gene ruvC 5913 6449 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941736.1 protein_id gnl|my_center|LOCUS_20250 6446 7045 gene locus_tag LOCUS_20260 gene ruvA 6446 7045 CDS product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941737.1 protein_id gnl|my_center|LOCUS_20260 7130 7480 gene locus_tag LOCUS_20270 7130 7480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20270 7747 7580 gene locus_tag LOCUS_20280 7747 7580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20280 8040 7702 gene locus_tag LOCUS_20290 8040 7702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20290 8482 8406 gene locus_tag LOCUS_t00220 8482 8406 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 10482 8590 gene locus_tag LOCUS_20300 gene dxs 10482 8590 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942408.1 protein_id gnl|my_center|LOCUS_20300 11409 10516 gene locus_tag LOCUS_20310 11409 10516 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942409.1 protein_id gnl|my_center|LOCUS_20310 11657 11427 gene locus_tag LOCUS_20320 11657 11427 CDS product exodeoxyribonuclease VII small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942410.1 protein_id gnl|my_center|LOCUS_20320 13129 11780 gene locus_tag LOCUS_20330 gene xseA 13129 11780 CDS product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942411.1 protein_id gnl|my_center|LOCUS_20330 13786 13202 gene locus_tag LOCUS_20340 13786 13202 CDS product LemA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942123.1 protein_id gnl|my_center|LOCUS_20340 14094 13831 gene locus_tag LOCUS_20350 14094 13831 CDS product SemiSWEET transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942122.1 protein_id gnl|my_center|LOCUS_20350 14825 14091 gene locus_tag LOCUS_20360 14825 14091 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942121.1 protein_id gnl|my_center|LOCUS_20360 15457 14822 gene locus_tag LOCUS_20370 15457 14822 CDS product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942120.1 protein_id gnl|my_center|LOCUS_20370 16441 15482 gene locus_tag LOCUS_20380 16441 15482 CDS product PATAN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942118.1 protein_id gnl|my_center|LOCUS_20380 >Feature sequence074 933 124 gene locus_tag LOCUS_20390 gene trpA 933 124 CDS product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943006.1 protein_id gnl|my_center|LOCUS_20390 3095 930 gene locus_tag LOCUS_20400 3095 930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20400 4004 3321 gene locus_tag LOCUS_20410 4004 3321 CDS product transglycosylase SLT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943009.1 protein_id gnl|my_center|LOCUS_20410 4596 4189 gene locus_tag LOCUS_20420 4596 4189 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942284.1 protein_id gnl|my_center|LOCUS_20420 5750 4905 gene locus_tag LOCUS_20430 gene tatC 5750 4905 CDS product twin-arginine translocase subunit TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942132.1 protein_id gnl|my_center|LOCUS_20430 8130 5806 gene locus_tag LOCUS_20440 gene rnr 8130 5806 CDS product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942131.1 protein_id gnl|my_center|LOCUS_20440 8967 8209 gene locus_tag LOCUS_20450 8967 8209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20450 9456 9923 gene locus_tag LOCUS_20460 gene ribE 9456 9923 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942334.1 protein_id gnl|my_center|LOCUS_20460 9923 10357 gene locus_tag LOCUS_20470 gene nusB 9923 10357 CDS product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942335.1 protein_id gnl|my_center|LOCUS_20470 10354 11670 gene locus_tag LOCUS_20480 10354 11670 CDS product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942336.1 protein_id gnl|my_center|LOCUS_20480 11697 13052 gene locus_tag LOCUS_20490 11697 13052 CDS product TrpB-like pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943015.1 protein_id gnl|my_center|LOCUS_20490 13056 13673 gene locus_tag LOCUS_20500 13056 13673 CDS product phosphoribosylanthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943014.1 protein_id gnl|my_center|LOCUS_20500 13670 14860 gene locus_tag LOCUS_20510 gene trpB 13670 14860 CDS product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943010.1 protein_id gnl|my_center|LOCUS_20510 14981 15985 gene locus_tag LOCUS_20520 gene pta 14981 15985 CDS product phosphate acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943344.1 protein_id gnl|my_center|LOCUS_20520 16216 16446 gene locus_tag LOCUS_20530 16216 16446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20530 >Feature sequence075 523 1191 gene locus_tag LOCUS_20540 523 1191 CDS product short-chain-enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048188.1 protein_id gnl|my_center|LOCUS_20540 1193 1720 gene locus_tag LOCUS_20550 gene cobO 1193 1720 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942222.1 protein_id gnl|my_center|LOCUS_20550 1808 2212 gene locus_tag LOCUS_20560 1808 2212 CDS product cobalamin B12-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942223.1 protein_id gnl|my_center|LOCUS_20560 2212 2946 gene locus_tag LOCUS_20570 2212 2946 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816058.1 protein_id gnl|my_center|LOCUS_20570 3312 4544 gene locus_tag LOCUS_20580 gene gdhA 3312 4544 CDS product NADP-specific glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941959.1 protein_id gnl|my_center|LOCUS_20580 4512 4521 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 4922 4773 gene locus_tag LOCUS_20590 4922 4773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20590 5211 6242 gene locus_tag LOCUS_20600 5211 6242 CDS product energy-coupling factor ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941934.1 protein_id gnl|my_center|LOCUS_20600 6329 6404 gene locus_tag LOCUS_t00230 6329 6404 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 6755 7432 gene locus_tag LOCUS_20610 6755 7432 CDS product energy-coupling factor ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_108306299.1 protein_id gnl|my_center|LOCUS_20610 7429 7764 gene locus_tag LOCUS_20620 7429 7764 CDS product energy-coupling factor ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030566.1 protein_id gnl|my_center|LOCUS_20620 7758 8504 gene locus_tag LOCUS_20630 gene cbiQ 7758 8504 CDS product cobalt ECF transporter T component CbiQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392734.1 protein_id gnl|my_center|LOCUS_20630 8501 9358 gene locus_tag LOCUS_20640 8501 9358 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392733.1 protein_id gnl|my_center|LOCUS_20640 9355 10347 gene locus_tag LOCUS_20650 gene rfaD 9355 10347 CDS product ADP-glyceromanno-heptose 6-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546025.1 protein_id gnl|my_center|LOCUS_20650 10483 10695 gene locus_tag LOCUS_20660 10483 10695 CDS product DUF6290 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011171671.1 protein_id gnl|my_center|LOCUS_20660 10712 10951 gene locus_tag LOCUS_20670 10712 10951 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011171672.1 protein_id gnl|my_center|LOCUS_20670 11348 13531 gene locus_tag LOCUS_20680 11348 13531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20680 13799 14140 gene locus_tag LOCUS_20690 13799 14140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20690 14233 15186 gene locus_tag LOCUS_20700 gene meaB 14233 15186 CDS product methylmalonyl Co-A mutase-associated GTPase MeaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942224.1 protein_id gnl|my_center|LOCUS_20700 15293 15853 gene locus_tag LOCUS_20710 15293 15853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20710 >Feature sequence076 634 332 gene locus_tag LOCUS_20720 634 332 CDS product septum formation initiator family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942459.1 protein_id gnl|my_center|LOCUS_20720 1570 635 gene locus_tag LOCUS_20730 1570 635 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942460.1 protein_id gnl|my_center|LOCUS_20730 2930 1572 gene locus_tag LOCUS_20740 2930 1572 CDS product UDP-glucose/GDP-mannose dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942461.1 protein_id gnl|my_center|LOCUS_20740 3843 3004 gene locus_tag LOCUS_20750 gene rsmI 3843 3004 CDS product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941314.1 protein_id gnl|my_center|LOCUS_20750 4469 3840 gene locus_tag LOCUS_20760 4469 3840 CDS product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932936.1 protein_id gnl|my_center|LOCUS_20760 4595 5770 gene locus_tag LOCUS_20770 4595 5770 CDS product class I SAM-dependent rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943264.1 protein_id gnl|my_center|LOCUS_20770 5839 6234 gene locus_tag LOCUS_20780 5839 6234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20780 6276 7220 gene locus_tag LOCUS_20790 6276 7220 CDS product PDDEXK nuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946960.1 protein_id gnl|my_center|LOCUS_20790 7529 7717 gene locus_tag LOCUS_20800 7529 7717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20800 8222 9313 gene locus_tag LOCUS_20810 8222 9313 CDS product DNA cytosine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_090649235.1 protein_id gnl|my_center|LOCUS_20810 9364 12336 gene locus_tag LOCUS_20820 9364 12336 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530591.1 protein_id gnl|my_center|LOCUS_20820 12329 14158 gene locus_tag LOCUS_20830 12329 14158 CDS product response regulator receiver domain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530590.1 protein_id gnl|my_center|LOCUS_20830 14361 14077 gene locus_tag LOCUS_20840 14361 14077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20840 14571 15581 gene locus_tag LOCUS_20850 14571 15581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20850 >Feature sequence077 <1 604 gene locus_tag LOCUS_20860 <1 604 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_027480405.1:Tn3 family transposase 924 790 gene locus_tag LOCUS_20870 924 790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20870 1055 2452 gene locus_tag LOCUS_20880 1055 2452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20880 2486 3748 gene locus_tag LOCUS_20890 2486 3748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20890 3723 5960 gene locus_tag LOCUS_20900 3723 5960 CDS product NHLP family bacteriocin export ABC transporter peptidase/permease/ATPase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814910.1 protein_id gnl|my_center|LOCUS_20900 5988 8690 gene locus_tag LOCUS_20910 5988 8690 CDS product NHLP bacteriocin export ABC transporter permease/ATPase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458930.1 protein_id gnl|my_center|LOCUS_20910 8699 9913 gene locus_tag LOCUS_20920 8699 9913 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272186.1 protein_id gnl|my_center|LOCUS_20920 9979 10896 gene locus_tag LOCUS_20930 9979 10896 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811776.1 protein_id gnl|my_center|LOCUS_20930 10911 11912 gene locus_tag LOCUS_20940 10911 11912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20940 11945 12931 gene locus_tag LOCUS_20950 11945 12931 CDS product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228102.1 protein_id gnl|my_center|LOCUS_20950 13002 13238 gene locus_tag LOCUS_20960 13002 13238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20960 13480 13235 gene locus_tag LOCUS_20970 13480 13235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20970 13816 13499 gene locus_tag LOCUS_20980 13816 13499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20980 14224 13889 gene locus_tag LOCUS_20990 14224 13889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20990 14291 14542 gene locus_tag LOCUS_21000 14291 14542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21000 14801 14562 gene locus_tag LOCUS_21010 14801 14562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21010 15230 14991 gene locus_tag LOCUS_21020 15230 14991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21020 15559 15410 gene locus_tag LOCUS_21030 15559 15410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21030 >Feature sequence078 117 1523 gene locus_tag LOCUS_21040 117 1523 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941505.1 protein_id gnl|my_center|LOCUS_21040 1832 2098 gene locus_tag LOCUS_21050 1832 2098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21050 2129 2587 gene locus_tag LOCUS_21060 2129 2587 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941259.1 protein_id gnl|my_center|LOCUS_21060 2581 2817 gene locus_tag LOCUS_21070 2581 2817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21070 2872 3960 gene locus_tag LOCUS_21080 2872 3960 CDS product cytochrome c3 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941257.1 protein_id gnl|my_center|LOCUS_21080 3965 4630 gene locus_tag LOCUS_21090 3965 4630 CDS product cytochrome b/b6 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941256.1 protein_id gnl|my_center|LOCUS_21090 4645 5175 gene locus_tag LOCUS_21100 4645 5175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21100 5255 5434 gene locus_tag LOCUS_21110 5255 5434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21110 5544 5789 gene locus_tag LOCUS_21120 5544 5789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21120 5838 6101 gene locus_tag LOCUS_21130 5838 6101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21130 6194 6514 gene locus_tag LOCUS_21140 6194 6514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21140 7111 6587 gene locus_tag LOCUS_21150 7111 6587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941253.1 protein_id gnl|my_center|LOCUS_21150 8029 7175 gene locus_tag LOCUS_21160 8029 7175 CDS product HAMP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941254.1 protein_id gnl|my_center|LOCUS_21160 9124 8111 gene locus_tag LOCUS_21170 9124 8111 CDS product cytochrome c3 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941255.1 protein_id gnl|my_center|LOCUS_21170 10539 9184 gene locus_tag LOCUS_21180 gene nrfD 10539 9184 CDS product polysulfide reductase NrfD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937840.1 protein_id gnl|my_center|LOCUS_21180 11450 10536 gene locus_tag LOCUS_21190 11450 10536 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937841.1 protein_id gnl|my_center|LOCUS_21190 12012 11482 gene locus_tag LOCUS_21200 12012 11482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21200 12261 12085 gene locus_tag LOCUS_21210 12261 12085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21210 12684 12304 gene locus_tag LOCUS_21220 12684 12304 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941259.1 protein_id gnl|my_center|LOCUS_21220 13921 13454 gene locus_tag LOCUS_21230 13921 13454 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939932.1 protein_id gnl|my_center|LOCUS_21230 15401 13950 gene locus_tag LOCUS_21240 gene gabD 15401 13950 CDS product NADP-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106269.1 protein_id gnl|my_center|LOCUS_21240 >Feature sequence079 38 2086 gene locus_tag LOCUS_21250 38 2086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21250 2493 2176 gene locus_tag LOCUS_21260 2493 2176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_21260 2602 2441 gene locus_tag LOCUS_21270 2602 2441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21270 2793 2972 gene locus_tag LOCUS_21280 2793 2972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21280 4858 2963 gene locus_tag LOCUS_21290 4858 2963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21290 6011 4878 gene locus_tag LOCUS_21300 6011 4878 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704481.1 protein_id gnl|my_center|LOCUS_21300 6975 6001 gene locus_tag LOCUS_21310 6975 6001 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878621.1 protein_id gnl|my_center|LOCUS_21310 7754 6999 gene locus_tag LOCUS_21320 7754 6999 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331295.1 protein_id gnl|my_center|LOCUS_21320 9237 8113 gene locus_tag LOCUS_21330 9237 8113 CDS product IS110 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970928.1 protein_id gnl|my_center|LOCUS_21330 9477 9298 gene locus_tag LOCUS_21340 9477 9298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21340 10535 9474 gene locus_tag LOCUS_21350 10535 9474 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064241993.1 protein_id gnl|my_center|LOCUS_21350 11770 10799 gene locus_tag LOCUS_21360 11770 10799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21360 12384 12530 gene locus_tag LOCUS_21370 12384 12530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21370 14140 13220 gene locus_tag LOCUS_21380 14140 13220 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868277.1 protein_id gnl|my_center|LOCUS_21380 14919 14419 gene locus_tag LOCUS_21390 14919 14419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21390 15331 15558 gene locus_tag LOCUS_21400 15331 15558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21400 >Feature sequence080 <1 1929 gene locus_tag LOCUS_21410 <1 1929 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010895684.1:formate dehydrogenase-N subunit alpha 1940 2821 gene locus_tag LOCUS_21420 gene fdxH 1940 2821 CDS product formate dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004528944.1 protein_id gnl|my_center|LOCUS_21420 2811 3443 gene locus_tag LOCUS_21430 2811 3443 CDS product formate dehydrogenase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004551972.1 protein_id gnl|my_center|LOCUS_21430 3440 4363 gene locus_tag LOCUS_21440 gene fdhE 3440 4363 CDS product formate dehydrogenase accessory protein FdhE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004551971.1 protein_id gnl|my_center|LOCUS_21440 5242 4376 gene locus_tag LOCUS_21450 5242 4376 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970106.1 protein_id gnl|my_center|LOCUS_21450 6144 5371 gene locus_tag LOCUS_21460 6144 5371 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943067.1 protein_id gnl|my_center|LOCUS_21460 7477 6314 gene locus_tag LOCUS_21470 gene clsB 7477 6314 CDS product cardiolipin synthase ClsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807044.1 protein_id gnl|my_center|LOCUS_21470 8736 7645 gene locus_tag LOCUS_21480 8736 7645 CDS product mechanosensitive ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403653.1 protein_id gnl|my_center|LOCUS_21480 9946 8870 gene locus_tag LOCUS_21490 9946 8870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21490 10329 9964 gene locus_tag LOCUS_21500 10329 9964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21500 10781 10617 gene locus_tag LOCUS_21510 10781 10617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21510 11195 11659 gene locus_tag LOCUS_21520 11195 11659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21520 11671 13083 gene locus_tag LOCUS_21530 11671 13083 CDS product efflux transporter outer membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188537.1 protein_id gnl|my_center|LOCUS_21530 13127 14272 gene locus_tag LOCUS_21540 13127 14272 CDS product HlyD family efflux transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943325.1 protein_id gnl|my_center|LOCUS_21540 >Feature sequence081 317 1495 gene locus_tag LOCUS_21550 317 1495 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943291.1 protein_id gnl|my_center|LOCUS_21550 2302 1499 gene locus_tag LOCUS_21560 gene mutM 2302 1499 CDS product bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941662.1 protein_id gnl|my_center|LOCUS_21560 3580 2324 gene locus_tag LOCUS_21570 3580 2324 CDS product competence/damage-inducible protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940819.1 protein_id gnl|my_center|LOCUS_21570 4758 3577 gene locus_tag LOCUS_21580 gene larC 4758 3577 CDS product nickel pincer cofactor biosynthesis protein LarC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940817.1 protein_id gnl|my_center|LOCUS_21580 5514 4765 gene locus_tag LOCUS_21590 gene larB 5514 4765 CDS product nickel pincer cofactor biosynthesis protein LarB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940816.1 protein_id gnl|my_center|LOCUS_21590 5698 6981 gene locus_tag LOCUS_21600 5698 6981 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942548.1 protein_id gnl|my_center|LOCUS_21600 6997 7524 gene locus_tag LOCUS_21610 6997 7524 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942547.1 protein_id gnl|my_center|LOCUS_21610 8532 7669 gene locus_tag LOCUS_21620 gene mtnP 8532 7669 CDS product S-methyl-5'-thioadenosine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941773.1 protein_id gnl|my_center|LOCUS_21620 10172 8577 gene locus_tag LOCUS_21630 10172 8577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21630 10338 10793 gene locus_tag LOCUS_21640 10338 10793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21640 10852 12375 gene locus_tag LOCUS_21650 10852 12375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21650 12760 13593 gene locus_tag LOCUS_21660 12760 13593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21660 13657 13983 gene locus_tag LOCUS_21670 13657 13983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21670 14183 15097 gene locus_tag LOCUS_21680 14183 15097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21680 >Feature sequence082 264 273 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1233 568 gene locus_tag LOCUS_21690 1233 568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21690 1277 1726 gene locus_tag LOCUS_21700 1277 1726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21700 1959 2567 gene locus_tag LOCUS_21710 1959 2567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21710 3045 3449 gene locus_tag LOCUS_21720 3045 3449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21720 3535 3948 gene locus_tag LOCUS_21730 3535 3948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21730 3860 4744 gene locus_tag LOCUS_21740 3860 4744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21740 4773 4946 gene locus_tag LOCUS_21750 4773 4946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21750 5067 5240 gene locus_tag LOCUS_21760 5067 5240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21760 5263 5859 gene locus_tag LOCUS_21770 5263 5859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_21770 5856 6359 gene locus_tag LOCUS_21780 5856 6359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_21780 6356 6706 gene locus_tag LOCUS_21790 6356 6706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21790 6818 7009 gene locus_tag LOCUS_21800 6818 7009 CDS product twin-arginine translocase TatA/TatE family subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941445.1 protein_id gnl|my_center|LOCUS_21800 7022 8794 gene locus_tag LOCUS_21810 7022 8794 CDS product bifunctional molybdopterin-guanine dinucleotide biosynthesis adaptor protein MobB/molybdopterin molybdotransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074309.1 protein_id gnl|my_center|LOCUS_21810 8785 9765 gene locus_tag LOCUS_21820 gene moaA 8785 9765 CDS product GTP 3',8-cyclase MoaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943768.1 protein_id gnl|my_center|LOCUS_21820 9770 10201 gene locus_tag LOCUS_21830 9770 10201 CDS product MOSC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943767.1 protein_id gnl|my_center|LOCUS_21830 10990 10187 gene locus_tag LOCUS_21840 gene extS 10990 10187 CDS product selenite/tellurite reduction operon c-type cytochrome lipoprotein ExtS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943561.1 protein_id gnl|my_center|LOCUS_21840 11376 10966 gene locus_tag LOCUS_21850 gene extQ 11376 10966 CDS product selenite/tellurite reduction operon b-type cytochrome membrane protein ExtQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235044913.1 protein_id gnl|my_center|LOCUS_21850 11993 11373 gene locus_tag LOCUS_21860 11993 11373 CDS product cytochrome b N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943563.1 protein_id gnl|my_center|LOCUS_21860 12402 12007 gene locus_tag LOCUS_21870 12402 12007 CDS product Rieske 2Fe-2S domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943564.1 protein_id gnl|my_center|LOCUS_21870 13379 12354 gene locus_tag LOCUS_21880 gene extO 13379 12354 CDS product selenite/tellurite reduction operon b-type cytochrome iron-sulfur cluster-binding subunit ExtO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943565.1 protein_id gnl|my_center|LOCUS_21880 13293 13622 gene locus_tag LOCUS_21890 13293 13622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21890 15210 13567 gene locus_tag LOCUS_21900 gene extM 15210 13567 CDS product selenite/tellurite reduction operon c-type cytochrome ExtM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943566.1 protein_id gnl|my_center|LOCUS_21900 >Feature sequence083 404 1171 gene locus_tag LOCUS_21910 404 1171 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038826.1 protein_id gnl|my_center|LOCUS_21910 1194 2090 gene locus_tag LOCUS_21920 1194 2090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21920 2321 3358 gene locus_tag LOCUS_21930 2321 3358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21930 3355 4281 gene locus_tag LOCUS_21940 3355 4281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21940 4475 6241 gene locus_tag LOCUS_21950 4475 6241 CDS product DUF3413 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957366.1 protein_id gnl|my_center|LOCUS_21950 6397 7188 gene locus_tag LOCUS_21960 6397 7188 CDS product diacylglycerol kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941539.1 protein_id gnl|my_center|LOCUS_21960 7298 8011 gene locus_tag LOCUS_21970 7298 8011 CDS product tRNA threonylcarbamoyladenosine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943899.1 protein_id gnl|my_center|LOCUS_21970 8309 9556 gene locus_tag LOCUS_21980 gene rho 8309 9556 CDS product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943729.1 protein_id gnl|my_center|LOCUS_21980 9657 9857 gene locus_tag LOCUS_21990 gene rpmE 9657 9857 CDS product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943728.1 protein_id gnl|my_center|LOCUS_21990 10030 10722 gene locus_tag LOCUS_22000 gene thyX 10030 10722 CDS product FAD-dependent thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943727.1 protein_id gnl|my_center|LOCUS_22000 10785 11678 gene locus_tag LOCUS_22010 10785 11678 CDS product DUF1385 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943726.1 protein_id gnl|my_center|LOCUS_22010 11761 12585 gene locus_tag LOCUS_22020 11761 12585 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941331.1 protein_id gnl|my_center|LOCUS_22020 12637 13401 gene locus_tag LOCUS_22030 12637 13401 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940872.1 protein_id gnl|my_center|LOCUS_22030 13424 14044 gene locus_tag LOCUS_22040 13424 14044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22040 <15413 14141 gene locus_tag LOCUS_22050 <15413 14141 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943878.1:UvrD-helicase domain-containing protein >Feature sequence084 <1 2028 gene locus_tag LOCUS_22060 <1 2028 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942279.1:phosphoribosylformylglycinamidine synthase subunit PurS 2121 3842 gene locus_tag LOCUS_22070 gene recQ 2121 3842 CDS product DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941564.1 protein_id gnl|my_center|LOCUS_22070 3908 4735 gene locus_tag LOCUS_22080 3908 4735 CDS product phosphoribosylformylglycinamidine synthase subunit PurQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942280.1 protein_id gnl|my_center|LOCUS_22080 4762 6189 gene locus_tag LOCUS_22090 gene purF 4762 6189 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942281.1 protein_id gnl|my_center|LOCUS_22090 6182 6733 gene locus_tag LOCUS_22100 gene pyrE 6182 6733 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942282.1 protein_id gnl|my_center|LOCUS_22100 6776 7876 gene locus_tag LOCUS_22110 6776 7876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22110 7904 8428 gene locus_tag LOCUS_22120 7904 8428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22120 9803 8505 gene locus_tag LOCUS_22130 9803 8505 CDS product Nramp family divalent metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966601.1 protein_id gnl|my_center|LOCUS_22130 11078 9816 gene locus_tag LOCUS_22140 11078 9816 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003355958.1 protein_id gnl|my_center|LOCUS_22140 11601 11416 gene locus_tag LOCUS_22150 11601 11416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22150 12093 11848 gene locus_tag LOCUS_22160 12093 11848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22160 13519 12302 gene locus_tag LOCUS_22170 13519 12302 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000772650.1 protein_id gnl|my_center|LOCUS_22170 15177 13702 gene locus_tag LOCUS_22180 gene trpE 15177 13702 CDS product anthranilate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943019.1 protein_id gnl|my_center|LOCUS_22180 >Feature sequence085 <1 1189 gene locus_tag LOCUS_22190 <1 1189 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942557.1:dihydroxy-acid dehydratase 1267 2967 gene locus_tag LOCUS_22200 gene ilvB 1267 2967 CDS product biosynthetic-type acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942556.1 protein_id gnl|my_center|LOCUS_22200 2983 3474 gene locus_tag LOCUS_22210 gene ilvN 2983 3474 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942555.1 protein_id gnl|my_center|LOCUS_22210 3682 4692 gene locus_tag LOCUS_22220 gene ilvC 3682 4692 CDS product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095066.1 protein_id gnl|my_center|LOCUS_22220 4839 5498 gene locus_tag LOCUS_22230 4839 5498 CDS product phosphatidylserine decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942553.1 protein_id gnl|my_center|LOCUS_22230 5512 6315 gene locus_tag LOCUS_22240 gene pssA 5512 6315 CDS product CDP-diacylglycerol--serine O-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942552.1 protein_id gnl|my_center|LOCUS_22240 6782 6312 gene locus_tag LOCUS_22250 6782 6312 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941889.1 protein_id gnl|my_center|LOCUS_22250 6845 7732 gene locus_tag LOCUS_22260 gene sppA 6845 7732 CDS product signal peptide peptidase SppA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941890.1 protein_id gnl|my_center|LOCUS_22260 8816 7764 gene locus_tag LOCUS_22270 8816 7764 CDS product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942928.1 protein_id gnl|my_center|LOCUS_22270 8950 9492 gene locus_tag LOCUS_22280 gene gmhB 8950 9492 CDS product D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942726.1 protein_id gnl|my_center|LOCUS_22280 9569 10471 gene locus_tag LOCUS_22290 gene rfbA 9569 10471 CDS product glucose-1-phosphate thymidylyltransferase RfbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942725.1 protein_id gnl|my_center|LOCUS_22290 10487 11311 gene locus_tag LOCUS_22300 gene mreC 10487 11311 CDS product rod shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942723.1 protein_id gnl|my_center|LOCUS_22300 10652 10661 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 11304 11798 gene locus_tag LOCUS_22310 gene mreD 11304 11798 CDS product rod shape-determining protein MreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942722.1 protein_id gnl|my_center|LOCUS_22310 11795 13729 gene locus_tag LOCUS_22320 gene mrdA 11795 13729 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942721.1 protein_id gnl|my_center|LOCUS_22320 13722 14822 gene locus_tag LOCUS_22330 gene rodA 13722 14822 CDS product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942720.1 protein_id gnl|my_center|LOCUS_22330 >Feature sequence086 899 2854 gene locus_tag LOCUS_22340 899 2854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22340 2851 4332 gene locus_tag LOCUS_22350 2851 4332 CDS product class I SAM-dependent DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022102.1 protein_id gnl|my_center|LOCUS_22350 4367 5023 gene locus_tag LOCUS_22360 4367 5023 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941248.1 protein_id gnl|my_center|LOCUS_22360 5038 6234 gene locus_tag LOCUS_22370 5038 6234 CDS product phospholipase D-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941150.1 protein_id gnl|my_center|LOCUS_22370 6231 7058 gene locus_tag LOCUS_22380 6231 7058 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943898.1 protein_id gnl|my_center|LOCUS_22380 7156 7488 gene locus_tag LOCUS_22390 7156 7488 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943945.1 protein_id gnl|my_center|LOCUS_22390 8202 7495 gene locus_tag LOCUS_22400 8202 7495 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942524.1 protein_id gnl|my_center|LOCUS_22400 9148 8213 gene locus_tag LOCUS_22410 9148 8213 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193360255.1 protein_id gnl|my_center|LOCUS_22410 9310 9795 gene locus_tag LOCUS_22420 9310 9795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941030.1 protein_id gnl|my_center|LOCUS_22420 12329 9828 gene locus_tag LOCUS_22430 12329 9828 CDS product ATP-dependent DNA helicase DinG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941031.1 protein_id gnl|my_center|LOCUS_22430 13261 12398 gene locus_tag LOCUS_22440 13261 12398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22440 13484 13293 gene locus_tag LOCUS_22450 13484 13293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22450 13981 13655 gene locus_tag LOCUS_22460 13981 13655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22460 14046 14492 gene locus_tag LOCUS_22470 14046 14492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22470 14541 14696 gene locus_tag LOCUS_22480 14541 14696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22480 >Feature sequence087 1094 81 gene locus_tag LOCUS_22490 1094 81 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978086.1 protein_id gnl|my_center|LOCUS_22490 1926 1111 gene locus_tag LOCUS_22500 1926 1111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22500 2228 2091 gene locus_tag LOCUS_22510 2228 2091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22510 4640 2322 gene locus_tag LOCUS_22520 4640 2322 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162006391.1 protein_id gnl|my_center|LOCUS_22520 5313 4735 gene locus_tag LOCUS_22530 5313 4735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22530 5625 5449 gene locus_tag LOCUS_22540 5625 5449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22540 7754 5721 gene locus_tag LOCUS_22550 7754 5721 CDS product amylo-alpha-1,6-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_190697803.1 protein_id gnl|my_center|LOCUS_22550 9636 7747 gene locus_tag LOCUS_22560 gene treZ 9636 7747 CDS product malto-oligosyltrehalose trehalohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389950.1 protein_id gnl|my_center|LOCUS_22560 9937 9674 gene locus_tag LOCUS_22570 9937 9674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22570 11113 9974 gene locus_tag LOCUS_22580 11113 9974 CDS product glutathione-independent formaldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405501.1 protein_id gnl|my_center|LOCUS_22580 11719 11141 gene locus_tag LOCUS_22590 11719 11141 CDS product Fe-Mn family superoxide dismutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941819.1 protein_id gnl|my_center|LOCUS_22590 11789 12010 gene locus_tag LOCUS_22600 11789 12010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22600 14468 12354 gene locus_tag LOCUS_22610 14468 12354 CDS product catalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036309.1 protein_id gnl|my_center|LOCUS_22610 >Feature sequence088 671 883 gene locus_tag LOCUS_22620 671 883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22620 985 2133 gene locus_tag LOCUS_22630 985 2133 CDS product DUF3108 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235044902.1 protein_id gnl|my_center|LOCUS_22630 2254 2670 gene locus_tag LOCUS_22640 2254 2670 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941536.1 protein_id gnl|my_center|LOCUS_22640 2811 3764 gene locus_tag LOCUS_22650 2811 3764 CDS product biosynthetic peptidoglycan transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193360258.1 protein_id gnl|my_center|LOCUS_22650 3815 4150 gene locus_tag LOCUS_22660 3815 4150 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393084.1 protein_id gnl|my_center|LOCUS_22660 4137 4547 gene locus_tag LOCUS_22670 4137 4547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22670 4599 5663 gene locus_tag LOCUS_22680 gene rlmN 4599 5663 CDS product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941772.1 protein_id gnl|my_center|LOCUS_22680 7114 5765 gene locus_tag LOCUS_22690 7114 5765 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941159.1 protein_id gnl|my_center|LOCUS_22690 7586 8683 gene locus_tag LOCUS_22700 7586 8683 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941783.1 protein_id gnl|my_center|LOCUS_22700 10145 8703 gene locus_tag LOCUS_22710 gene gnfM 10145 8703 CDS product nitrogen fixation sigma-54 dependent transcriptional regulator GnfM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941668.1 protein_id gnl|my_center|LOCUS_22710 11325 10222 gene locus_tag LOCUS_22720 gene gnfL 11325 10222 CDS product nitrogen fixation sensor histidine kinase GnfL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941669.1 protein_id gnl|my_center|LOCUS_22720 12313 11309 gene locus_tag LOCUS_22730 gene dusB 12313 11309 CDS product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941670.1 protein_id gnl|my_center|LOCUS_22730 12490 12783 gene locus_tag LOCUS_22740 12490 12783 CDS product TatA/E family twin arginine-targeting protein translocase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940700.1 protein_id gnl|my_center|LOCUS_22740 13299 12853 gene locus_tag LOCUS_22750 13299 12853 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941206.1 protein_id gnl|my_center|LOCUS_22750 14115 13366 gene locus_tag LOCUS_22760 gene recO 14115 13366 CDS product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941240.1 protein_id gnl|my_center|LOCUS_22760 14625 14269 gene locus_tag LOCUS_22770 gene nadS 14625 14269 CDS product NadS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000356397.1 protein_id gnl|my_center|LOCUS_22770 14938 14618 gene locus_tag LOCUS_22780 14938 14618 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811545.1 protein_id gnl|my_center|LOCUS_22780 >Feature sequence089 773 129 gene locus_tag LOCUS_22790 773 129 CDS product Eco29kI family restriction endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003689649.1 protein_id gnl|my_center|LOCUS_22790 1942 770 gene locus_tag LOCUS_22800 gene dcm 1942 770 CDS product DNA (cytosine-5-)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003689650.1 protein_id gnl|my_center|LOCUS_22800 2541 2741 gene locus_tag LOCUS_22810 2541 2741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22810 4580 3492 gene locus_tag LOCUS_22820 4580 3492 CDS product DUF3696 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000606740.1 protein_id gnl|my_center|LOCUS_22820 6304 4577 gene locus_tag LOCUS_22830 6304 4577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22830 6693 6316 gene locus_tag LOCUS_22840 6693 6316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22840 6998 7219 gene locus_tag LOCUS_22850 6998 7219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22850 8095 8019 gene locus_tag LOCUS_t00240 8095 8019 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 8706 8191 gene locus_tag LOCUS_22860 8706 8191 CDS product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942173.1 protein_id gnl|my_center|LOCUS_22860 9754 8747 gene locus_tag LOCUS_22870 9754 8747 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942172.1 protein_id gnl|my_center|LOCUS_22870 10434 9751 gene locus_tag LOCUS_22880 10434 9751 CDS product protein-L-isoaspartate(D-aspartate) O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942171.1 protein_id gnl|my_center|LOCUS_22880 11306 10563 gene locus_tag LOCUS_22890 gene surE 11306 10563 CDS product 5'/3'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942170.1 protein_id gnl|my_center|LOCUS_22890 11484 12470 gene locus_tag LOCUS_22900 11484 12470 CDS product NAD(P)H-quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943275.1 protein_id gnl|my_center|LOCUS_22900 12575 13096 gene locus_tag LOCUS_22910 12575 13096 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941558.1 protein_id gnl|my_center|LOCUS_22910 13098 13571 gene locus_tag LOCUS_22920 13098 13571 CDS product ferritin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941052.1 protein_id gnl|my_center|LOCUS_22920 14159 15073 gene locus_tag LOCUS_22930 14159 15073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22930 >Feature sequence090 694 50 gene locus_tag LOCUS_22940 694 50 CDS product metal-dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942031.1 protein_id gnl|my_center|LOCUS_22940 882 694 gene locus_tag LOCUS_22950 882 694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22950 2864 879 gene locus_tag LOCUS_22960 gene feoB 2864 879 CDS product ferrous iron transport protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235045027.1 protein_id gnl|my_center|LOCUS_22960 3379 2948 gene locus_tag LOCUS_22970 3379 2948 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942028.1 protein_id gnl|my_center|LOCUS_22970 4352 3468 gene locus_tag LOCUS_22980 4352 3468 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940889.1 protein_id gnl|my_center|LOCUS_22980 4597 5481 gene locus_tag LOCUS_22990 gene metF 4597 5481 CDS product methylenetetrahydrofolate reductase [NAD(P)H] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938296.1 protein_id gnl|my_center|LOCUS_22990 5793 5458 gene locus_tag LOCUS_23000 5793 5458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23000 7023 5794 gene locus_tag LOCUS_23010 gene rpsA 7023 5794 CDS product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941857.1 protein_id gnl|my_center|LOCUS_23010 7251 9185 gene locus_tag LOCUS_23020 gene htpG 7251 9185 CDS product molecular chaperone HtpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943026.1 protein_id gnl|my_center|LOCUS_23020 10180 9311 gene locus_tag LOCUS_23030 10180 9311 CDS product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529375.1 protein_id gnl|my_center|LOCUS_23030 10391 12442 gene locus_tag LOCUS_23040 10391 12442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23040 14437 12554 gene locus_tag LOCUS_23050 14437 12554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940971.1 protein_id gnl|my_center|LOCUS_23050 >Feature sequence091 361 2130 gene locus_tag LOCUS_23060 361 2130 CDS product M3 family oligoendopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942518.1 protein_id gnl|my_center|LOCUS_23060 2173 2691 gene locus_tag LOCUS_23070 2173 2691 CDS product DUF2721 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941689.1 protein_id gnl|my_center|LOCUS_23070 3906 2713 gene locus_tag LOCUS_23080 3906 2713 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941722.1 protein_id gnl|my_center|LOCUS_23080 3981 4862 gene locus_tag LOCUS_23090 3981 4862 CDS product DUF2156 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941707.1 protein_id gnl|my_center|LOCUS_23090 5160 8249 gene locus_tag LOCUS_23100 5160 8249 CDS product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025455799.1 protein_id gnl|my_center|LOCUS_23100 8243 9868 gene locus_tag LOCUS_23110 8243 9868 CDS product class I SAM-dependent DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003688773.1 protein_id gnl|my_center|LOCUS_23110 9861 11126 gene locus_tag LOCUS_23120 9861 11126 CDS product restriction endonuclease subunit S inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123229.1 protein_id gnl|my_center|LOCUS_23120 11171 12787 gene locus_tag LOCUS_23130 11171 12787 CDS product SIR2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000607108.1 protein_id gnl|my_center|LOCUS_23130 12960 13205 gene locus_tag LOCUS_23140 12960 13205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23140 13317 14243 gene locus_tag LOCUS_23150 13317 14243 CDS product 5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958093.1 protein_id gnl|my_center|LOCUS_23150 >Feature sequence092 281 2578 gene locus_tag LOCUS_23160 281 2578 CDS product PBP1A family penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943755.1 protein_id gnl|my_center|LOCUS_23160 3861 2644 gene locus_tag LOCUS_23170 3861 2644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23170 5749 3950 gene locus_tag LOCUS_23180 5749 3950 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940906.1 protein_id gnl|my_center|LOCUS_23180 6046 7149 gene locus_tag LOCUS_23190 6046 7149 CDS product DUF362 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941750.1 protein_id gnl|my_center|LOCUS_23190 7195 7533 gene locus_tag LOCUS_23200 7195 7533 CDS product zinc ribbon domain-containing protein YjdM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944048.1 protein_id gnl|my_center|LOCUS_23200 7576 8682 gene locus_tag LOCUS_23210 7576 8682 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328620.1 protein_id gnl|my_center|LOCUS_23210 8700 9407 gene locus_tag LOCUS_23220 8700 9407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23220 9459 9896 gene locus_tag LOCUS_23230 gene dtd 9459 9896 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941193.1 protein_id gnl|my_center|LOCUS_23230 9899 10774 gene locus_tag LOCUS_23240 9899 10774 CDS product 1,4-dihydroxy-6-naphthoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941121.1 protein_id gnl|my_center|LOCUS_23240 10767 11297 gene locus_tag LOCUS_23250 10767 11297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23250 12720 11323 gene locus_tag LOCUS_23260 12720 11323 CDS product NADH-quinone oxidoreductase subunit N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944039.1 protein_id gnl|my_center|LOCUS_23260 14024 12717 gene locus_tag LOCUS_23270 14024 12717 CDS product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944040.1 protein_id gnl|my_center|LOCUS_23270 >Feature sequence093 2872 785 gene locus_tag LOCUS_23280 2872 785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23280 4717 2903 gene locus_tag LOCUS_23290 4717 2903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23290 6203 4746 gene locus_tag LOCUS_23300 6203 4746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23300 7693 6236 gene locus_tag LOCUS_23310 7693 6236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23310 8028 7729 gene locus_tag LOCUS_23320 8028 7729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23320 8313 9254 gene locus_tag LOCUS_23330 8313 9254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23330 10633 9275 gene locus_tag LOCUS_23340 10633 9275 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943217.1 protein_id gnl|my_center|LOCUS_23340 13239 10630 gene locus_tag LOCUS_23350 13239 10630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23350 <14107 13239 gene locus_tag LOCUS_23360 <14107 13239 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008765304.1:M3 family metallopeptidase >Feature sequence094 2695 1550 gene locus_tag LOCUS_23370 2695 1550 CDS product L-dopachrome tautomerase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_210042844.1 protein_id gnl|my_center|LOCUS_23370 3969 2704 gene locus_tag LOCUS_23380 3969 2704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23380 5464 4028 gene locus_tag LOCUS_23390 5464 4028 CDS product DegQ family serine endoprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940999.1 protein_id gnl|my_center|LOCUS_23390 6518 5607 gene locus_tag LOCUS_23400 6518 5607 CDS product L,D-transpeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545473.1 protein_id gnl|my_center|LOCUS_23400 6948 6568 gene locus_tag LOCUS_23410 6948 6568 CDS product Lpp/OprI family alanine-zipper lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545357.1 protein_id gnl|my_center|LOCUS_23410 9710 7038 gene locus_tag LOCUS_23420 9710 7038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23420 11243 9849 gene locus_tag LOCUS_23430 11243 9849 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941476.1 protein_id gnl|my_center|LOCUS_23430 12068 11937 gene locus_tag LOCUS_23440 12068 11937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23440 12137 12610 gene locus_tag LOCUS_23450 12137 12610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23450 13340 13513 gene locus_tag LOCUS_23460 13340 13513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23460 13532 13771 gene locus_tag LOCUS_23470 13532 13771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23470 >Feature sequence095 236 1354 gene locus_tag LOCUS_23480 gene lptF 236 1354 CDS product LPS export ABC transporter permease LptF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942567.1 protein_id gnl|my_center|LOCUS_23480 1356 2435 gene locus_tag LOCUS_23490 gene lptG 1356 2435 CDS product LPS export ABC transporter permease LptG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942568.1 protein_id gnl|my_center|LOCUS_23490 2479 3405 gene locus_tag LOCUS_23500 2479 3405 CDS product IPT/TIG domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942569.1 protein_id gnl|my_center|LOCUS_23500 3469 5379 gene locus_tag LOCUS_23510 3469 5379 CDS product LTA synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943579.1 protein_id gnl|my_center|LOCUS_23510 8060 5385 gene locus_tag LOCUS_23520 8060 5385 CDS product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941349.1 protein_id gnl|my_center|LOCUS_23520 8449 10086 gene locus_tag LOCUS_23530 8449 10086 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940844.1 protein_id gnl|my_center|LOCUS_23530 10162 10599 gene locus_tag LOCUS_23540 10162 10599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23540 10659 12293 gene locus_tag LOCUS_23550 10659 12293 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942735.1 protein_id gnl|my_center|LOCUS_23550 12430 12588 gene locus_tag LOCUS_23560 12430 12588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23560 <13997 12659 gene locus_tag LOCUS_23570 <13997 12659 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941190.1:DEAD/DEAH box helicase >Feature sequence096 210 1163 gene locus_tag LOCUS_23580 210 1163 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944004.1 protein_id gnl|my_center|LOCUS_23580 1150 1929 gene locus_tag LOCUS_23590 1150 1929 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944003.1 protein_id gnl|my_center|LOCUS_23590 1916 2620 gene locus_tag LOCUS_23600 1916 2620 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944002.1 protein_id gnl|my_center|LOCUS_23600 2633 3550 gene locus_tag LOCUS_23610 2633 3550 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944001.1 protein_id gnl|my_center|LOCUS_23610 3550 4476 gene locus_tag LOCUS_23620 gene rarD 3550 4476 CDS product EamA family transporter RarD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235044965.1 protein_id gnl|my_center|LOCUS_23620 5202 4486 gene locus_tag LOCUS_23630 5202 4486 CDS product FadR/GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944007.1 protein_id gnl|my_center|LOCUS_23630 5361 8372 gene locus_tag LOCUS_23640 gene pruA 5361 8372 CDS product L-glutamate gamma-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944006.1 protein_id gnl|my_center|LOCUS_23640 9333 8446 gene locus_tag LOCUS_23650 9333 8446 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196382.1 protein_id gnl|my_center|LOCUS_23650 9590 9327 gene locus_tag LOCUS_23660 9590 9327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23660 9760 11214 gene locus_tag LOCUS_23670 9760 11214 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940696.1 protein_id gnl|my_center|LOCUS_23670 11242 11958 gene locus_tag LOCUS_23680 11242 11958 CDS product AzlC family ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941430.1 protein_id gnl|my_center|LOCUS_23680 11955 12278 gene locus_tag LOCUS_23690 11955 12278 CDS product AzlD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941431.1 protein_id gnl|my_center|LOCUS_23690 12378 13760 gene locus_tag LOCUS_23700 gene orpR 12378 13760 CDS product sigma 54-interacting transcriptional regulator OrpR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939383.1 protein_id gnl|my_center|LOCUS_23700 >Feature sequence097 235 414 gene locus_tag LOCUS_23710 235 414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23710 541 1431 gene locus_tag LOCUS_23720 541 1431 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003399742.1 protein_id gnl|my_center|LOCUS_23720 1795 3477 gene locus_tag LOCUS_23730 1795 3477 CDS product AMP-dependent synthetase/ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926994.1 protein_id gnl|my_center|LOCUS_23730 5136 3601 gene locus_tag LOCUS_23740 5136 3601 CDS product B12-binding domain-containing radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940912.1 protein_id gnl|my_center|LOCUS_23740 6615 5452 gene locus_tag LOCUS_23750 6615 5452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23750 8512 6638 gene locus_tag LOCUS_23760 8512 6638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23760 9388 8573 gene locus_tag LOCUS_23770 9388 8573 CDS product bifunctional 3-demethylubiquinone 3-O-methyltransferase/2-octaprenyl-6-hydroxy phenol methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006315751.1 protein_id gnl|my_center|LOCUS_23770 9798 9406 gene locus_tag LOCUS_23780 9798 9406 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023551.1 protein_id gnl|my_center|LOCUS_23780 10789 10965 gene locus_tag LOCUS_23790 10789 10965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23790 11054 11242 gene locus_tag LOCUS_23800 11054 11242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23800 11295 11561 gene locus_tag LOCUS_23810 11295 11561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480397.1 protein_id gnl|my_center|LOCUS_23810 11744 12355 gene locus_tag LOCUS_23820 11744 12355 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_074921927.1 protein_id gnl|my_center|LOCUS_23820 >Feature sequence098 147 1118 gene locus_tag LOCUS_23830 147 1118 CDS product saccharopine dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943175.1 protein_id gnl|my_center|LOCUS_23830 1143 3689 gene locus_tag LOCUS_23840 1143 3689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23840 3690 4598 gene locus_tag LOCUS_23850 3690 4598 CDS product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943987.1 protein_id gnl|my_center|LOCUS_23850 4646 5086 gene locus_tag LOCUS_23860 4646 5086 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389344.1 protein_id gnl|my_center|LOCUS_23860 5095 6249 gene locus_tag LOCUS_23870 gene nspC 5095 6249 CDS product carboxynorspermidine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943174.1 protein_id gnl|my_center|LOCUS_23870 6338 6547 gene locus_tag LOCUS_23880 6338 6547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941200.1 protein_id gnl|my_center|LOCUS_23880 6589 8826 gene locus_tag LOCUS_23890 gene priA 6589 8826 CDS product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940804.1 protein_id gnl|my_center|LOCUS_23890 9302 8925 gene locus_tag LOCUS_23900 9302 8925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23900 9412 10557 gene locus_tag LOCUS_23910 9412 10557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23910 10658 12454 gene locus_tag LOCUS_23920 10658 12454 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940777.1 protein_id gnl|my_center|LOCUS_23920 12535 13305 gene locus_tag LOCUS_23930 gene hypB 12535 13305 CDS product hydrogenase nickel incorporation protein HypB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940974.1 protein_id gnl|my_center|LOCUS_23930 >Feature sequence099 979 530 gene locus_tag LOCUS_23940 gene mlaD 979 530 CDS product outer membrane lipid asymmetry maintenance protein MlaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941481.1 protein_id gnl|my_center|LOCUS_23940 1756 1010 gene locus_tag LOCUS_23950 1756 1010 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941482.1 protein_id gnl|my_center|LOCUS_23950 2519 1758 gene locus_tag LOCUS_23960 2519 1758 CDS product MlaE family lipid ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941483.1 protein_id gnl|my_center|LOCUS_23960 3237 2608 gene locus_tag LOCUS_23970 3237 2608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23970 4749 3310 gene locus_tag LOCUS_23980 gene adeC 4749 3310 CDS product AdeC/AdeK/OprM family multidrug efflux complex outer membrane factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_153304094.1 protein_id gnl|my_center|LOCUS_23980 7921 4751 gene locus_tag LOCUS_23990 7921 4751 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943334.1 protein_id gnl|my_center|LOCUS_23990 9130 7934 gene locus_tag LOCUS_24000 9130 7934 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943335.1 protein_id gnl|my_center|LOCUS_24000 9821 9210 gene locus_tag LOCUS_24010 9821 9210 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943336.1 protein_id gnl|my_center|LOCUS_24010 11069 9924 gene locus_tag LOCUS_24020 gene hpnI 11069 9924 CDS product bacteriohopanetetrol glucosamine biosynthesis glycosyltransferase HpnI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941358.1 protein_id gnl|my_center|LOCUS_24020 11661 11071 gene locus_tag LOCUS_24030 11661 11071 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941350.1 protein_id gnl|my_center|LOCUS_24030 11746 12639 gene locus_tag LOCUS_24040 11746 12639 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943965.1 protein_id gnl|my_center|LOCUS_24040 13227 12652 gene locus_tag LOCUS_24050 gene amrA 13227 12652 CDS product AmmeMemoRadiSam system protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941768.1 protein_id gnl|my_center|LOCUS_24050 >Feature sequence100 76 1986 gene locus_tag LOCUS_24060 76 1986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24060 3899 2622 gene locus_tag LOCUS_24070 3899 2622 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066384.1 protein_id gnl|my_center|LOCUS_24070 4055 4687 gene locus_tag LOCUS_24080 4055 4687 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072260.1 protein_id gnl|my_center|LOCUS_24080 4684 5376 gene locus_tag LOCUS_24090 4684 5376 CDS product DUF2786 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072609.1 protein_id gnl|my_center|LOCUS_24090 5874 6941 gene locus_tag LOCUS_24100 5874 6941 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083692.1 protein_id gnl|my_center|LOCUS_24100 6938 7681 gene locus_tag LOCUS_24110 6938 7681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24110 7826 8041 gene locus_tag LOCUS_24120 7826 8041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24120 8218 8529 gene locus_tag LOCUS_24130 8218 8529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24130 8891 9514 gene locus_tag LOCUS_24140 8891 9514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24140 9624 9761 gene locus_tag LOCUS_24150 9624 9761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24150 9971 10366 gene locus_tag LOCUS_24160 9971 10366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24160 10722 10809 gene locus_tag LOCUS_t00250 10722 10809 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 11004 11576 gene locus_tag LOCUS_24170 11004 11576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24170 11661 12674 gene locus_tag LOCUS_24180 11661 12674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24180 12847 13188 gene locus_tag LOCUS_24190 12847 13188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24190 >Feature sequence101 <1 1240 gene locus_tag LOCUS_24200 <1 1240 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941584.1:methyl-accepting chemotaxis protein 1470 1730 gene locus_tag LOCUS_24210 1470 1730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24210 3420 1831 gene locus_tag LOCUS_24220 3420 1831 CDS product MDR family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942126.1 protein_id gnl|my_center|LOCUS_24220 4691 3420 gene locus_tag LOCUS_24230 4691 3420 CDS product HlyD family secretion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387917.1 protein_id gnl|my_center|LOCUS_24230 6140 4716 gene locus_tag LOCUS_24240 6140 4716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24240 6717 7130 gene locus_tag LOCUS_24250 6717 7130 CDS product bacteriohemerythrin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948264.1 protein_id gnl|my_center|LOCUS_24250 7527 7273 gene locus_tag LOCUS_24260 7527 7273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24260 7707 8483 gene locus_tag LOCUS_24270 7707 8483 CDS product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037393113.1 protein_id gnl|my_center|LOCUS_24270 11272 8507 gene locus_tag LOCUS_24280 gene ppc 11272 8507 CDS product phosphoenolpyruvate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259010.1 protein_id gnl|my_center|LOCUS_24280 11492 12124 gene locus_tag LOCUS_24290 11492 12124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24290 12177 12935 gene locus_tag LOCUS_24300 12177 12935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24300 >Feature sequence102 1238 774 gene locus_tag LOCUS_24310 1238 774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24310 2204 1428 gene locus_tag LOCUS_24320 2204 1428 CDS product molybdopterin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037113771.1 protein_id gnl|my_center|LOCUS_24320 3039 2197 gene locus_tag LOCUS_24330 3039 2197 CDS product cytochrome b/b6 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_126923991.1 protein_id gnl|my_center|LOCUS_24330 3303 3635 gene locus_tag LOCUS_24340 3303 3635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24340 4643 3726 gene locus_tag LOCUS_24350 4643 3726 CDS product cysteine synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943779.1 protein_id gnl|my_center|LOCUS_24350 5210 4869 gene locus_tag LOCUS_24360 5210 4869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24360 6272 5367 gene locus_tag LOCUS_24370 6272 5367 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258386.1 protein_id gnl|my_center|LOCUS_24370 7588 6278 gene locus_tag LOCUS_24380 7588 6278 CDS product Nramp family divalent metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001030679.1 protein_id gnl|my_center|LOCUS_24380 8837 7617 gene locus_tag LOCUS_24390 8837 7617 CDS product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941810.1 protein_id gnl|my_center|LOCUS_24390 9217 8840 gene locus_tag LOCUS_24400 9217 8840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24400 11759 9414 gene locus_tag LOCUS_24410 11759 9414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24410 12443 12276 gene locus_tag LOCUS_24420 12443 12276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24420 >Feature sequence103 1677 268 gene locus_tag LOCUS_24430 1677 268 CDS product efflux transporter outer membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004535038.1 protein_id gnl|my_center|LOCUS_24430 3644 1686 gene locus_tag LOCUS_24440 gene macB 3644 1686 CDS product macrolide ABC transporter ATP-binding protein/permease MacB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004523215.1 protein_id gnl|my_center|LOCUS_24440 4843 3647 gene locus_tag LOCUS_24450 4843 3647 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004551445.1 protein_id gnl|my_center|LOCUS_24450 5031 4843 gene locus_tag LOCUS_24460 5031 4843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24460 5337 6686 gene locus_tag LOCUS_24470 5337 6686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24470 7057 6875 gene locus_tag LOCUS_24480 7057 6875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24480 7324 8229 gene locus_tag LOCUS_24490 7324 8229 CDS product NmrA family NAD(P)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932762.1 protein_id gnl|my_center|LOCUS_24490 8439 9239 gene locus_tag LOCUS_24500 8439 9239 CDS product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943172.1 protein_id gnl|my_center|LOCUS_24500 9262 9816 gene locus_tag LOCUS_24510 9262 9816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24510 9923 10348 gene locus_tag LOCUS_24520 9923 10348 CDS product hotdog fold thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957885.1 protein_id gnl|my_center|LOCUS_24520 10710 11315 gene locus_tag LOCUS_24530 10710 11315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24530 11981 11391 gene locus_tag LOCUS_24540 11981 11391 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940850.1 protein_id gnl|my_center|LOCUS_24540 >Feature sequence104 85 648 gene locus_tag LOCUS_24550 85 648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24550 666 1289 gene locus_tag LOCUS_24560 666 1289 CDS product HEAT repeat domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626352.1 protein_id gnl|my_center|LOCUS_24560 1296 2138 gene locus_tag LOCUS_24570 1296 2138 CDS product protein-glutamate O-methyltransferase CheR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001002908.1 protein_id gnl|my_center|LOCUS_24570 2135 2506 gene locus_tag LOCUS_24580 2135 2506 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000757478.1 protein_id gnl|my_center|LOCUS_24580 2503 5145 gene locus_tag LOCUS_24590 2503 5145 CDS product chemotaxis protein CheA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390080.1 protein_id gnl|my_center|LOCUS_24590 5145 5384 gene locus_tag LOCUS_24600 5145 5384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24600 5493 5867 gene locus_tag LOCUS_24610 5493 5867 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390083.1 protein_id gnl|my_center|LOCUS_24610 5871 7148 gene locus_tag LOCUS_24620 5871 7148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24620 7148 7930 gene locus_tag LOCUS_24630 7148 7930 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390082.1 protein_id gnl|my_center|LOCUS_24630 8064 9170 gene locus_tag LOCUS_24640 8064 9170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_24640 9178 10356 gene locus_tag LOCUS_24650 9178 10356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24650 10405 10812 gene locus_tag LOCUS_24660 10405 10812 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941941.1 protein_id gnl|my_center|LOCUS_24660 10888 12573 gene locus_tag LOCUS_24670 10888 12573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24670 11387 11396 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence105 <1 2959 gene locus_tag LOCUS_24680 <1 2959 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941263.1:alpha-amylase family glycosyl hydrolase 2996 3169 gene locus_tag LOCUS_24690 2996 3169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24690 3172 3801 gene locus_tag LOCUS_24700 3172 3801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24700 4106 4402 gene locus_tag LOCUS_24710 4106 4402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24710 4489 5499 gene locus_tag LOCUS_24720 4489 5499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24720 5600 5803 gene locus_tag LOCUS_24730 5600 5803 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940882.1 protein_id gnl|my_center|LOCUS_24730 5960 7249 gene locus_tag LOCUS_24740 5960 7249 CDS product cyclopropane-fatty-acyl-phospholipid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000229037.1 protein_id gnl|my_center|LOCUS_24740 7236 8372 gene locus_tag LOCUS_24750 7236 8372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24750 8803 8522 gene locus_tag LOCUS_24760 8803 8522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943732.1 protein_id gnl|my_center|LOCUS_24760 9661 9110 gene locus_tag LOCUS_24770 9661 9110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24770 11954 10014 gene locus_tag LOCUS_24780 11954 10014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24780 <12561 11965 gene locus_tag LOCUS_24790 <12561 11965 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941545.1:ABC transporter substrate binding protein >Feature sequence106 <1 940 gene locus_tag LOCUS_24800 <1 940 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942835.1:IMP dehydrogenase 1148 2707 gene locus_tag LOCUS_24810 gene guaA 1148 2707 CDS product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942834.1 protein_id gnl|my_center|LOCUS_24810 2723 4465 gene locus_tag LOCUS_24820 gene cydD 2723 4465 CDS product thiol reductant ABC exporter subunit CydD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941872.1 protein_id gnl|my_center|LOCUS_24820 4513 6114 gene locus_tag LOCUS_24830 gene cydC 4513 6114 CDS product thiol reductant ABC exporter subunit CydC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941873.1 protein_id gnl|my_center|LOCUS_24830 6408 7754 gene locus_tag LOCUS_24840 6408 7754 CDS product cytochrome ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942285.1 protein_id gnl|my_center|LOCUS_24840 7758 8840 gene locus_tag LOCUS_24850 gene cydB 7758 8840 CDS product cytochrome d ubiquinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942286.1 protein_id gnl|my_center|LOCUS_24850 8391 8400 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 9059 9634 gene locus_tag LOCUS_24860 9059 9634 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940933.1 protein_id gnl|my_center|LOCUS_24860 9665 9955 gene locus_tag LOCUS_24870 9665 9955 CDS product putative quinol monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940931.1 protein_id gnl|my_center|LOCUS_24870 10164 10736 gene locus_tag LOCUS_24880 10164 10736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24880 10946 11443 gene locus_tag LOCUS_24890 10946 11443 CDS product chemotaxis protein CheX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942700.1 protein_id gnl|my_center|LOCUS_24890 11448 12113 gene locus_tag LOCUS_24900 11448 12113 CDS product YkgJ family cysteine cluster protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942283.1 protein_id gnl|my_center|LOCUS_24900 >Feature sequence107 1519 2871 gene locus_tag LOCUS_24910 gene radA 1519 2871 CDS product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940957.1 protein_id gnl|my_center|LOCUS_24910 2920 4560 gene locus_tag LOCUS_24920 2920 4560 CDS product fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940904.1 protein_id gnl|my_center|LOCUS_24920 4553 5356 gene locus_tag LOCUS_24930 4553 5356 CDS product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393691.1 protein_id gnl|my_center|LOCUS_24930 5466 6416 gene locus_tag LOCUS_24940 5466 6416 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937909.1 protein_id gnl|my_center|LOCUS_24940 6431 7825 gene locus_tag LOCUS_24950 gene ahcY 6431 7825 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942520.1 protein_id gnl|my_center|LOCUS_24950 8324 8034 gene locus_tag LOCUS_24960 8324 8034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24960 10249 8225 gene locus_tag LOCUS_24970 10249 8225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24970 10767 10249 gene locus_tag LOCUS_24980 10767 10249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24980 10951 12117 gene locus_tag LOCUS_24990 gene metK 10951 12117 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942525.1 protein_id gnl|my_center|LOCUS_24990 >Feature sequence108 <1 1770 gene locus_tag LOCUS_25000 <1 1770 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942922.1:HDIG domain-containing protein 1670 2140 gene locus_tag LOCUS_25010 gene ybeY 1670 2140 CDS product rRNA maturation RNase YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942921.1 protein_id gnl|my_center|LOCUS_25010 2170 2826 gene locus_tag LOCUS_25020 2170 2826 CDS product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_039648148.1 protein_id gnl|my_center|LOCUS_25020 3220 2846 gene locus_tag LOCUS_25030 3220 2846 CDS product glutaredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941816.1 protein_id gnl|my_center|LOCUS_25030 3533 3913 gene locus_tag LOCUS_25040 3533 3913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25040 4102 4467 gene locus_tag LOCUS_25050 4102 4467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25050 6201 4525 gene locus_tag LOCUS_25060 6201 4525 CDS product HAMP domain-containing methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941246.1 protein_id gnl|my_center|LOCUS_25060 6515 7900 gene locus_tag LOCUS_25070 gene asnS 6515 7900 CDS product asparagine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941817.1 protein_id gnl|my_center|LOCUS_25070 7958 8239 gene locus_tag LOCUS_25080 7958 8239 CDS product DUF503 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941818.1 protein_id gnl|my_center|LOCUS_25080 8422 9192 gene locus_tag LOCUS_25090 8422 9192 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014551636.1 protein_id gnl|my_center|LOCUS_25090 9225 10520 gene locus_tag LOCUS_25100 gene purB 9225 10520 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384999.1 protein_id gnl|my_center|LOCUS_25100 10513 11610 gene locus_tag LOCUS_25110 10513 11610 CDS product mechanosensitive ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942278.1 protein_id gnl|my_center|LOCUS_25110 >Feature sequence109 799 239 gene locus_tag LOCUS_25120 799 239 CDS product amino acid-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944067.1 protein_id gnl|my_center|LOCUS_25120 997 3006 gene locus_tag LOCUS_25130 997 3006 CDS product molybdopterin oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941543.1 protein_id gnl|my_center|LOCUS_25130 3976 2993 gene locus_tag LOCUS_25140 3976 2993 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763623.1 protein_id gnl|my_center|LOCUS_25140 4726 4088 gene locus_tag LOCUS_25150 4726 4088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25150 5330 4728 gene locus_tag LOCUS_25160 5330 4728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25160 5685 5945 gene locus_tag LOCUS_25170 5685 5945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25170 6379 6002 gene locus_tag LOCUS_25180 6379 6002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25180 6679 6491 gene locus_tag LOCUS_25190 6679 6491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25190 6969 8159 gene locus_tag LOCUS_25200 6969 8159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25200 8885 8193 gene locus_tag LOCUS_25210 8885 8193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25210 9470 8913 gene locus_tag LOCUS_25220 9470 8913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25220 10006 9470 gene locus_tag LOCUS_25230 10006 9470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25230 <12394 10076 gene locus_tag LOCUS_25240 <12394 10076 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010918008.1:tetratricopeptide repeat protein >Feature sequence110 197 4525 gene locus_tag LOCUS_25250 197 4525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25250 4666 5196 gene locus_tag LOCUS_25260 4666 5196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25260 5193 6068 gene locus_tag LOCUS_25270 5193 6068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25270 6539 6898 gene locus_tag LOCUS_25280 6539 6898 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766756.1 protein_id gnl|my_center|LOCUS_25280 6891 7166 gene locus_tag LOCUS_25290 6891 7166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25290 7842 10373 gene locus_tag LOCUS_25300 gene acnB 7842 10373 CDS product bifunctional aconitate hydratase 2/2-methylisocitrate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942304.1 protein_id gnl|my_center|LOCUS_25300 11129 10470 gene locus_tag LOCUS_25310 11129 10470 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201132289.1 protein_id gnl|my_center|LOCUS_25310 11325 11741 gene locus_tag LOCUS_25320 11325 11741 CDS product glutaredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943438.1 protein_id gnl|my_center|LOCUS_25320 12268 11897 gene locus_tag LOCUS_25330 12268 11897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25330 >Feature sequence111 2478 1405 gene locus_tag LOCUS_25340 2478 1405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941917.1 protein_id gnl|my_center|LOCUS_25340 3203 2475 gene locus_tag LOCUS_25350 3203 2475 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941916.1 protein_id gnl|my_center|LOCUS_25350 4341 3205 gene locus_tag LOCUS_25360 4341 3205 CDS product FtsX-like permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941915.1 protein_id gnl|my_center|LOCUS_25360 4634 4338 gene locus_tag LOCUS_25370 4634 4338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941914.1 protein_id gnl|my_center|LOCUS_25370 5120 4644 gene locus_tag LOCUS_25380 5120 4644 CDS product nitrous oxide reductase accessory protein NosL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941913.1 protein_id gnl|my_center|LOCUS_25380 5638 5135 gene locus_tag LOCUS_25390 5638 5135 CDS product nitrous oxide reductase accessory protein NosL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941938.1 protein_id gnl|my_center|LOCUS_25390 5975 8242 gene locus_tag LOCUS_25400 5975 8242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25400 8239 9561 gene locus_tag LOCUS_25410 8239 9561 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_084725968.1 protein_id gnl|my_center|LOCUS_25410 10069 11514 gene locus_tag LOCUS_25420 10069 11514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25420 >Feature sequence112 2240 633 gene locus_tag LOCUS_25430 2240 633 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390075.1 protein_id gnl|my_center|LOCUS_25430 4178 2256 gene locus_tag LOCUS_25440 4178 2256 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390074.1 protein_id gnl|my_center|LOCUS_25440 4985 4341 gene locus_tag LOCUS_25450 4985 4341 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940928.1 protein_id gnl|my_center|LOCUS_25450 6212 4986 gene locus_tag LOCUS_25460 6212 4986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25460 7018 6464 gene locus_tag LOCUS_25470 7018 6464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25470 7896 7492 gene locus_tag LOCUS_tm00010 7896 7492 tmRNA product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 8601 8101 gene locus_tag LOCUS_25480 gene smpB 8601 8101 CDS product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942353.1 protein_id gnl|my_center|LOCUS_25480 8669 11161 gene locus_tag LOCUS_25490 8669 11161 CDS product glycogen/starch/alpha-glucan phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942708.1 protein_id gnl|my_center|LOCUS_25490 >Feature sequence113 393 965 gene locus_tag LOCUS_25500 393 965 CDS product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943018.1 protein_id gnl|my_center|LOCUS_25500 1082 1375 gene locus_tag LOCUS_25510 1082 1375 CDS product PxxKW family cysteine-rich protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942657.1 protein_id gnl|my_center|LOCUS_25510 1447 1905 gene locus_tag LOCUS_25520 1447 1905 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942658.1 protein_id gnl|my_center|LOCUS_25520 2734 1910 gene locus_tag LOCUS_25530 2734 1910 CDS product menaquinone biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942660.1 protein_id gnl|my_center|LOCUS_25530 4206 2734 gene locus_tag LOCUS_25540 4206 2734 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942254.1 protein_id gnl|my_center|LOCUS_25540 4669 4283 gene locus_tag LOCUS_25550 gene gcvH 4669 4283 CDS product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942661.1 protein_id gnl|my_center|LOCUS_25550 6015 4675 gene locus_tag LOCUS_25560 gene accC 6015 4675 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942662.1 protein_id gnl|my_center|LOCUS_25560 6669 6196 gene locus_tag LOCUS_25570 gene accB 6669 6196 CDS product acetyl-CoA carboxylase biotin carboxyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942663.1 protein_id gnl|my_center|LOCUS_25570 7813 6743 gene locus_tag LOCUS_25580 7813 6743 CDS product Xaa-Pro peptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942664.1 protein_id gnl|my_center|LOCUS_25580 8316 7885 gene locus_tag LOCUS_25590 gene aroQ 8316 7885 CDS product type II 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942665.1 protein_id gnl|my_center|LOCUS_25590 8681 8319 gene locus_tag LOCUS_25600 8681 8319 CDS product GTPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942666.1 protein_id gnl|my_center|LOCUS_25600 9661 8672 gene locus_tag LOCUS_25610 9661 8672 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235044866.1 protein_id gnl|my_center|LOCUS_25610 10743 9664 gene locus_tag LOCUS_25620 gene aroB 10743 9664 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942668.1 protein_id gnl|my_center|LOCUS_25620 11238 10744 gene locus_tag LOCUS_25630 11238 10744 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942669.1 protein_id gnl|my_center|LOCUS_25630 <12027 11252 gene locus_tag LOCUS_25640 <12027 11252 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942670.1:chorismate synthase >Feature sequence114 539 453 gene locus_tag LOCUS_t00260 539 453 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 840 559 gene locus_tag LOCUS_25650 840 559 CDS product integration host factor subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943239.1 protein_id gnl|my_center|LOCUS_25650 2594 864 gene locus_tag LOCUS_25660 2594 864 CDS product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943240.1 protein_id gnl|my_center|LOCUS_25660 3514 2672 gene locus_tag LOCUS_25670 gene ispH 3514 2672 CDS product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943241.1 protein_id gnl|my_center|LOCUS_25670 4212 3511 gene locus_tag LOCUS_25680 gene cmk 4212 3511 CDS product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943242.1 protein_id gnl|my_center|LOCUS_25680 5505 4216 gene locus_tag LOCUS_25690 gene aroA 5505 4216 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943243.1 protein_id gnl|my_center|LOCUS_25690 6384 5527 gene locus_tag LOCUS_25700 6384 5527 CDS product prephenate dehydrogenase/arogenate dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943244.1 protein_id gnl|my_center|LOCUS_25700 7476 6397 gene locus_tag LOCUS_25710 gene pheA 7476 6397 CDS product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943245.1 protein_id gnl|my_center|LOCUS_25710 8228 7674 gene locus_tag LOCUS_25720 8228 7674 CDS product HDIG domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942328.1 protein_id gnl|my_center|LOCUS_25720 8420 8587 gene locus_tag LOCUS_25730 8420 8587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25730 9950 8685 gene locus_tag LOCUS_25740 9950 8685 CDS product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941810.1 protein_id gnl|my_center|LOCUS_25740 10163 11170 gene locus_tag LOCUS_25750 10163 11170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941103.1 protein_id gnl|my_center|LOCUS_25750 >Feature sequence115 387 761 gene locus_tag LOCUS_25760 387 761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943064.1 protein_id gnl|my_center|LOCUS_25760 773 1552 gene locus_tag LOCUS_25770 773 1552 CDS product DUF3108 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941333.1 protein_id gnl|my_center|LOCUS_25770 2001 1675 gene locus_tag LOCUS_25780 2001 1675 CDS product YajD family HNH nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941868.1 protein_id gnl|my_center|LOCUS_25780 2845 2057 gene locus_tag LOCUS_25790 2845 2057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25790 3619 3077 gene locus_tag LOCUS_25800 3619 3077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25800 4657 4055 gene locus_tag LOCUS_25810 gene cobC 4657 4055 CDS product alpha-ribazole phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041914029.1 protein_id gnl|my_center|LOCUS_25810 5443 4697 gene locus_tag LOCUS_25820 gene cobS 5443 4697 CDS product adenosylcobinamide-GDP ribazoletransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943638.1 protein_id gnl|my_center|LOCUS_25820 6959 5649 gene locus_tag LOCUS_25830 gene thiC 6959 5649 CDS product phosphomethylpyrimidine synthase ThiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943635.1 protein_id gnl|my_center|LOCUS_25830 8121 7069 gene locus_tag LOCUS_25840 gene cobT 8121 7069 CDS product nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943639.1 protein_id gnl|my_center|LOCUS_25840 8674 8141 gene locus_tag LOCUS_25850 gene cobU 8674 8141 CDS product bifunctional adenosylcobinamide kinase/adenosylcobinamide-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943640.1 protein_id gnl|my_center|LOCUS_25850 9434 9129 gene locus_tag LOCUS_25860 9434 9129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25860 9851 9603 gene locus_tag LOCUS_25870 9851 9603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25870 10558 10971 gene locus_tag LOCUS_25880 10558 10971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25880 >Feature sequence116 3841 1178 gene locus_tag LOCUS_25890 3841 1178 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267002.1 protein_id gnl|my_center|LOCUS_25890 9901 3962 gene locus_tag LOCUS_25900 9901 3962 CDS product DUF4011 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_150670707.1 protein_id gnl|my_center|LOCUS_25900 10366 9989 gene locus_tag LOCUS_25910 10366 9989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25910 11068 10601 gene locus_tag LOCUS_25920 gene tnpA 11068 10601 CDS product IS200/IS605 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120397.1 protein_id gnl|my_center|LOCUS_25920 >Feature sequence117 957 691 gene locus_tag LOCUS_25930 gene hupB 957 691 CDS product DNA-binding protein HU-beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087931.1 protein_id gnl|my_center|LOCUS_25930 1204 2412 gene locus_tag LOCUS_25940 1204 2412 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235044964.1 protein_id gnl|my_center|LOCUS_25940 2888 2502 gene locus_tag LOCUS_25950 2888 2502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25950 3080 2937 gene locus_tag LOCUS_25960 3080 2937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25960 3677 3279 gene locus_tag LOCUS_25970 3677 3279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25970 3810 3658 gene locus_tag LOCUS_25980 3810 3658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25980 3962 4453 gene locus_tag LOCUS_25990 3962 4453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25990 4501 5082 gene locus_tag LOCUS_26000 4501 5082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26000 5610 5140 gene locus_tag LOCUS_26010 5610 5140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26010 5948 5613 gene locus_tag LOCUS_26020 5948 5613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26020 6703 6452 gene locus_tag LOCUS_26030 6703 6452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26030 6771 6992 gene locus_tag LOCUS_26040 6771 6992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26040 7072 8643 gene locus_tag LOCUS_26050 7072 8643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26050 9615 8650 gene locus_tag LOCUS_26060 gene dinB 9615 8650 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940720.1 protein_id gnl|my_center|LOCUS_26060 9643 9819 gene locus_tag LOCUS_26070 9643 9819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26070 9920 10207 gene locus_tag LOCUS_26080 9920 10207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26080 >Feature sequence118 2179 992 gene locus_tag LOCUS_26090 2179 992 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944012.1 protein_id gnl|my_center|LOCUS_26090 2489 2208 gene locus_tag LOCUS_26100 2489 2208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943917.1 protein_id gnl|my_center|LOCUS_26100 3993 2566 gene locus_tag LOCUS_26110 3993 2566 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944014.1 protein_id gnl|my_center|LOCUS_26110 4797 4054 gene locus_tag LOCUS_26120 4797 4054 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_165443456.1 protein_id gnl|my_center|LOCUS_26120 5572 4784 gene locus_tag LOCUS_26130 5572 4784 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944016.1 protein_id gnl|my_center|LOCUS_26130 6360 5617 gene locus_tag LOCUS_26140 6360 5617 CDS product basic amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944017.1 protein_id gnl|my_center|LOCUS_26140 6565 7455 gene locus_tag LOCUS_26150 6565 7455 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944018.1 protein_id gnl|my_center|LOCUS_26150 7858 8229 gene locus_tag LOCUS_26160 gene rpsL 7858 8229 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943491.1 protein_id gnl|my_center|LOCUS_26160 8260 8730 gene locus_tag LOCUS_26170 gene rpsG 8260 8730 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943490.1 protein_id gnl|my_center|LOCUS_26170 8759 10840 gene locus_tag LOCUS_26180 gene fusA 8759 10840 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943489.1 protein_id gnl|my_center|LOCUS_26180 >Feature sequence119 321 1580 gene locus_tag LOCUS_26190 321 1580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26190 2455 1577 gene locus_tag LOCUS_26200 2455 1577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941721.1 protein_id gnl|my_center|LOCUS_26200 2853 5018 gene locus_tag LOCUS_26210 2853 5018 CDS product Tex family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940909.1 protein_id gnl|my_center|LOCUS_26210 5770 5063 gene locus_tag LOCUS_26220 5770 5063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529371.1 protein_id gnl|my_center|LOCUS_26220 6294 5812 gene locus_tag LOCUS_26230 6294 5812 CDS product GreA/GreB family elongation factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940845.1 protein_id gnl|my_center|LOCUS_26230 6565 6287 gene locus_tag LOCUS_26240 6565 6287 CDS product GIY-YIG nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404971.1 protein_id gnl|my_center|LOCUS_26240 7997 6591 gene locus_tag LOCUS_26250 gene merA 7997 6591 CDS product mercury(II) reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944034.1 protein_id gnl|my_center|LOCUS_26250 8454 8092 gene locus_tag LOCUS_26260 8454 8092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941583.1 protein_id gnl|my_center|LOCUS_26260 9526 8546 gene locus_tag LOCUS_26270 9526 8546 CDS product DUF1848 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814288.1 protein_id gnl|my_center|LOCUS_26270 10264 9551 gene locus_tag LOCUS_26280 10264 9551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26280 >Feature sequence120 <1 1071 gene locus_tag LOCUS_26290 <1 1071 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941147.1:aspartate ammonia-lyase 1111 1332 gene locus_tag LOCUS_26300 1111 1332 CDS product NifU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941148.1 protein_id gnl|my_center|LOCUS_26300 1412 1630 gene locus_tag LOCUS_26310 1412 1630 CDS product DUF1653 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229500.1 protein_id gnl|my_center|LOCUS_26310 1675 2847 gene locus_tag LOCUS_26320 1675 2847 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957791.1 protein_id gnl|my_center|LOCUS_26320 2976 4868 gene locus_tag LOCUS_26330 2976 4868 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941581.1 protein_id gnl|my_center|LOCUS_26330 7023 4873 gene locus_tag LOCUS_26340 7023 4873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26340 8613 7048 gene locus_tag LOCUS_26350 8613 7048 CDS product glycerol-3-phosphate dehydrogenase/oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943389.1 protein_id gnl|my_center|LOCUS_26350 9392 8610 gene locus_tag LOCUS_26360 9392 8610 CDS product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119041.1 protein_id gnl|my_center|LOCUS_26360 9779 10336 gene locus_tag LOCUS_26370 9779 10336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941903.1 protein_id gnl|my_center|LOCUS_26370 >Feature sequence121 1216 53 gene locus_tag LOCUS_26380 1216 53 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26380 2584 1415 gene locus_tag LOCUS_26390 2584 1415 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462207.1 protein_id gnl|my_center|LOCUS_26390 3212 2607 gene locus_tag LOCUS_26400 3212 2607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26400 4013 3312 gene locus_tag LOCUS_26410 4013 3312 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011787336.1 protein_id gnl|my_center|LOCUS_26410 5344 4037 gene locus_tag LOCUS_26420 5344 4037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26420 6320 5445 gene locus_tag LOCUS_26430 6320 5445 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142186.1 protein_id gnl|my_center|LOCUS_26430 6669 6436 gene locus_tag LOCUS_26440 6669 6436 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009291951.1 protein_id gnl|my_center|LOCUS_26440 8300 6672 gene locus_tag LOCUS_26450 gene acsA 8300 6672 CDS product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000862095.1 protein_id gnl|my_center|LOCUS_26450 8947 8300 gene locus_tag LOCUS_26460 8947 8300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26460 9872 8937 gene locus_tag LOCUS_26470 gene xrtA 9872 8937 CDS product exosortase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942623.1 protein_id gnl|my_center|LOCUS_26470 >Feature sequence122 117 644 gene locus_tag LOCUS_26480 117 644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_26480 644 1102 gene locus_tag LOCUS_26490 644 1102 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941140.1 protein_id gnl|my_center|LOCUS_26490 1137 2099 gene locus_tag LOCUS_26500 gene pfkA 1137 2099 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942710.1 protein_id gnl|my_center|LOCUS_26500 2221 2568 gene locus_tag LOCUS_26510 2221 2568 CDS product phage holin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887808.1 protein_id gnl|my_center|LOCUS_26510 2623 4011 gene locus_tag LOCUS_26520 gene tilS 2623 4011 CDS product tRNA lysidine(34) synthetase TilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942455.1 protein_id gnl|my_center|LOCUS_26520 4287 4090 gene locus_tag LOCUS_26530 4287 4090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26530 5019 7046 gene locus_tag LOCUS_26540 5019 7046 CDS product PBP1A family penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942207.1 protein_id gnl|my_center|LOCUS_26540 7203 8948 gene locus_tag LOCUS_26550 7203 8948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26550 9097 9636 gene locus_tag LOCUS_26560 9097 9636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26560 10380 9667 gene locus_tag LOCUS_26570 10380 9667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26570 >Feature sequence123 1195 1204 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2250 1342 gene locus_tag LOCUS_26580 2250 1342 CDS product DnaJ C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940692.1 protein_id gnl|my_center|LOCUS_26580 2397 3812 gene locus_tag LOCUS_26590 gene hemG 2397 3812 CDS product protoporphyrinogen oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940690.1 protein_id gnl|my_center|LOCUS_26590 3814 3996 gene locus_tag LOCUS_26600 3814 3996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26600 4718 4029 gene locus_tag LOCUS_26610 gene radC 4718 4029 CDS product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941054.1 protein_id gnl|my_center|LOCUS_26610 5548 4727 gene locus_tag LOCUS_26620 5548 4727 CDS product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941055.1 protein_id gnl|my_center|LOCUS_26620 5722 6342 gene locus_tag LOCUS_26630 5722 6342 CDS product DUF47 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941056.1 protein_id gnl|my_center|LOCUS_26630 6335 7336 gene locus_tag LOCUS_26640 6335 7336 CDS product inorganic phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941057.1 protein_id gnl|my_center|LOCUS_26640 7381 8430 gene locus_tag LOCUS_26650 gene gmd 7381 8430 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941289.1 protein_id gnl|my_center|LOCUS_26650 >Feature sequence124 2061 154 gene locus_tag LOCUS_26660 gene speA 2061 154 CDS product arginine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943173.1 protein_id gnl|my_center|LOCUS_26660 2358 2786 gene locus_tag LOCUS_26670 2358 2786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26670 2788 5226 gene locus_tag LOCUS_26680 gene lon 2788 5226 CDS product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943811.1 protein_id gnl|my_center|LOCUS_26680 5297 6571 gene locus_tag LOCUS_26690 5297 6571 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942352.1 protein_id gnl|my_center|LOCUS_26690 7220 6735 gene locus_tag LOCUS_26700 gene lspA 7220 6735 CDS product signal peptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943757.1 protein_id gnl|my_center|LOCUS_26700 10080 7306 gene locus_tag LOCUS_26710 gene ileS 10080 7306 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943758.1 protein_id gnl|my_center|LOCUS_26710 >Feature sequence125 2724 724 gene locus_tag LOCUS_26720 2724 724 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942130.1 protein_id gnl|my_center|LOCUS_26720 2753 2989 gene locus_tag LOCUS_26730 2753 2989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26730 3216 2956 gene locus_tag LOCUS_26740 3216 2956 CDS product DUF507 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943949.1 protein_id gnl|my_center|LOCUS_26740 3513 3226 gene locus_tag LOCUS_26750 3513 3226 CDS product DUF507 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943948.1 protein_id gnl|my_center|LOCUS_26750 3674 4354 gene locus_tag LOCUS_26760 gene queC 3674 4354 CDS product 7-cyano-7-deazaguanine synthase QueC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941151.1 protein_id gnl|my_center|LOCUS_26760 4485 4739 gene locus_tag LOCUS_26770 4485 4739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26770 5098 5364 gene locus_tag LOCUS_26780 5098 5364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26780 5528 5893 gene locus_tag LOCUS_26790 5528 5893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26790 6036 7094 gene locus_tag LOCUS_26800 6036 7094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943970.1 protein_id gnl|my_center|LOCUS_26800 7091 8263 gene locus_tag LOCUS_26810 7091 8263 CDS product VWA-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941022.1 protein_id gnl|my_center|LOCUS_26810 8265 8669 gene locus_tag LOCUS_26820 8265 8669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941023.1 protein_id gnl|my_center|LOCUS_26820 9522 8689 gene locus_tag LOCUS_26830 9522 8689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26830 9692 10066 gene locus_tag LOCUS_26840 9692 10066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943106.1 protein_id gnl|my_center|LOCUS_26840 >Feature sequence126 <1 1101 gene locus_tag LOCUS_26850 <1 1101 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010940787.1:F0F1 ATP synthase subunit alpha 1120 1986 gene locus_tag LOCUS_26860 gene atpG 1120 1986 CDS product ATP synthase F1 subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940788.1 protein_id gnl|my_center|LOCUS_26860 2096 3511 gene locus_tag LOCUS_26870 gene atpD 2096 3511 CDS product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940789.1 protein_id gnl|my_center|LOCUS_26870 3565 3981 gene locus_tag LOCUS_26880 3565 3981 CDS product F0F1 ATP synthase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940790.1 protein_id gnl|my_center|LOCUS_26880 4660 5334 gene locus_tag LOCUS_26890 4660 5334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26890 5670 6575 gene locus_tag LOCUS_26900 5670 6575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_26900 6712 8910 gene locus_tag LOCUS_26910 6712 8910 CDS product adenylate/guanylate cyclase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444419.1 protein_id gnl|my_center|LOCUS_26910 >Feature sequence127 319 1659 gene locus_tag LOCUS_26920 319 1659 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235044950.1 protein_id gnl|my_center|LOCUS_26920 1656 2771 gene locus_tag LOCUS_26930 1656 2771 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941060.1 protein_id gnl|my_center|LOCUS_26930 2775 5990 gene locus_tag LOCUS_26940 2775 5990 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941062.1 protein_id gnl|my_center|LOCUS_26940 6002 6427 gene locus_tag LOCUS_26950 6002 6427 CDS product C-GCAxxG-C-C family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941063.1 protein_id gnl|my_center|LOCUS_26950 6462 6686 gene locus_tag LOCUS_26960 6462 6686 CDS product DUF2892 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941064.1 protein_id gnl|my_center|LOCUS_26960 6683 7516 gene locus_tag LOCUS_26970 6683 7516 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941065.1 protein_id gnl|my_center|LOCUS_26970 7907 9475 gene locus_tag LOCUS_26980 7907 9475 CDS product DUF3373 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942839.1 protein_id gnl|my_center|LOCUS_26980 9596 9919 gene locus_tag LOCUS_26990 9596 9919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942840.1 protein_id gnl|my_center|LOCUS_26990 >Feature sequence128 774 160 gene locus_tag LOCUS_27000 gene yedF 774 160 CDS product sulfurtransferase-like selenium metabolism protein YedF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938959.1 protein_id gnl|my_center|LOCUS_27000 1627 794 gene locus_tag LOCUS_27010 gene selD 1627 794 CDS product selenide, water dikinase SelD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_196768338.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_27010 1840 1649 gene locus_tag LOCUS_27020 1840 1649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_27020 2144 4651 gene locus_tag LOCUS_27030 2144 4651 CDS product glycogen/starch/alpha-glucan phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_022951227.1 protein_id gnl|my_center|LOCUS_27030 4694 7342 gene locus_tag LOCUS_27040 4694 7342 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942226.1 protein_id gnl|my_center|LOCUS_27040 7449 7841 gene locus_tag LOCUS_27050 7449 7841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27050 7842 8273 gene locus_tag LOCUS_27060 7842 8273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27060 8390 9217 gene locus_tag LOCUS_27070 gene gluQRS 8390 9217 CDS product tRNA glutamyl-Q(34) synthetase GluQRS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941983.1 protein_id gnl|my_center|LOCUS_27070 9449 9297 gene locus_tag LOCUS_27080 9449 9297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27080 >Feature sequence129 1397 480 gene locus_tag LOCUS_27090 1397 480 CDS product TerC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941519.1 protein_id gnl|my_center|LOCUS_27090 1735 1523 gene locus_tag LOCUS_27100 1735 1523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27100 2251 2045 gene locus_tag LOCUS_27110 2251 2045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27110 3167 2301 gene locus_tag LOCUS_27120 gene htpX 3167 2301 CDS product zinc metalloprotease HtpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942212.1 protein_id gnl|my_center|LOCUS_27120 4023 5321 gene locus_tag LOCUS_27130 4023 5321 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942782.1 protein_id gnl|my_center|LOCUS_27130 5318 6550 gene locus_tag LOCUS_27140 5318 6550 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942781.1 protein_id gnl|my_center|LOCUS_27140 6639 9701 gene locus_tag LOCUS_27150 6639 9701 CDS product CusA/CzcA family heavy metal efflux RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941497.1 protein_id gnl|my_center|LOCUS_27150 9749 10072 gene locus_tag LOCUS_27160 9749 10072 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942779.1 protein_id gnl|my_center|LOCUS_27160 >Feature sequence130 224 69 gene locus_tag LOCUS_27170 224 69 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27170 644 826 gene locus_tag LOCUS_27180 644 826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27180 1363 1551 gene locus_tag LOCUS_27190 1363 1551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27190 1759 3351 gene locus_tag LOCUS_27200 gene pckA 1759 3351 CDS product phosphoenolpyruvate carboxykinase (ATP) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393393.1 protein_id gnl|my_center|LOCUS_27200 3398 5014 gene locus_tag LOCUS_27210 3398 5014 CDS product NADP-dependent glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941484.1 protein_id gnl|my_center|LOCUS_27210 5049 5357 gene locus_tag LOCUS_27220 5049 5357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27220 5574 6317 gene locus_tag LOCUS_27230 5574 6317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27230 7585 6776 gene locus_tag LOCUS_27240 7585 6776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_27240 8010 7717 gene locus_tag LOCUS_27250 8010 7717 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018210984.1 protein_id gnl|my_center|LOCUS_27250 8926 9747 gene locus_tag LOCUS_27260 8926 9747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27260 10004 9846 gene locus_tag LOCUS_27270 10004 9846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27270 >Feature sequence131 1170 112 gene locus_tag LOCUS_27280 1170 112 CDS product NAD(P)-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943746.1 protein_id gnl|my_center|LOCUS_27280 2242 1238 gene locus_tag LOCUS_27290 2242 1238 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943747.1 protein_id gnl|my_center|LOCUS_27290 3578 2547 gene locus_tag LOCUS_27300 3578 2547 CDS product L,D-transpeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940856.1 protein_id gnl|my_center|LOCUS_27300 4038 3715 gene locus_tag LOCUS_27310 4038 3715 CDS product Lpp/OprI family alanine-zipper lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940857.1 protein_id gnl|my_center|LOCUS_27310 5372 4035 gene locus_tag LOCUS_27320 5372 4035 CDS product L,D-transpeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940858.1 protein_id gnl|my_center|LOCUS_27320 5902 6363 gene locus_tag LOCUS_27330 5902 6363 CDS product SseB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941491.1 protein_id gnl|my_center|LOCUS_27330 7126 6491 gene locus_tag LOCUS_27340 7126 6491 CDS product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940854.1 protein_id gnl|my_center|LOCUS_27340 7345 7530 gene locus_tag LOCUS_27350 7345 7530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27350 7815 7540 gene locus_tag LOCUS_27360 7815 7540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27360 8091 7906 gene locus_tag LOCUS_27370 8091 7906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27370 9107 8148 gene locus_tag LOCUS_27380 9107 8148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27380 9385 9110 gene locus_tag LOCUS_27390 9385 9110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27390 9657 9388 gene locus_tag LOCUS_27400 9657 9388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27400 >Feature sequence132 2475 106 gene locus_tag LOCUS_27410 2475 106 CDS product U32 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943959.1 protein_id gnl|my_center|LOCUS_27410 3669 2569 gene locus_tag LOCUS_27420 gene asd 3669 2569 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943507.1 protein_id gnl|my_center|LOCUS_27420 4789 3701 gene locus_tag LOCUS_27430 gene leuB 4789 3701 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943508.1 protein_id gnl|my_center|LOCUS_27430 4956 6320 gene locus_tag LOCUS_27440 4956 6320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943886.1 protein_id gnl|my_center|LOCUS_27440 7696 6383 gene locus_tag LOCUS_27450 7696 6383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27450 8133 7933 gene locus_tag LOCUS_27460 8133 7933 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940882.1 protein_id gnl|my_center|LOCUS_27460 8915 8325 gene locus_tag LOCUS_27470 8915 8325 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941479.1 protein_id gnl|my_center|LOCUS_27470 <9839 8931 gene locus_tag LOCUS_27480 <9839 8931 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941480.1:TolC family protein >Feature sequence133 484 1272 gene locus_tag LOCUS_27490 484 1272 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545061.1 protein_id gnl|my_center|LOCUS_27490 1280 1936 gene locus_tag LOCUS_27500 1280 1936 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546346.1 protein_id gnl|my_center|LOCUS_27500 1933 2907 gene locus_tag LOCUS_27510 1933 2907 CDS product MlaD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546869.1 protein_id gnl|my_center|LOCUS_27510 2891 3841 gene locus_tag LOCUS_27520 2891 3841 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545926.1 protein_id gnl|my_center|LOCUS_27520 4037 6385 gene locus_tag LOCUS_27530 gene ptsP 4037 6385 CDS product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941826.1 protein_id gnl|my_center|LOCUS_27530 6477 7616 gene locus_tag LOCUS_27540 gene alr 6477 7616 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941268.1 protein_id gnl|my_center|LOCUS_27540 7642 8877 gene locus_tag LOCUS_27550 7642 8877 CDS product ASKHA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941270.1 protein_id gnl|my_center|LOCUS_27550 >Feature sequence134 1977 490 gene locus_tag LOCUS_27560 gene glpK 1977 490 CDS product glycerol kinase GlpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943390.1 protein_id gnl|my_center|LOCUS_27560 2477 2552 gene locus_tag LOCUS_t00270 2477 2552 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 2891 5758 gene locus_tag LOCUS_27570 2891 5758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27570 6052 6294 gene locus_tag LOCUS_27580 6052 6294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27580 7945 6947 gene locus_tag LOCUS_27590 7945 6947 CDS product ADP-ribosylglycohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940539.1 protein_id gnl|my_center|LOCUS_27590 8752 8027 gene locus_tag LOCUS_27600 8752 8027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27600 8861 9073 gene locus_tag LOCUS_27610 8861 9073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27610 9185 9781 gene locus_tag LOCUS_27620 9185 9781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27620 >Feature sequence135 705 1625 gene locus_tag LOCUS_27630 705 1625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27630 2751 1684 gene locus_tag LOCUS_27640 2751 1684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27640 3128 3343 gene locus_tag LOCUS_27650 3128 3343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27650 3321 3761 gene locus_tag LOCUS_27660 3321 3761 CDS product PIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680499.1 protein_id gnl|my_center|LOCUS_27660 4026 3781 gene locus_tag LOCUS_27670 4026 3781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27670 5213 4257 gene locus_tag LOCUS_27680 5213 4257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27680 5431 5213 gene locus_tag LOCUS_27690 5431 5213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27690 6109 6435 gene locus_tag LOCUS_27700 6109 6435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27700 7031 6432 gene locus_tag LOCUS_27710 7031 6432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27710 7642 7292 gene locus_tag LOCUS_27720 7642 7292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27720 8284 8487 gene locus_tag LOCUS_27730 8284 8487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27730 8508 8747 gene locus_tag LOCUS_27740 8508 8747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27740 8744 9712 gene locus_tag LOCUS_27750 8744 9712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27750 >Feature sequence136 1149 2111 gene locus_tag LOCUS_27760 1149 2111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27760 2089 5406 gene locus_tag LOCUS_27770 2089 5406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27770 5749 5576 gene locus_tag LOCUS_27780 5749 5576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27780 5963 5781 gene locus_tag LOCUS_27790 5963 5781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27790 6156 8162 gene locus_tag LOCUS_27800 6156 8162 CDS product UvrD-helicase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941556.1 protein_id gnl|my_center|LOCUS_27800 8222 8713 gene locus_tag LOCUS_27810 8222 8713 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029306122.1 protein_id gnl|my_center|LOCUS_27810 >Feature sequence137 404 1381 gene locus_tag LOCUS_27820 gene cas1f 404 1381 CDS product type I-F CRISPR-associated endonuclease Cas1f inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210191.1 protein_id gnl|my_center|LOCUS_27820 1378 4647 gene locus_tag LOCUS_27830 gene cas3f 1378 4647 CDS product type I-F CRISPR-associated helicase Cas3f inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002221142.1 protein_id gnl|my_center|LOCUS_27830 4771 5211 gene locus_tag LOCUS_27840 4771 5211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27840 5230 5391 gene locus_tag LOCUS_27850 5230 5391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27850 5570 6871 gene locus_tag LOCUS_27860 gene csy1 5570 6871 CDS product type I-F CRISPR-associated protein Csy1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222491.1 protein_id gnl|my_center|LOCUS_27860 6871 7842 gene locus_tag LOCUS_27870 gene csy2 6871 7842 CDS product type I-F CRISPR-associated protein Csy2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211868.1 protein_id gnl|my_center|LOCUS_27870 7884 8903 gene locus_tag LOCUS_27880 gene csy3 7884 8903 CDS product type I-F CRISPR-associated protein Csy3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211867.1 protein_id gnl|my_center|LOCUS_27880 8913 9467 gene locus_tag LOCUS_27890 gene cas6f 8913 9467 CDS product type I-F CRISPR-associated endoribonuclease Cas6/Csy4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211866.1 protein_id gnl|my_center|LOCUS_27890 >Feature sequence138 2390 1089 gene locus_tag LOCUS_27900 gene odhB 2390 1089 CDS product 2-oxoglutarate dehydrogenase complex dihydrolipoyllysine-residue succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943087.1 protein_id gnl|my_center|LOCUS_27900 3709 2534 gene locus_tag LOCUS_27910 gene nifS 3709 2534 CDS product cysteine desulfurase NifS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942654.1 protein_id gnl|my_center|LOCUS_27910 4578 3706 gene locus_tag LOCUS_27920 gene nifU 4578 3706 CDS product Fe-S cluster assembly protein NifU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942655.1 protein_id gnl|my_center|LOCUS_27920 6030 4612 gene locus_tag LOCUS_27930 6030 4612 CDS product phosphoglucomutase/phosphomannomutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942656.1 protein_id gnl|my_center|LOCUS_27930 9427 6242 gene locus_tag LOCUS_27940 9427 6242 CDS product DUF748 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941340.1 protein_id gnl|my_center|LOCUS_27940 >Feature sequence139 3 401 gene locus_tag LOCUS_27950 3 401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27950 433 1557 gene locus_tag LOCUS_27960 433 1557 CDS product HlyD family secretion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942127.1 protein_id gnl|my_center|LOCUS_27960 1554 3110 gene locus_tag LOCUS_27970 1554 3110 CDS product MDR family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942126.1 protein_id gnl|my_center|LOCUS_27970 3856 3191 gene locus_tag LOCUS_27980 gene cybH 3856 3191 CDS product Ni/Fe-hydrogenase, b-type cytochrome subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940797.1 protein_id gnl|my_center|LOCUS_27980 5567 3870 gene locus_tag LOCUS_27990 5567 3870 CDS product nickel-dependent hydrogenase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940798.1 protein_id gnl|my_center|LOCUS_27990 6707 5571 gene locus_tag LOCUS_28000 6707 5571 CDS product hydrogenase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940799.1 protein_id gnl|my_center|LOCUS_28000 9291 6895 gene locus_tag LOCUS_28010 gene ppk1 9291 6895 CDS product polyphosphate kinase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943936.1 protein_id gnl|my_center|LOCUS_28010 >Feature sequence140 195 1115 gene locus_tag LOCUS_28020 gene hslO 195 1115 CDS product Hsp33 family molecular chaperone HslO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943960.1 protein_id gnl|my_center|LOCUS_28020 1117 1884 gene locus_tag LOCUS_28030 gene truA 1117 1884 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943506.1 protein_id gnl|my_center|LOCUS_28030 2374 1859 gene locus_tag LOCUS_28040 2374 1859 CDS product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943891.1 protein_id gnl|my_center|LOCUS_28040 2709 2380 gene locus_tag LOCUS_28050 gene trxA 2709 2380 CDS product thioredoxin TrxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943892.1 protein_id gnl|my_center|LOCUS_28050 2866 3462 gene locus_tag LOCUS_28060 2866 3462 CDS product bifunctional precorrin-2 dehydrogenase/sirohydrochlorin ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943893.1 protein_id gnl|my_center|LOCUS_28060 3459 4259 gene locus_tag LOCUS_28070 gene ccsB 3459 4259 CDS product c-type cytochrome biogenesis protein CcsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943894.1 protein_id gnl|my_center|LOCUS_28070 4305 5606 gene locus_tag LOCUS_28080 gene hemA 4305 5606 CDS product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943895.1 protein_id gnl|my_center|LOCUS_28080 5606 6301 gene locus_tag LOCUS_28090 gene sfsA 5606 6301 CDS product DNA/RNA nuclease SfsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943351.1 protein_id gnl|my_center|LOCUS_28090 6341 7279 gene locus_tag LOCUS_28100 gene hemC 6341 7279 CDS product hydroxymethylbilane synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943896.1 protein_id gnl|my_center|LOCUS_28100 7272 8789 gene locus_tag LOCUS_28110 gene cobA 7272 8789 CDS product uroporphyrinogen-III C-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943897.1 protein_id gnl|my_center|LOCUS_28110 9286 8873 gene locus_tag LOCUS_28120 gene ndk 9286 8873 CDS product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941771.1 protein_id gnl|my_center|LOCUS_28120 9436 9522 gene locus_tag LOCUS_t00280 9436 9522 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence141 991 1629 gene locus_tag LOCUS_28130 991 1629 CDS product trimeric intracellular cation channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941865.1 protein_id gnl|my_center|LOCUS_28130 3537 1729 gene locus_tag LOCUS_28140 3537 1729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28140 4963 3590 gene locus_tag LOCUS_28150 4963 3590 CDS product bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940944.1 protein_id gnl|my_center|LOCUS_28150 5178 5738 gene locus_tag LOCUS_28160 5178 5738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940945.1 protein_id gnl|my_center|LOCUS_28160 5761 9270 gene locus_tag LOCUS_28170 gene mfd 5761 9270 CDS product transcription-repair coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940695.1 protein_id gnl|my_center|LOCUS_28170 >Feature sequence142 <1 1845 gene locus_tag LOCUS_28180 <1 1845 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941945.1:chemotaxis protein CheA 1886 3577 gene locus_tag LOCUS_28190 1886 3577 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941954.1 protein_id gnl|my_center|LOCUS_28190 3647 4126 gene locus_tag LOCUS_28200 3647 4126 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941803.1 protein_id gnl|my_center|LOCUS_28200 4223 5092 gene locus_tag LOCUS_28210 4223 5092 CDS product protein-glutamate O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941804.1 protein_id gnl|my_center|LOCUS_28210 5093 5641 gene locus_tag LOCUS_28220 5093 5641 CDS product chemotaxis protein CheD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941805.1 protein_id gnl|my_center|LOCUS_28220 5638 6708 gene locus_tag LOCUS_28230 5638 6708 CDS product chemotaxis response regulator protein-glutamate methylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941806.1 protein_id gnl|my_center|LOCUS_28230 6731 7621 gene locus_tag LOCUS_28240 6731 7621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28240 7628 8113 gene locus_tag LOCUS_28250 gene cheD 7628 8113 CDS product chemoreceptor glutamine deamidase CheD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072188.1 protein_id gnl|my_center|LOCUS_28250 >Feature sequence143 348 578 gene locus_tag LOCUS_28260 348 578 CDS product HypC/HybG/HupF family hydrogenase formation chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940976.1 protein_id gnl|my_center|LOCUS_28260 575 1666 gene locus_tag LOCUS_28270 gene hypD 575 1666 CDS product hydrogenase formation protein HypD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940977.1 protein_id gnl|my_center|LOCUS_28270 1671 2570 gene locus_tag LOCUS_28280 1671 2570 CDS product protoglobin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943923.1 protein_id gnl|my_center|LOCUS_28280 2574 3161 gene locus_tag LOCUS_28290 2574 3161 CDS product haloacid dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003014157.1 protein_id gnl|my_center|LOCUS_28290 3455 3859 gene locus_tag LOCUS_28300 3455 3859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28300 5468 3984 gene locus_tag LOCUS_28310 gene pap 5468 3984 CDS product polyphosphate:AMP phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941390.1 protein_id gnl|my_center|LOCUS_28310 6337 5525 gene locus_tag LOCUS_28320 gene proC 6337 5525 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943177.1 protein_id gnl|my_center|LOCUS_28320 6738 6358 gene locus_tag LOCUS_28330 6738 6358 CDS product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941813.1 protein_id gnl|my_center|LOCUS_28330 7592 6732 gene locus_tag LOCUS_28340 gene hpnK 7592 6732 CDS product hopanoid biosynthesis-associated protein HpnK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941812.1 protein_id gnl|my_center|LOCUS_28340 9019 7589 gene locus_tag LOCUS_28350 gene hpnJ 9019 7589 CDS product hopanoid biosynthesis associated radical SAM protein HpnJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941811.1 protein_id gnl|my_center|LOCUS_28350 >Feature sequence144 994 302 gene locus_tag LOCUS_28360 994 302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28360 2196 1117 gene locus_tag LOCUS_28370 2196 1117 CDS product 6-bladed beta-propeller inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942432.1 protein_id gnl|my_center|LOCUS_28370 2933 2295 gene locus_tag LOCUS_28380 2933 2295 CDS product cytochrome c3 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941282.1 protein_id gnl|my_center|LOCUS_28380 4148 3267 gene locus_tag LOCUS_28390 4148 3267 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073870.1 protein_id gnl|my_center|LOCUS_28390 5531 4176 gene locus_tag LOCUS_28400 5531 4176 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941138.1 protein_id gnl|my_center|LOCUS_28400 6762 5536 gene locus_tag LOCUS_28410 6762 5536 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941139.1 protein_id gnl|my_center|LOCUS_28410 7576 6962 gene locus_tag LOCUS_28420 7576 6962 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932570.1 protein_id gnl|my_center|LOCUS_28420 7913 7602 gene locus_tag LOCUS_28430 7913 7602 CDS product J domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942407.1 protein_id gnl|my_center|LOCUS_28430 8252 7944 gene locus_tag LOCUS_28440 8252 7944 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941460.1 protein_id gnl|my_center|LOCUS_28440 <9144 8426 gene locus_tag LOCUS_28450 <9144 8426 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941582.1:DEAD/DEAH box helicase >Feature sequence145 367 74 gene locus_tag LOCUS_28460 367 74 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931854.1 protein_id gnl|my_center|LOCUS_28460 1816 560 gene locus_tag LOCUS_28470 gene clpX 1816 560 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942435.1 protein_id gnl|my_center|LOCUS_28470 2412 1813 gene locus_tag LOCUS_28480 gene clpP 2412 1813 CDS product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942436.1 protein_id gnl|my_center|LOCUS_28480 3733 2423 gene locus_tag LOCUS_28490 gene tig 3733 2423 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942437.1 protein_id gnl|my_center|LOCUS_28490 3894 3810 gene locus_tag LOCUS_t00290 3894 3810 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 4360 4025 gene locus_tag LOCUS_28500 gene yciH 4360 4025 CDS product stress response translation initiation inhibitor YciH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001285199.1 protein_id gnl|my_center|LOCUS_28500 5178 4357 gene locus_tag LOCUS_28510 5178 4357 CDS product NAD+ synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941313.1 protein_id gnl|my_center|LOCUS_28510 6026 5178 gene locus_tag LOCUS_28520 6026 5178 CDS product carbon-nitrogen hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941312.1 protein_id gnl|my_center|LOCUS_28520 6535 6113 gene locus_tag LOCUS_28530 6535 6113 CDS product YraN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941311.1 protein_id gnl|my_center|LOCUS_28530 6783 8528 gene locus_tag LOCUS_28540 6783 8528 CDS product cytochrome c3 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943759.1 protein_id gnl|my_center|LOCUS_28540 >Feature sequence146 300 2222 gene locus_tag LOCUS_28550 300 2222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28550 2299 3504 gene locus_tag LOCUS_28560 gene extI 2299 3504 CDS product selenite/tellurite reduction operon porin ExtI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943570.1 protein_id gnl|my_center|LOCUS_28560 3624 4052 gene locus_tag LOCUS_28570 3624 4052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28570 4304 5722 gene locus_tag LOCUS_28580 4304 5722 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941261.1 protein_id gnl|my_center|LOCUS_28580 5709 7334 gene locus_tag LOCUS_28590 5709 7334 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941262.1 protein_id gnl|my_center|LOCUS_28590 >Feature sequence147 1932 1009 gene locus_tag LOCUS_28600 1932 1009 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235044954.1 protein_id gnl|my_center|LOCUS_28600 2501 1968 gene locus_tag LOCUS_28610 2501 1968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941136.1 protein_id gnl|my_center|LOCUS_28610 4080 2731 gene locus_tag LOCUS_28620 4080 2731 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941138.1 protein_id gnl|my_center|LOCUS_28620 5321 4077 gene locus_tag LOCUS_28630 5321 4077 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941139.1 protein_id gnl|my_center|LOCUS_28630 5530 5318 gene locus_tag LOCUS_28640 5530 5318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28640 6186 5710 gene locus_tag LOCUS_28650 6186 5710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941987.1 protein_id gnl|my_center|LOCUS_28650 <8841 6342 gene locus_tag LOCUS_28660 <8841 6342 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941986.1:CusA/CzcA family heavy metal efflux RND transporter >Feature sequence148 311 622 gene locus_tag LOCUS_28670 311 622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28670 1134 724 gene locus_tag LOCUS_28680 1134 724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_28680 1433 2635 gene locus_tag LOCUS_28690 1433 2635 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_187767773.1 protein_id gnl|my_center|LOCUS_28690 2679 3434 gene locus_tag LOCUS_28700 2679 3434 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804100.1 protein_id gnl|my_center|LOCUS_28700 3882 3436 gene locus_tag LOCUS_28710 3882 3436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28710 4169 3933 gene locus_tag LOCUS_28720 4169 3933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28720 4065 5369 gene locus_tag LOCUS_28730 4065 5369 CDS product B12-binding domain-containing radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940912.1 protein_id gnl|my_center|LOCUS_28730 5567 6655 gene locus_tag LOCUS_28740 5567 6655 CDS product type III polyketide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480137.1 protein_id gnl|my_center|LOCUS_28740 8080 6665 gene locus_tag LOCUS_28750 8080 6665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28750 8552 8743 gene locus_tag LOCUS_28760 8552 8743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28760 >Feature sequence149 602 2443 gene locus_tag LOCUS_28770 602 2443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28770 2501 3484 gene locus_tag LOCUS_28780 2501 3484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28780 4114 4785 gene locus_tag LOCUS_28790 4114 4785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28790 4800 5744 gene locus_tag LOCUS_28800 4800 5744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28800 5741 6928 gene locus_tag LOCUS_28810 5741 6928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28810 6960 7988 gene locus_tag LOCUS_28820 6960 7988 CDS product FemAB family PEP-CTERM system-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011787328.1 protein_id gnl|my_center|LOCUS_28820 >Feature sequence150 1569 1177 gene locus_tag LOCUS_28830 1569 1177 CDS product FxsA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941471.1 protein_id gnl|my_center|LOCUS_28830 2597 1707 gene locus_tag LOCUS_28840 2597 1707 CDS product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035416.1 protein_id gnl|my_center|LOCUS_28840 3051 2752 gene locus_tag LOCUS_28850 3051 2752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28850 3249 6791 gene locus_tag LOCUS_28860 3249 6791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943753.1 protein_id gnl|my_center|LOCUS_28860 6880 7560 gene locus_tag LOCUS_28870 6880 7560 CDS product YdbL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943752.1 protein_id gnl|my_center|LOCUS_28870 8505 7594 gene locus_tag LOCUS_28880 8505 7594 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941213.1 protein_id gnl|my_center|LOCUS_28880 >Feature sequence151 346 1392 gene locus_tag LOCUS_28890 346 1392 CDS product IS110-like element ISGsu4 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941629.1 protein_id gnl|my_center|LOCUS_28890 2122 1835 gene locus_tag LOCUS_28900 2122 1835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28900 3787 2240 gene locus_tag LOCUS_28910 3787 2240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28910 6526 3848 gene locus_tag LOCUS_28920 6526 3848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28920 <8612 6591 gene locus_tag LOCUS_28930 <8612 6591 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011021984.1:chemotaxis protein CheB >Feature sequence152 416 207 gene locus_tag LOCUS_28940 416 207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28940 818 447 gene locus_tag LOCUS_28950 818 447 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966792.1 protein_id gnl|my_center|LOCUS_28950 1109 1681 gene locus_tag LOCUS_28960 1109 1681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28960 2201 1845 gene locus_tag LOCUS_28970 2201 1845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28970 2715 2458 gene locus_tag LOCUS_28980 2715 2458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28980 2992 2753 gene locus_tag LOCUS_28990 2992 2753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28990 3565 5034 gene locus_tag LOCUS_29000 3565 5034 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946820.1 protein_id gnl|my_center|LOCUS_29000 5129 5449 gene locus_tag LOCUS_29010 5129 5449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29010 5547 6218 gene locus_tag LOCUS_29020 5547 6218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29020 6719 6922 gene locus_tag LOCUS_29030 6719 6922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29030 7130 7486 gene locus_tag LOCUS_29040 7130 7486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29040 7500 7730 gene locus_tag LOCUS_29050 7500 7730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29050 7727 8524 gene locus_tag LOCUS_29060 7727 8524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29060 >Feature sequence153 204 289 gene locus_tag LOCUS_t00300 204 289 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 1290 370 gene locus_tag LOCUS_29070 1290 370 CDS product putative 2-dehydropantoate 2-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943321.1 protein_id gnl|my_center|LOCUS_29070 1475 3259 gene locus_tag LOCUS_29080 1475 3259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29080 4664 3378 gene locus_tag LOCUS_29090 4664 3378 CDS product Hsp70 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391508.1 protein_id gnl|my_center|LOCUS_29090 7149 5056 gene locus_tag LOCUS_29100 7149 5056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29100 8160 7570 gene locus_tag LOCUS_29110 8160 7570 CDS product DUF502 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005772090.1 protein_id gnl|my_center|LOCUS_29110 >Feature sequence154 118 990 gene locus_tag LOCUS_29120 118 990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29120 994 2367 gene locus_tag LOCUS_29130 994 2367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29130 2360 3922 gene locus_tag LOCUS_29140 2360 3922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29140 4255 4025 gene locus_tag LOCUS_29150 4255 4025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29150 6518 4563 gene locus_tag LOCUS_29160 6518 4563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29160 7173 6670 gene locus_tag LOCUS_29170 7173 6670 CDS product type 1 glutamine amidotransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941820.1 protein_id gnl|my_center|LOCUS_29170 8194 7232 gene locus_tag LOCUS_29180 8194 7232 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_225414074.1 protein_id gnl|my_center|LOCUS_29180 >Feature sequence155 2611 1685 gene locus_tag LOCUS_29190 2611 1685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_29190 3114 2728 gene locus_tag LOCUS_29200 3114 2728 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941568.1 protein_id gnl|my_center|LOCUS_29200 3575 3159 gene locus_tag LOCUS_29210 3575 3159 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941569.1 protein_id gnl|my_center|LOCUS_29210 5019 3628 gene locus_tag LOCUS_29220 5019 3628 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941570.1 protein_id gnl|my_center|LOCUS_29220 5201 5016 gene locus_tag LOCUS_29230 5201 5016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29230 5884 5189 gene locus_tag LOCUS_29240 5884 5189 CDS product HDOD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941571.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_29240 6266 5871 gene locus_tag LOCUS_29250 6266 5871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943213.1 protein_id gnl|my_center|LOCUS_29250 6689 7510 gene locus_tag LOCUS_29260 6689 7510 CDS product phosphate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392686.1 protein_id gnl|my_center|LOCUS_29260 7503 8294 gene locus_tag LOCUS_29270 gene fetB 7503 8294 CDS product iron export ABC transporter permease subunit FetB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000679265.1 protein_id gnl|my_center|LOCUS_29270 >Feature sequence156 98 826 gene locus_tag LOCUS_29280 98 826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29280 836 1150 gene locus_tag LOCUS_29290 836 1150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29290 1150 1377 gene locus_tag LOCUS_29300 1150 1377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29300 1674 1390 gene locus_tag LOCUS_29310 1674 1390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29310 1947 1768 gene locus_tag LOCUS_29320 1947 1768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29320 2647 3933 gene locus_tag LOCUS_29330 2647 3933 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940741.1 protein_id gnl|my_center|LOCUS_29330 4533 4811 gene locus_tag LOCUS_29340 4533 4811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29340 4808 5647 gene locus_tag LOCUS_29350 4808 5647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29350 5874 6032 gene locus_tag LOCUS_29360 5874 6032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29360 6114 6401 gene locus_tag LOCUS_29370 6114 6401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29370 7395 6586 gene locus_tag LOCUS_29380 7395 6586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29380 7905 7447 gene locus_tag LOCUS_29390 7905 7447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29390 8178 8103 gene locus_tag LOCUS_t00310 8178 8103 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence157 306 1256 gene locus_tag LOCUS_29400 306 1256 CDS product SpoIID/LytB domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943259.1 protein_id gnl|my_center|LOCUS_29400 1262 2293 gene locus_tag LOCUS_29410 gene queA 1262 2293 CDS product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943258.1 protein_id gnl|my_center|LOCUS_29410 2401 3414 gene locus_tag LOCUS_29420 gene tgt 2401 3414 CDS product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943257.1 protein_id gnl|my_center|LOCUS_29420 3438 3764 gene locus_tag LOCUS_29430 gene yajC 3438 3764 CDS product preprotein translocase subunit YajC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943256.1 protein_id gnl|my_center|LOCUS_29430 3798 5387 gene locus_tag LOCUS_29440 gene secD 3798 5387 CDS product protein translocase subunit SecD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943255.1 protein_id gnl|my_center|LOCUS_29440 5403 6314 gene locus_tag LOCUS_29450 gene secF 5403 6314 CDS product protein translocase subunit SecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943254.1 protein_id gnl|my_center|LOCUS_29450 6349 6924 gene locus_tag LOCUS_29460 6349 6924 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943253.1 protein_id gnl|my_center|LOCUS_29460 >Feature sequence158 124 606 gene locus_tag LOCUS_29470 124 606 CDS product DUF2062 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941058.1 protein_id gnl|my_center|LOCUS_29470 1627 611 gene locus_tag LOCUS_29480 1627 611 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943927.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_29480 1864 1670 gene locus_tag LOCUS_29490 1864 1670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_29490 2214 3536 gene locus_tag LOCUS_29500 2214 3536 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940741.1 protein_id gnl|my_center|LOCUS_29500 3565 4188 gene locus_tag LOCUS_29510 3565 4188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29510 4666 4400 gene locus_tag LOCUS_29520 gene hupB 4666 4400 CDS product DNA-binding protein HU-beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087931.1 protein_id gnl|my_center|LOCUS_29520 5192 4740 gene locus_tag LOCUS_29530 5192 4740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29530 5243 5252 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 5541 6038 gene locus_tag LOCUS_29540 5541 6038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29540 6093 6695 gene locus_tag LOCUS_29550 6093 6695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29550 6735 7121 gene locus_tag LOCUS_29560 6735 7121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29560 >Feature sequence159 <1 1993 gene locus_tag LOCUS_29570 <1 1993 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943858.1:DNA polymerase domain-containing protein 2156 2545 gene locus_tag LOCUS_29580 2156 2545 CDS product exosortase system-associated protein, TIGR04073 family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943857.1 protein_id gnl|my_center|LOCUS_29580 3487 2624 gene locus_tag LOCUS_29590 gene galU 3487 2624 CDS product UTP--glucose-1-phosphate uridylyltransferase GalU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941523.1 protein_id gnl|my_center|LOCUS_29590 3513 3728 gene locus_tag LOCUS_29600 3513 3728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29600 4093 6309 gene locus_tag LOCUS_29610 4093 6309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29610 6306 7691 gene locus_tag LOCUS_29620 6306 7691 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940953.1 protein_id gnl|my_center|LOCUS_29620 >Feature sequence160 842 1966 gene locus_tag LOCUS_29630 842 1966 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941973.1 protein_id gnl|my_center|LOCUS_29630 1963 3330 gene locus_tag LOCUS_29640 1963 3330 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930426.1 protein_id gnl|my_center|LOCUS_29640 5224 3416 gene locus_tag LOCUS_29650 5224 3416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29650 6010 7284 gene locus_tag LOCUS_29660 6010 7284 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941984.1 protein_id gnl|my_center|LOCUS_29660 >Feature sequence161 690 319 gene locus_tag LOCUS_29670 690 319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005083563.1 protein_id gnl|my_center|LOCUS_29670 1282 2142 gene locus_tag LOCUS_29680 1282 2142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29680 3382 2423 gene locus_tag LOCUS_29690 3382 2423 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528466.1 protein_id gnl|my_center|LOCUS_29690 3729 3451 gene locus_tag LOCUS_29700 3729 3451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29700 5207 3732 gene locus_tag LOCUS_29710 5207 3732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_29710 6574 5309 gene locus_tag LOCUS_29720 6574 5309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29720 6773 6997 gene locus_tag LOCUS_29730 6773 6997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29730 >Feature sequence162 661 239 gene locus_tag LOCUS_29740 661 239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29740 1061 621 gene locus_tag LOCUS_29750 1061 621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29750 2906 1671 gene locus_tag LOCUS_29760 gene dinB 2906 1671 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940720.1 protein_id gnl|my_center|LOCUS_29760 3125 2907 gene locus_tag LOCUS_29770 3125 2907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940719.1 protein_id gnl|my_center|LOCUS_29770 3755 3153 gene locus_tag LOCUS_29780 gene lexA 3755 3153 CDS product transcriptional repressor LexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940718.1 protein_id gnl|my_center|LOCUS_29780 3906 4073 gene locus_tag LOCUS_29790 3906 4073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29790 4088 4354 gene locus_tag LOCUS_29800 4088 4354 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546355.1 protein_id gnl|my_center|LOCUS_29800 4717 4424 gene locus_tag LOCUS_29810 4717 4424 CDS product DUF2164 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550097.1 protein_id gnl|my_center|LOCUS_29810 4928 4746 gene locus_tag LOCUS_29820 4928 4746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29820 7128 4915 gene locus_tag LOCUS_29830 7128 4915 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338082.1 protein_id gnl|my_center|LOCUS_29830 <7953 7109 gene locus_tag LOCUS_29840 <7953 7109 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_023003683.1:ATP-binding protein >Feature sequence163 737 225 gene locus_tag LOCUS_29850 737 225 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942998.1 protein_id gnl|my_center|LOCUS_29850 853 1050 gene locus_tag LOCUS_29860 853 1050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29860 1418 1176 gene locus_tag LOCUS_29870 1418 1176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29870 2444 2259 gene locus_tag LOCUS_29880 2444 2259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29880 2631 4253 gene locus_tag LOCUS_29890 2631 4253 CDS product AarF/ABC1/UbiB kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460052.1 protein_id gnl|my_center|LOCUS_29890 5223 4756 gene locus_tag LOCUS_29900 5223 4756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29900 5505 6782 gene locus_tag LOCUS_29910 5505 6782 CDS product DUF6178 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943201.1 protein_id gnl|my_center|LOCUS_29910 7257 6991 gene locus_tag LOCUS_29920 gene hupB 7257 6991 CDS product DNA-binding protein HU-beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087931.1 protein_id gnl|my_center|LOCUS_29920 >Feature sequence164 150 1196 gene locus_tag LOCUS_29930 gene recA 150 1196 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940821.1 protein_id gnl|my_center|LOCUS_29930 1212 2369 gene locus_tag LOCUS_29940 1212 2369 CDS product type IV pilus twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940822.1 protein_id gnl|my_center|LOCUS_29940 2455 2832 gene locus_tag LOCUS_29950 2455 2832 CDS product regulatory protein RecX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940823.1 protein_id gnl|my_center|LOCUS_29950 2891 5533 gene locus_tag LOCUS_29960 gene alaS 2891 5533 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940824.1 protein_id gnl|my_center|LOCUS_29960 5537 6415 gene locus_tag LOCUS_29970 gene argB 5537 6415 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940826.1 protein_id gnl|my_center|LOCUS_29970 >Feature sequence165 355 143 gene locus_tag LOCUS_29980 355 143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29980 1968 283 gene locus_tag LOCUS_29990 1968 283 CDS product carbon starvation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545972.1 protein_id gnl|my_center|LOCUS_29990 2354 2004 gene locus_tag LOCUS_30000 2354 2004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30000 3127 2351 gene locus_tag LOCUS_30010 3127 2351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30010 3763 3137 gene locus_tag LOCUS_30020 gene upp 3763 3137 CDS product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003860560.1 protein_id gnl|my_center|LOCUS_30020 4239 3928 gene locus_tag LOCUS_30030 4239 3928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30030 5615 4404 gene locus_tag LOCUS_30040 5615 4404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30040 6386 5880 gene locus_tag LOCUS_30050 6386 5880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_30050 6733 6383 gene locus_tag LOCUS_30060 6733 6383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30060 7259 6834 gene locus_tag LOCUS_30070 7259 6834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30070 >Feature sequence166 1 2718 gene locus_tag LOCUS_30080 1 2718 CDS product NAD-glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942209.1 protein_id gnl|my_center|LOCUS_30080 2784 3521 gene locus_tag LOCUS_30090 2784 3521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30090 3624 3959 gene locus_tag LOCUS_30100 3624 3959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941572.1 protein_id gnl|my_center|LOCUS_30100 3946 4821 gene locus_tag LOCUS_30110 3946 4821 CDS product HDOD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941571.1 protein_id gnl|my_center|LOCUS_30110 4959 4968 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 4986 7097 gene locus_tag LOCUS_30120 4986 7097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30120 >Feature sequence167 1819 194 gene locus_tag LOCUS_30130 1819 194 CDS product fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941660.1 protein_id gnl|my_center|LOCUS_30130 2557 2096 gene locus_tag LOCUS_30140 2557 2096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943969.1 protein_id gnl|my_center|LOCUS_30140 4000 2690 gene locus_tag LOCUS_30150 4000 2690 CDS product phenylacetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942374.1 protein_id gnl|my_center|LOCUS_30150 5772 4030 gene locus_tag LOCUS_30160 5772 4030 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942106.1 protein_id gnl|my_center|LOCUS_30160 6828 5839 gene locus_tag LOCUS_30170 gene ispG 6828 5839 CDS product flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942105.1 protein_id gnl|my_center|LOCUS_30170 7223 6987 gene locus_tag LOCUS_30180 7223 6987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30180 >Feature sequence168 2129 471 gene locus_tag LOCUS_30190 2129 471 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941764.1 protein_id gnl|my_center|LOCUS_30190 2431 3633 gene locus_tag LOCUS_30200 2431 3633 CDS product DUF294 nucleotidyltransferase-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941728.1 protein_id gnl|my_center|LOCUS_30200 3794 4990 gene locus_tag LOCUS_30210 3794 4990 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946820.1 protein_id gnl|my_center|LOCUS_30210 5588 5091 gene locus_tag LOCUS_30220 5588 5091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30220 5557 5745 gene locus_tag LOCUS_30230 5557 5745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30230 6070 6375 gene locus_tag LOCUS_30240 6070 6375 CDS product putative addiction module antidote protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942189.1 protein_id gnl|my_center|LOCUS_30240 6624 7184 gene locus_tag LOCUS_30250 6624 7184 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942355.1 protein_id gnl|my_center|LOCUS_30250 >Feature sequence169 807 1025 gene locus_tag LOCUS_30260 807 1025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30260 1312 3006 gene locus_tag LOCUS_30270 1312 3006 CDS product autotransporter assembly complex family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004343881.1 protein_id gnl|my_center|LOCUS_30270 3003 6998 gene locus_tag LOCUS_30280 3003 6998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30280 >Feature sequence170 100 282 gene locus_tag LOCUS_30290 100 282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_129052038.1 protein_id gnl|my_center|LOCUS_30290 282 545 gene locus_tag LOCUS_30300 282 545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30300 1299 577 gene locus_tag LOCUS_30310 1299 577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30310 1553 1891 gene locus_tag LOCUS_30320 1553 1891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30320 2334 1990 gene locus_tag LOCUS_30330 2334 1990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30330 2727 2455 gene locus_tag LOCUS_30340 2727 2455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30340 3141 2881 gene locus_tag LOCUS_30350 3141 2881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30350 3242 3427 gene locus_tag LOCUS_30360 3242 3427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30360 3683 3402 gene locus_tag LOCUS_30370 3683 3402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944013.1 protein_id gnl|my_center|LOCUS_30370 3978 3787 gene locus_tag LOCUS_30380 3978 3787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30380 5791 4049 gene locus_tag LOCUS_30390 5791 4049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30390 7077 6535 gene locus_tag LOCUS_30400 7077 6535 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967173.1 protein_id gnl|my_center|LOCUS_30400 >Feature sequence171 1394 270 gene locus_tag LOCUS_30410 1394 270 CDS product MdtA/MuxA family multidrug efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815035.1 protein_id gnl|my_center|LOCUS_30410 274 283 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2105 1428 gene locus_tag LOCUS_30420 2105 1428 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943739.1 protein_id gnl|my_center|LOCUS_30420 3540 2098 gene locus_tag LOCUS_30430 3540 2098 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943740.1 protein_id gnl|my_center|LOCUS_30430 3824 4333 gene locus_tag LOCUS_30440 3824 4333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30440 4459 5382 gene locus_tag LOCUS_30450 4459 5382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30450 6432 6884 gene locus_tag LOCUS_30460 6432 6884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30460 >Feature sequence172 155 430 gene locus_tag LOCUS_30470 155 430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30470 549 740 gene locus_tag LOCUS_30480 549 740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30480 840 1118 gene locus_tag LOCUS_30490 840 1118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30490 1115 1417 gene locus_tag LOCUS_30500 1115 1417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30500 1452 2189 gene locus_tag LOCUS_30510 1452 2189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30510 2831 2331 gene locus_tag LOCUS_30520 2831 2331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30520 3442 2882 gene locus_tag LOCUS_30530 3442 2882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30530 3655 3479 gene locus_tag LOCUS_30540 3655 3479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30540 4365 3652 gene locus_tag LOCUS_30550 4365 3652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30550 4787 4796 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 5238 5615 gene locus_tag LOCUS_30560 5238 5615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30560 6132 6875 gene locus_tag LOCUS_30570 gene gnfK 6132 6875 CDS product nitrogen fixation two-component system sensor histidine kinase GnfK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941609.1 protein_id gnl|my_center|LOCUS_30570 >Feature sequence173 <1 1644 gene locus_tag LOCUS_30580 <1 1644 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941674.1:GTPase HflX 2284 1625 gene locus_tag LOCUS_30590 2284 1625 CDS product YceH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940907.1 protein_id gnl|my_center|LOCUS_30590 2606 2304 gene locus_tag LOCUS_30600 2606 2304 CDS product DUF2288 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943940.1 protein_id gnl|my_center|LOCUS_30600 3686 2658 gene locus_tag LOCUS_30610 3686 2658 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944069.1 protein_id gnl|my_center|LOCUS_30610 3802 4437 gene locus_tag LOCUS_30620 3802 4437 CDS product CoA pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943780.1 protein_id gnl|my_center|LOCUS_30620 4440 4955 gene locus_tag LOCUS_30630 gene tpx 4440 4955 CDS product thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941020.1 protein_id gnl|my_center|LOCUS_30630 5024 5596 gene locus_tag LOCUS_30640 5024 5596 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941667.1 protein_id gnl|my_center|LOCUS_30640 6294 5653 gene locus_tag LOCUS_30650 6294 5653 CDS product HAD-IA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193360256.1 protein_id gnl|my_center|LOCUS_30650 6604 6287 gene locus_tag LOCUS_30660 6604 6287 CDS product HNH endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942712.1 protein_id gnl|my_center|LOCUS_30660 6768 6844 gene locus_tag LOCUS_t00320 6768 6844 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence174 441 172 gene locus_tag LOCUS_30670 441 172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30670 880 644 gene locus_tag LOCUS_30680 880 644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30680 997 1416 gene locus_tag LOCUS_30690 997 1416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30690 1503 1703 gene locus_tag LOCUS_30700 1503 1703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940874.1 protein_id gnl|my_center|LOCUS_30700 3202 2120 gene locus_tag LOCUS_30710 3202 2120 CDS product IS5-like element ISGsu2 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941225.1 protein_id gnl|my_center|LOCUS_30710 4130 5581 gene locus_tag LOCUS_30720 4130 5581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30720 5866 6144 gene locus_tag LOCUS_30730 5866 6144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30730 6110 6484 gene locus_tag LOCUS_30740 6110 6484 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941778.1 protein_id gnl|my_center|LOCUS_30740 >Feature sequence175 565 212 gene locus_tag LOCUS_30750 565 212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30750 1145 570 gene locus_tag LOCUS_30760 1145 570 CDS product DUF6036 family nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958464.1 protein_id gnl|my_center|LOCUS_30760 3102 1411 gene locus_tag LOCUS_30770 3102 1411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30770 4407 3118 gene locus_tag LOCUS_30780 4407 3118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_30780 5233 4400 gene locus_tag LOCUS_30790 5233 4400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30790 5639 5259 gene locus_tag LOCUS_30800 5639 5259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30800 6122 5700 gene locus_tag LOCUS_30810 6122 5700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30810 6618 6247 gene locus_tag LOCUS_30820 6618 6247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30820 >Feature sequence176 356 1771 gene locus_tag LOCUS_30830 356 1771 CDS product voltage-gated chloride channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005416818.1 protein_id gnl|my_center|LOCUS_30830 1773 2228 gene locus_tag LOCUS_30840 1773 2228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30840 2301 3110 gene locus_tag LOCUS_30850 2301 3110 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942484.1 protein_id gnl|my_center|LOCUS_30850 3144 4919 gene locus_tag LOCUS_30860 3144 4919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30860 5054 6589 gene locus_tag LOCUS_30870 5054 6589 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256246.1 protein_id gnl|my_center|LOCUS_30870 >Feature sequence177 <1 923 gene locus_tag LOCUS_30880 <1 923 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011459240.1:IS1634 family transposase 1721 1023 gene locus_tag LOCUS_30890 1721 1023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_30890 3765 1918 gene locus_tag LOCUS_30900 3765 1918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30900 4643 3936 gene locus_tag LOCUS_30910 4643 3936 CDS product ACP phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941844.1 protein_id gnl|my_center|LOCUS_30910 6635 4767 gene locus_tag LOCUS_30920 6635 4767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30920 >Feature sequence178 192 401 gene locus_tag LOCUS_30930 192 401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30930 510 1082 gene locus_tag LOCUS_30940 510 1082 CDS product cysteine hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000844912.1 protein_id gnl|my_center|LOCUS_30940 1147 2421 gene locus_tag LOCUS_30950 1147 2421 CDS product B12-binding domain-containing radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940912.1 protein_id gnl|my_center|LOCUS_30950 2459 3106 gene locus_tag LOCUS_30960 2459 3106 CDS product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021861.1 protein_id gnl|my_center|LOCUS_30960 3143 4162 gene locus_tag LOCUS_30970 3143 4162 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942020.1 protein_id gnl|my_center|LOCUS_30970 4159 4386 gene locus_tag LOCUS_30980 4159 4386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30980 4521 4661 gene locus_tag LOCUS_30990 4521 4661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30990 4720 5343 gene locus_tag LOCUS_31000 4720 5343 CDS product heme-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920406.1 protein_id gnl|my_center|LOCUS_31000 5371 6363 gene locus_tag LOCUS_31010 5371 6363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31010 >Feature sequence179 2476 659 gene locus_tag LOCUS_31020 2476 659 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942354.1 protein_id gnl|my_center|LOCUS_31020 2639 2564 gene locus_tag LOCUS_t00330 2639 2564 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 4636 2735 gene locus_tag LOCUS_31030 4636 2735 CDS product DUF3488 and transglutaminase-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942341.1 protein_id gnl|my_center|LOCUS_31030 5408 4623 gene locus_tag LOCUS_31040 5408 4623 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_039644821.1 protein_id gnl|my_center|LOCUS_31040 6430 5489 gene locus_tag LOCUS_31050 6430 5489 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942339.1 protein_id gnl|my_center|LOCUS_31050 >Feature sequence180 96 281 gene locus_tag LOCUS_31060 96 281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31060 1004 264 gene locus_tag LOCUS_31070 1004 264 CDS product MTA/SAH nucleosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942542.1 protein_id gnl|my_center|LOCUS_31070 1116 1206 gene locus_tag LOCUS_t00340 1116 1206 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 1568 3262 gene locus_tag LOCUS_31080 gene dnaX 1568 3262 CDS product DNA polymerase III subunit gamma/tau inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940771.1 protein_id gnl|my_center|LOCUS_31080 3314 3628 gene locus_tag LOCUS_31090 3314 3628 CDS product YbaB/EbfC family nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940772.1 protein_id gnl|my_center|LOCUS_31090 3923 4474 gene locus_tag LOCUS_31100 gene recR 3923 4474 CDS product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940773.1 protein_id gnl|my_center|LOCUS_31100 >Feature sequence181 123 368 gene locus_tag LOCUS_31110 123 368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31110 2096 474 gene locus_tag LOCUS_31120 2096 474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31120 3060 2281 gene locus_tag LOCUS_31130 3060 2281 CDS product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932314.1 protein_id gnl|my_center|LOCUS_31130 5720 3063 gene locus_tag LOCUS_31140 gene mgtA 5720 3063 CDS product magnesium-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932315.1 protein_id gnl|my_center|LOCUS_31140 >Feature sequence182 871 602 gene locus_tag LOCUS_31150 871 602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941378.1 protein_id gnl|my_center|LOCUS_31150 1508 1017 gene locus_tag LOCUS_31160 1508 1017 CDS product BCAM0308 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943963.1 protein_id gnl|my_center|LOCUS_31160 2534 1533 gene locus_tag LOCUS_31170 2534 1533 CDS product zinc-dependent alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941236.1 protein_id gnl|my_center|LOCUS_31170 3001 2603 gene locus_tag LOCUS_31180 3001 2603 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943046.1 protein_id gnl|my_center|LOCUS_31180 3467 3018 gene locus_tag LOCUS_31190 3467 3018 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943047.1 protein_id gnl|my_center|LOCUS_31190 3922 4932 gene locus_tag LOCUS_31200 gene amrS 3922 4932 CDS product AmmeMemoRadiSam system radical SAM enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942373.1 protein_id gnl|my_center|LOCUS_31200 4943 5587 gene locus_tag LOCUS_31210 4943 5587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31210 5893 6303 gene locus_tag LOCUS_31220 5893 6303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941371.1 protein_id gnl|my_center|LOCUS_31220 >Feature sequence183 110 301 gene locus_tag LOCUS_31230 110 301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31230 1314 310 gene locus_tag LOCUS_31240 1314 310 CDS product NADP-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222377.1 protein_id gnl|my_center|LOCUS_31240 2033 1614 gene locus_tag LOCUS_31250 2033 1614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31250 2472 2059 gene locus_tag LOCUS_31260 2472 2059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31260 4376 2970 gene locus_tag LOCUS_31270 4376 2970 CDS product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404565.1 protein_id gnl|my_center|LOCUS_31270 5099 4491 gene locus_tag LOCUS_31280 5099 4491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_31280 >Feature sequence184 255 1295 gene locus_tag LOCUS_31290 255 1295 CDS product cytochrome-c peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_121651618.1 protein_id gnl|my_center|LOCUS_31290 2560 1604 gene locus_tag LOCUS_31300 2560 1604 CDS product acetyl-CoA carboxylase carboxyltransferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942051.1 protein_id gnl|my_center|LOCUS_31300 6134 2580 gene locus_tag LOCUS_31310 gene dnaE 6134 2580 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942050.1 protein_id gnl|my_center|LOCUS_31310 >Feature sequence185 1784 1395 gene locus_tag LOCUS_31320 1784 1395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31320 2258 2809 gene locus_tag LOCUS_31330 2258 2809 CDS product YceI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896521.1 protein_id gnl|my_center|LOCUS_31330 2812 3045 gene locus_tag LOCUS_31340 2812 3045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31340 3202 4122 gene locus_tag LOCUS_31350 3202 4122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31350 4393 5193 gene locus_tag LOCUS_31360 4393 5193 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706486.1 protein_id gnl|my_center|LOCUS_31360 5472 5882 gene locus_tag LOCUS_31370 5472 5882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31370 >Feature sequence186 254 670 gene locus_tag LOCUS_31380 254 670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31380 1757 684 gene locus_tag LOCUS_31390 1757 684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31390 2263 1754 gene locus_tag LOCUS_31400 2263 1754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31400 2646 2296 gene locus_tag LOCUS_31410 2646 2296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31410 4733 2829 gene locus_tag LOCUS_31420 gene aprA 4733 2829 CDS product adenylyl-sulfate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879166.1 protein_id gnl|my_center|LOCUS_31420 4250 4259 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 5215 4733 gene locus_tag LOCUS_31430 gene aprB 5215 4733 CDS product adenylyl-sulfate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879165.1 protein_id gnl|my_center|LOCUS_31430 >Feature sequence187 806 730 gene locus_tag LOCUS_t00350 806 730 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 1436 873 gene locus_tag LOCUS_31440 1436 873 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941133.1 protein_id gnl|my_center|LOCUS_31440 1908 1477 gene locus_tag LOCUS_31450 gene queF 1908 1477 CDS product preQ(1) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263288.1 protein_id gnl|my_center|LOCUS_31450 3259 1997 gene locus_tag LOCUS_31460 gene larA 3259 1997 CDS product nickel-dependent lactate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943907.1 protein_id gnl|my_center|LOCUS_31460 3519 3274 gene locus_tag LOCUS_31470 3519 3274 CDS product YtxH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943601.1 protein_id gnl|my_center|LOCUS_31470 4028 3642 gene locus_tag LOCUS_31480 4028 3642 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941941.1 protein_id gnl|my_center|LOCUS_31480 5503 4025 gene locus_tag LOCUS_31490 5503 4025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31490 >Feature sequence188 1007 306 gene locus_tag LOCUS_31500 1007 306 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943121.1 protein_id gnl|my_center|LOCUS_31500 2496 1000 gene locus_tag LOCUS_31510 2496 1000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31510 2744 4891 gene locus_tag LOCUS_31520 gene cyaB 2744 4891 CDS product cyclolysin T1SS permease/ATPase CyaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929996.1 protein_id gnl|my_center|LOCUS_31520 >Feature sequence189 70 210 gene locus_tag LOCUS_31530 70 210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31530 748 248 gene locus_tag LOCUS_31540 748 248 CDS product hydrogenase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940766.1 protein_id gnl|my_center|LOCUS_31540 2747 750 gene locus_tag LOCUS_31550 2747 750 CDS product CoB--CoM heterodisulfide reductase iron-sulfur subunit A family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940767.1 protein_id gnl|my_center|LOCUS_31550 3627 2749 gene locus_tag LOCUS_31560 3627 2749 CDS product CoB--CoM heterodisulfide reductase iron-sulfur subunit B family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940768.1 protein_id gnl|my_center|LOCUS_31560 4294 3725 gene locus_tag LOCUS_31570 4294 3725 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940769.1 protein_id gnl|my_center|LOCUS_31570 4733 4575 gene locus_tag LOCUS_31580 4733 4575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941841.1 protein_id gnl|my_center|LOCUS_31580 5802 4735 gene locus_tag LOCUS_31590 5802 4735 CDS product low specificity L-threonine aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944019.1 protein_id gnl|my_center|LOCUS_31590 >Feature sequence190 2571 124 gene locus_tag LOCUS_31600 2571 124 CDS product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_210762687.1 protein_id gnl|my_center|LOCUS_31600 4385 2568 gene locus_tag LOCUS_31610 4385 2568 CDS product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035470.1 protein_id gnl|my_center|LOCUS_31610 5562 4510 gene locus_tag LOCUS_31620 5562 4510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31620 5831 5559 gene locus_tag LOCUS_31630 5831 5559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31630 >Feature sequence191 1185 238 gene locus_tag LOCUS_31640 1185 238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31640 1703 2332 gene locus_tag LOCUS_31650 1703 2332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31650 2792 2974 gene locus_tag LOCUS_31660 2792 2974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943376.1 protein_id gnl|my_center|LOCUS_31660 5308 3095 gene locus_tag LOCUS_31670 5308 3095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31670 >Feature sequence192 1683 130 gene locus_tag LOCUS_31680 gene yidC 1683 130 CDS product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_169144818.1 protein_id gnl|my_center|LOCUS_31680 2716 3975 gene locus_tag LOCUS_31690 2716 3975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31690 4176 4646 gene locus_tag LOCUS_31700 4176 4646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_31700 4652 5278 gene locus_tag LOCUS_31710 4652 5278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_31710 >Feature sequence193 128 433 gene locus_tag LOCUS_31720 128 433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31720 718 2118 gene locus_tag LOCUS_31730 718 2118 CDS product DegQ family serine endoprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940999.1 protein_id gnl|my_center|LOCUS_31730 2934 2248 gene locus_tag LOCUS_31740 2934 2248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31740 3271 5478 gene locus_tag LOCUS_31750 3271 5478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31750 >Feature sequence194 1726 1385 gene locus_tag LOCUS_31760 1726 1385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31760 2773 1832 gene locus_tag LOCUS_31770 2773 1832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31770 2234 2243 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2951 2760 gene locus_tag LOCUS_31780 2951 2760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31780 2922 3122 gene locus_tag LOCUS_31790 2922 3122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31790 3588 3268 gene locus_tag LOCUS_31800 3588 3268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31800 3959 3585 gene locus_tag LOCUS_31810 3959 3585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31810 4694 3963 gene locus_tag LOCUS_31820 4694 3963 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070969.1 protein_id gnl|my_center|LOCUS_31820 5459 4776 gene locus_tag LOCUS_31830 5459 4776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_31830 >Feature sequence195 373 1689 gene locus_tag LOCUS_31840 373 1689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31840 2108 2548 gene locus_tag LOCUS_31850 2108 2548 CDS product C-GCAxxG-C-C family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358219.1 protein_id gnl|my_center|LOCUS_31850 2957 2646 gene locus_tag LOCUS_31860 2957 2646 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010201208.1 protein_id gnl|my_center|LOCUS_31860 3264 2944 gene locus_tag LOCUS_31870 3264 2944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099360.1 protein_id gnl|my_center|LOCUS_31870 4281 4919 gene locus_tag LOCUS_31880 4281 4919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31880 5068 5358 gene locus_tag LOCUS_31890 5068 5358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31890 >Feature sequence196 220 1371 gene locus_tag LOCUS_31900 220 1371 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942648.1 protein_id gnl|my_center|LOCUS_31900 1445 2311 gene locus_tag LOCUS_31910 1445 2311 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942649.1 protein_id gnl|my_center|LOCUS_31910 2329 3489 gene locus_tag LOCUS_31920 2329 3489 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942650.1 protein_id gnl|my_center|LOCUS_31920 3489 4202 gene locus_tag LOCUS_31930 3489 4202 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942651.1 protein_id gnl|my_center|LOCUS_31930 4230 4934 gene locus_tag LOCUS_31940 4230 4934 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942652.1 protein_id gnl|my_center|LOCUS_31940 4946 5365 gene locus_tag LOCUS_31950 4946 5365 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942653.1 protein_id gnl|my_center|LOCUS_31950 >Feature sequence197 1106 306 gene locus_tag LOCUS_31960 1106 306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31960 1606 1103 gene locus_tag LOCUS_31970 gene radC 1606 1103 CDS product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942813.1 protein_id gnl|my_center|LOCUS_31970 1781 1617 gene locus_tag LOCUS_31980 1781 1617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31980 2821 1853 gene locus_tag LOCUS_31990 2821 1853 CDS product PD-(D/E)XK nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942799.1 protein_id gnl|my_center|LOCUS_31990 3916 2942 gene locus_tag LOCUS_32000 3916 2942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32000 <5568 4159 gene locus_tag LOCUS_32010 <5568 4159 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002858720.1:ATP-binding protein >Feature sequence198 2477 459 gene locus_tag LOCUS_32020 2477 459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32020 2994 2506 gene locus_tag LOCUS_32030 2994 2506 CDS product GtrA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964330.1 protein_id gnl|my_center|LOCUS_32030 3950 2991 gene locus_tag LOCUS_32040 3950 2991 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989618.1 protein_id gnl|my_center|LOCUS_32040 5503 3947 gene locus_tag LOCUS_32050 5503 3947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32050 >Feature sequence199 817 188 gene locus_tag LOCUS_32060 817 188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32060 1115 2944 gene locus_tag LOCUS_32070 gene glmS 1115 2944 CDS product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940943.1 protein_id gnl|my_center|LOCUS_32070 3176 3526 gene locus_tag LOCUS_32080 3176 3526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32080 3562 3882 gene locus_tag LOCUS_32090 3562 3882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32090 3982 4134 gene locus_tag LOCUS_32100 3982 4134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32100 4152 4766 gene locus_tag LOCUS_32110 4152 4766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32110 >Feature sequence200 522 1226 gene locus_tag LOCUS_32120 522 1226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32120 1602 1291 gene locus_tag LOCUS_32130 1602 1291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32130 1962 3377 gene locus_tag LOCUS_32140 1962 3377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32140 3905 3516 gene locus_tag LOCUS_32150 3905 3516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32150 3816 4196 gene locus_tag LOCUS_32160 3816 4196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32160 <5430 4244 gene locus_tag LOCUS_32170 <5430 4244 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012256405.1:glucose-6-phosphate dehydrogenase >Feature sequence201 13 1107 gene locus_tag LOCUS_32180 13 1107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32180 1531 1331 gene locus_tag LOCUS_32190 1531 1331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32190 2645 1563 gene locus_tag LOCUS_32200 2645 1563 CDS product ADP-ribosylglycohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940869.1 protein_id gnl|my_center|LOCUS_32200 3736 2738 gene locus_tag LOCUS_32210 3736 2738 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268112.1 protein_id gnl|my_center|LOCUS_32210 4939 3854 gene locus_tag LOCUS_32220 4939 3854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32220 >Feature sequence202 3430 3167 gene locus_tag LOCUS_32230 3430 3167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32230 4935 3889 gene locus_tag LOCUS_32240 gene ltaE 4935 3889 CDS product low-specificity L-threonine aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943783.1 protein_id gnl|my_center|LOCUS_32240 5219 5145 gene locus_tag LOCUS_t00360 5219 5145 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence203 763 71 gene locus_tag LOCUS_32250 763 71 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114586.1 protein_id gnl|my_center|LOCUS_32250 1196 834 gene locus_tag LOCUS_32260 1196 834 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051076796.1 protein_id gnl|my_center|LOCUS_32260 1567 1229 gene locus_tag LOCUS_32270 1567 1229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32270 3313 2096 gene locus_tag LOCUS_32280 3313 2096 CDS product Calx-beta domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019895278.1 protein_id gnl|my_center|LOCUS_32280 4958 3501 gene locus_tag LOCUS_32290 gene cyaE 4958 3501 CDS product cyclolysin secretion protein CyaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929998.1 protein_id gnl|my_center|LOCUS_32290 5172 4948 gene locus_tag LOCUS_32300 5172 4948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32300 >Feature sequence204 747 358 gene locus_tag LOCUS_32310 747 358 CDS product four helix bundle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016267883.1 protein_id gnl|my_center|LOCUS_32310 1115 744 gene locus_tag LOCUS_32320 1115 744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_32320 1721 1146 gene locus_tag LOCUS_32330 1721 1146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_32330 2856 1978 gene locus_tag LOCUS_32340 2856 1978 CDS product YicC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942879.1 protein_id gnl|my_center|LOCUS_32340 >Feature sequence205 356 1426 gene locus_tag LOCUS_32350 gene prfA 356 1426 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943725.1 protein_id gnl|my_center|LOCUS_32350 1628 2044 gene locus_tag LOCUS_32360 1628 2044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32360 2135 2602 gene locus_tag LOCUS_32370 2135 2602 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524740.1 protein_id gnl|my_center|LOCUS_32370 3878 2667 gene locus_tag LOCUS_32380 3878 2667 CDS product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942466.1 protein_id gnl|my_center|LOCUS_32380 4356 4051 gene locus_tag LOCUS_32390 4356 4051 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941979.1 protein_id gnl|my_center|LOCUS_32390 <5294 4442 gene locus_tag LOCUS_32400 <5294 4442 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942467.1:DNA mismatch repair protein MutS >Feature sequence206 1408 104 gene locus_tag LOCUS_32410 1408 104 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940793.1 protein_id gnl|my_center|LOCUS_32410 2280 1666 gene locus_tag LOCUS_32420 2280 1666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940794.1 protein_id gnl|my_center|LOCUS_32420 2740 2273 gene locus_tag LOCUS_32430 2740 2273 CDS product WbuC family cupin fold metalloprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786607.1 protein_id gnl|my_center|LOCUS_32430 3094 2741 gene locus_tag LOCUS_32440 3094 2741 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940795.1 protein_id gnl|my_center|LOCUS_32440 4130 3108 gene locus_tag LOCUS_32450 gene hemE 4130 3108 CDS product uroporphyrinogen decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944063.1 protein_id gnl|my_center|LOCUS_32450 4470 4267 gene locus_tag LOCUS_32460 4470 4267 CDS product RNA-binding S4 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941132.1 protein_id gnl|my_center|LOCUS_32460 4741 4436 gene locus_tag LOCUS_32470 4741 4436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32470 4853 5053 gene locus_tag LOCUS_32480 4853 5053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32480 >Feature sequence207 189 1295 gene locus_tag LOCUS_32490 189 1295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32490 1759 1944 gene locus_tag LOCUS_32500 1759 1944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32500 2108 3232 gene locus_tag LOCUS_32510 2108 3232 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941973.1 protein_id gnl|my_center|LOCUS_32510 3229 4605 gene locus_tag LOCUS_32520 3229 4605 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930426.1 protein_id gnl|my_center|LOCUS_32520 5048 4731 gene locus_tag LOCUS_32530 5048 4731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32530 >Feature sequence208 125 334 gene locus_tag LOCUS_32540 125 334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32540 552 292 gene locus_tag LOCUS_32550 552 292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_32550 651 854 gene locus_tag LOCUS_32560 651 854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32560 2421 913 gene locus_tag LOCUS_32570 2421 913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32570 2689 3411 gene locus_tag LOCUS_32580 2689 3411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32580 3530 4834 gene locus_tag LOCUS_32590 3530 4834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32590 >Feature sequence209 2455 1232 gene locus_tag LOCUS_32600 2455 1232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32600 3624 2716 gene locus_tag LOCUS_32610 3624 2716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32610 4489 3770 gene locus_tag LOCUS_32620 4489 3770 CDS product LrgB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390180.1 protein_id gnl|my_center|LOCUS_32620 >Feature sequence210 756 277 gene locus_tag LOCUS_32630 756 277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32630 1665 940 gene locus_tag LOCUS_32640 1665 940 CDS product SprT family zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963651.1 protein_id gnl|my_center|LOCUS_32640 1981 1649 gene locus_tag LOCUS_32650 1981 1649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32650 2376 2663 gene locus_tag LOCUS_32660 2376 2663 CDS product integration host factor subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942168.1 protein_id gnl|my_center|LOCUS_32660 2660 3124 gene locus_tag LOCUS_32670 2660 3124 CDS product YaiI/YqxD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940846.1 protein_id gnl|my_center|LOCUS_32670 3127 4098 gene locus_tag LOCUS_32680 3127 4098 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090741.1 protein_id gnl|my_center|LOCUS_32680 4404 4664 gene locus_tag LOCUS_32690 4404 4664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32690 >Feature sequence211 362 601 gene locus_tag LOCUS_32700 362 601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32700 607 996 gene locus_tag LOCUS_32710 607 996 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000876264.1 protein_id gnl|my_center|LOCUS_32710 1149 2156 gene locus_tag LOCUS_32720 1149 2156 CDS product PDDEXK nuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266508.1 protein_id gnl|my_center|LOCUS_32720 2829 3350 gene locus_tag LOCUS_32730 2829 3350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32730 3549 3866 gene locus_tag LOCUS_32740 3549 3866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32740 4032 4772 gene locus_tag LOCUS_32750 4032 4772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32750 >Feature sequence212 1409 243 gene locus_tag LOCUS_32760 1409 243 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103065.1 protein_id gnl|my_center|LOCUS_32760 1971 1627 gene locus_tag LOCUS_32770 1971 1627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32770 2173 1940 gene locus_tag LOCUS_32780 2173 1940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32780 2757 2272 gene locus_tag LOCUS_32790 2757 2272 CDS product tRNA (cytidine(34)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941854.1 protein_id gnl|my_center|LOCUS_32790 2840 4465 gene locus_tag LOCUS_32800 gene serA 2840 4465 CDS product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941855.1 protein_id gnl|my_center|LOCUS_32800 >Feature sequence213 85 987 gene locus_tag LOCUS_32810 85 987 CDS product L,D-transpeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942225.1 protein_id gnl|my_center|LOCUS_32810 1981 1007 gene locus_tag LOCUS_32820 gene hemB 1981 1007 CDS product porphobilinogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940811.1 protein_id gnl|my_center|LOCUS_32820 2394 2050 gene locus_tag LOCUS_32830 2394 2050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943704.1 protein_id gnl|my_center|LOCUS_32830 2936 2394 gene locus_tag LOCUS_32840 2936 2394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235044918.1 protein_id gnl|my_center|LOCUS_32840 4124 3411 gene locus_tag LOCUS_32850 4124 3411 CDS product C4-type zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545753.1 protein_id gnl|my_center|LOCUS_32850 >Feature sequence214 1506 676 gene locus_tag LOCUS_32860 1506 676 CDS product bifunctional 3-demethylubiquinone 3-O-methyltransferase/2-octaprenyl-6-hydroxy phenol methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066727.1 protein_id gnl|my_center|LOCUS_32860 2884 1499 gene locus_tag LOCUS_32870 2884 1499 CDS product B12-binding domain-containing radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940912.1 protein_id gnl|my_center|LOCUS_32870 3273 3428 gene locus_tag LOCUS_32880 3273 3428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32880 3507 3698 gene locus_tag LOCUS_32890 3507 3698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32890 >Feature sequence215 741 319 gene locus_tag LOCUS_32900 741 319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000194195.1 protein_id gnl|my_center|LOCUS_32900 1694 738 gene locus_tag LOCUS_32910 1694 738 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941141.1 protein_id gnl|my_center|LOCUS_32910 2415 1774 gene locus_tag LOCUS_32920 2415 1774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32920 <4607 2720 gene locus_tag LOCUS_32930 <4607 2720 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000481742.1:YfjI family protein >Feature sequence216 222 1661 gene locus_tag LOCUS_32940 222 1661 CDS product phospholipid carrier-dependent glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946372.1 protein_id gnl|my_center|LOCUS_32940 2469 1747 gene locus_tag LOCUS_32950 2469 1747 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256313.1 protein_id gnl|my_center|LOCUS_32950 2668 2495 gene locus_tag LOCUS_32960 2668 2495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32960 3750 2674 gene locus_tag LOCUS_32970 gene lptG 3750 2674 CDS product LPS export ABC transporter permease LptG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942568.1 protein_id gnl|my_center|LOCUS_32970 4429 4124 gene locus_tag LOCUS_32980 4429 4124 CDS product YtxH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943099.1 protein_id gnl|my_center|LOCUS_32980 >Feature sequence217 13 706 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gttcactgccgcacaggcagctcagaaa 1085 795 gene locus_tag LOCUS_32990 1085 795 CDS product HigA family addiction module antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014062.1 protein_id gnl|my_center|LOCUS_32990 1474 1097 gene locus_tag LOCUS_33000 1474 1097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33000 1548 2591 gene locus_tag LOCUS_33010 1548 2591 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942731.1 protein_id gnl|my_center|LOCUS_33010 2729 3796 gene locus_tag LOCUS_33020 2729 3796 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942730.1 protein_id gnl|my_center|LOCUS_33020 3793 4362 gene locus_tag LOCUS_33030 gene gmhA 3793 4362 CDS product D-sedoheptulose 7-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942729.1 protein_id gnl|my_center|LOCUS_33030 >Feature sequence218 122 1360 gene locus_tag LOCUS_33040 122 1360 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002673537.1 protein_id gnl|my_center|LOCUS_33040 2468 1449 gene locus_tag LOCUS_33050 gene aroF 2468 1449 CDS product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943764.1 protein_id gnl|my_center|LOCUS_33050 3674 2733 gene locus_tag LOCUS_33060 3674 2733 CDS product chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941542.1 protein_id gnl|my_center|LOCUS_33060 >Feature sequence219 1332 511 gene locus_tag LOCUS_33070 1332 511 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941877.1 protein_id gnl|my_center|LOCUS_33070 3483 1399 gene locus_tag LOCUS_33080 3483 1399 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941245.1 protein_id gnl|my_center|LOCUS_33080 4003 3749 gene locus_tag LOCUS_33090 gene rpmA 4003 3749 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943850.1 protein_id gnl|my_center|LOCUS_33090 4350 4042 gene locus_tag LOCUS_33100 gene rplU 4350 4042 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943851.1 protein_id gnl|my_center|LOCUS_33100 >Feature sequence220 <1 1121 gene locus_tag LOCUS_33110 <1 1121 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011204177.1:chemotaxis protein CheA 1153 1644 gene locus_tag LOCUS_33120 gene cheW 1153 1644 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199265.1 protein_id gnl|my_center|LOCUS_33120 1673 3412 gene locus_tag LOCUS_33130 1673 3412 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004543739.1 protein_id gnl|my_center|LOCUS_33130 3465 4337 gene locus_tag LOCUS_33140 3465 4337 CDS product Chemotaxis protein methyltransferase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102222.1 protein_id gnl|my_center|LOCUS_33140 >Feature sequence221 1042 368 gene locus_tag LOCUS_33150 1042 368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33150 1054 1242 gene locus_tag LOCUS_33160 1054 1242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33160 1276 1632 gene locus_tag LOCUS_33170 1276 1632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33170 1685 2170 gene locus_tag LOCUS_33180 1685 2170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_33180 2640 2353 gene locus_tag LOCUS_33190 2640 2353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_33190 3374 3186 gene locus_tag LOCUS_33200 3374 3186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33200 3510 3956 gene locus_tag LOCUS_33210 3510 3956 CDS product NfeD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207517.1 protein_id gnl|my_center|LOCUS_33210 4000 4404 gene locus_tag LOCUS_33220 4000 4404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33220 >Feature sequence222 1973 2983 gene locus_tag LOCUS_33230 1973 2983 CDS product GPMC system family 4 glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_039643499.1 protein_id gnl|my_center|LOCUS_33230 3133 3354 gene locus_tag LOCUS_33240 3133 3354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33240 4398 3400 gene locus_tag LOCUS_33250 4398 3400 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941871.1 protein_id gnl|my_center|LOCUS_33250 >Feature sequence223 414 163 gene locus_tag LOCUS_33260 414 163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33260 784 1557 gene locus_tag LOCUS_33270 784 1557 CDS product carbon-nitrogen family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940707.1 protein_id gnl|my_center|LOCUS_33270 2467 1568 gene locus_tag LOCUS_33280 2467 1568 CDS product zinc dependent phospholipase C family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941786.1 protein_id gnl|my_center|LOCUS_33280 2576 3373 gene locus_tag LOCUS_33290 2576 3373 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941787.1 protein_id gnl|my_center|LOCUS_33290 >Feature sequence224 265 92 gene locus_tag LOCUS_33300 265 92 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33300 1731 268 gene locus_tag LOCUS_33310 1731 268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33310 3228 1972 gene locus_tag LOCUS_33320 3228 1972 CDS product glutamate-5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943829.1 protein_id gnl|my_center|LOCUS_33320 >Feature sequence225 184 693 gene locus_tag LOCUS_33330 gene gspG 184 693 CDS product type II secretion system major pseudopilin GspG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940994.1 protein_id gnl|my_center|LOCUS_33330 706 2835 gene locus_tag LOCUS_33340 706 2835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33340 3354 3761 gene locus_tag LOCUS_33350 3354 3761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33350 3877 4164 gene locus_tag LOCUS_33360 3877 4164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_33360 >Feature sequence226 193 2274 gene locus_tag LOCUS_33370 193 2274 CDS product adenylate/guanylate cyclase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028841931.1 protein_id gnl|my_center|LOCUS_33370 2271 2729 gene locus_tag LOCUS_33380 2271 2729 CDS product SH3 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545293.1 protein_id gnl|my_center|LOCUS_33380 2726 3619 gene locus_tag LOCUS_33390 2726 3619 CDS product M48 family metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546256.1 protein_id gnl|my_center|LOCUS_33390 <4383 3716 gene locus_tag LOCUS_33400 <4383 3716 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000986003.1:NupC/NupG family nucleoside CNT transporter >Feature sequence227 456 3560 gene locus_tag LOCUS_33410 456 3560 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942256.1 protein_id gnl|my_center|LOCUS_33410 >Feature sequence228 1931 435 gene locus_tag LOCUS_33420 1931 435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33420 2151 2549 gene locus_tag LOCUS_33430 2151 2549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33430 2631 3398 gene locus_tag LOCUS_33440 gene fkpA 2631 3398 CDS product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174645.1 protein_id gnl|my_center|LOCUS_33440 3577 4161 gene locus_tag LOCUS_33450 3577 4161 CDS product SCO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942047.1 protein_id gnl|my_center|LOCUS_33450 >Feature sequence229 930 857 gene locus_tag LOCUS_t00370 930 857 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 1534 992 gene locus_tag LOCUS_33460 1534 992 CDS product 2-oxoacid:acceptor oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942504.1 protein_id gnl|my_center|LOCUS_33460 2368 1625 gene locus_tag LOCUS_33470 2368 1625 CDS product thiamine pyrophosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942505.1 protein_id gnl|my_center|LOCUS_33470 3473 2388 gene locus_tag LOCUS_33480 3473 2388 CDS product 3-methyl-2-oxobutanoate dehydrogenase subunit VorB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942506.1 protein_id gnl|my_center|LOCUS_33480 3685 3479 gene locus_tag LOCUS_33490 3685 3479 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942507.1 protein_id gnl|my_center|LOCUS_33490 >Feature sequence230 625 149 gene locus_tag LOCUS_33500 625 149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33500 1092 646 gene locus_tag LOCUS_33510 1092 646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33510 1600 2919 gene locus_tag LOCUS_33520 1600 2919 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251170.1 protein_id gnl|my_center|LOCUS_33520 3288 3130 gene locus_tag LOCUS_33530 3288 3130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33530 3663 3313 gene locus_tag LOCUS_33540 3663 3313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33540 3907 3632 gene locus_tag LOCUS_33550 3907 3632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33550 4263 3967 gene locus_tag LOCUS_33560 4263 3967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33560 >Feature sequence231 76 765 gene locus_tag LOCUS_33570 76 765 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941355.1 protein_id gnl|my_center|LOCUS_33570 795 1421 gene locus_tag LOCUS_33580 795 1421 CDS product CAP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941829.1 protein_id gnl|my_center|LOCUS_33580 2455 1541 gene locus_tag LOCUS_33590 gene nadA 2455 1541 CDS product quinolinate synthase NadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940699.1 protein_id gnl|my_center|LOCUS_33590 3266 3742 gene locus_tag LOCUS_33600 3266 3742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33600 >Feature sequence232 22 183 gene locus_tag LOCUS_33610 22 183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33610 544 1077 gene locus_tag LOCUS_33620 544 1077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33620 1428 2246 gene locus_tag LOCUS_33630 1428 2246 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766271.1 protein_id gnl|my_center|LOCUS_33630 3244 2501 gene locus_tag LOCUS_33640 3244 2501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33640 >Feature sequence233 1686 238 gene locus_tag LOCUS_33650 gene gcvPB 1686 238 CDS product aminomethyl-transferring glycine dehydrogenase subunit GcvPB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941046.1 protein_id gnl|my_center|LOCUS_33650 3023 1677 gene locus_tag LOCUS_33660 gene gcvPA 3023 1677 CDS product aminomethyl-transferring glycine dehydrogenase subunit GcvPA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941045.1 protein_id gnl|my_center|LOCUS_33660 3405 3034 gene locus_tag LOCUS_33670 gene gcvH 3405 3034 CDS product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941044.1 protein_id gnl|my_center|LOCUS_33670 <4230 3479 gene locus_tag LOCUS_33680 <4230 3479 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941043.1:glycine cleavage system aminomethyltransferase GcvT >Feature sequence234 1445 348 gene locus_tag LOCUS_33690 1445 348 CDS product TIGR04283 family arsenosugar biosynthesis glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941541.1 protein_id gnl|my_center|LOCUS_33690 2134 1448 gene locus_tag LOCUS_33700 2134 1448 CDS product TVP38/TMEM64 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941968.1 protein_id gnl|my_center|LOCUS_33700 <4202 2131 gene locus_tag LOCUS_33710 <4202 2131 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010958393.1:aconitate hydratase AcnA >Feature sequence235 1275 145 gene locus_tag LOCUS_33720 1275 145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33720 1663 1424 gene locus_tag LOCUS_33730 1663 1424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33730 1930 1667 gene locus_tag LOCUS_33740 1930 1667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33740 2717 2070 gene locus_tag LOCUS_33750 2717 2070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33750 3949 2720 gene locus_tag LOCUS_33760 3949 2720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33760 >Feature sequence236 371 937 gene locus_tag LOCUS_33770 371 937 CDS product molecular chaperone TorD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932180.1 protein_id gnl|my_center|LOCUS_33770 939 3194 gene locus_tag LOCUS_33780 939 3194 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546592.1 protein_id gnl|my_center|LOCUS_33780 3243 4049 gene locus_tag LOCUS_33790 3243 4049 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461975.1 protein_id gnl|my_center|LOCUS_33790 >Feature sequence237 1429 29 gene locus_tag LOCUS_33800 1429 29 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33800 1870 1481 gene locus_tag LOCUS_33810 1870 1481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33810 2702 2370 gene locus_tag LOCUS_33820 2702 2370 CDS product DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261951.1 protein_id gnl|my_center|LOCUS_33820 3016 2702 gene locus_tag LOCUS_33830 3016 2702 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000843587.1 protein_id gnl|my_center|LOCUS_33830 3294 3058 gene locus_tag LOCUS_33840 3294 3058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33840 >Feature sequence238 225 557 gene locus_tag LOCUS_33850 225 557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33850 505 783 gene locus_tag LOCUS_33860 505 783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33860 780 1022 gene locus_tag LOCUS_33870 780 1022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33870 2536 1673 gene locus_tag LOCUS_33880 2536 1673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33880 4047 2824 gene locus_tag LOCUS_33890 4047 2824 CDS product ISNCY-like element ISRm17 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970069.1 protein_id gnl|my_center|LOCUS_33890 >Feature sequence239 420 271 gene locus_tag LOCUS_33900 420 271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33900 1463 495 gene locus_tag LOCUS_33910 1463 495 CDS product PD-(D/E)XK nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942799.1 protein_id gnl|my_center|LOCUS_33910 2567 1599 gene locus_tag LOCUS_33920 2567 1599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33920 <4091 2809 gene locus_tag LOCUS_33930 <4091 2809 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002858720.1:ATP-binding protein >Feature sequence240 831 757 gene locus_tag LOCUS_t00380 831 757 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 970 895 gene locus_tag LOCUS_t00390 970 895 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 1455 1192 gene locus_tag LOCUS_33940 1455 1192 CDS product cytochrome c3 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941274.1 protein_id gnl|my_center|LOCUS_33940 2035 1535 gene locus_tag LOCUS_33950 gene purE 2035 1535 CDS product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941273.1 protein_id gnl|my_center|LOCUS_33950 3352 2078 gene locus_tag LOCUS_33960 gene purD 3352 2078 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941272.1 protein_id gnl|my_center|LOCUS_33960 <4090 3393 gene locus_tag LOCUS_33970 <4090 3393 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012545749.1:bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase >Feature sequence241 291 497 gene locus_tag LOCUS_33980 291 497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33980 494 892 gene locus_tag LOCUS_33990 494 892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33990 932 1177 gene locus_tag LOCUS_34000 932 1177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34000 1174 1584 gene locus_tag LOCUS_34010 1174 1584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34010 1664 2419 gene locus_tag LOCUS_34020 1664 2419 CDS product lipoate--protein ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941047.1 protein_id gnl|my_center|LOCUS_34020 2416 3258 gene locus_tag LOCUS_34030 gene lipA 2416 3258 CDS product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941048.1 protein_id gnl|my_center|LOCUS_34030 3293 3700 gene locus_tag LOCUS_34040 3293 3700 CDS product PaaI family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064953.1 protein_id gnl|my_center|LOCUS_34040 >Feature sequence242 495 160 gene locus_tag LOCUS_34050 495 160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34050 809 1135 gene locus_tag LOCUS_34060 809 1135 CDS product cytochrome c peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926808.1 protein_id gnl|my_center|LOCUS_34060 2517 1654 gene locus_tag LOCUS_34070 gene nifH 2517 1654 CDS product nitrogenase iron protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943447.1 protein_id gnl|my_center|LOCUS_34070 >Feature sequence243 136 294 gene locus_tag LOCUS_34080 136 294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34080 420 827 gene locus_tag LOCUS_34090 420 827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34090 2678 1746 gene locus_tag LOCUS_34100 gene xerD 2678 1746 CDS product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723602.1 protein_id gnl|my_center|LOCUS_34100 2894 3157 gene locus_tag LOCUS_34110 2894 3157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34110 3157 3624 gene locus_tag LOCUS_34120 3157 3624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34120 3793 3936 gene locus_tag LOCUS_34130 3793 3936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34130 >Feature sequence244 224 1075 gene locus_tag LOCUS_34140 224 1075 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942052.1 protein_id gnl|my_center|LOCUS_34140 1056 1913 gene locus_tag LOCUS_34150 1056 1913 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942919.1 protein_id gnl|my_center|LOCUS_34150 1910 3496 gene locus_tag LOCUS_34160 gene lnt 1910 3496 CDS product apolipoprotein N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545206.1 protein_id gnl|my_center|LOCUS_34160 >Feature sequence245 741 136 gene locus_tag LOCUS_34170 gene yfbR 741 136 CDS product 5'-deoxynucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482513.1 protein_id gnl|my_center|LOCUS_34170 1886 744 gene locus_tag LOCUS_34180 1886 744 CDS product deoxyguanosinetriphosphate triphosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941902.1 protein_id gnl|my_center|LOCUS_34180 2414 1932 gene locus_tag LOCUS_34190 2414 1932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943763.1 protein_id gnl|my_center|LOCUS_34190 3107 3973 gene locus_tag LOCUS_34200 3107 3973 CDS product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963796.1 protein_id gnl|my_center|LOCUS_34200 >Feature sequence246 268 393 gene locus_tag LOCUS_34210 268 393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34210 449 625 gene locus_tag LOCUS_34220 449 625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34220 2391 1201 gene locus_tag LOCUS_34230 2391 1201 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095144.1 protein_id gnl|my_center|LOCUS_34230 3753 2887 gene locus_tag LOCUS_34240 3753 2887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34240 >Feature sequence247 2316 223 gene locus_tag LOCUS_34250 2316 223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34250 2695 2552 gene locus_tag LOCUS_34260 2695 2552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34260 3899 2859 gene locus_tag LOCUS_34270 3899 2859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34270 >Feature sequence248 <1 1382 gene locus_tag LOCUS_34280 <1 1382 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943097.1:penicillin-binding transpeptidase domain-containing protein 2109 1372 gene locus_tag LOCUS_34290 2109 1372 CDS product UDP-2,3-diacylglucosamine diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943095.1 protein_id gnl|my_center|LOCUS_34290 2172 2627 gene locus_tag LOCUS_34300 2172 2627 CDS product UPF0158 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943094.1 protein_id gnl|my_center|LOCUS_34300 2636 3691 gene locus_tag LOCUS_34310 2636 3691 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943093.1 protein_id gnl|my_center|LOCUS_34310 >Feature sequence249 2574 1648 gene locus_tag LOCUS_34320 2574 1648 CDS product YihY/virulence factor BrkB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090797.1 protein_id gnl|my_center|LOCUS_34320 3147 2818 gene locus_tag LOCUS_34330 3147 2818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34330 3392 3213 gene locus_tag LOCUS_34340 3392 3213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34340 >Feature sequence250 756 433 gene locus_tag LOCUS_34350 756 433 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942391.1 protein_id gnl|my_center|LOCUS_34350 922 2616 gene locus_tag LOCUS_34360 922 2616 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942806.1 protein_id gnl|my_center|LOCUS_34360 2613 2894 gene locus_tag LOCUS_34370 2613 2894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024889622.1 protein_id gnl|my_center|LOCUS_34370 3114 3038 gene locus_tag LOCUS_t00400 3114 3038 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence251 122 832 gene locus_tag LOCUS_34380 gene rnc 122 832 CDS product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942868.1 protein_id gnl|my_center|LOCUS_34380 829 1878 gene locus_tag LOCUS_34390 829 1878 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942867.1 protein_id gnl|my_center|LOCUS_34390 1882 2955 gene locus_tag LOCUS_34400 1882 2955 CDS product M42 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942836.1 protein_id gnl|my_center|LOCUS_34400 >Feature sequence252 1340 150 gene locus_tag LOCUS_34410 1340 150 CDS product FprA family A-type flavoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428474.1 protein_id gnl|my_center|LOCUS_34410 1522 2100 gene locus_tag LOCUS_34420 1522 2100 CDS product HEAT repeat domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940960.1 protein_id gnl|my_center|LOCUS_34420 3488 2097 gene locus_tag LOCUS_34430 3488 2097 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940959.1 protein_id gnl|my_center|LOCUS_34430 >Feature sequence253 1418 1176 gene locus_tag LOCUS_34440 1418 1176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34440 2620 1628 gene locus_tag LOCUS_34450 2620 1628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34450 3621 2686 gene locus_tag LOCUS_34460 3621 2686 CDS product CsgG/HfaB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005421307.1 protein_id gnl|my_center|LOCUS_34460 >Feature sequence254 323 1429 gene locus_tag LOCUS_34470 323 1429 CDS product geranylgeranyl reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392329.1 protein_id gnl|my_center|LOCUS_34470 2019 1441 gene locus_tag LOCUS_34480 2019 1441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34480 2729 2214 gene locus_tag LOCUS_34490 2729 2214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34490 >Feature sequence255 <1 1117 gene locus_tag LOCUS_34500 <1 1117 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942465.1:[protein-PII] uridylyltransferase 1295 1675 gene locus_tag LOCUS_34510 1295 1675 CDS product NifB/NifX family molybdenum-iron cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942061.1 protein_id gnl|my_center|LOCUS_34510 1679 2005 gene locus_tag LOCUS_34520 1679 2005 CDS product DUF134 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942058.1 protein_id gnl|my_center|LOCUS_34520 2119 2517 gene locus_tag LOCUS_34530 2119 2517 CDS product iron-sulfur cluster assembly scaffold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942057.1 protein_id gnl|my_center|LOCUS_34530 2575 3462 gene locus_tag LOCUS_34540 gene xerD 2575 3462 CDS product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942464.1 protein_id gnl|my_center|LOCUS_34540 >Feature sequence256 594 220 gene locus_tag LOCUS_34550 594 220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34550 1393 1572 gene locus_tag LOCUS_34560 1393 1572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34560 2128 1934 gene locus_tag LOCUS_34570 2128 1934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34570 <3512 2313 gene locus_tag LOCUS_34580 <3512 2313 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_235044884.1:PAS domain S-box protein >Feature sequence257 1688 279 gene locus_tag LOCUS_34590 1688 279 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946820.1 protein_id gnl|my_center|LOCUS_34590 2823 2338 gene locus_tag LOCUS_34600 gene radC 2823 2338 CDS product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942813.1 protein_id gnl|my_center|LOCUS_34600 3252 2911 gene locus_tag LOCUS_34610 3252 2911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34610 3371 3249 gene locus_tag LOCUS_34620 3371 3249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34620 >Feature sequence258 109 1632 gene locus_tag LOCUS_34630 109 1632 CDS product IS66-like element ISCro1 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000381397.1 protein_id gnl|my_center|LOCUS_34630 1920 1651 gene locus_tag LOCUS_34640 1920 1651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_34640 2962 2132 gene locus_tag LOCUS_34650 2962 2132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_34650 >Feature sequence259 3340 254 gene locus_tag LOCUS_34660 3340 254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34660 >Feature sequence260 2868 208 gene locus_tag LOCUS_34670 2868 208 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942688.1 protein_id gnl|my_center|LOCUS_34670 3063 3293 gene locus_tag LOCUS_34680 3063 3293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34680 >Feature sequence261 <1 728 gene locus_tag LOCUS_34690 <1 728 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941767.1:citrate (Si)-synthase 1141 1521 gene locus_tag LOCUS_34700 1141 1521 CDS product desulfoferrodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940441.1 protein_id gnl|my_center|LOCUS_34700 2609 1680 gene locus_tag LOCUS_34710 2609 1680 CDS product D-2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707438.1 protein_id gnl|my_center|LOCUS_34710 >Feature sequence262 476 1963 gene locus_tag LOCUS_34720 476 1963 CDS product lipopolysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528104.1 protein_id gnl|my_center|LOCUS_34720 1960 2361 gene locus_tag LOCUS_34730 1960 2361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34730 2403 2648 gene locus_tag LOCUS_34740 2403 2648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34740 >Feature sequence263 1254 811 gene locus_tag LOCUS_34750 1254 811 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942129.1 protein_id gnl|my_center|LOCUS_34750 1374 1835 gene locus_tag LOCUS_34760 gene rimI 1374 1835 CDS product ribosomal protein S18-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942401.1 protein_id gnl|my_center|LOCUS_34760 1835 2653 gene locus_tag LOCUS_34770 1835 2653 CDS product dihydroorotate dehydrogenase electron transfer subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942400.1 protein_id gnl|my_center|LOCUS_34770 >Feature sequence264 602 171 gene locus_tag LOCUS_34780 602 171 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941977.1 protein_id gnl|my_center|LOCUS_34780 1330 599 gene locus_tag LOCUS_34790 1330 599 CDS product cytochrome c biogenesis protein CcdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941976.1 protein_id gnl|my_center|LOCUS_34790 1883 1341 gene locus_tag LOCUS_34800 1883 1341 CDS product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941975.1 protein_id gnl|my_center|LOCUS_34800 2922 1954 gene locus_tag LOCUS_34810 2922 1954 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941971.1 protein_id gnl|my_center|LOCUS_34810 >Feature sequence265 768 544 gene locus_tag LOCUS_34820 768 544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34820 1767 1339 gene locus_tag LOCUS_34830 1767 1339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34830 <3229 1921 gene locus_tag LOCUS_34840 <3229 1921 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010946820.1:tyrosine-type recombinase/integrase >Feature sequence266 790 638 gene locus_tag LOCUS_34850 790 638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34850 1318 1485 gene locus_tag LOCUS_34860 1318 1485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34860 1758 2003 gene locus_tag LOCUS_34870 1758 2003 CDS product type II toxin-antitoxin system prevent-host-death family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943075.1 protein_id gnl|my_center|LOCUS_34870 1993 2277 gene locus_tag LOCUS_34880 1993 2277 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943076.1 protein_id gnl|my_center|LOCUS_34880 >Feature sequence267 3 635 gene locus_tag LOCUS_34890 3 635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34890 596 1144 gene locus_tag LOCUS_34900 596 1144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34900 1224 2318 gene locus_tag LOCUS_34910 1224 2318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34910 <3084 2437 gene locus_tag LOCUS_34920 <3084 2437 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943682.1:NADPH-dependent glutamate synthase >Feature sequence268 274 582 gene locus_tag LOCUS_34930 274 582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34930 686 1480 gene locus_tag LOCUS_34940 686 1480 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030868.1 protein_id gnl|my_center|LOCUS_34940 1553 2263 gene locus_tag LOCUS_34950 1553 2263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34950 >Feature sequence269 1698 1183 gene locus_tag LOCUS_34960 1698 1183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_34960 2373 1702 gene locus_tag LOCUS_34970 2373 1702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_34970 >Feature sequence270 1626 949 gene locus_tag LOCUS_34980 1626 949 CDS product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941396.1 protein_id gnl|my_center|LOCUS_34980 1776 2669 gene locus_tag LOCUS_34990 1776 2669 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940889.1 protein_id gnl|my_center|LOCUS_34990 >Feature sequence271 991 578 gene locus_tag LOCUS_35000 991 578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35000 1278 1024 gene locus_tag LOCUS_35010 1278 1024 CDS product YfhL family 4Fe-4S dicluster ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195247.1 protein_id gnl|my_center|LOCUS_35010 2258 2515 gene locus_tag LOCUS_35020 2258 2515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35020 2512 2889 gene locus_tag LOCUS_35030 2512 2889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35030 >Feature sequence272 267 1220 gene locus_tag LOCUS_35040 267 1220 CDS product PDDEXK nuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017159.1 protein_id gnl|my_center|LOCUS_35040 1283 2404 gene locus_tag LOCUS_35050 1283 2404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35050 >Feature sequence273 285 1256 gene locus_tag LOCUS_35060 285 1256 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941155.1 protein_id gnl|my_center|LOCUS_35060 2318 1284 gene locus_tag LOCUS_35070 2318 1284 CDS product FemAB family PEP-CTERM system-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011787328.1 protein_id gnl|my_center|LOCUS_35070 >Feature sequence274 806 648 gene locus_tag LOCUS_35080 806 648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35080 1293 943 gene locus_tag LOCUS_35090 1293 943 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942074.1 protein_id gnl|my_center|LOCUS_35090 1765 1406 gene locus_tag LOCUS_35100 gene arsD 1765 1406 CDS product arsenite efflux transporter metallochaperone ArsD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324069.1 protein_id gnl|my_center|LOCUS_35100 2420 1848 gene locus_tag LOCUS_35110 2420 1848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_35110 2589 2404 gene locus_tag LOCUS_35120 2589 2404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_35120 >Feature sequence275 1321 374 gene locus_tag LOCUS_35130 1321 374 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943586.1 protein_id gnl|my_center|LOCUS_35130 2330 1416 gene locus_tag LOCUS_35140 2330 1416 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942842.1 protein_id gnl|my_center|LOCUS_35140