>Feature sequence001 1037 99 gene locus_tag LOCUS_00010 1037 99 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00010 1123 1395 gene locus_tag LOCUS_00020 1123 1395 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125708.1 protein_id gnl|my_center|LOCUS_00020 1500 2246 gene locus_tag LOCUS_00030 1500 2246 CDS product creatininase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057232.1 protein_id gnl|my_center|LOCUS_00030 2371 3765 gene locus_tag LOCUS_00040 2371 3765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00040 5269 3878 gene locus_tag LOCUS_00050 5269 3878 CDS product ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142146.1 protein_id gnl|my_center|LOCUS_00050 5449 5985 gene locus_tag LOCUS_00060 5449 5985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00060 7267 6185 gene locus_tag LOCUS_00070 gene psbA 7267 6185 CDS product photosystem II q(b) protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057317.1 protein_id gnl|my_center|LOCUS_00070 9296 7797 gene locus_tag LOCUS_00080 9296 7797 CDS product MBOAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119569.1 protein_id gnl|my_center|LOCUS_00080 12432 9409 gene locus_tag LOCUS_00090 12432 9409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00090 12822 13049 gene locus_tag LOCUS_00100 12822 13049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00100 13160 16309 gene locus_tag LOCUS_00110 gene ppc 13160 16309 CDS product phosphoenolpyruvate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057749.1 protein_id gnl|my_center|LOCUS_00110 16397 16651 gene locus_tag LOCUS_00120 16397 16651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00120 17128 16739 gene locus_tag LOCUS_00130 17128 16739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00130 17368 17673 gene locus_tag LOCUS_00140 17368 17673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00140 18448 17855 gene locus_tag LOCUS_00150 18448 17855 CDS product Maf family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057142.1 protein_id gnl|my_center|LOCUS_00150 19016 18471 gene locus_tag LOCUS_00160 gene psbP 19016 18471 CDS product photosystem II reaction center PsbP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057910.1 protein_id gnl|my_center|LOCUS_00160 19086 19712 gene locus_tag LOCUS_00170 19086 19712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00170 21124 19724 gene locus_tag LOCUS_00180 21124 19724 CDS product PP2C family protein-serine/threonine phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058070.1 protein_id gnl|my_center|LOCUS_00180 23639 21954 gene locus_tag LOCUS_00190 23639 21954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00190 24515 23865 gene locus_tag LOCUS_00200 gene nusB 24515 23865 CDS product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056630.1 protein_id gnl|my_center|LOCUS_00200 25541 24819 gene locus_tag LOCUS_00210 25541 24819 CDS product DUF502 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124163.1 protein_id gnl|my_center|LOCUS_00210 27943 26465 gene locus_tag LOCUS_00220 27943 26465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00220 29196 28108 gene locus_tag LOCUS_00230 gene cobD 29196 28108 CDS product threonine-phosphate decarboxylase CobD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058099.1 protein_id gnl|my_center|LOCUS_00230 29515 29231 gene locus_tag LOCUS_00240 29515 29231 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921010.1 protein_id gnl|my_center|LOCUS_00240 32188 30044 gene locus_tag LOCUS_00250 32188 30044 CDS product AMIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058177.1 protein_id gnl|my_center|LOCUS_00250 33112 32354 gene locus_tag LOCUS_00260 33112 32354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058176.1 protein_id gnl|my_center|LOCUS_00260 33879 33109 gene locus_tag LOCUS_00270 33879 33109 CDS product PilN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058175.1 protein_id gnl|my_center|LOCUS_00270 35114 34002 gene locus_tag LOCUS_00280 gene pilM 35114 34002 CDS product type IV pilus assembly protein PilM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921030.1 protein_id gnl|my_center|LOCUS_00280 35403 36554 gene locus_tag LOCUS_00290 35403 36554 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920974.1 protein_id gnl|my_center|LOCUS_00290 39672 36859 gene locus_tag LOCUS_00300 39672 36859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00300 39879 40928 gene locus_tag LOCUS_00310 gene hisC 39879 40928 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121508.1 protein_id gnl|my_center|LOCUS_00310 41282 41983 gene locus_tag LOCUS_00320 41282 41983 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140728.1 protein_id gnl|my_center|LOCUS_00320 42270 42572 gene locus_tag LOCUS_00330 42270 42572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00330 43962 42712 gene locus_tag LOCUS_00340 43962 42712 CDS product folylpolyglutamate synthase/dihydrofolate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099798996.1 protein_id gnl|my_center|LOCUS_00340 44434 44309 gene locus_tag LOCUS_00350 44434 44309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00350 45090 44560 gene locus_tag LOCUS_00360 45090 44560 CDS product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056687.1 protein_id gnl|my_center|LOCUS_00360 45288 45797 gene locus_tag LOCUS_00370 45288 45797 CDS product TIGR02652 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058200.1 protein_id gnl|my_center|LOCUS_00370 45873 46316 gene locus_tag LOCUS_00380 45873 46316 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057581.1 protein_id gnl|my_center|LOCUS_00380 46463 49321 gene locus_tag LOCUS_00390 46463 49321 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197524115.1 protein_id gnl|my_center|LOCUS_00390 49760 50587 gene locus_tag LOCUS_00400 gene map 49760 50587 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056279.1 protein_id gnl|my_center|LOCUS_00400 50900 51130 gene locus_tag LOCUS_00410 50900 51130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00410 52268 51093 gene locus_tag LOCUS_00420 52268 51093 CDS product CO2 hydration protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057960.1 protein_id gnl|my_center|LOCUS_00420 53902 52400 gene locus_tag LOCUS_00430 53902 52400 CDS product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142080.1 protein_id gnl|my_center|LOCUS_00430 55791 53935 gene locus_tag LOCUS_00440 55791 53935 CDS product NAD(P)H-quinone oxidoreductase subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057958.1 protein_id gnl|my_center|LOCUS_00440 56428 56736 gene locus_tag LOCUS_00450 56428 56736 CDS product BMC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142094.1 protein_id gnl|my_center|LOCUS_00450 56888 57232 gene locus_tag LOCUS_00460 56888 57232 CDS product carbon dioxide-concentrating mechanism protein CcmK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056790.1 protein_id gnl|my_center|LOCUS_00460 57239 57541 gene locus_tag LOCUS_00470 57239 57541 CDS product EutN/CcmL family microcompartment protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142092.1 protein_id gnl|my_center|LOCUS_00470 57823 59529 gene locus_tag LOCUS_00480 57823 59529 CDS product ribulose bisphosphate carboxylase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023171949.1 protein_id gnl|my_center|LOCUS_00480 59634 60383 gene locus_tag LOCUS_00490 59634 60383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00490 60448 61215 gene locus_tag LOCUS_00500 60448 61215 CDS product BMC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048869675.1 protein_id gnl|my_center|LOCUS_00500 61580 62518 gene locus_tag LOCUS_00510 61580 62518 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920971.1 protein_id gnl|my_center|LOCUS_00510 62691 64274 gene locus_tag LOCUS_00520 62691 64274 CDS product PAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944047.1 protein_id gnl|my_center|LOCUS_00520 64307 65935 gene locus_tag LOCUS_00530 gene muiA 64307 65935 CDS product mucoidy inhibitor MuiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114297.1 protein_id gnl|my_center|LOCUS_00530 66009 67541 gene locus_tag LOCUS_00540 66009 67541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00540 69055 67712 gene locus_tag LOCUS_00550 gene mgtE 69055 67712 CDS product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141924.1 protein_id gnl|my_center|LOCUS_00550 70577 70446 gene locus_tag LOCUS_00560 70577 70446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00560 70946 74161 gene locus_tag LOCUS_00570 70946 74161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00570 75420 74158 gene locus_tag LOCUS_00580 75420 74158 CDS product RNA-guided endonuclease TnpB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000942660.1 protein_id gnl|my_center|LOCUS_00580 76488 75685 gene locus_tag LOCUS_00590 76488 75685 CDS product sugar phosphate nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235282074.1 protein_id gnl|my_center|LOCUS_00590 77030 76707 gene locus_tag LOCUS_00600 77030 76707 CDS product DUF1232 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056708.1 protein_id gnl|my_center|LOCUS_00600 77248 78033 gene locus_tag LOCUS_00610 77248 78033 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920671.1 protein_id gnl|my_center|LOCUS_00610 78071 78763 gene locus_tag LOCUS_00620 78071 78763 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920634.1 protein_id gnl|my_center|LOCUS_00620 79052 79210 gene locus_tag LOCUS_00630 79052 79210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00630 80337 79630 gene locus_tag LOCUS_00640 gene psb29 80337 79630 CDS product photosystem II biogenesis protein Psp29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056976.1 protein_id gnl|my_center|LOCUS_00640 80616 81218 gene locus_tag LOCUS_00650 80616 81218 CDS product chromophore lyase CpcT/CpeT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_040689791.1 protein_id gnl|my_center|LOCUS_00650 81583 81215 gene locus_tag LOCUS_00660 81583 81215 CDS product STAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942075.1 protein_id gnl|my_center|LOCUS_00660 83080 82031 gene locus_tag LOCUS_00670 gene hemF 83080 82031 CDS product oxygen-dependent coproporphyrinogen oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920736.1 protein_id gnl|my_center|LOCUS_00670 83707 84231 gene locus_tag LOCUS_00680 83707 84231 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920865.1 protein_id gnl|my_center|LOCUS_00680 84431 85501 gene locus_tag LOCUS_00690 84431 85501 CDS product Mrp/NBP35 family ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928792.1 protein_id gnl|my_center|LOCUS_00690 85602 86912 gene locus_tag LOCUS_00700 gene rodA 85602 86912 CDS product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920901.1 protein_id gnl|my_center|LOCUS_00700 87013 87210 gene locus_tag LOCUS_00710 87013 87210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00710 87542 88198 gene locus_tag LOCUS_00720 87542 88198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143006.1 protein_id gnl|my_center|LOCUS_00720 88351 90498 gene locus_tag LOCUS_00730 88351 90498 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058305.1 protein_id gnl|my_center|LOCUS_00730 91332 92270 gene locus_tag LOCUS_00740 91332 92270 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056512.1 protein_id gnl|my_center|LOCUS_00740 92344 93735 gene locus_tag LOCUS_00750 92344 93735 CDS product UDP-glucose/GDP-mannose dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056511.1 protein_id gnl|my_center|LOCUS_00750 94598 93804 gene locus_tag LOCUS_00760 94598 93804 CDS product DUF2993 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140639.1 protein_id gnl|my_center|LOCUS_00760 95342 94749 gene locus_tag LOCUS_00770 95342 94749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00770 95461 96939 gene locus_tag LOCUS_00780 95461 96939 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403192.1 protein_id gnl|my_center|LOCUS_00780 97030 97560 gene locus_tag LOCUS_00790 97030 97560 CDS product dihydrofolate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024413.1 protein_id gnl|my_center|LOCUS_00790 97818 98468 gene locus_tag LOCUS_00800 97818 98468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00800 98574 99392 gene locus_tag LOCUS_00810 98574 99392 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141358.1 protein_id gnl|my_center|LOCUS_00810 99418 100128 gene locus_tag LOCUS_00820 99418 100128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00820 101817 100540 gene locus_tag LOCUS_00830 101817 100540 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235044964.1 protein_id gnl|my_center|LOCUS_00830 102745 102278 gene locus_tag LOCUS_00840 102745 102278 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263922.1 protein_id gnl|my_center|LOCUS_00840 104488 102995 gene locus_tag LOCUS_00850 104488 102995 CDS product glycosyltransferase family 39 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124214.1 protein_id gnl|my_center|LOCUS_00850 104764 105411 gene locus_tag LOCUS_00860 104764 105411 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056621.1 protein_id gnl|my_center|LOCUS_00860 105501 106031 gene locus_tag LOCUS_00870 105501 106031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099797617.1 protein_id gnl|my_center|LOCUS_00870 106108 106995 gene locus_tag LOCUS_00880 106108 106995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920654.1 protein_id gnl|my_center|LOCUS_00880 108069 107305 gene locus_tag LOCUS_00890 108069 107305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00890 109033 108557 gene locus_tag LOCUS_00900 109033 108557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00900 109109 109891 gene locus_tag LOCUS_00910 109109 109891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00910 110859 115049 gene locus_tag LOCUS_00920 110859 115049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00920 115487 115984 gene locus_tag LOCUS_00930 115487 115984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00930 117983 116367 gene locus_tag LOCUS_00940 117983 116367 CDS product nickel-dependent hydrogenase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258626.1 protein_id gnl|my_center|LOCUS_00940 119113 118151 gene locus_tag LOCUS_00950 119113 118151 CDS product hydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258627.1 protein_id gnl|my_center|LOCUS_00950 119304 119113 gene locus_tag LOCUS_00960 119304 119113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00960 119913 120884 gene locus_tag LOCUS_00970 119913 120884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00970 120963 121229 gene locus_tag LOCUS_00980 120963 121229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00980 121238 121462 gene locus_tag LOCUS_00990 121238 121462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00990 121633 122871 gene locus_tag LOCUS_01000 121633 122871 CDS product NHL repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258620.1 protein_id gnl|my_center|LOCUS_01000 123093 125576 gene locus_tag LOCUS_01010 gene hypF 123093 125576 CDS product carbamoyltransferase HypF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940975.1 protein_id gnl|my_center|LOCUS_01010 125764 126021 gene locus_tag LOCUS_01020 gene hypC 125764 126021 CDS product HypC/HybG/HupF family hydrogenase formation chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338277.1 protein_id gnl|my_center|LOCUS_01020 126068 127198 gene locus_tag LOCUS_01030 gene hypD 126068 127198 CDS product hydrogenase formation protein HypD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728537.1 protein_id gnl|my_center|LOCUS_01030 127398 128546 gene locus_tag LOCUS_01040 127398 128546 CDS product FAD binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974144.1 protein_id gnl|my_center|LOCUS_01040 128766 129866 gene locus_tag LOCUS_01050 gene hypE 128766 129866 CDS product hydrogenase expression/formation protein HypE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225638.1 protein_id gnl|my_center|LOCUS_01050 130076 130417 gene locus_tag LOCUS_01060 gene hypA 130076 130417 CDS product hydrogenase maturation nickel metallochaperone HypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941042.1 protein_id gnl|my_center|LOCUS_01060 130408 131262 gene locus_tag LOCUS_01070 gene hypB 130408 131262 CDS product hydrogenase nickel incorporation protein HypB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933458.1 protein_id gnl|my_center|LOCUS_01070 131674 131327 gene locus_tag LOCUS_01080 131674 131327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01080 132866 131973 gene locus_tag LOCUS_01090 132866 131973 CDS product fructosamine kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143165.1 protein_id gnl|my_center|LOCUS_01090 134219 132936 gene locus_tag LOCUS_01100 134219 132936 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142580.1 protein_id gnl|my_center|LOCUS_01100 134884 136680 gene locus_tag LOCUS_01110 134884 136680 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530674.1 protein_id gnl|my_center|LOCUS_01110 136701 137135 gene locus_tag LOCUS_01120 136701 137135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01120 137665 137444 gene locus_tag LOCUS_01130 137665 137444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01130 139017 137596 gene locus_tag LOCUS_01140 139017 137596 CDS product IS66-like element ISH10B family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289081.1 protein_id gnl|my_center|LOCUS_01140 139170 140792 gene locus_tag LOCUS_01150 139170 140792 CDS product glycosyltransferase family 39 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532497.1 protein_id gnl|my_center|LOCUS_01150 140826 142139 gene locus_tag LOCUS_01160 140826 142139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01160 142213 143727 gene locus_tag LOCUS_01170 gene crtD 142213 143727 CDS product C-3',4' desaturase CrtD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056087.1 protein_id gnl|my_center|LOCUS_01170 144991 144122 gene locus_tag LOCUS_01180 144991 144122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01180 145451 145146 gene locus_tag LOCUS_01190 145451 145146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01190 145820 148636 gene locus_tag LOCUS_01200 145820 148636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01200 148937 149770 gene locus_tag LOCUS_01210 148937 149770 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920805.1 protein_id gnl|my_center|LOCUS_01210 152249 149790 gene locus_tag LOCUS_01220 152249 149790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01220 152934 154136 gene locus_tag LOCUS_01230 152934 154136 CDS product sorbosone dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479768.1 protein_id gnl|my_center|LOCUS_01230 156382 154226 gene locus_tag LOCUS_01240 156382 154226 CDS product polysaccharide biosynthesis tyrosine autokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143774.1 protein_id gnl|my_center|LOCUS_01240 158162 156645 gene locus_tag LOCUS_01250 158162 156645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01250 159042 158338 gene locus_tag LOCUS_01260 159042 158338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01260 159206 160636 gene locus_tag LOCUS_01270 159206 160636 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000034322.1 protein_id gnl|my_center|LOCUS_01270 161714 160821 gene locus_tag LOCUS_01280 gene crtB 161714 160821 CDS product cyanoexosortase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_214431335.1 protein_id gnl|my_center|LOCUS_01280 162973 161795 gene locus_tag LOCUS_01290 162973 161795 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257503.1 protein_id gnl|my_center|LOCUS_01290 163941 165455 gene locus_tag LOCUS_01300 163941 165455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01300 165764 167065 gene locus_tag LOCUS_01310 165764 167065 CDS product IctB family putative bicarbonate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015158974.1 protein_id gnl|my_center|LOCUS_01310 167510 167214 gene locus_tag LOCUS_01320 167510 167214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01320 167923 168390 gene locus_tag LOCUS_01330 gene smpB 167923 168390 CDS product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057764.1 protein_id gnl|my_center|LOCUS_01330 168483 169238 gene locus_tag LOCUS_01340 168483 169238 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144247.1 protein_id gnl|my_center|LOCUS_01340 169399 170076 gene locus_tag LOCUS_01350 169399 170076 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583690.1 protein_id gnl|my_center|LOCUS_01350 170397 171503 gene locus_tag LOCUS_01360 170397 171503 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056664.1 protein_id gnl|my_center|LOCUS_01360 175124 171579 gene locus_tag LOCUS_01370 175124 171579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01370 175532 175338 gene locus_tag LOCUS_01380 175532 175338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01380 176738 176169 gene locus_tag LOCUS_01390 176738 176169 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140580.1 protein_id gnl|my_center|LOCUS_01390 180137 176745 gene locus_tag LOCUS_01400 180137 176745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01400 180738 182615 gene locus_tag LOCUS_01410 gene uvrC 180738 182615 CDS product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057590.1 protein_id gnl|my_center|LOCUS_01410 185220 184120 gene locus_tag LOCUS_01420 185220 184120 CDS product IS630 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_155249484.1 protein_id gnl|my_center|LOCUS_01420 >Feature sequence002 216 1436 gene locus_tag LOCUS_01430 216 1436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01430 1934 1572 gene locus_tag LOCUS_01440 1934 1572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01440 2299 2018 gene locus_tag LOCUS_01450 2299 2018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01450 2913 2440 gene locus_tag LOCUS_01460 2913 2440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01460 4693 3104 gene locus_tag LOCUS_01470 4693 3104 CDS product alkaline phosphatase D family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063921597.1 protein_id gnl|my_center|LOCUS_01470 6499 5459 gene locus_tag LOCUS_01480 6499 5459 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002468311.1 protein_id gnl|my_center|LOCUS_01480 7483 6713 gene locus_tag LOCUS_01490 7483 6713 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480002.1 protein_id gnl|my_center|LOCUS_01490 9095 7713 gene locus_tag LOCUS_01500 gene mnmE 9095 7713 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056805.1 protein_id gnl|my_center|LOCUS_01500 9334 9525 gene locus_tag LOCUS_01510 9334 9525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01510 9804 9604 gene locus_tag LOCUS_01520 9804 9604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01520 11004 10072 gene locus_tag LOCUS_01530 11004 10072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01530 11356 12345 gene locus_tag LOCUS_01540 11356 12345 CDS product aspartate carbamoyltransferase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057398.1 protein_id gnl|my_center|LOCUS_01540 12762 13169 gene locus_tag LOCUS_01550 12762 13169 CDS product pentapeptide repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920705.1 protein_id gnl|my_center|LOCUS_01550 14622 13282 gene locus_tag LOCUS_01560 14622 13282 CDS product TldD/PmbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920812.1 protein_id gnl|my_center|LOCUS_01560 16249 14777 gene locus_tag LOCUS_01570 16249 14777 CDS product TldD/PmbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056379.1 protein_id gnl|my_center|LOCUS_01570 16549 16902 gene locus_tag LOCUS_01580 16549 16902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01580 16899 17147 gene locus_tag LOCUS_01590 16899 17147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01590 17705 17163 gene locus_tag LOCUS_01600 17705 17163 CDS product putative colanic acid biosynthesis acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331372.1 protein_id gnl|my_center|LOCUS_01600 18219 17692 gene locus_tag LOCUS_01610 18219 17692 CDS product YdcF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124316.1 protein_id gnl|my_center|LOCUS_01610 19368 18361 gene locus_tag LOCUS_01620 19368 18361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01620 20116 19340 gene locus_tag LOCUS_01630 20116 19340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01630 20795 20145 gene locus_tag LOCUS_01640 20795 20145 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403388.1 protein_id gnl|my_center|LOCUS_01640 22003 20810 gene locus_tag LOCUS_01650 22003 20810 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974187.1 protein_id gnl|my_center|LOCUS_01650 23638 22280 gene locus_tag LOCUS_01660 23638 22280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01660 24792 23683 gene locus_tag LOCUS_01670 24792 23683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01670 25418 24774 gene locus_tag LOCUS_01680 25418 24774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01680 26504 25443 gene locus_tag LOCUS_01690 26504 25443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01690 27674 26691 gene locus_tag LOCUS_01700 27674 26691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01700 28654 27695 gene locus_tag LOCUS_01710 28654 27695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01710 29695 28820 gene locus_tag LOCUS_01720 29695 28820 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035329735.1 protein_id gnl|my_center|LOCUS_01720 31201 29945 gene locus_tag LOCUS_01730 31201 29945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01730 31969 31202 gene locus_tag LOCUS_01740 31969 31202 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009891672.1 protein_id gnl|my_center|LOCUS_01740 32796 31975 gene locus_tag LOCUS_01750 32796 31975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01750 33908 32793 gene locus_tag LOCUS_01760 33908 32793 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875973.1 protein_id gnl|my_center|LOCUS_01760 34346 33912 gene locus_tag LOCUS_01770 34346 33912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01770 35712 34417 gene locus_tag LOCUS_01780 35712 34417 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942151.1 protein_id gnl|my_center|LOCUS_01780 36874 35804 gene locus_tag LOCUS_01790 36874 35804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01790 38340 37090 gene locus_tag LOCUS_01800 38340 37090 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203722.1 protein_id gnl|my_center|LOCUS_01800 39430 38408 gene locus_tag LOCUS_01810 39430 38408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01810 40805 39525 gene locus_tag LOCUS_01820 40805 39525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01820 41845 41003 gene locus_tag LOCUS_01830 41845 41003 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942150.1 protein_id gnl|my_center|LOCUS_01830 42194 41853 gene locus_tag LOCUS_01840 42194 41853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197529989.1 protein_id gnl|my_center|LOCUS_01840 43767 42460 gene locus_tag LOCUS_01850 43767 42460 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103019809.1 protein_id gnl|my_center|LOCUS_01850 44191 46401 gene locus_tag LOCUS_01860 44191 46401 CDS product polysaccharide biosynthesis tyrosine autokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143774.1 protein_id gnl|my_center|LOCUS_01860 46687 47217 gene locus_tag LOCUS_01870 46687 47217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01870 48409 47390 gene locus_tag LOCUS_01880 48409 47390 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532977.1 protein_id gnl|my_center|LOCUS_01880 50024 48543 gene locus_tag LOCUS_01890 50024 48543 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257389.1 protein_id gnl|my_center|LOCUS_01890 50413 50066 gene locus_tag LOCUS_01900 50413 50066 CDS product c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103126030.1 protein_id gnl|my_center|LOCUS_01900 50704 52155 gene locus_tag LOCUS_01910 50704 52155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01910 52273 53052 gene locus_tag LOCUS_01920 52273 53052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01920 53392 53201 gene locus_tag LOCUS_01930 53392 53201 CDS product YqaE/Pmp3 family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390272.1 protein_id gnl|my_center|LOCUS_01930 53936 53535 gene locus_tag LOCUS_01940 53936 53535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01940 54564 54223 gene locus_tag LOCUS_01950 54564 54223 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125585.1 protein_id gnl|my_center|LOCUS_01950 56855 54696 gene locus_tag LOCUS_01960 56855 54696 CDS product Tex family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144130.1 protein_id gnl|my_center|LOCUS_01960 57100 57531 gene locus_tag LOCUS_01970 57100 57531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01970 58180 57683 gene locus_tag LOCUS_01980 58180 57683 CDS product DUF4385 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_126352787.1 protein_id gnl|my_center|LOCUS_01980 60321 58180 gene locus_tag LOCUS_01990 60321 58180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01990 61322 60711 gene locus_tag LOCUS_02000 61322 60711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02000 62798 63206 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq tcgcgcctgctgaacctgcaccaggttgaccccc 63948 64406 gene locus_tag LOCUS_02010 63948 64406 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143783.1 protein_id gnl|my_center|LOCUS_02010 64435 64722 gene locus_tag LOCUS_02020 64435 64722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02020 65586 64828 gene locus_tag LOCUS_02030 65586 64828 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404953.1 protein_id gnl|my_center|LOCUS_02030 66398 65865 gene locus_tag LOCUS_02040 66398 65865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02040 66333 66716 gene locus_tag LOCUS_02050 66333 66716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02050 67009 67776 gene locus_tag LOCUS_02060 67009 67776 CDS product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582696.1 protein_id gnl|my_center|LOCUS_02060 69405 67942 gene locus_tag LOCUS_02070 69405 67942 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142505.1 protein_id gnl|my_center|LOCUS_02070 71458 69626 gene locus_tag LOCUS_02080 71458 69626 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007246686.1 protein_id gnl|my_center|LOCUS_02080 71593 72435 gene locus_tag LOCUS_02090 71593 72435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02090 72761 74377 gene locus_tag LOCUS_02100 72761 74377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02100 75118 74399 gene locus_tag LOCUS_02110 75118 74399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02110 75924 77372 gene locus_tag LOCUS_02120 gene pds 75924 77372 CDS product 15-cis-phytoene desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124322.1 protein_id gnl|my_center|LOCUS_02120 77483 78385 gene locus_tag LOCUS_02130 77483 78385 CDS product phytoene synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057400.1 protein_id gnl|my_center|LOCUS_02130 78498 78588 gene locus_tag LOCUS_t00010 78498 78588 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 78765 80093 gene locus_tag LOCUS_02140 78765 80093 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056637.1 protein_id gnl|my_center|LOCUS_02140 80510 82036 gene locus_tag LOCUS_02150 80510 82036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02150 82970 82089 gene locus_tag LOCUS_02160 82970 82089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02160 84138 84926 gene locus_tag LOCUS_02170 84138 84926 CDS product WecB/TagA/CpsF family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965614.1 protein_id gnl|my_center|LOCUS_02170 86150 84987 gene locus_tag LOCUS_02180 86150 84987 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_073856746.1 protein_id gnl|my_center|LOCUS_02180 87616 86396 gene locus_tag LOCUS_02190 87616 86396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02190 88532 87633 gene locus_tag LOCUS_02200 88532 87633 CDS product DUF6492 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530228.1 protein_id gnl|my_center|LOCUS_02200 89584 88562 gene locus_tag LOCUS_02210 gene uppG 89584 88562 CDS product polysaccharide biosynthesis glycosyltransferase UppG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162992409.1 protein_id gnl|my_center|LOCUS_02210 90569 89640 gene locus_tag LOCUS_02220 90569 89640 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037393323.1 protein_id gnl|my_center|LOCUS_02220 91605 90574 gene locus_tag LOCUS_02230 91605 90574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02230 92435 94780 gene locus_tag LOCUS_02240 92435 94780 CDS product tyrosine-protein kinase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057041.1 protein_id gnl|my_center|LOCUS_02240 94770 94943 gene locus_tag LOCUS_02250 94770 94943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02250 95031 96299 gene locus_tag LOCUS_02260 95031 96299 CDS product MOP flippase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244371.1 protein_id gnl|my_center|LOCUS_02260 96309 97367 gene locus_tag LOCUS_02270 96309 97367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02270 98388 97447 gene locus_tag LOCUS_02280 98388 97447 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058107.1 protein_id gnl|my_center|LOCUS_02280 98569 99102 gene locus_tag LOCUS_02290 98569 99102 CDS product C40 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058023.1 protein_id gnl|my_center|LOCUS_02290 99118 100131 gene locus_tag LOCUS_02300 99118 100131 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125825.1 protein_id gnl|my_center|LOCUS_02300 101516 100395 gene locus_tag LOCUS_02310 101516 100395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02310 101845 102204 gene locus_tag LOCUS_02320 101845 102204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02320 102564 103787 gene locus_tag LOCUS_02330 102564 103787 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058074.1 protein_id gnl|my_center|LOCUS_02330 103906 103833 gene locus_tag LOCUS_t00020 103906 103833 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 103941 104447 gene locus_tag LOCUS_02340 gene moaC 103941 104447 CDS product cyclic pyranopterin monophosphate synthase MoaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197530031.1 protein_id gnl|my_center|LOCUS_02340 104657 104457 gene locus_tag LOCUS_02350 104657 104457 CDS product DUF2795 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226108.1 protein_id gnl|my_center|LOCUS_02350 104929 105219 gene locus_tag LOCUS_02360 104929 105219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02360 106309 110526 gene locus_tag LOCUS_02370 106309 110526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02370 112434 110743 gene locus_tag LOCUS_02380 112434 110743 CDS product NAD(P)H-hydrate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058227.1 protein_id gnl|my_center|LOCUS_02380 113287 112535 gene locus_tag LOCUS_02390 113287 112535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02390 113667 114722 gene locus_tag LOCUS_02400 gene mnmA 113667 114722 CDS product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058089.1 protein_id gnl|my_center|LOCUS_02400 115535 117355 gene locus_tag LOCUS_02410 115535 117355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02410 120854 117486 gene locus_tag LOCUS_02420 120854 117486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02420 120930 121277 gene locus_tag LOCUS_02430 120930 121277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02430 121918 123105 gene locus_tag LOCUS_02440 gene sat 121918 123105 CDS product sulfate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056887.1 protein_id gnl|my_center|LOCUS_02440 123206 125404 gene locus_tag LOCUS_02450 123206 125404 CDS product caspase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057163.1 protein_id gnl|my_center|LOCUS_02450 126708 125845 gene locus_tag LOCUS_02460 126708 125845 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920780.1 protein_id gnl|my_center|LOCUS_02460 126916 127734 gene locus_tag LOCUS_02470 126916 127734 CDS product DUF1206 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118502.1 protein_id gnl|my_center|LOCUS_02470 127739 127912 gene locus_tag LOCUS_02480 127739 127912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02480 128050 129054 gene locus_tag LOCUS_02490 128050 129054 CDS product family 10 glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141800.1 protein_id gnl|my_center|LOCUS_02490 132994 129191 gene locus_tag LOCUS_02500 132994 129191 CDS product AAA-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057338.1 protein_id gnl|my_center|LOCUS_02500 133966 133121 gene locus_tag LOCUS_02510 133966 133121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02510 133965 134099 gene locus_tag LOCUS_02520 133965 134099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02520 134336 135661 gene locus_tag LOCUS_02530 134336 135661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02530 136513 135764 gene locus_tag LOCUS_02540 136513 135764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02540 137477 136860 gene locus_tag LOCUS_02550 137477 136860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02550 137629 138636 gene locus_tag LOCUS_02560 137629 138636 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113970.1 protein_id gnl|my_center|LOCUS_02560 138768 139196 gene locus_tag LOCUS_02570 138768 139196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02570 139198 139902 gene locus_tag LOCUS_02580 139198 139902 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933646.1 protein_id gnl|my_center|LOCUS_02580 141178 139877 gene locus_tag LOCUS_02590 141178 139877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02590 141805 143367 gene locus_tag LOCUS_02600 141805 143367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02600 146300 143409 gene locus_tag LOCUS_02610 gene uvrA 146300 143409 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197524117.1 protein_id gnl|my_center|LOCUS_02610 146523 147251 gene locus_tag LOCUS_02620 146523 147251 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_190557989.1 protein_id gnl|my_center|LOCUS_02620 148254 147328 gene locus_tag LOCUS_02630 148254 147328 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057729.1 protein_id gnl|my_center|LOCUS_02630 149461 148418 gene locus_tag LOCUS_02640 149461 148418 CDS product mechanosensitive ion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942993.1 protein_id gnl|my_center|LOCUS_02640 149765 150682 gene locus_tag LOCUS_02650 149765 150682 CDS product histone deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141618.1 protein_id gnl|my_center|LOCUS_02650 150859 155355 gene locus_tag LOCUS_02660 150859 155355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02660 155333 157240 gene locus_tag LOCUS_02670 155333 157240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02670 157403 158536 gene locus_tag LOCUS_02680 gene gshA 157403 158536 CDS product glutamate--cysteine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056177.1 protein_id gnl|my_center|LOCUS_02680 158807 159262 gene locus_tag LOCUS_02690 158807 159262 CDS product tRNA (cytidine(34)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057630.1 protein_id gnl|my_center|LOCUS_02690 160201 162525 gene locus_tag LOCUS_02700 160201 162525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02700 162715 162789 gene locus_tag LOCUS_t00030 162715 162789 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 165119 162861 gene locus_tag LOCUS_02710 165119 162861 CDS product amylo-alpha-1,6-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_190697803.1 protein_id gnl|my_center|LOCUS_02710 165258 165869 gene locus_tag LOCUS_02720 165258 165869 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057294.1 protein_id gnl|my_center|LOCUS_02720 166073 166609 gene locus_tag LOCUS_02730 166073 166609 CDS product peroxiredoxin-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057129.1 protein_id gnl|my_center|LOCUS_02730 167762 166767 gene locus_tag LOCUS_02740 167762 166767 CDS product DnaJ C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056135.1 protein_id gnl|my_center|LOCUS_02740 168396 167929 gene locus_tag LOCUS_02750 168396 167929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02750 169818 168532 gene locus_tag LOCUS_02760 169818 168532 CDS product glucose-1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920845.1 protein_id gnl|my_center|LOCUS_02760 170122 171429 gene locus_tag LOCUS_02770 170122 171429 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_198406250.1 protein_id gnl|my_center|LOCUS_02770 171707 171456 gene locus_tag LOCUS_02780 171707 171456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02780 171958 171704 gene locus_tag LOCUS_02790 171958 171704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02790 174958 172430 gene locus_tag LOCUS_02800 174958 172430 CDS product mannose-1-phosphate guanyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143331.1 protein_id gnl|my_center|LOCUS_02800 175469 175660 gene locus_tag LOCUS_02810 175469 175660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02810 >Feature sequence003 234 662 gene locus_tag LOCUS_02820 234 662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02820 766 1380 gene locus_tag LOCUS_02830 766 1380 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254180.1 protein_id gnl|my_center|LOCUS_02830 1519 2451 gene locus_tag LOCUS_02840 1519 2451 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041170099.1 protein_id gnl|my_center|LOCUS_02840 2530 2754 gene locus_tag LOCUS_02850 2530 2754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02850 2724 3578 gene locus_tag LOCUS_02860 2724 3578 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140840.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02860 4011 6809 gene locus_tag LOCUS_02870 4011 6809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02870 7659 6964 gene locus_tag LOCUS_02880 7659 6964 CDS product LuxR C-terminal-related transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197530096.1 protein_id gnl|my_center|LOCUS_02880 7757 8482 gene locus_tag LOCUS_02890 7757 8482 CDS product DJ-1/PfpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140298.1 protein_id gnl|my_center|LOCUS_02890 8606 9049 gene locus_tag LOCUS_02900 8606 9049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02900 9213 9404 gene locus_tag LOCUS_02910 9213 9404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02910 9407 9670 gene locus_tag LOCUS_02920 9407 9670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02920 9618 9977 gene locus_tag LOCUS_02930 9618 9977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02930 10349 10759 gene locus_tag LOCUS_02940 10349 10759 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141533.1 protein_id gnl|my_center|LOCUS_02940 11119 11553 gene locus_tag LOCUS_02950 11119 11553 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056354.1 protein_id gnl|my_center|LOCUS_02950 12868 11909 gene locus_tag LOCUS_02960 12868 11909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02960 13404 12985 gene locus_tag LOCUS_02970 13404 12985 CDS product putative toxin-antitoxin system toxin component, PIN family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392184.1 protein_id gnl|my_center|LOCUS_02970 13627 13394 gene locus_tag LOCUS_02980 13627 13394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02980 13904 13704 gene locus_tag LOCUS_02990 13904 13704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02990 14872 14069 gene locus_tag LOCUS_03000 gene pgeF 14872 14069 CDS product peptidoglycan editing factor PgeF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099799068.1 protein_id gnl|my_center|LOCUS_03000 14950 15762 gene locus_tag LOCUS_03010 14950 15762 CDS product biotin--[acetyl-CoA-carboxylase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141338.1 protein_id gnl|my_center|LOCUS_03010 16032 17630 gene locus_tag LOCUS_03020 16032 17630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03020 19037 17691 gene locus_tag LOCUS_03030 19037 17691 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839967.1 protein_id gnl|my_center|LOCUS_03030 19299 20222 gene locus_tag LOCUS_03040 19299 20222 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143217.1 protein_id gnl|my_center|LOCUS_03040 21215 20535 gene locus_tag LOCUS_03050 21215 20535 CDS product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057523.1 protein_id gnl|my_center|LOCUS_03050 21554 22051 gene locus_tag LOCUS_03060 21554 22051 CDS product bifunctional nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920972.1 protein_id gnl|my_center|LOCUS_03060 22127 23254 gene locus_tag LOCUS_03070 22127 23254 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143741.1 protein_id gnl|my_center|LOCUS_03070 23904 23332 gene locus_tag LOCUS_03080 23904 23332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03080 25153 24803 gene locus_tag LOCUS_03090 25153 24803 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020391.1 protein_id gnl|my_center|LOCUS_03090 25354 26070 gene locus_tag LOCUS_03100 25354 26070 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262955.1 protein_id gnl|my_center|LOCUS_03100 27487 26450 gene locus_tag LOCUS_03110 27487 26450 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197524103.1 protein_id gnl|my_center|LOCUS_03110 28150 29913 gene locus_tag LOCUS_03120 28150 29913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03120 30030 30734 gene locus_tag LOCUS_03130 gene bioD 30030 30734 CDS product dethiobiotin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_198406219.1 protein_id gnl|my_center|LOCUS_03130 30787 32001 gene locus_tag LOCUS_03140 30787 32001 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921052.1 protein_id gnl|my_center|LOCUS_03140 32411 33214 gene locus_tag LOCUS_03150 32411 33214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03150 33761 33198 gene locus_tag LOCUS_03160 33761 33198 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477468.1 protein_id gnl|my_center|LOCUS_03160 34498 34094 gene locus_tag LOCUS_03170 34498 34094 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028171561.1 protein_id gnl|my_center|LOCUS_03170 35591 34761 gene locus_tag LOCUS_03180 35591 34761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03180 35994 35611 gene locus_tag LOCUS_03190 35994 35611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03190 36267 37757 gene locus_tag LOCUS_03200 36267 37757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03200 37771 38559 gene locus_tag LOCUS_03210 37771 38559 CDS product CPBP family intramembrane metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073567.1 protein_id gnl|my_center|LOCUS_03210 39239 38565 gene locus_tag LOCUS_03220 39239 38565 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056571.1 protein_id gnl|my_center|LOCUS_03220 40915 39578 gene locus_tag LOCUS_03230 40915 39578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03230 42053 44410 gene locus_tag LOCUS_03240 42053 44410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03240 44537 44953 gene locus_tag LOCUS_03250 gene arfB 44537 44953 CDS product alternative ribosome rescue aminoacyl-tRNA hydrolase ArfB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105972.1 protein_id gnl|my_center|LOCUS_03250 46573 45224 gene locus_tag LOCUS_03260 gene aroA 46573 45224 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056198.1 protein_id gnl|my_center|LOCUS_03260 46702 47214 gene locus_tag LOCUS_03270 46702 47214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03270 47938 47354 gene locus_tag LOCUS_03280 47938 47354 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057625.1 protein_id gnl|my_center|LOCUS_03280 48799 48584 gene locus_tag LOCUS_03290 48799 48584 CDS product chlorophyll a/b-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058042.1 protein_id gnl|my_center|LOCUS_03290 49050 50582 gene locus_tag LOCUS_03300 49050 50582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03300 50628 51467 gene locus_tag LOCUS_03310 50628 51467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03310 51478 51924 gene locus_tag LOCUS_03320 gene dut 51478 51924 CDS product dUTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964734.1 protein_id gnl|my_center|LOCUS_03320 52596 51997 gene locus_tag LOCUS_03330 gene dcd 52596 51997 CDS product dCTP deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056667.1 protein_id gnl|my_center|LOCUS_03330 53253 52717 gene locus_tag LOCUS_03340 53253 52717 CDS product P-loop NTPase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143500.1 protein_id gnl|my_center|LOCUS_03340 53711 54274 gene locus_tag LOCUS_03350 53711 54274 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004114385.1 protein_id gnl|my_center|LOCUS_03350 54473 55216 gene locus_tag LOCUS_03360 gene rph 54473 55216 CDS product ribonuclease PH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920723.1 protein_id gnl|my_center|LOCUS_03360 55448 56167 gene locus_tag LOCUS_03370 gene pgl 55448 56167 CDS product 6-phosphogluconolactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056919.1 protein_id gnl|my_center|LOCUS_03370 56934 56686 gene locus_tag LOCUS_03380 56934 56686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03380 56961 57287 gene locus_tag LOCUS_03390 56961 57287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03390 57548 58291 gene locus_tag LOCUS_03400 57548 58291 CDS product M50 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057460.1 protein_id gnl|my_center|LOCUS_03400 58377 58706 gene locus_tag LOCUS_03410 58377 58706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03410 58760 59524 gene locus_tag LOCUS_03420 58760 59524 CDS product DUF4058 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258578.1 protein_id gnl|my_center|LOCUS_03420 60561 59854 gene locus_tag LOCUS_03430 60561 59854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03430 61613 61128 gene locus_tag LOCUS_03440 61613 61128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143307.1 protein_id gnl|my_center|LOCUS_03440 62087 62992 gene locus_tag LOCUS_03450 gene hslO 62087 62992 CDS product Hsp33 family molecular chaperone HslO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142278.1 protein_id gnl|my_center|LOCUS_03450 63151 65241 gene locus_tag LOCUS_03460 63151 65241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920912.1 protein_id gnl|my_center|LOCUS_03460 66054 65296 gene locus_tag LOCUS_03470 66054 65296 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230740.1 protein_id gnl|my_center|LOCUS_03470 68432 66435 gene locus_tag LOCUS_03480 gene uvrB 68432 66435 CDS product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057868.1 protein_id gnl|my_center|LOCUS_03480 68710 69135 gene locus_tag LOCUS_03490 68710 69135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03490 69472 69654 gene locus_tag LOCUS_03500 69472 69654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03500 69825 70391 gene locus_tag LOCUS_03510 69825 70391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03510 70468 70992 gene locus_tag LOCUS_03520 70468 70992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03520 71799 72605 gene locus_tag LOCUS_03530 71799 72605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03530 72801 73664 gene locus_tag LOCUS_03540 72801 73664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03540 73661 74314 gene locus_tag LOCUS_03550 73661 74314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03550 74352 75068 gene locus_tag LOCUS_03560 74352 75068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03560 75865 75158 gene locus_tag LOCUS_03570 gene rpe 75865 75158 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058202.1 protein_id gnl|my_center|LOCUS_03570 75943 77532 gene locus_tag LOCUS_03580 75943 77532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03580 77831 79159 gene locus_tag LOCUS_03590 77831 79159 CDS product serpin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141968.1 protein_id gnl|my_center|LOCUS_03590 80399 79128 gene locus_tag LOCUS_03600 80399 79128 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920638.1 protein_id gnl|my_center|LOCUS_03600 81363 82652 gene locus_tag LOCUS_03610 81363 82652 CDS product LCP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058187.1 protein_id gnl|my_center|LOCUS_03610 83713 82949 gene locus_tag LOCUS_03620 83713 82949 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141217.1 protein_id gnl|my_center|LOCUS_03620 85192 85920 gene locus_tag LOCUS_03630 gene pyrH 85192 85920 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056115.1 protein_id gnl|my_center|LOCUS_03630 85907 86455 gene locus_tag LOCUS_03640 gene frr 85907 86455 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056114.1 protein_id gnl|my_center|LOCUS_03640 87500 88624 gene locus_tag LOCUS_03650 87500 88624 CDS product geranylgeranyl reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057244.1 protein_id gnl|my_center|LOCUS_03650 88902 88567 gene locus_tag LOCUS_03660 88902 88567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03660 89915 88824 gene locus_tag LOCUS_03670 89915 88824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03670 91060 90011 gene locus_tag LOCUS_03680 91060 90011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03680 92134 91250 gene locus_tag LOCUS_03690 92134 91250 CDS product type II CAAX endopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928875.1 protein_id gnl|my_center|LOCUS_03690 92873 92406 gene locus_tag LOCUS_03700 92873 92406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03700 94179 95183 gene locus_tag LOCUS_03710 94179 95183 CDS product succinate dehydrogenase/fumarate reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057591.1 protein_id gnl|my_center|LOCUS_03710 95914 95387 gene locus_tag LOCUS_03720 95914 95387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03720 96577 95981 gene locus_tag LOCUS_03730 96577 95981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03730 97511 96588 gene locus_tag LOCUS_03740 97511 96588 CDS product Ycf66 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057849.1 protein_id gnl|my_center|LOCUS_03740 98206 98496 gene locus_tag LOCUS_03750 98206 98496 CDS product YggT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142008.1 protein_id gnl|my_center|LOCUS_03750 99919 98567 gene locus_tag LOCUS_03760 gene accC 99919 98567 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057645.1 protein_id gnl|my_center|LOCUS_03760 100360 100442 gene locus_tag LOCUS_t00040 100360 100442 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 100620 101249 gene locus_tag LOCUS_03770 100620 101249 CDS product chorismate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_157768333.1 protein_id gnl|my_center|LOCUS_03770 102138 103910 gene locus_tag LOCUS_03780 102138 103910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03780 104024 105082 gene locus_tag LOCUS_03790 gene ccsB 104024 105082 CDS product c-type cytochrome biogenesis protein CcsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057454.1 protein_id gnl|my_center|LOCUS_03790 105354 106058 gene locus_tag LOCUS_03800 105354 106058 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038082630.1 protein_id gnl|my_center|LOCUS_03800 106746 106297 gene locus_tag LOCUS_03810 106746 106297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03810 109181 106881 gene locus_tag LOCUS_03820 109181 106881 CDS product prolyl oligopeptidase family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140627.1 protein_id gnl|my_center|LOCUS_03820 115203 110071 gene locus_tag LOCUS_03830 115203 110071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03830 117904 115274 gene locus_tag LOCUS_03840 117904 115274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03840 118446 117919 gene locus_tag LOCUS_03850 118446 117919 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056202.1 protein_id gnl|my_center|LOCUS_03850 118825 118460 gene locus_tag LOCUS_03860 118825 118460 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056201.1 protein_id gnl|my_center|LOCUS_03860 119463 121199 gene locus_tag LOCUS_03870 gene hmpF 119463 121199 CDS product pilus motility taxis protein HmpF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058194.1 protein_id gnl|my_center|LOCUS_03870 122435 121401 gene locus_tag LOCUS_03880 gene tilS 122435 121401 CDS product tRNA lysidine(34) synthetase TilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057455.1 protein_id gnl|my_center|LOCUS_03880 122732 125611 gene locus_tag LOCUS_03890 122732 125611 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197524115.1 protein_id gnl|my_center|LOCUS_03890 125867 125709 gene locus_tag LOCUS_03900 125867 125709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03900 125983 125909 gene locus_tag LOCUS_t00050 125983 125909 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 126680 127435 gene locus_tag LOCUS_03910 126680 127435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03910 127526 128578 gene locus_tag LOCUS_03920 127526 128578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03920 128591 128929 gene locus_tag LOCUS_03930 128591 128929 CDS product divalent-cation tolerance protein CutA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920728.1 protein_id gnl|my_center|LOCUS_03930 129235 128960 gene locus_tag LOCUS_03940 129235 128960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03940 129937 129242 gene locus_tag LOCUS_03950 gene plsY 129937 129242 CDS product glycerol-3-phosphate 1-O-acyltransferase PlsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531489.1 protein_id gnl|my_center|LOCUS_03950 131293 130010 gene locus_tag LOCUS_03960 131293 130010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03960 131835 131446 gene locus_tag LOCUS_03970 131835 131446 CDS product DUF3119 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056952.1 protein_id gnl|my_center|LOCUS_03970 132934 132185 gene locus_tag LOCUS_03980 132934 132185 CDS product MlaE family lipid ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141808.1 protein_id gnl|my_center|LOCUS_03980 133411 133698 gene locus_tag LOCUS_03990 133411 133698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03990 134130 134951 gene locus_tag LOCUS_04000 gene sppA 134130 134951 CDS product signal peptide peptidase SppA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057641.1 protein_id gnl|my_center|LOCUS_04000 135058 135429 gene locus_tag LOCUS_04010 gene aroH 135058 135429 CDS product chorismate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057640.1 protein_id gnl|my_center|LOCUS_04010 136142 135666 gene locus_tag LOCUS_04020 136142 135666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_04020 136664 137893 gene locus_tag LOCUS_04030 136664 137893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04030 139012 138113 gene locus_tag LOCUS_04040 139012 138113 CDS product fatty acid desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057737.1 protein_id gnl|my_center|LOCUS_04040 139402 141171 gene locus_tag LOCUS_04050 gene pyk 139402 141171 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058108.1 protein_id gnl|my_center|LOCUS_04050 141446 141189 gene locus_tag LOCUS_04060 141446 141189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04060 143076 141955 gene locus_tag LOCUS_04070 143076 141955 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143959.1 protein_id gnl|my_center|LOCUS_04070 143629 143033 gene locus_tag LOCUS_04080 143629 143033 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083435038.1 protein_id gnl|my_center|LOCUS_04080 144539 143694 gene locus_tag LOCUS_04090 144539 143694 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966350.1 protein_id gnl|my_center|LOCUS_04090 145489 144758 gene locus_tag LOCUS_04100 gene radC 145489 144758 CDS product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920920.1 protein_id gnl|my_center|LOCUS_04100 146557 145592 gene locus_tag LOCUS_04110 146557 145592 CDS product phosphoribulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144407.1 protein_id gnl|my_center|LOCUS_04110 146961 147626 gene locus_tag LOCUS_04120 146961 147626 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405133.1 protein_id gnl|my_center|LOCUS_04120 148607 147678 gene locus_tag LOCUS_04130 148607 147678 CDS product rhodanese-related sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032607335.1 protein_id gnl|my_center|LOCUS_04130 149766 151505 gene locus_tag LOCUS_04140 149766 151505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04140 151850 153328 gene locus_tag LOCUS_04150 151850 153328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04150 153362 153805 gene locus_tag LOCUS_04160 153362 153805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04160 156045 154549 gene locus_tag LOCUS_04170 156045 154549 CDS product HlyD family type I secretion periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040402.1 protein_id gnl|my_center|LOCUS_04170 157175 156300 gene locus_tag LOCUS_04180 157175 156300 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141460.1 protein_id gnl|my_center|LOCUS_04180 158031 157249 gene locus_tag LOCUS_04190 gene xth 158031 157249 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920930.1 protein_id gnl|my_center|LOCUS_04190 158583 159650 gene locus_tag LOCUS_04200 158583 159650 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057430.1 protein_id gnl|my_center|LOCUS_04200 159982 161010 gene locus_tag LOCUS_04210 159982 161010 CDS product alcohol dehydrogenase catalytic domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920792.1 protein_id gnl|my_center|LOCUS_04210 161071 162231 gene locus_tag LOCUS_04220 161071 162231 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_096581549.1 protein_id gnl|my_center|LOCUS_04220 162686 162315 gene locus_tag LOCUS_04230 162686 162315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04230 163102 162743 gene locus_tag LOCUS_04240 163102 162743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04240 163729 163418 gene locus_tag LOCUS_04250 163729 163418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04250 163984 163733 gene locus_tag LOCUS_04260 163984 163733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04260 164411 163995 gene locus_tag LOCUS_04270 164411 163995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04270 165065 166018 gene locus_tag LOCUS_04280 gene cysK 165065 166018 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056355.1 protein_id gnl|my_center|LOCUS_04280 167257 166478 gene locus_tag LOCUS_04290 167257 166478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04290 167467 168912 gene locus_tag LOCUS_04300 167467 168912 CDS product cytochrome ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141197.1 protein_id gnl|my_center|LOCUS_04300 169150 170166 gene locus_tag LOCUS_04310 gene cydB 169150 170166 CDS product cytochrome d ubiquinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141196.1 protein_id gnl|my_center|LOCUS_04310 170763 171125 gene locus_tag LOCUS_04320 170763 171125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04320 >Feature sequence004 441 100 gene locus_tag LOCUS_04330 441 100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04330 920 832 gene locus_tag LOCUS_t00060 920 832 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 1009 1377 gene locus_tag LOCUS_04340 1009 1377 CDS product 2Fe-2S iron-sulfur cluster binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057493.1 protein_id gnl|my_center|LOCUS_04340 1505 1921 gene locus_tag LOCUS_04350 1505 1921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04350 1964 2506 gene locus_tag LOCUS_04360 1964 2506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04360 2503 2892 gene locus_tag LOCUS_04370 2503 2892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04370 3631 3846 gene locus_tag LOCUS_04380 3631 3846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04380 4025 4528 gene locus_tag LOCUS_04390 4025 4528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04390 4512 4844 gene locus_tag LOCUS_04400 4512 4844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04400 5204 6019 gene locus_tag LOCUS_04410 5204 6019 CDS product inositol monophosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057494.1 protein_id gnl|my_center|LOCUS_04410 6369 6157 gene locus_tag LOCUS_04420 6369 6157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04420 6385 7569 gene locus_tag LOCUS_04430 gene tnpB 6385 7569 CDS product IS200/IS605 family element RNA-guided endonuclease TnpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020316.1 protein_id gnl|my_center|LOCUS_04430 7638 8591 gene locus_tag LOCUS_04440 7638 8591 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056037.1 protein_id gnl|my_center|LOCUS_04440 8591 9832 gene locus_tag LOCUS_04450 8591 9832 CDS product ATP phosphoribosyltransferase regulatory subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056036.1 protein_id gnl|my_center|LOCUS_04450 10448 10194 gene locus_tag LOCUS_04460 10448 10194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04460 11159 12385 gene locus_tag LOCUS_04470 11159 12385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04470 12959 14026 gene locus_tag LOCUS_04480 12959 14026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04480 15652 14153 gene locus_tag LOCUS_04490 15652 14153 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057081.1 protein_id gnl|my_center|LOCUS_04490 16726 17253 gene locus_tag LOCUS_04500 16726 17253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04500 18035 18640 gene locus_tag LOCUS_04510 18035 18640 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929042.1 protein_id gnl|my_center|LOCUS_04510 18755 19204 gene locus_tag LOCUS_04520 18755 19204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04520 19415 19639 gene locus_tag LOCUS_04530 19415 19639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04530 20145 19738 gene locus_tag LOCUS_04540 20145 19738 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972683.1 protein_id gnl|my_center|LOCUS_04540 20369 20142 gene locus_tag LOCUS_04550 20369 20142 CDS product AbrB/MazE/SpoVT family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006312031.1 protein_id gnl|my_center|LOCUS_04550 21417 20539 gene locus_tag LOCUS_04560 21417 20539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04560 21956 21483 gene locus_tag LOCUS_04570 21956 21483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04570 24147 22294 gene locus_tag LOCUS_04580 24147 22294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04580 25471 24425 gene locus_tag LOCUS_04590 25471 24425 CDS product adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920837.1 protein_id gnl|my_center|LOCUS_04590 25653 26996 gene locus_tag LOCUS_04600 25653 26996 CDS product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056381.1 protein_id gnl|my_center|LOCUS_04600 27111 27701 gene locus_tag LOCUS_04610 27111 27701 CDS product 50S ribosomal protein L25/general stress protein Ctc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140402.1 protein_id gnl|my_center|LOCUS_04610 27800 29347 gene locus_tag LOCUS_04620 27800 29347 CDS product bifunctional aminoglycoside phosphotransferase/ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056133.1 protein_id gnl|my_center|LOCUS_04620 29357 29857 gene locus_tag LOCUS_04630 29357 29857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04630 30113 30820 gene locus_tag LOCUS_04640 30113 30820 CDS product YdcF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057996.1 protein_id gnl|my_center|LOCUS_04640 30923 31144 gene locus_tag LOCUS_04650 30923 31144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04650 31419 31150 gene locus_tag LOCUS_04660 31419 31150 CDS product ferredoxin-thioredoxin reductase variable chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057357.1 protein_id gnl|my_center|LOCUS_04660 32744 31662 gene locus_tag LOCUS_04670 32744 31662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04670 34026 33319 gene locus_tag LOCUS_04680 34026 33319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04680 35790 34201 gene locus_tag LOCUS_04690 35790 34201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04690 36022 36606 gene locus_tag LOCUS_04700 36022 36606 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197530066.1 protein_id gnl|my_center|LOCUS_04700 37265 36702 gene locus_tag LOCUS_04710 37265 36702 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141894.1 protein_id gnl|my_center|LOCUS_04710 39385 37532 gene locus_tag LOCUS_04720 39385 37532 CDS product protein phosphatase 2C domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056767.1 protein_id gnl|my_center|LOCUS_04720 39685 40119 gene locus_tag LOCUS_04730 39685 40119 CDS product NfeD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920989.1 protein_id gnl|my_center|LOCUS_04730 40150 41157 gene locus_tag LOCUS_04740 40150 41157 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058018.1 protein_id gnl|my_center|LOCUS_04740 41670 41272 gene locus_tag LOCUS_04750 41670 41272 CDS product Fur family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056047.1 protein_id gnl|my_center|LOCUS_04750 41816 42094 gene locus_tag LOCUS_04760 gene purS 41816 42094 CDS product phosphoribosylformylglycinamidine synthase subunit PurS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140445.1 protein_id gnl|my_center|LOCUS_04760 42190 42864 gene locus_tag LOCUS_04770 gene purQ 42190 42864 CDS product phosphoribosylformylglycinamidine synthase subunit PurQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141325.1 protein_id gnl|my_center|LOCUS_04770 42991 43203 gene locus_tag LOCUS_04780 42991 43203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04780 43184 43543 gene locus_tag LOCUS_04790 43184 43543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04790 45192 43669 gene locus_tag LOCUS_04800 gene trpE 45192 43669 CDS product anthranilate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057509.1 protein_id gnl|my_center|LOCUS_04800 45706 45284 gene locus_tag LOCUS_04810 45706 45284 CDS product photosystem I reaction center subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057561.1 protein_id gnl|my_center|LOCUS_04810 47744 45840 gene locus_tag LOCUS_04820 47744 45840 CDS product DICT sensory domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057496.1 protein_id gnl|my_center|LOCUS_04820 49302 50330 gene locus_tag LOCUS_04830 49302 50330 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143157.1 protein_id gnl|my_center|LOCUS_04830 50985 53270 gene locus_tag LOCUS_04840 50985 53270 CDS product amylo-alpha-1,6-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929205.1 protein_id gnl|my_center|LOCUS_04840 53721 53389 gene locus_tag LOCUS_04850 53721 53389 CDS product DUF2973 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057538.1 protein_id gnl|my_center|LOCUS_04850 54388 54071 gene locus_tag LOCUS_04860 54388 54071 CDS product DUF2605 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057537.1 protein_id gnl|my_center|LOCUS_04860 55644 57473 gene locus_tag LOCUS_04870 gene thrS 55644 57473 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_216087114.1 protein_id gnl|my_center|LOCUS_04870 57550 57741 gene locus_tag LOCUS_04880 57550 57741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04880 57726 58028 gene locus_tag LOCUS_04890 57726 58028 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921693.1 protein_id gnl|my_center|LOCUS_04890 58249 58485 gene locus_tag LOCUS_04900 58249 58485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04900 58491 59669 gene locus_tag LOCUS_04910 58491 59669 CDS product DNA cytosine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921453.1 protein_id gnl|my_center|LOCUS_04910 60168 59656 gene locus_tag LOCUS_04920 60168 59656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04920 60821 60339 gene locus_tag LOCUS_04930 gene bcp 60821 60339 CDS product thioredoxin-dependent thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932346.1 protein_id gnl|my_center|LOCUS_04930 61419 60913 gene locus_tag LOCUS_04940 61419 60913 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036864.1 protein_id gnl|my_center|LOCUS_04940 62166 61753 gene locus_tag LOCUS_04950 gene merR 62166 61753 CDS product Hg(II)-responsive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000640384.1 protein_id gnl|my_center|LOCUS_04950 62589 62335 gene locus_tag LOCUS_04960 62589 62335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04960 64859 62598 gene locus_tag LOCUS_04970 64859 62598 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001003185.1 protein_id gnl|my_center|LOCUS_04970 65876 65415 gene locus_tag LOCUS_04980 65876 65415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04980 66228 67022 gene locus_tag LOCUS_04990 66228 67022 CDS product PhzF family phenazine biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_095645285.1 protein_id gnl|my_center|LOCUS_04990 67627 67256 gene locus_tag LOCUS_05000 67627 67256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05000 68032 67664 gene locus_tag LOCUS_05010 68032 67664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05010 68337 68014 gene locus_tag LOCUS_05020 68337 68014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967828.1 protein_id gnl|my_center|LOCUS_05020 69129 68932 gene locus_tag LOCUS_05030 69129 68932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05030 69762 69232 gene locus_tag LOCUS_05040 69762 69232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05040 70280 71515 gene locus_tag LOCUS_05050 gene aroB 70280 71515 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393064.1 protein_id gnl|my_center|LOCUS_05050 71515 72345 gene locus_tag LOCUS_05060 71515 72345 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880979.1 protein_id gnl|my_center|LOCUS_05060 72689 73969 gene locus_tag LOCUS_05070 72689 73969 CDS product ATP-grasp domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001093155.1 protein_id gnl|my_center|LOCUS_05070 74306 74542 gene locus_tag LOCUS_05080 74306 74542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05080 75655 74789 gene locus_tag LOCUS_05090 75655 74789 CDS product WYL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142464.1 protein_id gnl|my_center|LOCUS_05090 75756 77933 gene locus_tag LOCUS_05100 75756 77933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05100 78186 78524 gene locus_tag LOCUS_05110 78186 78524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05110 78580 78825 gene locus_tag LOCUS_05120 78580 78825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05120 78828 79187 gene locus_tag LOCUS_05130 78828 79187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05130 79445 82735 gene locus_tag LOCUS_05140 79445 82735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05140 82790 83800 gene locus_tag LOCUS_05150 82790 83800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05150 83806 84513 gene locus_tag LOCUS_05160 83806 84513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05160 84918 84514 gene locus_tag LOCUS_05170 84918 84514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05170 84964 85818 gene locus_tag LOCUS_05180 84964 85818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05180 85827 87215 gene locus_tag LOCUS_05190 85827 87215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05190 88292 88933 gene locus_tag LOCUS_05200 88292 88933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05200 89191 89580 gene locus_tag LOCUS_05210 89191 89580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056454.1 protein_id gnl|my_center|LOCUS_05210 89624 89773 gene locus_tag LOCUS_05220 89624 89773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05220 90005 89838 gene locus_tag LOCUS_05230 90005 89838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05230 90180 93728 gene locus_tag LOCUS_05240 90180 93728 CDS product AAA-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057338.1 protein_id gnl|my_center|LOCUS_05240 93841 94164 gene locus_tag LOCUS_05250 93841 94164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05250 95225 95689 gene locus_tag LOCUS_05260 95225 95689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05260 95963 95808 gene locus_tag LOCUS_05270 95963 95808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05270 96607 100026 gene locus_tag LOCUS_05280 96607 100026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05280 101393 100926 gene locus_tag LOCUS_05290 101393 100926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05290 102492 102854 gene locus_tag LOCUS_05300 102492 102854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05300 104236 102926 gene locus_tag LOCUS_05310 104236 102926 CDS product aminopeptidase P N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058098.1 protein_id gnl|my_center|LOCUS_05310 104542 105084 gene locus_tag LOCUS_05320 104542 105084 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258691.1 protein_id gnl|my_center|LOCUS_05320 105081 106427 gene locus_tag LOCUS_05330 105081 106427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05330 107861 106614 gene locus_tag LOCUS_05340 107861 106614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05340 108128 109288 gene locus_tag LOCUS_05350 108128 109288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05350 109419 110015 gene locus_tag LOCUS_05360 109419 110015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05360 111351 110353 gene locus_tag LOCUS_05370 gene galE 111351 110353 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920997.1 protein_id gnl|my_center|LOCUS_05370 111924 112349 gene locus_tag LOCUS_05380 111924 112349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05380 112507 114258 gene locus_tag LOCUS_05390 112507 114258 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056502.1 protein_id gnl|my_center|LOCUS_05390 115032 114490 gene locus_tag LOCUS_05400 115032 114490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05400 116025 116324 gene locus_tag LOCUS_05410 116025 116324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05410 117062 116382 gene locus_tag LOCUS_05420 gene surE 117062 116382 CDS product 5'/3'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122691.1 protein_id gnl|my_center|LOCUS_05420 118478 117297 gene locus_tag LOCUS_05430 118478 117297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05430 121376 119007 gene locus_tag LOCUS_05440 121376 119007 CDS product glycoside hydrolase family 31 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140201.1 protein_id gnl|my_center|LOCUS_05440 121663 121887 gene locus_tag LOCUS_05450 121663 121887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05450 122979 123656 gene locus_tag LOCUS_05460 122979 123656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05460 123962 123735 gene locus_tag LOCUS_05470 123962 123735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05470 124642 124130 gene locus_tag LOCUS_05480 124642 124130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05480 125629 125138 gene locus_tag LOCUS_05490 125629 125138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05490 126355 126765 gene locus_tag LOCUS_05500 126355 126765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_05500 127646 127059 gene locus_tag LOCUS_05510 127646 127059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05510 128200 128601 gene locus_tag LOCUS_05520 128200 128601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05520 128684 129775 gene locus_tag LOCUS_05530 128684 129775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05530 129888 130592 gene locus_tag LOCUS_05540 129888 130592 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197530111.1 protein_id gnl|my_center|LOCUS_05540 130699 131868 gene locus_tag LOCUS_05550 130699 131868 CDS product zinc-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140737.1 protein_id gnl|my_center|LOCUS_05550 131981 132706 gene locus_tag LOCUS_05560 131981 132706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05560 132814 133983 gene locus_tag LOCUS_05570 132814 133983 CDS product zinc-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140737.1 protein_id gnl|my_center|LOCUS_05570 134238 135356 gene locus_tag LOCUS_05580 134238 135356 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640182.1 protein_id gnl|my_center|LOCUS_05580 135446 135787 gene locus_tag LOCUS_05590 135446 135787 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143541.1 protein_id gnl|my_center|LOCUS_05590 136079 137002 gene locus_tag LOCUS_05600 136079 137002 CDS product manganese catalase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245071.1 protein_id gnl|my_center|LOCUS_05600 137082 137330 gene locus_tag LOCUS_05610 137082 137330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05610 138505 137411 gene locus_tag LOCUS_05620 138505 137411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193991055.1 protein_id gnl|my_center|LOCUS_05620 139831 138728 gene locus_tag LOCUS_05630 139831 138728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05630 140387 140827 gene locus_tag LOCUS_05640 gene ureE 140387 140827 CDS product urease accessory protein UreE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057206.1 protein_id gnl|my_center|LOCUS_05640 140805 141494 gene locus_tag LOCUS_05650 140805 141494 CDS product urease accessory protein UreF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057205.1 protein_id gnl|my_center|LOCUS_05650 141585 142181 gene locus_tag LOCUS_05660 gene ureG 141585 142181 CDS product urease accessory protein UreG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055912.1 protein_id gnl|my_center|LOCUS_05660 142283 142627 gene locus_tag LOCUS_05670 142283 142627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05670 142661 142858 gene locus_tag LOCUS_05680 142661 142858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05680 142845 143519 gene locus_tag LOCUS_05690 142845 143519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05690 144405 143788 gene locus_tag LOCUS_05700 144405 143788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05700 144834 145799 gene locus_tag LOCUS_05710 144834 145799 CDS product acetamidase/formamidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087744.1 protein_id gnl|my_center|LOCUS_05710 145883 146194 gene locus_tag LOCUS_05720 145883 146194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05720 146437 147579 gene locus_tag LOCUS_05730 146437 147579 CDS product BMP family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389655.1 protein_id gnl|my_center|LOCUS_05730 147576 147788 gene locus_tag LOCUS_05740 147576 147788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05740 148111 147944 gene locus_tag LOCUS_05750 148111 147944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05750 148393 148593 gene locus_tag LOCUS_05760 148393 148593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05760 148789 149679 gene locus_tag LOCUS_05770 148789 149679 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729046.1 protein_id gnl|my_center|LOCUS_05770 149988 150578 gene locus_tag LOCUS_05780 149988 150578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05780 151647 152378 gene locus_tag LOCUS_05790 151647 152378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05790 152414 153205 gene locus_tag LOCUS_05800 152414 153205 CDS product SAM-dependent chlorinase/fluorinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141879.1 protein_id gnl|my_center|LOCUS_05800 154900 153257 gene locus_tag LOCUS_05810 154900 153257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05810 155503 156180 gene locus_tag LOCUS_05820 155503 156180 CDS product CsbD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142260.1 protein_id gnl|my_center|LOCUS_05820 156463 156954 gene locus_tag LOCUS_05830 156463 156954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05830 158400 157096 gene locus_tag LOCUS_05840 158400 157096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05840 159072 158437 gene locus_tag LOCUS_05850 159072 158437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05850 161270 160101 gene locus_tag LOCUS_05860 gene bioF 161270 160101 CDS product 8-amino-7-oxononanoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140400.1 protein_id gnl|my_center|LOCUS_05860 161516 161890 gene locus_tag LOCUS_05870 161516 161890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05870 162538 161903 gene locus_tag LOCUS_05880 gene ruvA 162538 161903 CDS product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056382.1 protein_id gnl|my_center|LOCUS_05880 163284 162535 gene locus_tag LOCUS_05890 163284 162535 CDS product sucrose-phosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143827.1 protein_id gnl|my_center|LOCUS_05890 163508 165871 gene locus_tag LOCUS_05900 163508 165871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05900 166272 165952 gene locus_tag LOCUS_05910 166272 165952 CDS product antibiotic biosynthesis monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003891546.1 protein_id gnl|my_center|LOCUS_05910 167194 166277 gene locus_tag LOCUS_05920 167194 166277 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140485.1 protein_id gnl|my_center|LOCUS_05920 168366 167221 gene locus_tag LOCUS_05930 168366 167221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05930 168944 168720 gene locus_tag LOCUS_05940 168944 168720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05940 >Feature sequence005 418 83 gene locus_tag LOCUS_05950 418 83 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05950 894 481 gene locus_tag LOCUS_05960 894 481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05960 1885 1106 gene locus_tag LOCUS_05970 1885 1106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05970 2333 1989 gene locus_tag LOCUS_05980 2333 1989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05980 3931 2654 gene locus_tag LOCUS_05990 3931 2654 CDS product MOP flippase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244371.1 protein_id gnl|my_center|LOCUS_05990 4612 4022 gene locus_tag LOCUS_06000 4612 4022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06000 5984 5400 gene locus_tag LOCUS_06010 5984 5400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06010 7113 6493 gene locus_tag LOCUS_06020 7113 6493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06020 7601 7266 gene locus_tag LOCUS_06030 7601 7266 CDS product ribulose bisphosphate carboxylase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142155.1 protein_id gnl|my_center|LOCUS_06030 8068 7661 gene locus_tag LOCUS_06040 8068 7661 CDS product chaperonin family protein RbcX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057345.1 protein_id gnl|my_center|LOCUS_06040 9600 8170 gene locus_tag LOCUS_06050 9600 8170 CDS product form I ribulose bisphosphate carboxylase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057346.1 protein_id gnl|my_center|LOCUS_06050 10063 10611 gene locus_tag LOCUS_06060 10063 10611 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_166172348.1 protein_id gnl|my_center|LOCUS_06060 10963 11736 gene locus_tag LOCUS_06070 gene panB 10963 11736 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928599.1 protein_id gnl|my_center|LOCUS_06070 12422 11850 gene locus_tag LOCUS_06080 12422 11850 CDS product 2'-5' RNA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928679.1 protein_id gnl|my_center|LOCUS_06080 12759 13025 gene locus_tag LOCUS_06090 12759 13025 CDS product YciI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920742.1 protein_id gnl|my_center|LOCUS_06090 13184 13573 gene locus_tag LOCUS_06100 13184 13573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06100 13731 14135 gene locus_tag LOCUS_06110 13731 14135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06110 14375 14752 gene locus_tag LOCUS_06120 gene queF 14375 14752 CDS product preQ(1) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056073.1 protein_id gnl|my_center|LOCUS_06120 18650 15030 gene locus_tag LOCUS_06130 18650 15030 CDS product GLUG motif-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113036.1 protein_id gnl|my_center|LOCUS_06130 20314 18902 gene locus_tag LOCUS_06140 20314 18902 CDS product cytochrome c biogenesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056530.1 protein_id gnl|my_center|LOCUS_06140 21128 20319 gene locus_tag LOCUS_06150 21128 20319 CDS product cytochrome c biogenesis protein CcdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055907.1 protein_id gnl|my_center|LOCUS_06150 21570 21235 gene locus_tag LOCUS_06160 21570 21235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06160 21943 21635 gene locus_tag LOCUS_06170 21943 21635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06170 22282 22088 gene locus_tag LOCUS_06180 22282 22088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06180 24258 22642 gene locus_tag LOCUS_06190 24258 22642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06190 24555 25208 gene locus_tag LOCUS_06200 24555 25208 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141387.1 protein_id gnl|my_center|LOCUS_06200 25192 25596 gene locus_tag LOCUS_06210 25192 25596 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141388.1 protein_id gnl|my_center|LOCUS_06210 27096 26080 gene locus_tag LOCUS_06220 27096 26080 CDS product TOBE-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057527.1 protein_id gnl|my_center|LOCUS_06220 27357 28577 gene locus_tag LOCUS_06230 gene chlP 27357 28577 CDS product geranylgeranyl reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056005.1 protein_id gnl|my_center|LOCUS_06230 28961 29716 gene locus_tag LOCUS_06240 28961 29716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06240 30843 30097 gene locus_tag LOCUS_06250 30843 30097 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144148.1 protein_id gnl|my_center|LOCUS_06250 31001 32053 gene locus_tag LOCUS_06260 31001 32053 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056195.1 protein_id gnl|my_center|LOCUS_06260 33554 32088 gene locus_tag LOCUS_06270 33554 32088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06270 34234 33551 gene locus_tag LOCUS_06280 34234 33551 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941118.1 protein_id gnl|my_center|LOCUS_06280 34751 35305 gene locus_tag LOCUS_06290 34751 35305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06290 35971 36348 gene locus_tag LOCUS_06300 35971 36348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06300 37766 36903 gene locus_tag LOCUS_06310 37766 36903 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143349.1 protein_id gnl|my_center|LOCUS_06310 37919 38800 gene locus_tag LOCUS_06320 37919 38800 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226695.1 protein_id gnl|my_center|LOCUS_06320 38874 39731 gene locus_tag LOCUS_06330 38874 39731 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730663.1 protein_id gnl|my_center|LOCUS_06330 40369 40572 gene locus_tag LOCUS_06340 40369 40572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06340 41870 41247 gene locus_tag LOCUS_06350 41870 41247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06350 42434 43744 gene locus_tag LOCUS_06360 42434 43744 CDS product ABC exporter membrane fusion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056492.1 protein_id gnl|my_center|LOCUS_06360 43741 44934 gene locus_tag LOCUS_06370 gene devC 43741 44934 CDS product ABC transporter permease DevC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141427.1 protein_id gnl|my_center|LOCUS_06370 45163 45855 gene locus_tag LOCUS_06380 45163 45855 CDS product DevA family ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056490.1 protein_id gnl|my_center|LOCUS_06380 46535 46089 gene locus_tag LOCUS_06390 46535 46089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06390 46910 48133 gene locus_tag LOCUS_06400 46910 48133 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928500.1 protein_id gnl|my_center|LOCUS_06400 48130 48786 gene locus_tag LOCUS_06410 48130 48786 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256556.1 protein_id gnl|my_center|LOCUS_06410 49205 48798 gene locus_tag LOCUS_06420 49205 48798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06420 49394 50188 gene locus_tag LOCUS_06430 49394 50188 CDS product ion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887476.1 protein_id gnl|my_center|LOCUS_06430 50753 53458 gene locus_tag LOCUS_06440 50753 53458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06440 53471 54010 gene locus_tag LOCUS_06450 53471 54010 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921584.1 protein_id gnl|my_center|LOCUS_06450 56380 54335 gene locus_tag LOCUS_06460 gene tkt 56380 54335 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057707.1 protein_id gnl|my_center|LOCUS_06460 58083 56833 gene locus_tag LOCUS_06470 gene fabF 58083 56833 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057708.1 protein_id gnl|my_center|LOCUS_06470 58561 58310 gene locus_tag LOCUS_06480 gene acpP 58561 58310 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057709.1 protein_id gnl|my_center|LOCUS_06480 59001 59906 gene locus_tag LOCUS_06490 59001 59906 CDS product CoB--CoM heterodisulfide reductase iron-sulfur subunit B family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056823.1 protein_id gnl|my_center|LOCUS_06490 62959 60122 gene locus_tag LOCUS_06500 62959 60122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06500 64781 63729 gene locus_tag LOCUS_06510 gene lpxD 64781 63729 CDS product UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142707.1 protein_id gnl|my_center|LOCUS_06510 65110 66270 gene locus_tag LOCUS_06520 65110 66270 CDS product RNA-guided endonuclease TnpB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057329.1 protein_id gnl|my_center|LOCUS_06520 67584 66313 gene locus_tag LOCUS_06530 67584 66313 CDS product MltA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056813.1 protein_id gnl|my_center|LOCUS_06530 68463 69233 gene locus_tag LOCUS_06540 68463 69233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_105219828.1 protein_id gnl|my_center|LOCUS_06540 69675 73466 gene locus_tag LOCUS_06550 69675 73466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06550 73968 74576 gene locus_tag LOCUS_06560 73968 74576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06560 75093 75812 gene locus_tag LOCUS_06570 75093 75812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06570 76796 76392 gene locus_tag LOCUS_06580 76796 76392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06580 77955 76969 gene locus_tag LOCUS_06590 gene holA 77955 76969 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920898.1 protein_id gnl|my_center|LOCUS_06590 78165 78989 gene locus_tag LOCUS_06600 78165 78989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06600 79750 79256 gene locus_tag LOCUS_06610 79750 79256 CDS product DUF2243 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024311089.1 protein_id gnl|my_center|LOCUS_06610 79910 80380 gene locus_tag LOCUS_06620 79910 80380 CDS product NADAR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058296.1 protein_id gnl|my_center|LOCUS_06620 80913 80497 gene locus_tag LOCUS_06630 80913 80497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06630 81422 80943 gene locus_tag LOCUS_06640 81422 80943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06640 82165 82902 gene locus_tag LOCUS_06650 82165 82902 CDS product TPM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056259.1 protein_id gnl|my_center|LOCUS_06650 83347 82955 gene locus_tag LOCUS_06660 83347 82955 CDS product DUF4346 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140855.1 protein_id gnl|my_center|LOCUS_06660 84827 83646 gene locus_tag LOCUS_06670 84827 83646 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057699.1 protein_id gnl|my_center|LOCUS_06670 85570 84878 gene locus_tag LOCUS_06680 85570 84878 CDS product dihydrofolate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_106289931.1 protein_id gnl|my_center|LOCUS_06680 85871 87904 gene locus_tag LOCUS_06690 85871 87904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06690 89051 87912 gene locus_tag LOCUS_06700 89051 87912 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061730.1 protein_id gnl|my_center|LOCUS_06700 89841 89122 gene locus_tag LOCUS_06710 gene rnc 89841 89122 CDS product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142642.1 protein_id gnl|my_center|LOCUS_06710 90147 89920 gene locus_tag LOCUS_06720 90147 89920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06720 91415 90705 gene locus_tag LOCUS_06730 91415 90705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06730 92626 91472 gene locus_tag LOCUS_06740 gene corA 92626 91472 CDS product magnesium/cobalt transporter CorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141025.1 protein_id gnl|my_center|LOCUS_06740 93356 94546 gene locus_tag LOCUS_06750 93356 94546 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928500.1 protein_id gnl|my_center|LOCUS_06750 94717 96345 gene locus_tag LOCUS_06760 94717 96345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06760 96506 97240 gene locus_tag LOCUS_06770 96506 97240 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140352.1 protein_id gnl|my_center|LOCUS_06770 99222 97558 gene locus_tag LOCUS_06780 gene groL 99222 97558 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142891.1 protein_id gnl|my_center|LOCUS_06780 99868 100839 gene locus_tag LOCUS_06790 99868 100839 CDS product MraY family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228588.1 protein_id gnl|my_center|LOCUS_06790 101659 100895 gene locus_tag LOCUS_06800 gene fabG 101659 100895 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057342.1 protein_id gnl|my_center|LOCUS_06800 101748 102119 gene locus_tag LOCUS_06810 gene trxA 101748 102119 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921014.1 protein_id gnl|my_center|LOCUS_06810 103379 102237 gene locus_tag LOCUS_06820 103379 102237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06820 103456 104430 gene locus_tag LOCUS_06830 103456 104430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06830 104682 105290 gene locus_tag LOCUS_06840 104682 105290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06840 105739 105341 gene locus_tag LOCUS_06850 gene crcB 105739 105341 CDS product fluoride efflux transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927153.1 protein_id gnl|my_center|LOCUS_06850 106223 105834 gene locus_tag LOCUS_06860 gene crcB 106223 105834 CDS product fluoride efflux transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258331.1 protein_id gnl|my_center|LOCUS_06860 107547 106618 gene locus_tag LOCUS_06870 107547 106618 CDS product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056369.1 protein_id gnl|my_center|LOCUS_06870 108218 107544 gene locus_tag LOCUS_06880 gene tmk 108218 107544 CDS product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140680.1 protein_id gnl|my_center|LOCUS_06880 108613 108792 gene locus_tag LOCUS_06890 108613 108792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06890 109670 109158 gene locus_tag LOCUS_06900 109670 109158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06900 110407 109871 gene locus_tag LOCUS_06910 110407 109871 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001101141.1 protein_id gnl|my_center|LOCUS_06910 111429 111166 gene locus_tag LOCUS_06920 111429 111166 CDS product Calvin cycle protein CP12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057657.1 protein_id gnl|my_center|LOCUS_06920 112426 111647 gene locus_tag LOCUS_06930 112426 111647 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058265.1 protein_id gnl|my_center|LOCUS_06930 114050 112464 gene locus_tag LOCUS_06940 114050 112464 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142130.1 protein_id gnl|my_center|LOCUS_06940 114373 114705 gene locus_tag LOCUS_06950 114373 114705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06950 114789 115700 gene locus_tag LOCUS_06960 114789 115700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06960 115929 117053 gene locus_tag LOCUS_06970 115929 117053 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141501.1 protein_id gnl|my_center|LOCUS_06970 117626 118336 gene locus_tag LOCUS_06980 117626 118336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06980 118377 120209 gene locus_tag LOCUS_06990 118377 120209 CDS product GMC family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198666.1 protein_id gnl|my_center|LOCUS_06990 120288 122114 gene locus_tag LOCUS_07000 120288 122114 CDS product alpha-amylase family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921313.1 protein_id gnl|my_center|LOCUS_07000 122496 123098 gene locus_tag LOCUS_07010 122496 123098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07010 123148 123753 gene locus_tag LOCUS_07020 123148 123753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07020 123823 124215 gene locus_tag LOCUS_07030 123823 124215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07030 124676 124323 gene locus_tag LOCUS_07040 gene hxlR 124676 124323 CDS product transcriptional activator HxlR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246265.1 protein_id gnl|my_center|LOCUS_07040 125026 125649 gene locus_tag LOCUS_07050 gene azoR3 125026 125649 CDS product FMN-dependent NADH-azoreductase AzoR3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114814.1 protein_id gnl|my_center|LOCUS_07050 126700 125690 gene locus_tag LOCUS_07060 126700 125690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07060 128294 126846 gene locus_tag LOCUS_07070 128294 126846 CDS product DUF5009 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766054.1 protein_id gnl|my_center|LOCUS_07070 129256 128381 gene locus_tag LOCUS_07080 129256 128381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07080 130239 129736 gene locus_tag LOCUS_07090 130239 129736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07090 131603 130800 gene locus_tag LOCUS_07100 131603 130800 CDS product creatininase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531124.1 protein_id gnl|my_center|LOCUS_07100 131945 132652 gene locus_tag LOCUS_07110 131945 132652 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775698.1 protein_id gnl|my_center|LOCUS_07110 133063 132863 gene locus_tag LOCUS_07120 133063 132863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07120 133858 133349 gene locus_tag LOCUS_07130 133858 133349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_07130 134149 133910 gene locus_tag LOCUS_07140 134149 133910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_07140 134668 134270 gene locus_tag LOCUS_07150 134668 134270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07150 135180 136199 gene locus_tag LOCUS_07160 135180 136199 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140745.1 protein_id gnl|my_center|LOCUS_07160 137757 138002 gene locus_tag LOCUS_07170 137757 138002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07170 138014 139252 gene locus_tag LOCUS_07180 138014 139252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07180 139560 139934 gene locus_tag LOCUS_07190 139560 139934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07190 139941 141353 gene locus_tag LOCUS_07200 139941 141353 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172635924.1 protein_id gnl|my_center|LOCUS_07200 141712 142824 gene locus_tag LOCUS_07210 141712 142824 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099799453.1 protein_id gnl|my_center|LOCUS_07210 143989 142835 gene locus_tag LOCUS_07220 143989 142835 CDS product HhoA/HhoB/HtrA family serine endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056518.1 protein_id gnl|my_center|LOCUS_07220 144491 145243 gene locus_tag LOCUS_07230 144491 145243 CDS product ZIP family zinc transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225190.1 protein_id gnl|my_center|LOCUS_07230 145648 145409 gene locus_tag LOCUS_07240 145648 145409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07240 147091 145823 gene locus_tag LOCUS_07250 147091 145823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07250 148462 147293 gene locus_tag LOCUS_07260 148462 147293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07260 151347 148792 gene locus_tag LOCUS_07270 151347 148792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07270 152206 151715 gene locus_tag LOCUS_07280 152206 151715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193487403.1 protein_id gnl|my_center|LOCUS_07280 155515 152900 gene locus_tag LOCUS_07290 155515 152900 CDS product glycogen/starch/alpha-glucan phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140696.1 protein_id gnl|my_center|LOCUS_07290 157055 155700 gene locus_tag LOCUS_07300 157055 155700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07300 >Feature sequence006 302 979 gene locus_tag LOCUS_07310 302 979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07310 1020 1949 gene locus_tag LOCUS_07320 1020 1949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07320 2117 5998 gene locus_tag LOCUS_07330 2117 5998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07330 6289 6717 gene locus_tag LOCUS_07340 6289 6717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07340 6826 11559 gene locus_tag LOCUS_07350 6826 11559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07350 11624 12445 gene locus_tag LOCUS_07360 11624 12445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07360 16636 12512 gene locus_tag LOCUS_07370 16636 12512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07370 17315 16743 gene locus_tag LOCUS_07380 17315 16743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07380 18534 17494 gene locus_tag LOCUS_07390 18534 17494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07390 19960 18755 gene locus_tag LOCUS_07400 19960 18755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07400 20815 20231 gene locus_tag LOCUS_07410 20815 20231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07410 22715 21147 gene locus_tag LOCUS_07420 22715 21147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07420 23371 23111 gene locus_tag LOCUS_07430 23371 23111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07430 23614 24201 gene locus_tag LOCUS_07440 23614 24201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07440 24301 25311 gene locus_tag LOCUS_07450 24301 25311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07450 25471 25803 gene locus_tag LOCUS_07460 25471 25803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07460 25852 26037 gene locus_tag LOCUS_07470 25852 26037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07470 26047 26586 gene locus_tag LOCUS_07480 26047 26586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07480 27043 28131 gene locus_tag LOCUS_07490 27043 28131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07490 28112 28606 gene locus_tag LOCUS_07500 28112 28606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07500 28603 30057 gene locus_tag LOCUS_07510 28603 30057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07510 31599 30451 gene locus_tag LOCUS_07520 31599 30451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07520 32596 31994 gene locus_tag LOCUS_07530 32596 31994 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143585.1 protein_id gnl|my_center|LOCUS_07530 33092 32868 gene locus_tag LOCUS_07540 33092 32868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07540 33617 33177 gene locus_tag LOCUS_07550 33617 33177 CDS product globin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928811.1 protein_id gnl|my_center|LOCUS_07550 34428 33631 gene locus_tag LOCUS_07560 34428 33631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_165444153.1 protein_id gnl|my_center|LOCUS_07560 35692 34979 gene locus_tag LOCUS_07570 35692 34979 CDS product MOSC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001262987.1 protein_id gnl|my_center|LOCUS_07570 36106 35951 gene locus_tag LOCUS_07580 36106 35951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07580 37004 36813 gene locus_tag LOCUS_07590 37004 36813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07590 37281 37009 gene locus_tag LOCUS_07600 37281 37009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07600 38186 37431 gene locus_tag LOCUS_07610 38186 37431 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142832.1 protein_id gnl|my_center|LOCUS_07610 39637 38912 gene locus_tag LOCUS_07620 39637 38912 CDS product glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195790.1 protein_id gnl|my_center|LOCUS_07620 40019 39738 gene locus_tag LOCUS_07630 40019 39738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07630 41057 40140 gene locus_tag LOCUS_07640 41057 40140 CDS product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186540.1 protein_id gnl|my_center|LOCUS_07640 41523 41074 gene locus_tag LOCUS_07650 41523 41074 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267323.1 protein_id gnl|my_center|LOCUS_07650 41679 42728 gene locus_tag LOCUS_07660 gene cynR 41679 42728 CDS product transcriptional regulator CynR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256690.1 protein_id gnl|my_center|LOCUS_07660 43020 43241 gene locus_tag LOCUS_07670 43020 43241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07670 43816 43607 gene locus_tag LOCUS_07680 43816 43607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07680 44114 48154 gene locus_tag LOCUS_07690 44114 48154 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122252.1 protein_id gnl|my_center|LOCUS_07690 48644 51262 gene locus_tag LOCUS_07700 gene ppsA 48644 51262 CDS product phosphoenolpyruvate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201372230.1 protein_id gnl|my_center|LOCUS_07700 52357 51584 gene locus_tag LOCUS_07710 52357 51584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07710 54308 52689 gene locus_tag LOCUS_07720 54308 52689 CDS product phosphodiester glycosidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031038.1 protein_id gnl|my_center|LOCUS_07720 54972 55910 gene locus_tag LOCUS_07730 54972 55910 CDS product DUF5996 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929027.1 protein_id gnl|my_center|LOCUS_07730 56055 56696 gene locus_tag LOCUS_07740 56055 56696 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920683.1 protein_id gnl|my_center|LOCUS_07740 61602 57106 gene locus_tag LOCUS_07750 61602 57106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07750 62187 64493 gene locus_tag LOCUS_07760 62187 64493 CDS product ATP-dependent RecD-like DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256716.1 protein_id gnl|my_center|LOCUS_07760 65029 65469 gene locus_tag LOCUS_07770 65029 65469 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921390.1 protein_id gnl|my_center|LOCUS_07770 66233 65817 gene locus_tag LOCUS_07780 66233 65817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07780 66841 66233 gene locus_tag LOCUS_07790 66841 66233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07790 67241 66756 gene locus_tag LOCUS_07800 67241 66756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_07800 67815 67318 gene locus_tag LOCUS_07810 67815 67318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07810 68101 67904 gene locus_tag LOCUS_07820 68101 67904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07820 68294 68070 gene locus_tag LOCUS_07830 68294 68070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07830 68503 69591 gene locus_tag LOCUS_07840 68503 69591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07840 70268 69798 gene locus_tag LOCUS_07850 70268 69798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07850 70274 70516 gene locus_tag LOCUS_07860 70274 70516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07860 70600 70833 gene locus_tag LOCUS_07870 70600 70833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07870 70833 71252 gene locus_tag LOCUS_07880 70833 71252 CDS product PIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679685.1 protein_id gnl|my_center|LOCUS_07880 72604 72768 gene locus_tag LOCUS_07890 72604 72768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07890 72860 73462 gene locus_tag LOCUS_07900 72860 73462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07900 74500 73706 gene locus_tag LOCUS_07910 74500 73706 CDS product AhpC/TSA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125038.1 protein_id gnl|my_center|LOCUS_07910 74852 74628 gene locus_tag LOCUS_07920 74852 74628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07920 75559 75185 gene locus_tag LOCUS_07930 75559 75185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07930 76406 76089 gene locus_tag LOCUS_07940 76406 76089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07940 77202 76615 gene locus_tag LOCUS_07950 77202 76615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07950 77398 79029 gene locus_tag LOCUS_07960 77398 79029 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921199.1 protein_id gnl|my_center|LOCUS_07960 79627 80166 gene locus_tag LOCUS_07970 79627 80166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07970 80521 81132 gene locus_tag LOCUS_07980 80521 81132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07980 81285 81623 gene locus_tag LOCUS_07990 81285 81623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07990 81659 84574 gene locus_tag LOCUS_08000 81659 84574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140619.1 protein_id gnl|my_center|LOCUS_08000 84613 85359 gene locus_tag LOCUS_08010 84613 85359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08010 85477 86625 gene locus_tag LOCUS_08020 85477 86625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08020 86632 87414 gene locus_tag LOCUS_08030 86632 87414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08030 87454 89205 gene locus_tag LOCUS_08040 87454 89205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08040 89311 90036 gene locus_tag LOCUS_08050 89311 90036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08050 90039 91628 gene locus_tag LOCUS_08060 90039 91628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08060 92136 93908 gene locus_tag LOCUS_08070 92136 93908 CDS product type IV secretion system DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142038.1 protein_id gnl|my_center|LOCUS_08070 93958 94176 gene locus_tag LOCUS_08080 93958 94176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08080 94169 96682 gene locus_tag LOCUS_08090 94169 96682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08090 97943 96945 gene locus_tag LOCUS_08100 97943 96945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08100 98356 98781 gene locus_tag LOCUS_08110 98356 98781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08110 99341 99493 gene locus_tag LOCUS_08120 99341 99493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08120 99493 100545 gene locus_tag LOCUS_08130 99493 100545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08130 101435 100785 gene locus_tag LOCUS_08140 101435 100785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08140 101932 102735 gene locus_tag LOCUS_08150 101932 102735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08150 103729 102779 gene locus_tag LOCUS_08160 103729 102779 CDS product RNA polymerase sigma factor, RpoD/SigA family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193329020.1 protein_id gnl|my_center|LOCUS_08160 104379 103906 gene locus_tag LOCUS_08170 104379 103906 CDS product DUF3122 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056141.1 protein_id gnl|my_center|LOCUS_08170 105219 105416 gene locus_tag LOCUS_08180 105219 105416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08180 106794 105472 gene locus_tag LOCUS_08190 106794 105472 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_135257956.1 protein_id gnl|my_center|LOCUS_08190 111529 106871 gene locus_tag LOCUS_08200 111529 106871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08200 116208 111529 gene locus_tag LOCUS_08210 116208 111529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08210 122989 116381 gene locus_tag LOCUS_08220 122989 116381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08220 124134 126797 gene locus_tag LOCUS_08230 124134 126797 CDS product TonB-dependent siderophore receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015154897.1 protein_id gnl|my_center|LOCUS_08230 127032 128534 gene locus_tag LOCUS_08240 127032 128534 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021912.1 protein_id gnl|my_center|LOCUS_08240 128569 129558 gene locus_tag LOCUS_08250 128569 129558 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461571.1 protein_id gnl|my_center|LOCUS_08250 129555 130433 gene locus_tag LOCUS_08260 129555 130433 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461187.1 protein_id gnl|my_center|LOCUS_08260 130443 131372 gene locus_tag LOCUS_08270 130443 131372 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809174.1 protein_id gnl|my_center|LOCUS_08270 131359 131964 gene locus_tag LOCUS_08280 131359 131964 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272615.1 protein_id gnl|my_center|LOCUS_08280 133183 132746 gene locus_tag LOCUS_08290 133183 132746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08290 133506 133291 gene locus_tag LOCUS_08300 133506 133291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08300 134047 134784 gene locus_tag LOCUS_08310 134047 134784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08310 134759 135094 gene locus_tag LOCUS_08320 134759 135094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08320 135901 135215 gene locus_tag LOCUS_08330 135901 135215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08330 138428 136383 gene locus_tag LOCUS_08340 138428 136383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08340 142079 138453 gene locus_tag LOCUS_08350 142079 138453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08350 144654 142096 gene locus_tag LOCUS_08360 144654 142096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08360 146088 144883 gene locus_tag LOCUS_08370 146088 144883 CDS product DNA cytosine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383518.1 protein_id gnl|my_center|LOCUS_08370 >Feature sequence007 297 1049 gene locus_tag LOCUS_08380 297 1049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08380 1291 3978 gene locus_tag LOCUS_08390 1291 3978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08390 4214 6670 gene locus_tag LOCUS_08400 4214 6670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08400 7240 6830 gene locus_tag LOCUS_08410 gene vapC 7240 6830 CDS product tRNA(fMet)-specific endonuclease VapC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331362.1 protein_id gnl|my_center|LOCUS_08410 7539 7246 gene locus_tag LOCUS_08420 7539 7246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08420 9753 8251 gene locus_tag LOCUS_08430 9753 8251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08430 10333 9869 gene locus_tag LOCUS_08440 10333 9869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08440 10591 10352 gene locus_tag LOCUS_08450 10591 10352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08450 10788 10576 gene locus_tag LOCUS_08460 10788 10576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08460 11663 11046 gene locus_tag LOCUS_08470 11663 11046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08470 13579 12689 gene locus_tag LOCUS_08480 13579 12689 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143217.1 protein_id gnl|my_center|LOCUS_08480 14669 14322 gene locus_tag LOCUS_08490 14669 14322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08490 15205 15657 gene locus_tag LOCUS_08500 15205 15657 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056717.1 protein_id gnl|my_center|LOCUS_08500 16648 15752 gene locus_tag LOCUS_08510 16648 15752 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141368.1 protein_id gnl|my_center|LOCUS_08510 16839 20147 gene locus_tag LOCUS_08520 16839 20147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08520 20475 25295 gene locus_tag LOCUS_08530 20475 25295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08530 25343 25546 gene locus_tag LOCUS_08540 25343 25546 CDS product RNA-binding S4 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140229.1 protein_id gnl|my_center|LOCUS_08540 25960 25655 gene locus_tag LOCUS_08550 25960 25655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08550 27012 26827 gene locus_tag LOCUS_08560 27012 26827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08560 27140 31276 gene locus_tag LOCUS_08570 27140 31276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08570 31670 32575 gene locus_tag LOCUS_08580 31670 32575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08580 32810 33007 gene locus_tag LOCUS_08590 32810 33007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08590 34729 33020 gene locus_tag LOCUS_08600 34729 33020 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920921.1 protein_id gnl|my_center|LOCUS_08600 34911 35681 gene locus_tag LOCUS_08610 34911 35681 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038842.1 protein_id gnl|my_center|LOCUS_08610 36348 35701 gene locus_tag LOCUS_08620 36348 35701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08620 36606 37034 gene locus_tag LOCUS_08630 36606 37034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08630 37554 37237 gene locus_tag LOCUS_08640 37554 37237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08640 38144 38389 gene locus_tag LOCUS_08650 38144 38389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08650 38474 38893 gene locus_tag LOCUS_08660 38474 38893 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207371.1 protein_id gnl|my_center|LOCUS_08660 39717 38935 gene locus_tag LOCUS_08670 39717 38935 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921210.1 protein_id gnl|my_center|LOCUS_08670 39853 39772 gene locus_tag LOCUS_t00070 39853 39772 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 40226 41620 gene locus_tag LOCUS_08680 gene murA 40226 41620 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056623.1 protein_id gnl|my_center|LOCUS_08680 41780 42655 gene locus_tag LOCUS_08690 41780 42655 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056486.1 protein_id gnl|my_center|LOCUS_08690 42634 42718 gene locus_tag LOCUS_t00080 42634 42718 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 44511 44768 gene locus_tag LOCUS_08700 44511 44768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08700 45267 46082 gene locus_tag LOCUS_08710 45267 46082 CDS product WecB/TagA/CpsF family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920874.1 protein_id gnl|my_center|LOCUS_08710 47038 48312 gene locus_tag LOCUS_08720 47038 48312 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942151.1 protein_id gnl|my_center|LOCUS_08720 48377 49603 gene locus_tag LOCUS_08730 48377 49603 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868579.1 protein_id gnl|my_center|LOCUS_08730 49638 50624 gene locus_tag LOCUS_08740 49638 50624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08740 50857 52524 gene locus_tag LOCUS_08750 50857 52524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08750 52533 53582 gene locus_tag LOCUS_08760 52533 53582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08760 54189 55271 gene locus_tag LOCUS_08770 gene rfbB 54189 55271 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056311.1 protein_id gnl|my_center|LOCUS_08770 55301 56260 gene locus_tag LOCUS_08780 gene rfbA 55301 56260 CDS product glucose-1-phosphate thymidylyltransferase RfbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920694.1 protein_id gnl|my_center|LOCUS_08780 56257 56802 gene locus_tag LOCUS_08790 gene rfbC 56257 56802 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096184.1 protein_id gnl|my_center|LOCUS_08790 56802 57698 gene locus_tag LOCUS_08800 gene rfbD 56802 57698 CDS product dTDP-4-dehydrorhamnose reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266715.1 protein_id gnl|my_center|LOCUS_08800 57946 58785 gene locus_tag LOCUS_08810 57946 58785 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942150.1 protein_id gnl|my_center|LOCUS_08810 58915 60180 gene locus_tag LOCUS_08820 58915 60180 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942151.1 protein_id gnl|my_center|LOCUS_08820 60463 61341 gene locus_tag LOCUS_08830 60463 61341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08830 62087 62800 gene locus_tag LOCUS_08840 62087 62800 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164924814.1 protein_id gnl|my_center|LOCUS_08840 62841 63836 gene locus_tag LOCUS_08850 62841 63836 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197524103.1 protein_id gnl|my_center|LOCUS_08850 63949 65985 gene locus_tag LOCUS_08860 63949 65985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08860 66276 67808 gene locus_tag LOCUS_08870 66276 67808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08870 67845 68972 gene locus_tag LOCUS_08880 gene glf 67845 68972 CDS product UDP-galactopyranose mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228271.1 protein_id gnl|my_center|LOCUS_08880 69135 70967 gene locus_tag LOCUS_08890 69135 70967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08890 71035 71232 gene locus_tag LOCUS_08900 71035 71232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08900 73110 71239 gene locus_tag LOCUS_08910 73110 71239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08910 76186 73988 gene locus_tag LOCUS_08920 76186 73988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08920 76800 77906 gene locus_tag LOCUS_08930 76800 77906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08930 78025 79188 gene locus_tag LOCUS_08940 78025 79188 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256879.1 protein_id gnl|my_center|LOCUS_08940 79648 80388 gene locus_tag LOCUS_08950 79648 80388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08950 80498 81781 gene locus_tag LOCUS_08960 80498 81781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08960 82063 82941 gene locus_tag LOCUS_08970 82063 82941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08970 83009 83821 gene locus_tag LOCUS_08980 83009 83821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08980 83897 84970 gene locus_tag LOCUS_08990 83897 84970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08990 84967 86106 gene locus_tag LOCUS_09000 84967 86106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09000 86526 86188 gene locus_tag LOCUS_09010 86526 86188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09010 86954 87613 gene locus_tag LOCUS_09020 86954 87613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09020 88726 87599 gene locus_tag LOCUS_09030 88726 87599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09030 90525 88783 gene locus_tag LOCUS_09040 90525 88783 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258301.1 protein_id gnl|my_center|LOCUS_09040 91610 90702 gene locus_tag LOCUS_09050 91610 90702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528117.1 protein_id gnl|my_center|LOCUS_09050 92215 92021 gene locus_tag LOCUS_09060 92215 92021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09060 94380 92353 gene locus_tag LOCUS_09070 94380 92353 CDS product lasso peptide isopeptide bond-forming cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528116.1 protein_id gnl|my_center|LOCUS_09070 94829 94377 gene locus_tag LOCUS_09080 94829 94377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09080 95130 94813 gene locus_tag LOCUS_09090 95130 94813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09090 95980 95660 gene locus_tag LOCUS_09100 95980 95660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09100 96412 96485 gene locus_tag LOCUS_t00090 96412 96485 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 97564 99780 gene locus_tag LOCUS_09110 97564 99780 CDS product polysaccharide biosynthesis tyrosine autokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057604.1 protein_id gnl|my_center|LOCUS_09110 100190 99993 gene locus_tag LOCUS_09120 100190 99993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09120 100175 100753 gene locus_tag LOCUS_09130 100175 100753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09130 101400 102077 gene locus_tag LOCUS_09140 101400 102077 CDS product 2OG-Fe dioxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142596.1 protein_id gnl|my_center|LOCUS_09140 102256 103497 gene locus_tag LOCUS_09150 102256 103497 CDS product cysteine desulfurase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257673.1 protein_id gnl|my_center|LOCUS_09150 104072 103710 gene locus_tag LOCUS_09160 104072 103710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09160 104804 104133 gene locus_tag LOCUS_09170 104804 104133 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966328.1 protein_id gnl|my_center|LOCUS_09170 104780 105322 gene locus_tag LOCUS_09180 104780 105322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09180 105498 105863 gene locus_tag LOCUS_09190 105498 105863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09190 105946 106497 gene locus_tag LOCUS_09200 105946 106497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09200 107533 108228 gene locus_tag LOCUS_09210 107533 108228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09210 109247 108408 gene locus_tag LOCUS_09220 109247 108408 CDS product SWIM zinc finger family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142412.1 protein_id gnl|my_center|LOCUS_09220 112466 109251 gene locus_tag LOCUS_09230 112466 109251 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142413.1 protein_id gnl|my_center|LOCUS_09230 113366 112641 gene locus_tag LOCUS_09240 113366 112641 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928484.1 protein_id gnl|my_center|LOCUS_09240 113985 113473 gene locus_tag LOCUS_09250 113985 113473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09250 116352 113995 gene locus_tag LOCUS_09260 116352 113995 CDS product xanthine dehydrogenase family protein molybdopterin-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975840.1 protein_id gnl|my_center|LOCUS_09260 118630 116411 gene locus_tag LOCUS_09270 118630 116411 CDS product xanthine dehydrogenase family protein molybdopterin-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975840.1 protein_id gnl|my_center|LOCUS_09270 119610 118627 gene locus_tag LOCUS_09280 119610 118627 CDS product xanthine dehydrogenase family protein subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727255.1 protein_id gnl|my_center|LOCUS_09280 120214 119597 gene locus_tag LOCUS_09290 120214 119597 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531562.1 protein_id gnl|my_center|LOCUS_09290 121264 120413 gene locus_tag LOCUS_09300 121264 120413 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039771.1 protein_id gnl|my_center|LOCUS_09300 121506 121285 gene locus_tag LOCUS_09310 121506 121285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09310 123082 121541 gene locus_tag LOCUS_09320 123082 121541 CDS product gamma-glutamyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228174.1 protein_id gnl|my_center|LOCUS_09320 126013 123263 gene locus_tag LOCUS_09330 126013 123263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09330 127140 126391 gene locus_tag LOCUS_09340 127140 126391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09340 127605 128702 gene locus_tag LOCUS_09350 127605 128702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09350 128807 130063 gene locus_tag LOCUS_09360 128807 130063 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056989.1 protein_id gnl|my_center|LOCUS_09360 130125 130697 gene locus_tag LOCUS_09370 130125 130697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09370 131001 130810 gene locus_tag LOCUS_09380 131001 130810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09380 131242 132390 gene locus_tag LOCUS_09390 131242 132390 CDS product RNA-guided endonuclease TnpB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459437.1 protein_id gnl|my_center|LOCUS_09390 133190 132450 gene locus_tag LOCUS_09400 133190 132450 CDS product 2-phosphosulfolactate phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056258.1 protein_id gnl|my_center|LOCUS_09400 134689 133271 gene locus_tag LOCUS_09410 134689 133271 CDS product pyridoxal-dependent decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258696.1 protein_id gnl|my_center|LOCUS_09410 135011 135430 gene locus_tag LOCUS_09420 135011 135430 CDS product BlaI/MecI/CopY family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140769.1 protein_id gnl|my_center|LOCUS_09420 135430 136269 gene locus_tag LOCUS_09430 135430 136269 CDS product M56 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140768.1 protein_id gnl|my_center|LOCUS_09430 136923 136738 gene locus_tag LOCUS_09440 136923 136738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09440 136983 138509 gene locus_tag LOCUS_09450 136983 138509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09450 138499 138711 gene locus_tag LOCUS_09460 138499 138711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09460 139298 138765 gene locus_tag LOCUS_09470 139298 138765 CDS product DUF421 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811345.1 protein_id gnl|my_center|LOCUS_09470 140097 139315 gene locus_tag LOCUS_09480 140097 139315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09480 141229 140315 gene locus_tag LOCUS_09490 141229 140315 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140745.1 protein_id gnl|my_center|LOCUS_09490 141547 142662 gene locus_tag LOCUS_09500 141547 142662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09500 143051 143848 gene locus_tag LOCUS_09510 143051 143848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09510 145495 144236 gene locus_tag LOCUS_09520 145495 144236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09520 145939 145571 gene locus_tag LOCUS_09530 145939 145571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09530 >Feature sequence008 2276 1263 gene locus_tag LOCUS_09540 2276 1263 CDS product mechanosensitive ion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121934.1 protein_id gnl|my_center|LOCUS_09540 3336 2524 gene locus_tag LOCUS_09550 3336 2524 CDS product potassium channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054642.1 protein_id gnl|my_center|LOCUS_09550 4632 3346 gene locus_tag LOCUS_09560 4632 3346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09560 6378 4699 gene locus_tag LOCUS_09570 6378 4699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09570 7029 7991 gene locus_tag LOCUS_09580 7029 7991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09580 10861 8123 gene locus_tag LOCUS_09590 10861 8123 CDS product cation-transporting P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939279.1 protein_id gnl|my_center|LOCUS_09590 11536 11108 gene locus_tag LOCUS_09600 11536 11108 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140692.1 protein_id gnl|my_center|LOCUS_09600 13006 11978 gene locus_tag LOCUS_09610 13006 11978 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099799453.1 protein_id gnl|my_center|LOCUS_09610 14105 15217 gene locus_tag LOCUS_09620 14105 15217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933801.1 protein_id gnl|my_center|LOCUS_09620 15815 16354 gene locus_tag LOCUS_09630 15815 16354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09630 16434 16628 gene locus_tag LOCUS_09640 16434 16628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09640 16577 16765 gene locus_tag LOCUS_09650 16577 16765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09650 18430 16772 gene locus_tag LOCUS_09660 18430 16772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09660 19484 18465 gene locus_tag LOCUS_09670 19484 18465 CDS product mechanosensitive ion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121934.1 protein_id gnl|my_center|LOCUS_09670 19799 20833 gene locus_tag LOCUS_09680 19799 20833 CDS product DUF389 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057303.1 protein_id gnl|my_center|LOCUS_09680 21071 22231 gene locus_tag LOCUS_09690 21071 22231 CDS product RNA-guided endonuclease TnpB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056452.1 protein_id gnl|my_center|LOCUS_09690 22768 23118 gene locus_tag LOCUS_09700 22768 23118 CDS product phage holin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057146.1 protein_id gnl|my_center|LOCUS_09700 23245 24024 gene locus_tag LOCUS_09710 23245 24024 CDS product superoxide dismutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_165444156.1 protein_id gnl|my_center|LOCUS_09710 24038 25381 gene locus_tag LOCUS_09720 24038 25381 CDS product ferredoxin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027856.1 protein_id gnl|my_center|LOCUS_09720 25824 27191 gene locus_tag LOCUS_09730 25824 27191 CDS product glycoside hydrolase 100 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124524.1 protein_id gnl|my_center|LOCUS_09730 27212 28630 gene locus_tag LOCUS_09740 27212 28630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193329014.1 protein_id gnl|my_center|LOCUS_09740 29730 28798 gene locus_tag LOCUS_09750 29730 28798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09750 31683 30046 gene locus_tag LOCUS_09760 31683 30046 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056013.1 protein_id gnl|my_center|LOCUS_09760 33512 31869 gene locus_tag LOCUS_09770 33512 31869 CDS product alpha-amylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083724.1 protein_id gnl|my_center|LOCUS_09770 33843 35414 gene locus_tag LOCUS_09780 33843 35414 CDS product Na+/H+ antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878349.1 protein_id gnl|my_center|LOCUS_09780 35660 37213 gene locus_tag LOCUS_09790 35660 37213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09790 37790 37221 gene locus_tag LOCUS_09800 37790 37221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09800 38477 37800 gene locus_tag LOCUS_09810 38477 37800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09810 39031 38591 gene locus_tag LOCUS_09820 39031 38591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09820 39511 40737 gene locus_tag LOCUS_09830 39511 40737 CDS product PQQ-dependent sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957530.1 protein_id gnl|my_center|LOCUS_09830 40838 41530 gene locus_tag LOCUS_09840 40838 41530 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141809.1 protein_id gnl|my_center|LOCUS_09840 42157 41552 gene locus_tag LOCUS_09850 42157 41552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09850 42457 43734 gene locus_tag LOCUS_09860 42457 43734 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141685.1 protein_id gnl|my_center|LOCUS_09860 44012 44365 gene locus_tag LOCUS_09870 44012 44365 CDS product phage holin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198632.1 protein_id gnl|my_center|LOCUS_09870 44707 45855 gene locus_tag LOCUS_09880 44707 45855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404253.1 protein_id gnl|my_center|LOCUS_09880 45963 46655 gene locus_tag LOCUS_09890 45963 46655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09890 46624 47331 gene locus_tag LOCUS_09900 46624 47331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09900 47518 48183 gene locus_tag LOCUS_09910 47518 48183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09910 48232 48927 gene locus_tag LOCUS_09920 48232 48927 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144247.1 protein_id gnl|my_center|LOCUS_09920 49065 50414 gene locus_tag LOCUS_09930 49065 50414 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141651.1 protein_id gnl|my_center|LOCUS_09930 50507 51085 gene locus_tag LOCUS_09940 50507 51085 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928824.1 protein_id gnl|my_center|LOCUS_09940 51204 52010 gene locus_tag LOCUS_09950 51204 52010 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089920.1 protein_id gnl|my_center|LOCUS_09950 52556 53080 gene locus_tag LOCUS_09960 52556 53080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886848.1 protein_id gnl|my_center|LOCUS_09960 53571 53789 gene locus_tag LOCUS_09970 53571 53789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09970 54815 53820 gene locus_tag LOCUS_09980 54815 53820 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928642.1 protein_id gnl|my_center|LOCUS_09980 55346 55080 gene locus_tag LOCUS_09990 55346 55080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09990 55441 56604 gene locus_tag LOCUS_10000 gene hemH 55441 56604 CDS product ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920998.1 protein_id gnl|my_center|LOCUS_10000 56754 57134 gene locus_tag LOCUS_10010 56754 57134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10010 58718 57657 gene locus_tag LOCUS_10020 58718 57657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10020 59652 58912 gene locus_tag LOCUS_10030 59652 58912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10030 60128 59919 gene locus_tag LOCUS_10040 60128 59919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10040 60759 60187 gene locus_tag LOCUS_10050 60759 60187 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056278.1 protein_id gnl|my_center|LOCUS_10050 61335 60832 gene locus_tag LOCUS_10060 61335 60832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10060 61824 64052 gene locus_tag LOCUS_10070 61824 64052 CDS product PBP1A family penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124578.1 protein_id gnl|my_center|LOCUS_10070 64404 65501 gene locus_tag LOCUS_10080 64404 65501 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920638.1 protein_id gnl|my_center|LOCUS_10080 65857 67380 gene locus_tag LOCUS_10090 65857 67380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10090 68583 67534 gene locus_tag LOCUS_10100 68583 67534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10100 71405 68949 gene locus_tag LOCUS_10110 71405 68949 CDS product ATP-dependent Clp protease ATP-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056163.1 protein_id gnl|my_center|LOCUS_10110 71798 72088 gene locus_tag LOCUS_10120 71798 72088 CDS product DUF3288 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057272.1 protein_id gnl|my_center|LOCUS_10120 74188 72536 gene locus_tag LOCUS_10130 74188 72536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10130 75288 74506 gene locus_tag LOCUS_10140 75288 74506 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920674.1 protein_id gnl|my_center|LOCUS_10140 75380 76861 gene locus_tag LOCUS_10150 75380 76861 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142130.1 protein_id gnl|my_center|LOCUS_10150 77072 77296 gene locus_tag LOCUS_10160 77072 77296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10160 78891 77509 gene locus_tag LOCUS_10170 78891 77509 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_088243667.1 protein_id gnl|my_center|LOCUS_10170 80370 79018 gene locus_tag LOCUS_10180 80370 79018 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057372.1 protein_id gnl|my_center|LOCUS_10180 81036 80638 gene locus_tag LOCUS_10190 81036 80638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10190 82508 81513 gene locus_tag LOCUS_10200 82508 81513 CDS product formylglycine-generating enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026311868.1 protein_id gnl|my_center|LOCUS_10200 83892 82519 gene locus_tag LOCUS_10210 83892 82519 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121616.1 protein_id gnl|my_center|LOCUS_10210 84756 85964 gene locus_tag LOCUS_10220 gene dcm 84756 85964 CDS product DNA (cytosine-5-)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003690264.1 protein_id gnl|my_center|LOCUS_10220 86658 85945 gene locus_tag LOCUS_10230 86658 85945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10230 86903 86655 gene locus_tag LOCUS_10240 86903 86655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10240 87125 87817 gene locus_tag LOCUS_10250 87125 87817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10250 89192 88263 gene locus_tag LOCUS_10260 89192 88263 CDS product ChaN family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012164238.1 protein_id gnl|my_center|LOCUS_10260 90940 89900 gene locus_tag LOCUS_10270 gene chlG 90940 89900 CDS product chlorophyll synthase ChlG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920891.1 protein_id gnl|my_center|LOCUS_10270 92182 91082 gene locus_tag LOCUS_10280 92182 91082 CDS product ArsA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141227.1 protein_id gnl|my_center|LOCUS_10280 92451 92257 gene locus_tag LOCUS_10290 92451 92257 CDS product DUF2862 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056374.1 protein_id gnl|my_center|LOCUS_10290 92624 92800 gene locus_tag LOCUS_10300 92624 92800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10300 93149 93967 gene locus_tag LOCUS_10310 93149 93967 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186421.1 protein_id gnl|my_center|LOCUS_10310 94061 95140 gene locus_tag LOCUS_10320 gene gmd 94061 95140 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056481.1 protein_id gnl|my_center|LOCUS_10320 95196 96506 gene locus_tag LOCUS_10330 95196 96506 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705992.1 protein_id gnl|my_center|LOCUS_10330 96499 98337 gene locus_tag LOCUS_10340 96499 98337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10340 98403 99962 gene locus_tag LOCUS_10350 98403 99962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10350 100051 101139 gene locus_tag LOCUS_10360 100051 101139 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000658622.1 protein_id gnl|my_center|LOCUS_10360 101136 102323 gene locus_tag LOCUS_10370 101136 102323 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021204.1 protein_id gnl|my_center|LOCUS_10370 102438 103400 gene locus_tag LOCUS_10380 102438 103400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10380 103440 105743 gene locus_tag LOCUS_10390 103440 105743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10390 105799 106167 gene locus_tag LOCUS_10400 105799 106167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10400 106235 107203 gene locus_tag LOCUS_10410 gene gmd 106235 107203 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257005.1 protein_id gnl|my_center|LOCUS_10410 107213 108523 gene locus_tag LOCUS_10420 107213 108523 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963751.1 protein_id gnl|my_center|LOCUS_10420 108523 109884 gene locus_tag LOCUS_10430 108523 109884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10430 109891 111129 gene locus_tag LOCUS_10440 109891 111129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10440 111538 111161 gene locus_tag LOCUS_10450 111538 111161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10450 111866 111513 gene locus_tag LOCUS_10460 111866 111513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10460 112887 111964 gene locus_tag LOCUS_10470 112887 111964 CDS product CbiQ family ECF transporter T component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056139.1 protein_id gnl|my_center|LOCUS_10470 114343 112970 gene locus_tag LOCUS_10480 gene der 114343 112970 CDS product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056722.1 protein_id gnl|my_center|LOCUS_10480 114515 114736 gene locus_tag LOCUS_10490 114515 114736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10490 114808 115050 gene locus_tag LOCUS_10500 114808 115050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10500 115031 115393 gene locus_tag LOCUS_10510 115031 115393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_10510 115871 116311 gene locus_tag LOCUS_10520 115871 116311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10520 116456 118576 gene locus_tag LOCUS_10530 116456 118576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10530 119797 118943 gene locus_tag LOCUS_10540 119797 118943 CDS product inositol monophosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057953.1 protein_id gnl|my_center|LOCUS_10540 121303 119870 gene locus_tag LOCUS_10550 121303 119870 CDS product BCD family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141482.1 protein_id gnl|my_center|LOCUS_10550 121549 122496 gene locus_tag LOCUS_10560 121549 122496 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141923.1 protein_id gnl|my_center|LOCUS_10560 123322 122561 gene locus_tag LOCUS_10570 123322 122561 CDS product circadian clock KaiB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920713.1 protein_id gnl|my_center|LOCUS_10570 123847 128301 gene locus_tag LOCUS_10580 123847 128301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10580 128716 128883 gene locus_tag LOCUS_10590 128716 128883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10590 132792 128929 gene locus_tag LOCUS_10600 132792 128929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10600 >Feature sequence009 339 1802 gene locus_tag LOCUS_10610 339 1802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10610 3079 1880 gene locus_tag LOCUS_10620 3079 1880 CDS product putative peptidoglycan glycosyltransferase FtsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099799340.1 protein_id gnl|my_center|LOCUS_10620 3791 3207 gene locus_tag LOCUS_10630 3791 3207 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140673.1 protein_id gnl|my_center|LOCUS_10630 3898 4440 gene locus_tag LOCUS_10640 3898 4440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140674.1 protein_id gnl|my_center|LOCUS_10640 4892 4686 gene locus_tag LOCUS_10650 4892 4686 CDS product phycobilisome linker polypeptide inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056799.1 protein_id gnl|my_center|LOCUS_10650 5610 5122 gene locus_tag LOCUS_10660 gene apcB 5610 5122 CDS product allophycocyanin subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056800.1 protein_id gnl|my_center|LOCUS_10660 6161 5676 gene locus_tag LOCUS_10670 gene apcA 6161 5676 CDS product allophycocyanin subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056801.1 protein_id gnl|my_center|LOCUS_10670 9937 6542 gene locus_tag LOCUS_10680 9937 6542 CDS product phycobilisome rod-core linker polypeptide inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058198.1 protein_id gnl|my_center|LOCUS_10680 11124 10297 gene locus_tag LOCUS_10690 11124 10297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10690 12557 11118 gene locus_tag LOCUS_10700 12557 11118 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226681.1 protein_id gnl|my_center|LOCUS_10700 12653 13846 gene locus_tag LOCUS_10710 12653 13846 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057783.1 protein_id gnl|my_center|LOCUS_10710 15129 13915 gene locus_tag LOCUS_10720 15129 13915 CDS product RNA-guided endonuclease TnpB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140589.1 protein_id gnl|my_center|LOCUS_10720 15513 15950 gene locus_tag LOCUS_10730 15513 15950 CDS product ATP synthase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920689.1 protein_id gnl|my_center|LOCUS_10730 16115 16870 gene locus_tag LOCUS_10740 gene atpB 16115 16870 CDS product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056285.1 protein_id gnl|my_center|LOCUS_10740 16994 17239 gene locus_tag LOCUS_10750 gene atpE 16994 17239 CDS product ATP synthase F0 subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024125083.1 protein_id gnl|my_center|LOCUS_10750 17711 18202 gene locus_tag LOCUS_10760 17711 18202 CDS product F0F1 ATP synthase subunit B' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056287.1 protein_id gnl|my_center|LOCUS_10760 18328 18891 gene locus_tag LOCUS_10770 18328 18891 CDS product F0F1 ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197524128.1 protein_id gnl|my_center|LOCUS_10770 18888 19442 gene locus_tag LOCUS_10780 gene atpH 18888 19442 CDS product ATP synthase F1 subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056289.1 protein_id gnl|my_center|LOCUS_10780 19543 21063 gene locus_tag LOCUS_10790 gene atpA 19543 21063 CDS product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056290.1 protein_id gnl|my_center|LOCUS_10790 21377 22324 gene locus_tag LOCUS_10800 21377 22324 CDS product F0F1 ATP synthase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056240.1 protein_id gnl|my_center|LOCUS_10800 22425 23189 gene locus_tag LOCUS_10810 22425 23189 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000490911.1 protein_id gnl|my_center|LOCUS_10810 23282 23669 gene locus_tag LOCUS_tm00010 23282 23669 tmRNA product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 23970 24725 gene locus_tag LOCUS_10820 23970 24725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10820 24820 25125 gene locus_tag LOCUS_10830 24820 25125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10830 28203 25288 gene locus_tag LOCUS_10840 28203 25288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10840 28857 28417 gene locus_tag LOCUS_10850 28857 28417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10850 29783 31501 gene locus_tag LOCUS_10860 29783 31501 CDS product diflavin flavoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056931.1 protein_id gnl|my_center|LOCUS_10860 31655 33367 gene locus_tag LOCUS_10870 31655 33367 CDS product diflavin flavoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141774.1 protein_id gnl|my_center|LOCUS_10870 34529 34116 gene locus_tag LOCUS_10880 34529 34116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10880 35013 34603 gene locus_tag LOCUS_10890 35013 34603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10890 35153 37783 gene locus_tag LOCUS_10900 35153 37783 CDS product trans-splicing intein-formed DNA polymerase III subunit alpha N-terminal partner DnaE-N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057891.1 protein_id gnl|my_center|LOCUS_10900 38238 38017 gene locus_tag LOCUS_10910 38238 38017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10910 38698 38309 gene locus_tag LOCUS_10920 38698 38309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10920 41747 38703 gene locus_tag LOCUS_10930 41747 38703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10930 42640 43467 gene locus_tag LOCUS_10940 42640 43467 CDS product thioredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928794.1 protein_id gnl|my_center|LOCUS_10940 43730 44476 gene locus_tag LOCUS_10950 43730 44476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10950 44986 45678 gene locus_tag LOCUS_10960 44986 45678 CDS product CAP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941829.1 protein_id gnl|my_center|LOCUS_10960 46042 45839 gene locus_tag LOCUS_10970 46042 45839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10970 46106 47317 gene locus_tag LOCUS_10980 46106 47317 CDS product RNA-guided endonuclease TnpB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000942660.1 protein_id gnl|my_center|LOCUS_10980 48093 48947 gene locus_tag LOCUS_10990 48093 48947 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970319.1 protein_id gnl|my_center|LOCUS_10990 49630 49328 gene locus_tag LOCUS_11000 49630 49328 CDS product DUF1816 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057540.1 protein_id gnl|my_center|LOCUS_11000 50687 49716 gene locus_tag LOCUS_11010 gene rlmB 50687 49716 CDS product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144167.1 protein_id gnl|my_center|LOCUS_11010 51270 50785 gene locus_tag LOCUS_11020 51270 50785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11020 52026 51745 gene locus_tag LOCUS_11030 52026 51745 CDS product STAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197530063.1 protein_id gnl|my_center|LOCUS_11030 53478 52312 gene locus_tag LOCUS_11040 gene carA 53478 52312 CDS product glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056605.1 protein_id gnl|my_center|LOCUS_11040 53837 54952 gene locus_tag LOCUS_11050 53837 54952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11050 55258 57141 gene locus_tag LOCUS_11060 55258 57141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11060 59994 57208 gene locus_tag LOCUS_11070 59994 57208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11070 60788 60381 gene locus_tag LOCUS_11080 60788 60381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11080 61938 60853 gene locus_tag LOCUS_11090 61938 60853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11090 62140 63636 gene locus_tag LOCUS_11100 62140 63636 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_169153932.1 protein_id gnl|my_center|LOCUS_11100 63647 64045 gene locus_tag LOCUS_11110 63647 64045 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978646.1 protein_id gnl|my_center|LOCUS_11110 64532 64197 gene locus_tag LOCUS_11120 64532 64197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11120 65139 64840 gene locus_tag LOCUS_11130 65139 64840 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058088.1 protein_id gnl|my_center|LOCUS_11130 66660 65524 gene locus_tag LOCUS_11140 66660 65524 CDS product RNA-guided endonuclease TnpB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058231.1 protein_id gnl|my_center|LOCUS_11140 66994 68301 gene locus_tag LOCUS_11150 66994 68301 CDS product acetyl ornithine aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143837.1 protein_id gnl|my_center|LOCUS_11150 68596 69510 gene locus_tag LOCUS_11160 68596 69510 CDS product DUF1338 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143838.1 protein_id gnl|my_center|LOCUS_11160 72704 69906 gene locus_tag LOCUS_11170 72704 69906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11170 74807 73569 gene locus_tag LOCUS_11180 74807 73569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11180 75560 77023 gene locus_tag LOCUS_11190 75560 77023 CDS product heme peroxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929330.1 protein_id gnl|my_center|LOCUS_11190 77219 79324 gene locus_tag LOCUS_11200 77219 79324 CDS product M3 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057023.1 protein_id gnl|my_center|LOCUS_11200 79351 80214 gene locus_tag LOCUS_11210 79351 80214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11210 80506 81357 gene locus_tag LOCUS_11220 80506 81357 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920890.1 protein_id gnl|my_center|LOCUS_11220 81985 81689 gene locus_tag LOCUS_11230 81985 81689 CDS product 2Fe-2S iron-sulfur cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057369.1 protein_id gnl|my_center|LOCUS_11230 82751 83890 gene locus_tag LOCUS_11240 82751 83890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11240 83935 84819 gene locus_tag LOCUS_11250 83935 84819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11250 86369 85353 gene locus_tag LOCUS_11260 gene tgt 86369 85353 CDS product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055935.1 protein_id gnl|my_center|LOCUS_11260 87036 86662 gene locus_tag LOCUS_11270 87036 86662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11270 87745 88491 gene locus_tag LOCUS_11280 gene cobS 87745 88491 CDS product adenosylcobinamide-GDP ribazoletransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057177.1 protein_id gnl|my_center|LOCUS_11280 89083 88622 gene locus_tag LOCUS_11290 89083 88622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11290 90297 89740 gene locus_tag LOCUS_11300 90297 89740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11300 90943 93087 gene locus_tag LOCUS_11310 90943 93087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11310 93826 93317 gene locus_tag LOCUS_11320 93826 93317 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_137906819.1 protein_id gnl|my_center|LOCUS_11320 94260 93850 gene locus_tag LOCUS_11330 gene fosLL 94260 93850 CDS product fosfomycin resistance glutathione transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207881.1 protein_id gnl|my_center|LOCUS_11330 94880 94281 gene locus_tag LOCUS_11340 94880 94281 CDS product tRNA isopentenyl-2-thiomethyl-A-37 hydroxylase MiaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058204.1 protein_id gnl|my_center|LOCUS_11340 95134 95823 gene locus_tag LOCUS_11350 95134 95823 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582846.1 protein_id gnl|my_center|LOCUS_11350 96787 95882 gene locus_tag LOCUS_11360 96787 95882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11360 96800 97282 gene locus_tag LOCUS_11370 96800 97282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11370 97285 97500 gene locus_tag LOCUS_11380 97285 97500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11380 98966 97920 gene locus_tag LOCUS_11390 98966 97920 CDS product S-adenosylmethionine:tRNA ribosyltransferase-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223438.1 protein_id gnl|my_center|LOCUS_11390 99208 99540 gene locus_tag LOCUS_11400 99208 99540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_11400 100189 99722 gene locus_tag LOCUS_11410 100189 99722 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027654.1 protein_id gnl|my_center|LOCUS_11410 100804 100388 gene locus_tag LOCUS_11420 100804 100388 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063172160.1 protein_id gnl|my_center|LOCUS_11420 101593 100823 gene locus_tag LOCUS_11430 101593 100823 CDS product YciK family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007245137.1 protein_id gnl|my_center|LOCUS_11430 102326 101610 gene locus_tag LOCUS_11440 102326 101610 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928484.1 protein_id gnl|my_center|LOCUS_11440 102778 102383 gene locus_tag LOCUS_11450 102778 102383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11450 103750 102977 gene locus_tag LOCUS_11460 103750 102977 CDS product ZIP family metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144264.1 protein_id gnl|my_center|LOCUS_11460 104281 103922 gene locus_tag LOCUS_11470 104281 103922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11470 104585 104418 gene locus_tag LOCUS_11480 104585 104418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11480 104994 106079 gene locus_tag LOCUS_11490 104994 106079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11490 107737 106322 gene locus_tag LOCUS_11500 107737 106322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11500 108455 107784 gene locus_tag LOCUS_11510 108455 107784 CDS product DUF1295 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030520.1 protein_id gnl|my_center|LOCUS_11510 109252 108482 gene locus_tag LOCUS_11520 109252 108482 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958274.1 protein_id gnl|my_center|LOCUS_11520 110212 109433 gene locus_tag LOCUS_11530 110212 109433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057850.1 protein_id gnl|my_center|LOCUS_11530 110370 111443 gene locus_tag LOCUS_11540 gene murG 110370 111443 CDS product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057646.1 protein_id gnl|my_center|LOCUS_11540 114990 111529 gene locus_tag LOCUS_11550 114990 111529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11550 115390 115686 gene locus_tag LOCUS_11560 115390 115686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11560 116849 115791 gene locus_tag LOCUS_11570 116849 115791 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_097654226.1 protein_id gnl|my_center|LOCUS_11570 117494 116904 gene locus_tag LOCUS_11580 117494 116904 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056210.1 protein_id gnl|my_center|LOCUS_11580 117633 118061 gene locus_tag LOCUS_11590 117633 118061 CDS product NIL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057637.1 protein_id gnl|my_center|LOCUS_11590 118167 119501 gene locus_tag LOCUS_11600 118167 119501 CDS product vanadium-dependent haloperoxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089742.1 protein_id gnl|my_center|LOCUS_11600 120717 119650 gene locus_tag LOCUS_11610 120717 119650 CDS product DUF3616 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141362.1 protein_id gnl|my_center|LOCUS_11610 120997 121965 gene locus_tag LOCUS_11620 120997 121965 CDS product CHAD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057358.1 protein_id gnl|my_center|LOCUS_11620 122812 122306 gene locus_tag LOCUS_11630 122812 122306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11630 123220 126960 gene locus_tag LOCUS_11640 gene bchH 123220 126960 CDS product magnesium chelatase subunit H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259209.1 protein_id gnl|my_center|LOCUS_11640 127769 127131 gene locus_tag LOCUS_11650 127769 127131 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141001.1 protein_id gnl|my_center|LOCUS_11650 128567 130315 gene locus_tag LOCUS_11660 128567 130315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11660 130532 130828 gene locus_tag LOCUS_11670 130532 130828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11670 131352 130825 gene locus_tag LOCUS_11680 131352 130825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11680 >Feature sequence010 385 1563 gene locus_tag LOCUS_11690 385 1563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404253.1 protein_id gnl|my_center|LOCUS_11690 2165 1686 gene locus_tag LOCUS_11700 2165 1686 CDS product DUF4383 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727892.1 protein_id gnl|my_center|LOCUS_11700 2926 3129 gene locus_tag LOCUS_11710 gene chaB 2926 3129 CDS product putative cation transport regulator ChaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001146392.1 protein_id gnl|my_center|LOCUS_11710 3214 4557 gene locus_tag LOCUS_11720 gene gor 3214 4557 CDS product glutathione-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057447.1 protein_id gnl|my_center|LOCUS_11720 4831 6177 gene locus_tag LOCUS_11730 4831 6177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11730 6998 6198 gene locus_tag LOCUS_11740 6998 6198 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007245058.1 protein_id gnl|my_center|LOCUS_11740 7266 9212 gene locus_tag LOCUS_11750 7266 9212 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225976.1 protein_id gnl|my_center|LOCUS_11750 9589 11628 gene locus_tag LOCUS_11760 9589 11628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11760 11915 12709 gene locus_tag LOCUS_11770 11915 12709 CDS product 3-oxoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001832302.1 protein_id gnl|my_center|LOCUS_11770 13282 12893 gene locus_tag LOCUS_11780 13282 12893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11780 13860 13417 gene locus_tag LOCUS_11790 13860 13417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11790 14421 14954 gene locus_tag LOCUS_11800 14421 14954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11800 14968 15222 gene locus_tag LOCUS_11810 14968 15222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11810 15233 15739 gene locus_tag LOCUS_11820 15233 15739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11820 17037 16066 gene locus_tag LOCUS_11830 17037 16066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11830 20100 17824 gene locus_tag LOCUS_11840 gene ppsA 20100 17824 CDS product phosphoenolpyruvate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005629687.1 protein_id gnl|my_center|LOCUS_11840 20502 20954 gene locus_tag LOCUS_11850 20502 20954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11850 22230 21103 gene locus_tag LOCUS_11860 gene recF 22230 21103 CDS product DNA replication/repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142400.1 protein_id gnl|my_center|LOCUS_11860 25197 22333 gene locus_tag LOCUS_11870 25197 22333 CDS product cation-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057066.1 protein_id gnl|my_center|LOCUS_11870 25515 27149 gene locus_tag LOCUS_11880 25515 27149 CDS product transglutaminase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056162.1 protein_id gnl|my_center|LOCUS_11880 27482 27222 gene locus_tag LOCUS_11890 27482 27222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11890 28392 27613 gene locus_tag LOCUS_11900 28392 27613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11900 28416 28796 gene locus_tag LOCUS_11910 28416 28796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11910 29118 29390 gene locus_tag LOCUS_11920 29118 29390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11920 29788 30309 gene locus_tag LOCUS_11930 29788 30309 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975511.1 protein_id gnl|my_center|LOCUS_11930 33113 30354 gene locus_tag LOCUS_11940 gene polA 33113 30354 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140638.1 protein_id gnl|my_center|LOCUS_11940 34203 33367 gene locus_tag LOCUS_11950 34203 33367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11950 34884 35759 gene locus_tag LOCUS_11960 34884 35759 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140835.1 protein_id gnl|my_center|LOCUS_11960 36624 35965 gene locus_tag LOCUS_11970 36624 35965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11970 37133 37852 gene locus_tag LOCUS_11980 37133 37852 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142793.1 protein_id gnl|my_center|LOCUS_11980 38187 38525 gene locus_tag LOCUS_11990 38187 38525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11990 39568 38537 gene locus_tag LOCUS_12000 39568 38537 CDS product PstS family phosphate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057692.1 protein_id gnl|my_center|LOCUS_12000 42369 40954 gene locus_tag LOCUS_12010 42369 40954 CDS product serine/threonine-protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058264.1 protein_id gnl|my_center|LOCUS_12010 43470 42460 gene locus_tag LOCUS_12020 43470 42460 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057048.1 protein_id gnl|my_center|LOCUS_12020 44863 45579 gene locus_tag LOCUS_12030 44863 45579 CDS product NnrU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056001.1 protein_id gnl|my_center|LOCUS_12030 45798 45989 gene locus_tag LOCUS_12040 45798 45989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12040 46236 46622 gene locus_tag LOCUS_12050 46236 46622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12050 47067 49163 gene locus_tag LOCUS_12060 47067 49163 CDS product NAD(P)H-quinone oxidoreductase subunit 5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140222.1 protein_id gnl|my_center|LOCUS_12060 49406 50977 gene locus_tag LOCUS_12070 gene ndhD1 49406 50977 CDS product photosynthetic/respiratory NAD(P)H-quinone oxidoreductase subunit D1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056566.1 protein_id gnl|my_center|LOCUS_12070 52312 51017 gene locus_tag LOCUS_12080 52312 51017 CDS product RNA-guided endonuclease TnpB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403015.1 protein_id gnl|my_center|LOCUS_12080 54154 52721 gene locus_tag LOCUS_12090 54154 52721 CDS product cobyrinate a,c-diamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920940.1 protein_id gnl|my_center|LOCUS_12090 55593 54214 gene locus_tag LOCUS_12100 gene opcA 55593 54214 CDS product glucose-6-phosphate dehydrogenase assembly protein OpcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056389.1 protein_id gnl|my_center|LOCUS_12100 57233 55704 gene locus_tag LOCUS_12110 gene zwf 57233 55704 CDS product glucose-6-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056390.1 protein_id gnl|my_center|LOCUS_12110 58522 57377 gene locus_tag LOCUS_12120 gene tal 58522 57377 CDS product transaldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143366.1 protein_id gnl|my_center|LOCUS_12120 59763 58711 gene locus_tag LOCUS_12130 gene fbp 59763 58711 CDS product class 1 fructose-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056391.1 protein_id gnl|my_center|LOCUS_12130 60625 60350 gene locus_tag LOCUS_12140 60625 60350 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058088.1 protein_id gnl|my_center|LOCUS_12140 61823 61596 gene locus_tag LOCUS_12150 61823 61596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197530057.1 protein_id gnl|my_center|LOCUS_12150 63101 62028 gene locus_tag LOCUS_12160 63101 62028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12160 64656 63421 gene locus_tag LOCUS_12170 64656 63421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12170 64880 65482 gene locus_tag LOCUS_12180 64880 65482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12180 65614 66459 gene locus_tag LOCUS_12190 gene dapF 65614 66459 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583145.1 protein_id gnl|my_center|LOCUS_12190 67456 66662 gene locus_tag LOCUS_12200 gene cysE 67456 66662 CDS product serine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056695.1 protein_id gnl|my_center|LOCUS_12200 69363 67678 gene locus_tag LOCUS_12210 69363 67678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12210 70821 69610 gene locus_tag LOCUS_12220 70821 69610 CDS product RNA-guided endonuclease TnpB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254458.1 protein_id gnl|my_center|LOCUS_12220 70883 71074 gene locus_tag LOCUS_12230 70883 71074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12230 71168 71524 gene locus_tag LOCUS_12240 71168 71524 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055899.1 protein_id gnl|my_center|LOCUS_12240 71981 73072 gene locus_tag LOCUS_12250 gene hrcA 71981 73072 CDS product heat-inducible transcriptional repressor HrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056606.1 protein_id gnl|my_center|LOCUS_12250 73133 73855 gene locus_tag LOCUS_12260 73133 73855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057488.1 protein_id gnl|my_center|LOCUS_12260 73860 74507 gene locus_tag LOCUS_12270 73860 74507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140265.1 protein_id gnl|my_center|LOCUS_12270 74725 75237 gene locus_tag LOCUS_12280 74725 75237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12280 76734 76537 gene locus_tag LOCUS_12290 76734 76537 CDS product chlorophyll a/b-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142054.1 protein_id gnl|my_center|LOCUS_12290 77024 77842 gene locus_tag LOCUS_12300 77024 77842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12300 78222 77854 gene locus_tag LOCUS_12310 78222 77854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12310 79060 78830 gene locus_tag LOCUS_12320 79060 78830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12320 79552 79106 gene locus_tag LOCUS_12330 79552 79106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12330 79898 79710 gene locus_tag LOCUS_12340 79898 79710 CDS product CPXCG motif-containing cysteine-rich protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143465.1 protein_id gnl|my_center|LOCUS_12340 81806 80160 gene locus_tag LOCUS_12350 81806 80160 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057717.1 protein_id gnl|my_center|LOCUS_12350 82082 81828 gene locus_tag LOCUS_12360 82082 81828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12360 82942 82118 gene locus_tag LOCUS_12370 82942 82118 CDS product DUF4037 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000349559.1 protein_id gnl|my_center|LOCUS_12370 84288 83200 gene locus_tag LOCUS_12380 gene aroC 84288 83200 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056316.1 protein_id gnl|my_center|LOCUS_12380 85847 84765 gene locus_tag LOCUS_12390 gene psbA 85847 84765 CDS product photosystem II q(b) protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057317.1 protein_id gnl|my_center|LOCUS_12390 87121 86087 gene locus_tag LOCUS_12400 87121 86087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12400 87509 88132 gene locus_tag LOCUS_12410 87509 88132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12410 88211 89281 gene locus_tag LOCUS_12420 gene cofG 88211 89281 CDS product 7,8-didemethyl-8-hydroxy-5-deazariboflavin synthase subunit CofG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057355.1 protein_id gnl|my_center|LOCUS_12420 89492 89827 gene locus_tag LOCUS_12430 89492 89827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12430 89820 91145 gene locus_tag LOCUS_12440 89820 91145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12440 91142 93097 gene locus_tag LOCUS_12450 91142 93097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12450 93211 93465 gene locus_tag LOCUS_12460 93211 93465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12460 93509 93847 gene locus_tag LOCUS_12470 93509 93847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12470 93873 94205 gene locus_tag LOCUS_12480 gene mazF9 93873 94205 CDS product type II toxin-antitoxin system toxin endoribonuclease MazF9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414166.1 protein_id gnl|my_center|LOCUS_12480 94851 94222 gene locus_tag LOCUS_12490 94851 94222 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017653748.1 protein_id gnl|my_center|LOCUS_12490 95172 96812 gene locus_tag LOCUS_12500 gene hflX 95172 96812 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144128.1 protein_id gnl|my_center|LOCUS_12500 97110 97400 gene locus_tag LOCUS_12510 gene grxC 97110 97400 CDS product glutaredoxin 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056751.1 protein_id gnl|my_center|LOCUS_12510 97877 98845 gene locus_tag LOCUS_12520 gene gshB 97877 98845 CDS product glutathione synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056752.1 protein_id gnl|my_center|LOCUS_12520 100583 99279 gene locus_tag LOCUS_12530 gene ftsZ 100583 99279 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023065873.1 protein_id gnl|my_center|LOCUS_12530 102817 101939 gene locus_tag LOCUS_12540 102817 101939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12540 104425 104075 gene locus_tag LOCUS_12550 104425 104075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056902.1 protein_id gnl|my_center|LOCUS_12550 105363 106196 gene locus_tag LOCUS_12560 105363 106196 CDS product photosystem II manganese-stabilizing polypeptide inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056297.1 protein_id gnl|my_center|LOCUS_12560 107004 107780 gene locus_tag LOCUS_12570 107004 107780 CDS product RNA polymerase sigma factor SigF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056585.1 protein_id gnl|my_center|LOCUS_12570 108045 109079 gene locus_tag LOCUS_12580 108045 109079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12580 109082 109327 gene locus_tag LOCUS_12590 109082 109327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920941.1 protein_id gnl|my_center|LOCUS_12590 109729 112113 gene locus_tag LOCUS_12600 109729 112113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12600 112395 112201 gene locus_tag LOCUS_12610 112395 112201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12610 113350 113099 gene locus_tag LOCUS_12620 gene psbE 113350 113099 CDS product cytochrome b559 subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057381.1 protein_id gnl|my_center|LOCUS_12620 114476 113454 gene locus_tag LOCUS_12630 114476 113454 CDS product photosynthesis system II assembly factor Ycf48 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057532.1 protein_id gnl|my_center|LOCUS_12630 114901 114566 gene locus_tag LOCUS_12640 114901 114566 CDS product rubredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057533.1 protein_id gnl|my_center|LOCUS_12640 115097 115459 gene locus_tag LOCUS_12650 gene ndhC 115097 115459 CDS product photosynthetic/respiratory NAD(P)H-quinone oxidoreductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_126986108.1 protein_id gnl|my_center|LOCUS_12650 115450 116187 gene locus_tag LOCUS_12660 gene ndhK 115450 116187 CDS product photosynthetic/respiratory NAD(P)H-quinone oxidoreductase subunit K inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056552.1 protein_id gnl|my_center|LOCUS_12660 116180 116704 gene locus_tag LOCUS_12670 116180 116704 CDS product NAD(P)H-quinone oxidoreductase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057270.1 protein_id gnl|my_center|LOCUS_12670 118193 116787 gene locus_tag LOCUS_12680 118193 116787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12680 119110 118865 gene locus_tag LOCUS_12690 119110 118865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929067.1 protein_id gnl|my_center|LOCUS_12690 119863 119285 gene locus_tag LOCUS_12700 119863 119285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12700 120707 119931 gene locus_tag LOCUS_12710 120707 119931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12710 121347 123398 gene locus_tag LOCUS_12720 121347 123398 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058192.1 protein_id gnl|my_center|LOCUS_12720 123763 124167 gene locus_tag LOCUS_12730 123763 124167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12730 >Feature sequence011 2211 169 gene locus_tag LOCUS_12740 2211 169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12740 2631 2281 gene locus_tag LOCUS_12750 2631 2281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12750 4125 2848 gene locus_tag LOCUS_12760 4125 2848 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_105221568.1 protein_id gnl|my_center|LOCUS_12760 4299 5054 gene locus_tag LOCUS_12770 4299 5054 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056030.1 protein_id gnl|my_center|LOCUS_12770 5214 6473 gene locus_tag LOCUS_12780 5214 6473 CDS product FAD-dependent hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921015.1 protein_id gnl|my_center|LOCUS_12780 7124 9313 gene locus_tag LOCUS_12790 7124 9313 CDS product transglycosylase SLT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920783.1 protein_id gnl|my_center|LOCUS_12790 9409 10218 gene locus_tag LOCUS_12800 gene tatC 9409 10218 CDS product twin-arginine translocase subunit TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056797.1 protein_id gnl|my_center|LOCUS_12800 10491 10312 gene locus_tag LOCUS_12810 10491 10312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12810 10824 10513 gene locus_tag LOCUS_12820 10824 10513 CDS product DUF3067 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056802.1 protein_id gnl|my_center|LOCUS_12820 11051 11590 gene locus_tag LOCUS_12830 11051 11590 CDS product cytochrome b6-f complex iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124615.1 protein_id gnl|my_center|LOCUS_12830 11709 12710 gene locus_tag LOCUS_12840 gene petA 11709 12710 CDS product apocytochrome f inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056804.1 protein_id gnl|my_center|LOCUS_12840 13267 12965 gene locus_tag LOCUS_12850 13267 12965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12850 13693 13529 gene locus_tag LOCUS_12860 13693 13529 CDS product Zn ribbon-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125892.1 protein_id gnl|my_center|LOCUS_12860 14603 14331 gene locus_tag LOCUS_12870 14603 14331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12870 16791 14812 gene locus_tag LOCUS_12880 16791 14812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12880 18004 17123 gene locus_tag LOCUS_12890 18004 17123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12890 20529 18004 gene locus_tag LOCUS_12900 20529 18004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12900 21132 21380 gene locus_tag LOCUS_12910 21132 21380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12910 21580 22266 gene locus_tag LOCUS_12920 21580 22266 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141382.1 protein_id gnl|my_center|LOCUS_12920 23941 22352 gene locus_tag LOCUS_12930 23941 22352 CDS product glycoside hydrolase family 57 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057809.1 protein_id gnl|my_center|LOCUS_12930 25208 24060 gene locus_tag LOCUS_12940 gene rsgA 25208 24060 CDS product small ribosomal subunit biogenesis GTPase RsgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056831.1 protein_id gnl|my_center|LOCUS_12940 25462 25205 gene locus_tag LOCUS_12950 25462 25205 CDS product sulfurtransferase TusA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056832.1 protein_id gnl|my_center|LOCUS_12950 26592 25459 gene locus_tag LOCUS_12960 gene dnaJ 26592 25459 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920758.1 protein_id gnl|my_center|LOCUS_12960 29301 27349 gene locus_tag LOCUS_12970 gene dnaK 29301 27349 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056634.1 protein_id gnl|my_center|LOCUS_12970 30298 29510 gene locus_tag LOCUS_12980 gene grpE 30298 29510 CDS product nucleotide exchange factor GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057154.1 protein_id gnl|my_center|LOCUS_12980 31240 30689 gene locus_tag LOCUS_12990 31240 30689 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086720.1 protein_id gnl|my_center|LOCUS_12990 31447 32271 gene locus_tag LOCUS_13000 31447 32271 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029786.1 protein_id gnl|my_center|LOCUS_13000 32402 32626 gene locus_tag LOCUS_13010 32402 32626 CDS product DUF433 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142391.1 protein_id gnl|my_center|LOCUS_13010 32623 32961 gene locus_tag LOCUS_13020 32623 32961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13020 33188 35122 gene locus_tag LOCUS_13030 33188 35122 CDS product GspE/PulE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055977.1 protein_id gnl|my_center|LOCUS_13030 35315 36433 gene locus_tag LOCUS_13040 35315 36433 CDS product type IV pilus twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055976.1 protein_id gnl|my_center|LOCUS_13040 36681 37895 gene locus_tag LOCUS_13050 36681 37895 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099798964.1 protein_id gnl|my_center|LOCUS_13050 38025 38579 gene locus_tag LOCUS_13060 38025 38579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197524130.1 protein_id gnl|my_center|LOCUS_13060 39616 38690 gene locus_tag LOCUS_13070 39616 38690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13070 41314 40430 gene locus_tag LOCUS_13080 41314 40430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13080 41204 41512 gene locus_tag LOCUS_13090 41204 41512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13090 42082 41768 gene locus_tag LOCUS_13100 42082 41768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13100 42364 43311 gene locus_tag LOCUS_13110 42364 43311 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284156.1 protein_id gnl|my_center|LOCUS_13110 44187 43678 gene locus_tag LOCUS_13120 44187 43678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13120 45031 44255 gene locus_tag LOCUS_13130 45031 44255 CDS product DUF4198 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391325.1 protein_id gnl|my_center|LOCUS_13130 46356 45334 gene locus_tag LOCUS_13140 46356 45334 CDS product saccharopine dehydrogenase-like oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928537.1 protein_id gnl|my_center|LOCUS_13140 47094 47303 gene locus_tag LOCUS_13150 47094 47303 CDS product DUF2997 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_126987300.1 protein_id gnl|my_center|LOCUS_13150 47343 47729 gene locus_tag LOCUS_13160 47343 47729 CDS product DUF1257 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057973.1 protein_id gnl|my_center|LOCUS_13160 47729 48190 gene locus_tag LOCUS_13170 47729 48190 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099798060.1 protein_id gnl|my_center|LOCUS_13170 50051 48405 gene locus_tag LOCUS_13180 50051 48405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13180 50746 50141 gene locus_tag LOCUS_13190 50746 50141 CDS product DUF3038 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057324.1 protein_id gnl|my_center|LOCUS_13190 53747 51264 gene locus_tag LOCUS_13200 53747 51264 CDS product endonuclease MutS2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921058.1 protein_id gnl|my_center|LOCUS_13200 54177 55340 gene locus_tag LOCUS_13210 54177 55340 CDS product GuaB3 family IMP dehydrogenase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058024.1 protein_id gnl|my_center|LOCUS_13210 55751 56074 gene locus_tag LOCUS_13220 gene trxA 55751 56074 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140882.1 protein_id gnl|my_center|LOCUS_13220 57240 58316 gene locus_tag LOCUS_13230 57240 58316 CDS product LOG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057667.1 protein_id gnl|my_center|LOCUS_13230 59886 58408 gene locus_tag LOCUS_13240 59886 58408 CDS product leucyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057582.1 protein_id gnl|my_center|LOCUS_13240 62118 59998 gene locus_tag LOCUS_13250 62118 59998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13250 62597 62121 gene locus_tag LOCUS_13260 62597 62121 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006316403.1 protein_id gnl|my_center|LOCUS_13260 66336 62608 gene locus_tag LOCUS_13270 66336 62608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13270 68074 66890 gene locus_tag LOCUS_13280 68074 66890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13280 69160 68342 gene locus_tag LOCUS_13290 69160 68342 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142238.1 protein_id gnl|my_center|LOCUS_13290 70003 69275 gene locus_tag LOCUS_13300 70003 69275 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142237.1 protein_id gnl|my_center|LOCUS_13300 70383 71984 gene locus_tag LOCUS_13310 gene metG 70383 71984 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056597.1 protein_id gnl|my_center|LOCUS_13310 72127 72765 gene locus_tag LOCUS_13320 72127 72765 CDS product NYN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056598.1 protein_id gnl|my_center|LOCUS_13320 72765 73982 gene locus_tag LOCUS_13330 72765 73982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13330 75367 74045 gene locus_tag LOCUS_13340 75367 74045 CDS product D-alanyl-D-alanine carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057931.1 protein_id gnl|my_center|LOCUS_13340 76287 77312 gene locus_tag LOCUS_13350 gene plsX 76287 77312 CDS product phosphate acyltransferase PlsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056688.1 protein_id gnl|my_center|LOCUS_13350 77411 78403 gene locus_tag LOCUS_13360 77411 78403 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056689.1 protein_id gnl|my_center|LOCUS_13360 78523 79401 gene locus_tag LOCUS_13370 gene fabD 78523 79401 CDS product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920631.1 protein_id gnl|my_center|LOCUS_13370 79586 80152 gene locus_tag LOCUS_13380 79586 80152 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055897.1 protein_id gnl|my_center|LOCUS_13380 80427 81467 gene locus_tag LOCUS_13390 80427 81467 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141878.1 protein_id gnl|my_center|LOCUS_13390 81560 81862 gene locus_tag LOCUS_13400 81560 81862 CDS product DUF2288 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943940.1 protein_id gnl|my_center|LOCUS_13400 82576 82007 gene locus_tag LOCUS_13410 82576 82007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13410 83000 82924 gene locus_tag LOCUS_t00100 83000 82924 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 84127 83030 gene locus_tag LOCUS_13420 84127 83030 CDS product tocopherol cyclase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197530023.1 protein_id gnl|my_center|LOCUS_13420 84157 84768 gene locus_tag LOCUS_13430 84157 84768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13430 84938 87025 gene locus_tag LOCUS_13440 84938 87025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13440 88504 87671 gene locus_tag LOCUS_13450 88504 87671 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143597.1 protein_id gnl|my_center|LOCUS_13450 88767 89828 gene locus_tag LOCUS_13460 88767 89828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13460 90005 90589 gene locus_tag LOCUS_13470 90005 90589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13470 91215 90688 gene locus_tag LOCUS_13480 91215 90688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_13480 92358 91258 gene locus_tag LOCUS_13490 92358 91258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_13490 93038 92481 gene locus_tag LOCUS_13500 93038 92481 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642476.1 protein_id gnl|my_center|LOCUS_13500 95698 93473 gene locus_tag LOCUS_13510 95698 93473 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459225.1 protein_id gnl|my_center|LOCUS_13510 97093 95765 gene locus_tag LOCUS_13520 97093 95765 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272228.1 protein_id gnl|my_center|LOCUS_13520 98530 97244 gene locus_tag LOCUS_13530 98530 97244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13530 99921 98671 gene locus_tag LOCUS_13540 99921 98671 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460075.1 protein_id gnl|my_center|LOCUS_13540 100097 100417 gene locus_tag LOCUS_13550 100097 100417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13550 101742 102980 gene locus_tag LOCUS_13560 101742 102980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13560 103249 104337 gene locus_tag LOCUS_13570 103249 104337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13570 104420 104866 gene locus_tag LOCUS_13580 104420 104866 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056339.1 protein_id gnl|my_center|LOCUS_13580 106464 104977 gene locus_tag LOCUS_13590 106464 104977 CDS product 2-succinylbenzoate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920832.1 protein_id gnl|my_center|LOCUS_13590 107465 106449 gene locus_tag LOCUS_13600 107465 106449 CDS product o-succinylbenzoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057016.1 protein_id gnl|my_center|LOCUS_13600 108289 107465 gene locus_tag LOCUS_13610 gene menA 108289 107465 CDS product 2-carboxy-1,4-naphthoquinone phytyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_073592656.1 protein_id gnl|my_center|LOCUS_13610 108708 110123 gene locus_tag LOCUS_13620 108708 110123 CDS product isochorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057055.1 protein_id gnl|my_center|LOCUS_13620 113807 110115 gene locus_tag LOCUS_13630 113807 110115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13630 115608 114301 gene locus_tag LOCUS_13640 115608 114301 CDS product glutamate-5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_165442178.1 protein_id gnl|my_center|LOCUS_13640 115825 116292 gene locus_tag LOCUS_13650 115825 116292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13650 117200 116361 gene locus_tag LOCUS_13660 117200 116361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13660 117713 117201 gene locus_tag LOCUS_13670 117713 117201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13670 118021 118093 gene locus_tag LOCUS_t00110 118021 118093 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 118369 118283 gene locus_tag LOCUS_t00120 118369 118283 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 120776 118419 gene locus_tag LOCUS_13680 120776 118419 CDS product ComEC/Rec2 family competence protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057539.1 protein_id gnl|my_center|LOCUS_13680 121416 120937 gene locus_tag LOCUS_13690 121416 120937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13690 122472 121555 gene locus_tag LOCUS_13700 gene glyQ 122472 121555 CDS product glycine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920808.1 protein_id gnl|my_center|LOCUS_13700 >Feature sequence012 398 192 gene locus_tag LOCUS_13710 398 192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13710 674 3961 gene locus_tag LOCUS_13720 674 3961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13720 4259 5140 gene locus_tag LOCUS_13730 4259 5140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13730 5856 6872 gene locus_tag LOCUS_13740 5856 6872 CDS product DUF3365 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023174491.1 protein_id gnl|my_center|LOCUS_13740 6984 7799 gene locus_tag LOCUS_13750 6984 7799 CDS product MinD/ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920789.1 protein_id gnl|my_center|LOCUS_13750 8137 7784 gene locus_tag LOCUS_13760 8137 7784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13760 8368 9108 gene locus_tag LOCUS_13770 8368 9108 CDS product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922137.1 protein_id gnl|my_center|LOCUS_13770 12154 9185 gene locus_tag LOCUS_13780 12154 9185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13780 14585 12354 gene locus_tag LOCUS_13790 14585 12354 CDS product NHLP family bacteriocin export ABC transporter peptidase/permease/ATPase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814910.1 protein_id gnl|my_center|LOCUS_13790 16117 14663 gene locus_tag LOCUS_13800 16117 14663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13800 17315 16218 gene locus_tag LOCUS_13810 17315 16218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13810 18205 19068 gene locus_tag LOCUS_13820 18205 19068 CDS product STAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036368.1 protein_id gnl|my_center|LOCUS_13820 19088 19483 gene locus_tag LOCUS_13830 19088 19483 CDS product STAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036369.1 protein_id gnl|my_center|LOCUS_13830 19464 19865 gene locus_tag LOCUS_13840 19464 19865 CDS product anti-sigma regulatory factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883997.1 protein_id gnl|my_center|LOCUS_13840 19880 20893 gene locus_tag LOCUS_13850 19880 20893 CDS product anti-sigma regulatory factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883998.1 protein_id gnl|my_center|LOCUS_13850 20890 23028 gene locus_tag LOCUS_13860 20890 23028 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883999.1 protein_id gnl|my_center|LOCUS_13860 23039 25387 gene locus_tag LOCUS_13870 23039 25387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13870 27249 25612 gene locus_tag LOCUS_13880 gene groL 27249 25612 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056040.1 protein_id gnl|my_center|LOCUS_13880 27737 27426 gene locus_tag LOCUS_13890 gene groES 27737 27426 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125740.1 protein_id gnl|my_center|LOCUS_13890 28695 28171 gene locus_tag LOCUS_13900 28695 28171 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056717.1 protein_id gnl|my_center|LOCUS_13900 29229 30299 gene locus_tag LOCUS_13910 29229 30299 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057430.1 protein_id gnl|my_center|LOCUS_13910 30838 30395 gene locus_tag LOCUS_13920 30838 30395 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106829.1 protein_id gnl|my_center|LOCUS_13920 31862 31098 gene locus_tag LOCUS_13930 31862 31098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13930 32301 31906 gene locus_tag LOCUS_13940 32301 31906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13940 32843 32538 gene locus_tag LOCUS_13950 32843 32538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13950 33391 32840 gene locus_tag LOCUS_13960 33391 32840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13960 33948 33511 gene locus_tag LOCUS_13970 33948 33511 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056717.1 protein_id gnl|my_center|LOCUS_13970 34515 38909 gene locus_tag LOCUS_13980 34515 38909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13980 39784 39134 gene locus_tag LOCUS_13990 39784 39134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13990 39990 40970 gene locus_tag LOCUS_14000 39990 40970 CDS product YegS/Rv2252/BmrU family lipid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143508.1 protein_id gnl|my_center|LOCUS_14000 41001 42551 gene locus_tag LOCUS_14010 41001 42551 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142505.1 protein_id gnl|my_center|LOCUS_14010 42992 42573 gene locus_tag LOCUS_14020 42992 42573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14020 43832 43095 gene locus_tag LOCUS_14030 43832 43095 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072508.1 protein_id gnl|my_center|LOCUS_14030 44467 45138 gene locus_tag LOCUS_14040 44467 45138 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967335.1 protein_id gnl|my_center|LOCUS_14040 45629 45207 gene locus_tag LOCUS_14050 45629 45207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14050 46563 46135 gene locus_tag LOCUS_14060 46563 46135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14060 47094 46600 gene locus_tag LOCUS_14070 47094 46600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14070 49598 47223 gene locus_tag LOCUS_14080 49598 47223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14080 50480 53629 gene locus_tag LOCUS_14090 50480 53629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14090 54572 53838 gene locus_tag LOCUS_14100 54572 53838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14100 54885 55481 gene locus_tag LOCUS_14110 54885 55481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14110 55904 56674 gene locus_tag LOCUS_14120 55904 56674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14120 57063 56695 gene locus_tag LOCUS_14130 57063 56695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14130 57188 58162 gene locus_tag LOCUS_14140 57188 58162 CDS product zinc-dependent alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119496.1 protein_id gnl|my_center|LOCUS_14140 58451 59074 gene locus_tag LOCUS_14150 gene tenA 58451 59074 CDS product thiaminase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000666827.1 protein_id gnl|my_center|LOCUS_14150 59237 59971 gene locus_tag LOCUS_14160 59237 59971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14160 59946 60857 gene locus_tag LOCUS_14170 59946 60857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14170 61189 61638 gene locus_tag LOCUS_14180 61189 61638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14180 61761 63446 gene locus_tag LOCUS_14190 gene ilvD 61761 63446 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258705.1 protein_id gnl|my_center|LOCUS_14190 65036 63528 gene locus_tag LOCUS_14200 65036 63528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14200 66193 66987 gene locus_tag LOCUS_14210 66193 66987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14210 67400 68755 gene locus_tag LOCUS_14220 67400 68755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14220 68777 69184 gene locus_tag LOCUS_14230 68777 69184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14230 70414 69245 gene locus_tag LOCUS_14240 70414 69245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14240 71386 70508 gene locus_tag LOCUS_14250 71386 70508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14250 72578 71652 gene locus_tag LOCUS_14260 72578 71652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14260 73669 72698 gene locus_tag LOCUS_14270 73669 72698 CDS product 2-oxoglutarate and iron-dependent oxygenase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266548.1 protein_id gnl|my_center|LOCUS_14270 73837 74400 gene locus_tag LOCUS_14280 73837 74400 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258478.1 protein_id gnl|my_center|LOCUS_14280 75451 74498 gene locus_tag LOCUS_14290 75451 74498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14290 76373 75474 gene locus_tag LOCUS_14300 76373 75474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14300 77701 76610 gene locus_tag LOCUS_14310 gene ychF 77701 76610 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057426.1 protein_id gnl|my_center|LOCUS_14310 77984 77763 gene locus_tag LOCUS_14320 77984 77763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14320 78152 79711 gene locus_tag LOCUS_14330 78152 79711 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965635.1 protein_id gnl|my_center|LOCUS_14330 79931 79701 gene locus_tag LOCUS_14340 79931 79701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14340 81546 80122 gene locus_tag LOCUS_14350 81546 80122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14350 82003 81638 gene locus_tag LOCUS_14360 82003 81638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14360 83279 82227 gene locus_tag LOCUS_14370 gene dusB 83279 82227 CDS product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056835.1 protein_id gnl|my_center|LOCUS_14370 83520 83678 gene locus_tag LOCUS_14380 83520 83678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14380 83754 85676 gene locus_tag LOCUS_14390 gene dnaK 83754 85676 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057570.1 protein_id gnl|my_center|LOCUS_14390 85914 86564 gene locus_tag LOCUS_14400 85914 86564 CDS product acetoacetate decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144133.1 protein_id gnl|my_center|LOCUS_14400 88263 86674 gene locus_tag LOCUS_14410 88263 86674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14410 89001 89294 gene locus_tag LOCUS_14420 gene fdxB 89001 89294 CDS product ferredoxin III, nif-specific inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720698.1 protein_id gnl|my_center|LOCUS_14420 90137 91141 gene locus_tag LOCUS_14430 90137 91141 CDS product cytochrome c oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057846.1 protein_id gnl|my_center|LOCUS_14430 91197 92891 gene locus_tag LOCUS_14440 gene ctaD 91197 92891 CDS product cytochrome c oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057845.1 protein_id gnl|my_center|LOCUS_14440 93234 93827 gene locus_tag LOCUS_14450 93234 93827 CDS product heme-copper oxidase subunit III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057844.1 protein_id gnl|my_center|LOCUS_14450 93889 94371 gene locus_tag LOCUS_14460 93889 94371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14460 94414 95025 gene locus_tag LOCUS_14470 94414 95025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14470 95109 95582 gene locus_tag LOCUS_14480 95109 95582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14480 96701 95844 gene locus_tag LOCUS_14490 96701 95844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14490 96887 97132 gene locus_tag LOCUS_14500 96887 97132 CDS product peptidoglycan-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_208349085.1 protein_id gnl|my_center|LOCUS_14500 97836 97381 gene locus_tag LOCUS_14510 97836 97381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14510 100901 97836 gene locus_tag LOCUS_14520 100901 97836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14520 105320 101169 gene locus_tag LOCUS_14530 105320 101169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14530 106083 105553 gene locus_tag LOCUS_14540 106083 105553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14540 106544 106152 gene locus_tag LOCUS_14550 106544 106152 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056419.1 protein_id gnl|my_center|LOCUS_14550 108169 106802 gene locus_tag LOCUS_14560 108169 106802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14560 109351 109097 gene locus_tag LOCUS_14570 109351 109097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14570 109608 109369 gene locus_tag LOCUS_14580 109608 109369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14580 110259 110477 gene locus_tag LOCUS_14590 110259 110477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14590 110964 111968 gene locus_tag LOCUS_14600 110964 111968 CDS product RNA-guided endonuclease TnpB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403412.1 protein_id gnl|my_center|LOCUS_14600 112015 112365 gene locus_tag LOCUS_14610 112015 112365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14610 >Feature sequence013 508 1854 gene locus_tag LOCUS_14620 508 1854 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197309.1 protein_id gnl|my_center|LOCUS_14620 2351 2785 gene locus_tag LOCUS_14630 gene infC 2351 2785 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355797.1 protein_id gnl|my_center|LOCUS_14630 3325 4260 gene locus_tag LOCUS_14640 3325 4260 CDS product IS630 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_085939171.1 protein_id gnl|my_center|LOCUS_14640 4409 4257 gene locus_tag LOCUS_14650 4409 4257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14650 5464 6933 gene locus_tag LOCUS_14660 5464 6933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14660 6983 8035 gene locus_tag LOCUS_14670 6983 8035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14670 8126 10804 gene locus_tag LOCUS_14680 8126 10804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14680 11767 10964 gene locus_tag LOCUS_14690 11767 10964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14690 14282 11760 gene locus_tag LOCUS_14700 14282 11760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14700 15077 16042 gene locus_tag LOCUS_14710 15077 16042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_14710 16112 17500 gene locus_tag LOCUS_14720 16112 17500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14720 17699 18973 gene locus_tag LOCUS_14730 17699 18973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14730 20069 19317 gene locus_tag LOCUS_14740 20069 19317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14740 20234 20428 gene locus_tag LOCUS_14750 20234 20428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14750 20615 21388 gene locus_tag LOCUS_14760 20615 21388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14760 22613 21438 gene locus_tag LOCUS_14770 gene purT 22613 21438 CDS product formate-dependent phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125336.1 protein_id gnl|my_center|LOCUS_14770 23192 22692 gene locus_tag LOCUS_14780 23192 22692 CDS product pentapeptide repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141985.1 protein_id gnl|my_center|LOCUS_14780 23403 23963 gene locus_tag LOCUS_14790 23403 23963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14790 24856 24038 gene locus_tag LOCUS_14800 24856 24038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14800 27246 25315 gene locus_tag LOCUS_14810 27246 25315 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140600.1 protein_id gnl|my_center|LOCUS_14810 27880 27464 gene locus_tag LOCUS_14820 27880 27464 CDS product DUF1824 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929141.1 protein_id gnl|my_center|LOCUS_14820 28800 27958 gene locus_tag LOCUS_14830 28800 27958 CDS product prohibitin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057597.1 protein_id gnl|my_center|LOCUS_14830 28901 30748 gene locus_tag LOCUS_14840 28901 30748 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144121.1 protein_id gnl|my_center|LOCUS_14840 30924 31367 gene locus_tag LOCUS_14850 30924 31367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14850 32170 31406 gene locus_tag LOCUS_14860 32170 31406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14860 32577 32167 gene locus_tag LOCUS_14870 32577 32167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14870 34020 32641 gene locus_tag LOCUS_14880 34020 32641 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143056.1 protein_id gnl|my_center|LOCUS_14880 34215 34847 gene locus_tag LOCUS_14890 34215 34847 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920739.1 protein_id gnl|my_center|LOCUS_14890 34847 35716 gene locus_tag LOCUS_14900 34847 35716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14900 36385 35873 gene locus_tag LOCUS_14910 36385 35873 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000351160.1 protein_id gnl|my_center|LOCUS_14910 37327 36443 gene locus_tag LOCUS_14920 37327 36443 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143051.1 protein_id gnl|my_center|LOCUS_14920 37555 37998 gene locus_tag LOCUS_14930 37555 37998 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056717.1 protein_id gnl|my_center|LOCUS_14930 38751 38113 gene locus_tag LOCUS_14940 gene fsa 38751 38113 CDS product fructose-6-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869995.1 protein_id gnl|my_center|LOCUS_14940 39198 38803 gene locus_tag LOCUS_14950 39198 38803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_14950 39567 39367 gene locus_tag LOCUS_14960 39567 39367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_14960 39740 40552 gene locus_tag LOCUS_14970 39740 40552 CDS product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986927.1 protein_id gnl|my_center|LOCUS_14970 40806 43145 gene locus_tag LOCUS_14980 40806 43145 CDS product CHASE2 domain-containing serine/threonine-protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_204368676.1 protein_id gnl|my_center|LOCUS_14980 46529 43215 gene locus_tag LOCUS_14990 46529 43215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14990 47173 46796 gene locus_tag LOCUS_15000 47173 46796 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056419.1 protein_id gnl|my_center|LOCUS_15000 47978 47550 gene locus_tag LOCUS_15010 47978 47550 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144197.1 protein_id gnl|my_center|LOCUS_15010 48601 48224 gene locus_tag LOCUS_15020 48601 48224 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144197.1 protein_id gnl|my_center|LOCUS_15020 52172 48921 gene locus_tag LOCUS_15030 52172 48921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15030 54450 52546 gene locus_tag LOCUS_15040 54450 52546 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144195.1 protein_id gnl|my_center|LOCUS_15040 55220 56251 gene locus_tag LOCUS_15050 55220 56251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15050 56305 56910 gene locus_tag LOCUS_15060 56305 56910 CDS product YdcF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000662215.1 protein_id gnl|my_center|LOCUS_15060 57975 57160 gene locus_tag LOCUS_15070 57975 57160 CDS product DUF1838 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055925.1 protein_id gnl|my_center|LOCUS_15070 59338 58154 gene locus_tag LOCUS_15080 59338 58154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15080 59940 59608 gene locus_tag LOCUS_15090 59940 59608 CDS product DUF190 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867781.1 protein_id gnl|my_center|LOCUS_15090 61173 60352 gene locus_tag LOCUS_15100 61173 60352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15100 62389 63279 gene locus_tag LOCUS_15110 gene htpX 62389 63279 CDS product zinc metalloprotease HtpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974338.1 protein_id gnl|my_center|LOCUS_15110 63369 63773 gene locus_tag LOCUS_15120 63369 63773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15120 63958 65745 gene locus_tag LOCUS_15130 gene aspS 63958 65745 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056986.1 protein_id gnl|my_center|LOCUS_15130 67331 65871 gene locus_tag LOCUS_15140 67331 65871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15140 73725 68365 gene locus_tag LOCUS_15150 73725 68365 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000686845.1 protein_id gnl|my_center|LOCUS_15150 75198 73861 gene locus_tag LOCUS_15160 75198 73861 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009890213.1 protein_id gnl|my_center|LOCUS_15160 75544 76023 gene locus_tag LOCUS_15170 75544 76023 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056717.1 protein_id gnl|my_center|LOCUS_15170 76479 76324 gene locus_tag LOCUS_15180 76479 76324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15180 76608 77393 gene locus_tag LOCUS_15190 76608 77393 CDS product SAM-dependent chlorinase/fluorinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142916.1 protein_id gnl|my_center|LOCUS_15190 77595 78248 gene locus_tag LOCUS_15200 77595 78248 CDS product DUF2301 domain-containing membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142018.1 protein_id gnl|my_center|LOCUS_15200 78248 78937 gene locus_tag LOCUS_15210 78248 78937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15210 79121 80242 gene locus_tag LOCUS_15220 gene dprA 79121 80242 CDS product DNA-processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920872.1 protein_id gnl|my_center|LOCUS_15220 80347 80802 gene locus_tag LOCUS_15230 80347 80802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15230 82090 80843 gene locus_tag LOCUS_15240 82090 80843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15240 83508 82705 gene locus_tag LOCUS_15250 83508 82705 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057950.1 protein_id gnl|my_center|LOCUS_15250 84443 83907 gene locus_tag LOCUS_15260 84443 83907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15260 87548 84753 gene locus_tag LOCUS_15270 gene secA 87548 84753 CDS product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057688.1 protein_id gnl|my_center|LOCUS_15270 88568 88020 gene locus_tag LOCUS_15280 88568 88020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15280 90072 88894 gene locus_tag LOCUS_15290 90072 88894 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058078.1 protein_id gnl|my_center|LOCUS_15290 90376 90927 gene locus_tag LOCUS_15300 90376 90927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15300 91003 92028 gene locus_tag LOCUS_15310 91003 92028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15310 92077 92856 gene locus_tag LOCUS_15320 92077 92856 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057759.1 protein_id gnl|my_center|LOCUS_15320 93722 93015 gene locus_tag LOCUS_15330 93722 93015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15330 94520 93942 gene locus_tag LOCUS_15340 94520 93942 CDS product DUF981 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081917.1 protein_id gnl|my_center|LOCUS_15340 94863 95381 gene locus_tag LOCUS_15350 94863 95381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15350 96537 95650 gene locus_tag LOCUS_15360 96537 95650 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027842956.1 protein_id gnl|my_center|LOCUS_15360 96563 97213 gene locus_tag LOCUS_15370 gene purN 96563 97213 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197524113.1 protein_id gnl|my_center|LOCUS_15370 97735 97529 gene locus_tag LOCUS_15380 97735 97529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15380 98074 97742 gene locus_tag LOCUS_15390 98074 97742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15390 98442 98254 gene locus_tag LOCUS_15400 98442 98254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15400 98772 98566 gene locus_tag LOCUS_15410 98772 98566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15410 99060 99479 gene locus_tag LOCUS_15420 99060 99479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15420 99467 99808 gene locus_tag LOCUS_15430 99467 99808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15430 100937 100257 gene locus_tag LOCUS_15440 100937 100257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15440 102917 102333 gene locus_tag LOCUS_15450 102917 102333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15450 105873 103024 gene locus_tag LOCUS_15460 105873 103024 CDS product CHAT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545943.1 protein_id gnl|my_center|LOCUS_15460 >Feature sequence014 1083 202 gene locus_tag LOCUS_15470 1083 202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15470 1664 1296 gene locus_tag LOCUS_15480 1664 1296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15480 3450 1753 gene locus_tag LOCUS_15490 3450 1753 CDS product AarF/ABC1/UbiB kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057497.1 protein_id gnl|my_center|LOCUS_15490 4194 5288 gene locus_tag LOCUS_15500 4194 5288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15500 5842 6945 gene locus_tag LOCUS_15510 5842 6945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15510 7639 9138 gene locus_tag LOCUS_15520 7639 9138 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057032.1 protein_id gnl|my_center|LOCUS_15520 10427 9174 gene locus_tag LOCUS_15530 10427 9174 CDS product glycoside hydrolase family 10 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057137.1 protein_id gnl|my_center|LOCUS_15530 11302 12852 gene locus_tag LOCUS_15540 11302 12852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15540 13194 13793 gene locus_tag LOCUS_15550 13194 13793 CDS product gamma-glutamylcyclotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140022.1 protein_id gnl|my_center|LOCUS_15550 13827 14057 gene locus_tag LOCUS_15560 13827 14057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15560 14054 14233 gene locus_tag LOCUS_15570 14054 14233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15570 14656 14450 gene locus_tag LOCUS_15580 14656 14450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15580 15405 14707 gene locus_tag LOCUS_15590 15405 14707 CDS product SprT family zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087772.1 protein_id gnl|my_center|LOCUS_15590 18599 15402 gene locus_tag LOCUS_15600 18599 15402 CDS product HsdR family type I site-specific deoxyribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087773.1 protein_id gnl|my_center|LOCUS_15600 18961 19218 gene locus_tag LOCUS_15610 18961 19218 CDS product type II toxin-antitoxin system ParD family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_076057464.1 protein_id gnl|my_center|LOCUS_15610 19215 19538 gene locus_tag LOCUS_15620 19215 19538 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140361.1 protein_id gnl|my_center|LOCUS_15620 20926 19544 gene locus_tag LOCUS_15630 20926 19544 CDS product restriction endonuclease subunit S inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014205996.1 protein_id gnl|my_center|LOCUS_15630 21365 20958 gene locus_tag LOCUS_15640 21365 20958 CDS product PIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142424.1 protein_id gnl|my_center|LOCUS_15640 21577 21362 gene locus_tag LOCUS_15650 21577 21362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15650 22688 21618 gene locus_tag LOCUS_15660 22688 21618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15660 24223 22688 gene locus_tag LOCUS_15670 24223 22688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15670 24912 24841 gene locus_tag LOCUS_t00130 24912 24841 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 25936 25334 gene locus_tag LOCUS_15680 25936 25334 CDS product chromophore lyase CpcT/CpeT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057990.1 protein_id gnl|my_center|LOCUS_15680 26137 27396 gene locus_tag LOCUS_15690 26137 27396 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_218596652.1 protein_id gnl|my_center|LOCUS_15690 28791 27526 gene locus_tag LOCUS_15700 28791 27526 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933540.1 protein_id gnl|my_center|LOCUS_15700 29470 30303 gene locus_tag LOCUS_15710 29470 30303 CDS product 3-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000818985.1 protein_id gnl|my_center|LOCUS_15710 30565 32124 gene locus_tag LOCUS_15720 30565 32124 CDS product GMC family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141163.1 protein_id gnl|my_center|LOCUS_15720 33746 32487 gene locus_tag LOCUS_15730 33746 32487 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122402.1 protein_id gnl|my_center|LOCUS_15730 34425 33958 gene locus_tag LOCUS_15740 34425 33958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15740 35508 34483 gene locus_tag LOCUS_15750 35508 34483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15750 36847 35843 gene locus_tag LOCUS_15760 36847 35843 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112346.1 protein_id gnl|my_center|LOCUS_15760 38124 36949 gene locus_tag LOCUS_15770 gene devC 38124 36949 CDS product ABC transporter permease DevC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141427.1 protein_id gnl|my_center|LOCUS_15770 39649 38456 gene locus_tag LOCUS_15780 39649 38456 CDS product ABC exporter membrane fusion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141428.1 protein_id gnl|my_center|LOCUS_15780 40814 42175 gene locus_tag LOCUS_15790 40814 42175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15790 43263 43553 gene locus_tag LOCUS_15800 43263 43553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15800 43778 49426 gene locus_tag LOCUS_15810 43778 49426 CDS product type I polyketide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_190970337.1 protein_id gnl|my_center|LOCUS_15810 49565 50116 gene locus_tag LOCUS_15820 49565 50116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15820 50211 51959 gene locus_tag LOCUS_15830 50211 51959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15830 52312 57084 gene locus_tag LOCUS_15840 52312 57084 CDS product type I polyketide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141955.1 protein_id gnl|my_center|LOCUS_15840 57197 58861 gene locus_tag LOCUS_15850 57197 58861 CDS product PfaD family polyunsaturated fatty acid/polyketide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141954.1 protein_id gnl|my_center|LOCUS_15850 58956 60476 gene locus_tag LOCUS_15860 58956 60476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15860 61266 62036 gene locus_tag LOCUS_15870 61266 62036 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257603.1 protein_id gnl|my_center|LOCUS_15870 62879 62160 gene locus_tag LOCUS_15880 62879 62160 CDS product 4'-phosphopantetheinyl transferase superfamily protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142845.1 protein_id gnl|my_center|LOCUS_15880 65175 63379 gene locus_tag LOCUS_15890 gene cobJ 65175 63379 CDS product precorrin-3B C(17)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003147855.1 protein_id gnl|my_center|LOCUS_15890 66020 65316 gene locus_tag LOCUS_15900 66020 65316 CDS product precorrin-2 C(20)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390738.1 protein_id gnl|my_center|LOCUS_15900 66646 66017 gene locus_tag LOCUS_15910 66646 66017 CDS product precorrin-8X methylmutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521551.1 protein_id gnl|my_center|LOCUS_15910 68273 66660 gene locus_tag LOCUS_15920 68273 66660 CDS product NirA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117878.1 protein_id gnl|my_center|LOCUS_15920 68682 68509 gene locus_tag LOCUS_15930 68682 68509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15930 68751 70193 gene locus_tag LOCUS_15940 68751 70193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15940 70384 71589 gene locus_tag LOCUS_15950 70384 71589 CDS product bifunctional cobalt-precorrin-7 (C(5))-methyltransferase/cobalt-precorrin-6B (C(15))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390740.1 protein_id gnl|my_center|LOCUS_15950 71544 71699 gene locus_tag LOCUS_15960 71544 71699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15960 71851 72771 gene locus_tag LOCUS_15970 71851 72771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15970 73187 72906 gene locus_tag LOCUS_15980 73187 72906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15980 73386 73610 gene locus_tag LOCUS_15990 73386 73610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15990 73889 75421 gene locus_tag LOCUS_16000 73889 75421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16000 75506 76621 gene locus_tag LOCUS_16010 75506 76621 CDS product carboxylate-amine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259418.1 protein_id gnl|my_center|LOCUS_16010 76641 77426 gene locus_tag LOCUS_16020 76641 77426 CDS product SAM-dependent chlorinase/fluorinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141879.1 protein_id gnl|my_center|LOCUS_16020 77780 78328 gene locus_tag LOCUS_16030 77780 78328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16030 79063 78833 gene locus_tag LOCUS_16040 79063 78833 CDS product type II toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878572.1 protein_id gnl|my_center|LOCUS_16040 79974 79231 gene locus_tag LOCUS_16050 79974 79231 CDS product cobalt-precorrin-6A reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390736.1 protein_id gnl|my_center|LOCUS_16050 80625 81422 gene locus_tag LOCUS_16060 80625 81422 CDS product TSUP family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000347994.1 protein_id gnl|my_center|LOCUS_16060 82488 81403 gene locus_tag LOCUS_16070 gene cbiD 82488 81403 CDS product cobalt-precorrin-5B (C(1))-methyltransferase CbiD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048868466.1 protein_id gnl|my_center|LOCUS_16070 82636 83370 gene locus_tag LOCUS_16080 82636 83370 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057310.1 protein_id gnl|my_center|LOCUS_16080 86319 83524 gene locus_tag LOCUS_16090 86319 83524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16090 89983 86351 gene locus_tag LOCUS_16100 89983 86351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16100 91074 89980 gene locus_tag LOCUS_16110 91074 89980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16110 92036 93271 gene locus_tag LOCUS_16120 92036 93271 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939181.1 protein_id gnl|my_center|LOCUS_16120 93692 94642 gene locus_tag LOCUS_16130 93692 94642 CDS product DUF3365 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023174491.1 protein_id gnl|my_center|LOCUS_16130 95715 94699 gene locus_tag LOCUS_16140 95715 94699 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142928.1 protein_id gnl|my_center|LOCUS_16140 97950 96082 gene locus_tag LOCUS_16150 97950 96082 CDS product iron uptake porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920716.1 protein_id gnl|my_center|LOCUS_16150 99470 98223 gene locus_tag LOCUS_16160 gene trpB 99470 98223 CDS product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058306.1 protein_id gnl|my_center|LOCUS_16160 100497 99682 gene locus_tag LOCUS_16170 gene trpA 100497 99682 CDS product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056294.1 protein_id gnl|my_center|LOCUS_16170 101420 100569 gene locus_tag LOCUS_16180 gene trpC 101420 100569 CDS product indole-3-glycerol phosphate synthase TrpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142551.1 protein_id gnl|my_center|LOCUS_16180 103821 101626 gene locus_tag LOCUS_16190 103821 101626 CDS product anthranilate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066518.1 protein_id gnl|my_center|LOCUS_16190 >Feature sequence015 261 689 gene locus_tag LOCUS_16200 261 689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16200 1270 956 gene locus_tag LOCUS_16210 1270 956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16210 1667 1341 gene locus_tag LOCUS_16220 1667 1341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16220 1956 3107 gene locus_tag LOCUS_16230 1956 3107 CDS product IS4 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229302.1 note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_16230 7034 3312 gene locus_tag LOCUS_16240 7034 3312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16240 9010 7469 gene locus_tag LOCUS_16250 9010 7469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16250 10174 9017 gene locus_tag LOCUS_16260 10174 9017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16260 10496 10867 gene locus_tag LOCUS_16270 10496 10867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16270 11845 12447 gene locus_tag LOCUS_16280 11845 12447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16280 12842 15583 gene locus_tag LOCUS_16290 12842 15583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140619.1 protein_id gnl|my_center|LOCUS_16290 15611 16336 gene locus_tag LOCUS_16300 15611 16336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16300 16355 17374 gene locus_tag LOCUS_16310 16355 17374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16310 17451 18230 gene locus_tag LOCUS_16320 17451 18230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16320 18227 20053 gene locus_tag LOCUS_16330 18227 20053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16330 20096 20920 gene locus_tag LOCUS_16340 20096 20920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16340 20917 22779 gene locus_tag LOCUS_16350 20917 22779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16350 22784 23401 gene locus_tag LOCUS_16360 22784 23401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16360 23415 25268 gene locus_tag LOCUS_16370 23415 25268 CDS product type IV secretion system DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142038.1 protein_id gnl|my_center|LOCUS_16370 25278 25580 gene locus_tag LOCUS_16380 25278 25580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16380 25600 27036 gene locus_tag LOCUS_16390 25600 27036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16390 27033 28664 gene locus_tag LOCUS_16400 27033 28664 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055931.1 protein_id gnl|my_center|LOCUS_16400 32183 28797 gene locus_tag LOCUS_16410 32183 28797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16410 32670 32326 gene locus_tag LOCUS_16420 32670 32326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16420 33049 32822 gene locus_tag LOCUS_16430 33049 32822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16430 33340 33831 gene locus_tag LOCUS_16440 33340 33831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16440 34635 34381 gene locus_tag LOCUS_16450 34635 34381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16450 35911 34856 gene locus_tag LOCUS_16460 35911 34856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16460 36978 36169 gene locus_tag LOCUS_16470 36978 36169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16470 38249 38491 gene locus_tag LOCUS_16480 38249 38491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16480 38505 38777 gene locus_tag LOCUS_16490 38505 38777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16490 38774 39193 gene locus_tag LOCUS_16500 38774 39193 CDS product PIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680561.1 protein_id gnl|my_center|LOCUS_16500 41055 39283 gene locus_tag LOCUS_16510 41055 39283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16510 41609 42766 gene locus_tag LOCUS_16520 41609 42766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16520 42756 43169 gene locus_tag LOCUS_16530 42756 43169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16530 43204 44265 gene locus_tag LOCUS_16540 43204 44265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16540 44262 44966 gene locus_tag LOCUS_16550 44262 44966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16550 45029 46012 gene locus_tag LOCUS_16560 45029 46012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16560 46219 46590 gene locus_tag LOCUS_16570 46219 46590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16570 46641 47993 gene locus_tag LOCUS_16580 46641 47993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16580 48759 48965 gene locus_tag LOCUS_16590 48759 48965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16590 50463 49039 gene locus_tag LOCUS_16600 50463 49039 CDS product WGR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978299.1 protein_id gnl|my_center|LOCUS_16600 51163 51750 gene locus_tag LOCUS_16610 51163 51750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16610 51944 52930 gene locus_tag LOCUS_16620 gene xerC 51944 52930 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545085.1 protein_id gnl|my_center|LOCUS_16620 53492 53205 gene locus_tag LOCUS_16630 53492 53205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16630 54547 53549 gene locus_tag LOCUS_16640 54547 53549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16640 56024 54573 gene locus_tag LOCUS_16650 56024 54573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16650 56527 56835 gene locus_tag LOCUS_16660 56527 56835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16660 56847 57140 gene locus_tag LOCUS_16670 56847 57140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16670 57174 61298 gene locus_tag LOCUS_16680 57174 61298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16680 61377 62621 gene locus_tag LOCUS_16690 61377 62621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16690 62626 68883 gene locus_tag LOCUS_16700 62626 68883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16700 68918 69232 gene locus_tag LOCUS_16710 68918 69232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16710 70828 69845 gene locus_tag LOCUS_16720 70828 69845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16720 71656 71348 gene locus_tag LOCUS_16730 71656 71348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16730 72128 71658 gene locus_tag LOCUS_16740 72128 71658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16740 73015 72218 gene locus_tag LOCUS_16750 73015 72218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16750 73404 73027 gene locus_tag LOCUS_16760 73404 73027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16760 78481 73493 gene locus_tag LOCUS_16770 78481 73493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16770 82310 78546 gene locus_tag LOCUS_16780 82310 78546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16780 82825 82676 gene locus_tag LOCUS_16790 82825 82676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16790 83855 83031 gene locus_tag LOCUS_16800 83855 83031 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098079.1 protein_id gnl|my_center|LOCUS_16800 84121 83900 gene locus_tag LOCUS_16810 84121 83900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16810 84503 84204 gene locus_tag LOCUS_16820 84503 84204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16820 85217 84963 gene locus_tag LOCUS_16830 85217 84963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16830 85612 85286 gene locus_tag LOCUS_16840 85612 85286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16840 86537 86836 gene locus_tag LOCUS_16850 86537 86836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16850 88342 86849 gene locus_tag LOCUS_16860 88342 86849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16860 88511 88825 gene locus_tag LOCUS_16870 gene tnpA 88511 88825 CDS product IS200/IS605 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435056.1 protein_id gnl|my_center|LOCUS_16870 88899 89072 gene locus_tag LOCUS_16880 88899 89072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16880 90169 89477 gene locus_tag LOCUS_16890 90169 89477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16890 90626 90471 gene locus_tag LOCUS_16900 90626 90471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16900 91534 90695 gene locus_tag LOCUS_16910 91534 90695 CDS product DUF4058 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258578.1 protein_id gnl|my_center|LOCUS_16910 91684 92724 gene locus_tag LOCUS_16920 gene xerC 91684 92724 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003570336.1 protein_id gnl|my_center|LOCUS_16920 93113 92811 gene locus_tag LOCUS_16930 93113 92811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16930 94105 93155 gene locus_tag LOCUS_16940 94105 93155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16940 94889 95671 gene locus_tag LOCUS_16950 94889 95671 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393993.1 protein_id gnl|my_center|LOCUS_16950 96030 96959 gene locus_tag LOCUS_16960 96030 96959 CDS product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143340.1 protein_id gnl|my_center|LOCUS_16960 >Feature sequence016 598 248 gene locus_tag LOCUS_16970 598 248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16970 1523 978 gene locus_tag LOCUS_16980 1523 978 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971624.1 protein_id gnl|my_center|LOCUS_16980 2712 1927 gene locus_tag LOCUS_16990 2712 1927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16990 3297 3701 gene locus_tag LOCUS_17000 3297 3701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17000 4755 3907 gene locus_tag LOCUS_17010 gene fghA 4755 3907 CDS product S-formylglutathione hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144409.1 protein_id gnl|my_center|LOCUS_17010 5929 4850 gene locus_tag LOCUS_17020 5929 4850 CDS product RNA-guided endonuclease TnpB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056984.1 protein_id gnl|my_center|LOCUS_17020 7306 6194 gene locus_tag LOCUS_17030 7306 6194 CDS product S-(hydroxymethyl)glutathione dehydrogenase/class III alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144408.1 protein_id gnl|my_center|LOCUS_17030 7651 7469 gene locus_tag LOCUS_17040 7651 7469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17040 8360 9643 gene locus_tag LOCUS_17050 8360 9643 CDS product valine--pyruvate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057579.1 protein_id gnl|my_center|LOCUS_17050 9636 10454 gene locus_tag LOCUS_17060 9636 10454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17060 10988 10518 gene locus_tag LOCUS_17070 10988 10518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17070 11391 11068 gene locus_tag LOCUS_17080 11391 11068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17080 12201 13685 gene locus_tag LOCUS_17090 12201 13685 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144195.1 protein_id gnl|my_center|LOCUS_17090 17894 13662 gene locus_tag LOCUS_17100 17894 13662 CDS product chemotaxis protein CheB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141852.1 protein_id gnl|my_center|LOCUS_17100 18665 20179 gene locus_tag LOCUS_17110 18665 20179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17110 21051 21200 gene locus_tag LOCUS_17120 21051 21200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17120 21450 23831 gene locus_tag LOCUS_17130 21450 23831 CDS product phosphoketolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140999.1 protein_id gnl|my_center|LOCUS_17130 24669 23908 gene locus_tag LOCUS_17140 24669 23908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17140 25502 25966 gene locus_tag LOCUS_17150 25502 25966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17150 26368 27417 gene locus_tag LOCUS_17160 gene gap 26368 27417 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143315.1 protein_id gnl|my_center|LOCUS_17160 27720 28907 gene locus_tag LOCUS_17170 27720 28907 CDS product transaldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056320.1 protein_id gnl|my_center|LOCUS_17170 29148 28918 gene locus_tag LOCUS_17180 29148 28918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17180 29902 31536 gene locus_tag LOCUS_17190 29902 31536 CDS product alpha-D-glucose phosphate-specific phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143971.1 protein_id gnl|my_center|LOCUS_17190 32299 31679 gene locus_tag LOCUS_17200 32299 31679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17200 32481 33650 gene locus_tag LOCUS_17210 32481 33650 CDS product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141002.1 protein_id gnl|my_center|LOCUS_17210 34268 33831 gene locus_tag LOCUS_17220 34268 33831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013221985.1 protein_id gnl|my_center|LOCUS_17220 39525 35371 gene locus_tag LOCUS_17230 39525 35371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17230 45583 39647 gene locus_tag LOCUS_17240 45583 39647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17240 46652 45981 gene locus_tag LOCUS_17250 46652 45981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17250 47993 50206 gene locus_tag LOCUS_17260 47993 50206 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941039.1 protein_id gnl|my_center|LOCUS_17260 51763 50459 gene locus_tag LOCUS_17270 51763 50459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17270 53086 51767 gene locus_tag LOCUS_17280 53086 51767 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003440033.1 protein_id gnl|my_center|LOCUS_17280 54479 53196 gene locus_tag LOCUS_17290 54479 53196 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026800.1 protein_id gnl|my_center|LOCUS_17290 55423 54680 gene locus_tag LOCUS_17300 55423 54680 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125923.1 protein_id gnl|my_center|LOCUS_17300 56679 55579 gene locus_tag LOCUS_17310 gene ruvB 56679 55579 CDS product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143112.1 protein_id gnl|my_center|LOCUS_17310 56944 57711 gene locus_tag LOCUS_17320 gene hisF 56944 57711 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099799407.1 protein_id gnl|my_center|LOCUS_17320 57827 58018 gene locus_tag LOCUS_17330 57827 58018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17330 58144 58216 gene locus_tag LOCUS_t00140 58144 58216 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 61285 58268 gene locus_tag LOCUS_17340 61285 58268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17340 62579 61332 gene locus_tag LOCUS_17350 62579 61332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17350 62681 63151 gene locus_tag LOCUS_17360 62681 63151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17360 63239 64642 gene locus_tag LOCUS_17370 63239 64642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17370 64720 65088 gene locus_tag LOCUS_17380 64720 65088 CDS product DUF5615 family PIN-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142925.1 protein_id gnl|my_center|LOCUS_17380 65406 65732 gene locus_tag LOCUS_17390 65406 65732 CDS product DUF433 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142926.1 protein_id gnl|my_center|LOCUS_17390 65732 66073 gene locus_tag LOCUS_17400 65732 66073 CDS product DUF5615 family PIN-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142157.1 protein_id gnl|my_center|LOCUS_17400 66101 66328 gene locus_tag LOCUS_17410 66101 66328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17410 66796 69435 gene locus_tag LOCUS_17420 66796 69435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17420 70113 69619 gene locus_tag LOCUS_17430 70113 69619 CDS product pentapeptide repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125313.1 protein_id gnl|my_center|LOCUS_17430 72586 70199 gene locus_tag LOCUS_17440 72586 70199 CDS product DUF3604 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063907.1 protein_id gnl|my_center|LOCUS_17440 73409 72591 gene locus_tag LOCUS_17450 73409 72591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17450 74850 73984 gene locus_tag LOCUS_17460 gene cysW 74850 73984 CDS product sulfate ABC transporter permease subunit CysW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056131.1 protein_id gnl|my_center|LOCUS_17460 75712 74840 gene locus_tag LOCUS_17470 gene cysT 75712 74840 CDS product sulfate ABC transporter permease subunit CysT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928930.1 protein_id gnl|my_center|LOCUS_17470 76788 75718 gene locus_tag LOCUS_17480 76788 75718 CDS product sulfate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056129.1 protein_id gnl|my_center|LOCUS_17480 76991 78127 gene locus_tag LOCUS_17490 gene gcvT 76991 78127 CDS product glycine cleavage system aminomethyltransferase GcvT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143519.1 protein_id gnl|my_center|LOCUS_17490 78319 78705 gene locus_tag LOCUS_17500 gene gcvH 78319 78705 CDS product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057515.1 protein_id gnl|my_center|LOCUS_17500 78901 81843 gene locus_tag LOCUS_17510 gene gcvP 78901 81843 CDS product aminomethyl-transferring glycine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140250.1 protein_id gnl|my_center|LOCUS_17510 82234 82052 gene locus_tag LOCUS_17520 82234 82052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17520 82305 83705 gene locus_tag LOCUS_17530 82305 83705 CDS product RNA-guided endonuclease TnpB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041233550.1 protein_id gnl|my_center|LOCUS_17530 83837 85360 gene locus_tag LOCUS_17540 83837 85360 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000528010.1 protein_id gnl|my_center|LOCUS_17540 85857 85675 gene locus_tag LOCUS_17550 85857 85675 CDS product PCP reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143955.1 protein_id gnl|my_center|LOCUS_17550 87435 86050 gene locus_tag LOCUS_17560 gene psbC 87435 86050 CDS product photosystem II reaction center protein CP43 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024124637.1 protein_id gnl|my_center|LOCUS_17560 88477 87419 gene locus_tag LOCUS_17570 gene psbD 88477 87419 CDS product photosystem II D2 protein (photosystem q(a) protein) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056308.1 protein_id gnl|my_center|LOCUS_17570 89113 89562 gene locus_tag LOCUS_17580 89113 89562 CDS product photosystem I assembly protein Ycf4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057228.1 protein_id gnl|my_center|LOCUS_17580 89634 90422 gene locus_tag LOCUS_17590 89634 90422 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055992.1 protein_id gnl|my_center|LOCUS_17590 90554 91765 gene locus_tag LOCUS_17600 90554 91765 CDS product beta-ketoacyl-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056469.1 protein_id gnl|my_center|LOCUS_17600 91855 93300 gene locus_tag LOCUS_17610 91855 93300 CDS product folate/biopterin family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055871.1 protein_id gnl|my_center|LOCUS_17610 93417 94910 gene locus_tag LOCUS_17620 93417 94910 CDS product carotenoid oxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042464373.1 protein_id gnl|my_center|LOCUS_17620 95107 95268 gene locus_tag LOCUS_17630 95107 95268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17630 >Feature sequence017 1163 327 gene locus_tag LOCUS_17640 1163 327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17640 3192 1222 gene locus_tag LOCUS_17650 3192 1222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17650 3466 3645 gene locus_tag LOCUS_17660 3466 3645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17660 4427 6343 gene locus_tag LOCUS_17670 gene ilvB 4427 6343 CDS product biosynthetic-type acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146975.1 protein_id gnl|my_center|LOCUS_17670 6344 7477 gene locus_tag LOCUS_17680 6344 7477 CDS product leucine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001162675.1 protein_id gnl|my_center|LOCUS_17680 7489 8445 gene locus_tag LOCUS_17690 7489 8445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17690 8624 9748 gene locus_tag LOCUS_17700 8624 9748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17700 9969 11297 gene locus_tag LOCUS_17710 9969 11297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17710 11466 12650 gene locus_tag LOCUS_17720 11466 12650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17720 12792 13685 gene locus_tag LOCUS_17730 12792 13685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17730 13739 14650 gene locus_tag LOCUS_17740 13739 14650 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368544.1 protein_id gnl|my_center|LOCUS_17740 14708 15643 gene locus_tag LOCUS_17750 14708 15643 CDS product UbiA family prenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031014.1 protein_id gnl|my_center|LOCUS_17750 15791 17086 gene locus_tag LOCUS_17760 15791 17086 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461038.1 protein_id gnl|my_center|LOCUS_17760 17194 18279 gene locus_tag LOCUS_17770 17194 18279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17770 18224 18868 gene locus_tag LOCUS_17780 18224 18868 CDS product DsbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919709.1 protein_id gnl|my_center|LOCUS_17780 18862 20103 gene locus_tag LOCUS_17790 18862 20103 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_110716881.1 protein_id gnl|my_center|LOCUS_17790 20262 21518 gene locus_tag LOCUS_17800 gene eboE 20262 21518 CDS product metabolite traffic protein EboE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368548.1 protein_id gnl|my_center|LOCUS_17800 21835 23202 gene locus_tag LOCUS_17810 21835 23202 CDS product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368546.1 protein_id gnl|my_center|LOCUS_17810 24057 26267 gene locus_tag LOCUS_17820 24057 26267 CDS product anthranilate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529939.1 protein_id gnl|my_center|LOCUS_17820 26359 27210 gene locus_tag LOCUS_17830 gene trpC 26359 27210 CDS product indole-3-glycerol phosphate synthase TrpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142551.1 protein_id gnl|my_center|LOCUS_17830 27227 28186 gene locus_tag LOCUS_17840 27227 28186 CDS product zinc-dependent alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119496.1 protein_id gnl|my_center|LOCUS_17840 28235 29062 gene locus_tag LOCUS_17850 gene trpA 28235 29062 CDS product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056294.1 protein_id gnl|my_center|LOCUS_17850 29169 30407 gene locus_tag LOCUS_17860 gene trpB 29169 30407 CDS product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058306.1 protein_id gnl|my_center|LOCUS_17860 30612 31721 gene locus_tag LOCUS_17870 gene trpD 30612 31721 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057551.1 protein_id gnl|my_center|LOCUS_17870 31844 32917 gene locus_tag LOCUS_17880 gene aroF 31844 32917 CDS product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056213.1 protein_id gnl|my_center|LOCUS_17880 33429 34274 gene locus_tag LOCUS_17890 33429 34274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17890 34484 35020 gene locus_tag LOCUS_17900 34484 35020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17900 35213 37315 gene locus_tag LOCUS_17910 35213 37315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17910 38428 37619 gene locus_tag LOCUS_17920 38428 37619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17920 40335 38695 gene locus_tag LOCUS_17930 40335 38695 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929004.1 protein_id gnl|my_center|LOCUS_17930 40641 40429 gene locus_tag LOCUS_17940 40641 40429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17940 40696 40923 gene locus_tag LOCUS_17950 40696 40923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17950 41089 41781 gene locus_tag LOCUS_17960 41089 41781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17960 43932 42172 gene locus_tag LOCUS_17970 gene ftsH2 43932 42172 CDS product ATP-dependent zinc metalloprotease FtsH2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056581.1 protein_id gnl|my_center|LOCUS_17970 44854 45048 gene locus_tag LOCUS_17980 44854 45048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17980 45146 47551 gene locus_tag LOCUS_17990 45146 47551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17990 47594 48238 gene locus_tag LOCUS_18000 47594 48238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18000 48938 48444 gene locus_tag LOCUS_18010 48938 48444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18010 50877 49399 gene locus_tag LOCUS_18020 gene gltX 50877 49399 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056357.1 protein_id gnl|my_center|LOCUS_18020 51032 50959 gene locus_tag LOCUS_t00150 51032 50959 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 51956 52546 gene locus_tag LOCUS_18030 51956 52546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18030 52961 54844 gene locus_tag LOCUS_18040 gene gsiA 52961 54844 CDS product glutathione ABC transporter ATP-binding protein GsiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097436.1 protein_id gnl|my_center|LOCUS_18040 55419 55021 gene locus_tag LOCUS_18050 55419 55021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18050 55892 55476 gene locus_tag LOCUS_18060 55892 55476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18060 56161 56427 gene locus_tag LOCUS_18070 56161 56427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18070 56633 57790 gene locus_tag LOCUS_18080 56633 57790 CDS product RNA-guided endonuclease TnpB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459437.1 protein_id gnl|my_center|LOCUS_18080 58384 59433 gene locus_tag LOCUS_18090 58384 59433 CDS product chemotaxis protein CheB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525053.1 protein_id gnl|my_center|LOCUS_18090 60159 62015 gene locus_tag LOCUS_18100 60159 62015 CDS product PAS domain S-box protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225982.1 protein_id gnl|my_center|LOCUS_18100 62206 63528 gene locus_tag LOCUS_18110 62206 63528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18110 64422 63529 gene locus_tag LOCUS_18120 gene rsmH 64422 63529 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057907.1 protein_id gnl|my_center|LOCUS_18120 64585 65769 gene locus_tag LOCUS_18130 64585 65769 CDS product NAD(P)H-quinone oxidoreductase subunit H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057128.1 protein_id gnl|my_center|LOCUS_18130 66310 66849 gene locus_tag LOCUS_18140 66310 66849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18140 67114 66938 gene locus_tag LOCUS_18150 67114 66938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18150 67356 68156 gene locus_tag LOCUS_18160 67356 68156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18160 68126 68548 gene locus_tag LOCUS_18170 68126 68548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18170 68736 69959 gene locus_tag LOCUS_18180 68736 69959 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142380.1 protein_id gnl|my_center|LOCUS_18180 70280 71152 gene locus_tag LOCUS_18190 70280 71152 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004523300.1 protein_id gnl|my_center|LOCUS_18190 72913 71210 gene locus_tag LOCUS_18200 72913 71210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18200 73090 73743 gene locus_tag LOCUS_18210 73090 73743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141333.1 protein_id gnl|my_center|LOCUS_18210 74137 74907 gene locus_tag LOCUS_18220 74137 74907 CDS product RES family NAD+ phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141332.1 protein_id gnl|my_center|LOCUS_18220 75020 75940 gene locus_tag LOCUS_18230 75020 75940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18230 78467 76266 gene locus_tag LOCUS_18240 78467 76266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18240 78963 78784 gene locus_tag LOCUS_18250 78963 78784 CDS product ssl1498 family light-harvesting-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055918.1 protein_id gnl|my_center|LOCUS_18250 81213 79210 gene locus_tag LOCUS_18260 81213 79210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18260 81903 81526 gene locus_tag LOCUS_18270 81903 81526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18270 82259 81921 gene locus_tag LOCUS_18280 82259 81921 CDS product 2Fe-2S iron-sulfur cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141520.1 protein_id gnl|my_center|LOCUS_18280 82677 83906 gene locus_tag LOCUS_18290 82677 83906 CDS product RNA-guided endonuclease TnpB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000942660.1 protein_id gnl|my_center|LOCUS_18290 83948 85564 gene locus_tag LOCUS_18300 gene cimA 83948 85564 CDS product citramalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056694.1 protein_id gnl|my_center|LOCUS_18300 86054 85821 gene locus_tag LOCUS_18310 86054 85821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18310 86215 88320 gene locus_tag LOCUS_18320 86215 88320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056981.1 protein_id gnl|my_center|LOCUS_18320 90066 88633 gene locus_tag LOCUS_18330 90066 88633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18330 90702 90427 gene locus_tag LOCUS_18340 90702 90427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18340 >Feature sequence018 307 588 gene locus_tag LOCUS_18350 307 588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18350 2692 1664 gene locus_tag LOCUS_18360 2692 1664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18360 3263 2967 gene locus_tag LOCUS_18370 3263 2967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18370 3774 3589 gene locus_tag LOCUS_18380 3774 3589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057753.1 protein_id gnl|my_center|LOCUS_18380 4210 5301 gene locus_tag LOCUS_18390 gene ald 4210 5301 CDS product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057941.1 protein_id gnl|my_center|LOCUS_18390 7589 5337 gene locus_tag LOCUS_18400 7589 5337 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140636.1 protein_id gnl|my_center|LOCUS_18400 8339 7755 gene locus_tag LOCUS_18410 8339 7755 CDS product chemotaxis protein CheB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001105137.1 protein_id gnl|my_center|LOCUS_18410 9320 8409 gene locus_tag LOCUS_18420 9320 8409 CDS product protein-glutamate O-methyltransferase CheR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000429044.1 protein_id gnl|my_center|LOCUS_18420 9420 10586 gene locus_tag LOCUS_18430 9420 10586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18430 11499 10870 gene locus_tag LOCUS_18440 11499 10870 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140508.1 protein_id gnl|my_center|LOCUS_18440 12354 11524 gene locus_tag LOCUS_18450 gene larE 12354 11524 CDS product ATP-dependent sacrificial sulfur transferase LarE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920840.1 protein_id gnl|my_center|LOCUS_18450 12463 13329 gene locus_tag LOCUS_18460 12463 13329 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057431.1 protein_id gnl|my_center|LOCUS_18460 13611 13447 gene locus_tag LOCUS_18470 13611 13447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18470 14720 13809 gene locus_tag LOCUS_18480 gene lipA 14720 13809 CDS product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056422.1 protein_id gnl|my_center|LOCUS_18480 15062 15634 gene locus_tag LOCUS_18490 15062 15634 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058037.1 protein_id gnl|my_center|LOCUS_18490 16608 16790 gene locus_tag LOCUS_18500 16608 16790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18500 16866 18647 gene locus_tag LOCUS_18510 16866 18647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18510 20428 18881 gene locus_tag LOCUS_18520 20428 18881 CDS product NAD(P)H-quinone oxidoreductase subunit N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055900.1 protein_id gnl|my_center|LOCUS_18520 21025 20708 gene locus_tag LOCUS_18530 21025 20708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18530 22413 25076 gene locus_tag LOCUS_18540 gene topA 22413 25076 CDS product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057718.1 protein_id gnl|my_center|LOCUS_18540 25577 25714 gene locus_tag LOCUS_18550 25577 25714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18550 25727 26188 gene locus_tag LOCUS_18560 gene aroQ 25727 26188 CDS product type II 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920703.1 protein_id gnl|my_center|LOCUS_18560 26339 27277 gene locus_tag LOCUS_18570 26339 27277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18570 27631 30132 gene locus_tag LOCUS_18580 27631 30132 CDS product HDIG domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_096663323.1 protein_id gnl|my_center|LOCUS_18580 30146 31009 gene locus_tag LOCUS_18590 30146 31009 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143217.1 protein_id gnl|my_center|LOCUS_18590 31118 31711 gene locus_tag LOCUS_18600 31118 31711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966478.1 protein_id gnl|my_center|LOCUS_18600 31762 32346 gene locus_tag LOCUS_18610 31762 32346 CDS product TIGR00730 family Rossman fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222951.1 protein_id gnl|my_center|LOCUS_18610 33915 33121 gene locus_tag LOCUS_18620 33915 33121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18620 34046 34363 gene locus_tag LOCUS_18630 34046 34363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18630 34344 35021 gene locus_tag LOCUS_18640 34344 35021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18640 35189 35554 gene locus_tag LOCUS_18650 35189 35554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18650 37019 35775 gene locus_tag LOCUS_18660 37019 35775 CDS product DUF445 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_231833781.1 protein_id gnl|my_center|LOCUS_18660 37781 37089 gene locus_tag LOCUS_18670 gene ubiE 37781 37089 CDS product bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140131.1 protein_id gnl|my_center|LOCUS_18670 38131 39210 gene locus_tag LOCUS_18680 38131 39210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142156.1 protein_id gnl|my_center|LOCUS_18680 39669 41138 gene locus_tag LOCUS_18690 39669 41138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18690 42061 41144 gene locus_tag LOCUS_18700 42061 41144 CDS product DUF3365 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023174491.1 protein_id gnl|my_center|LOCUS_18700 42264 43121 gene locus_tag LOCUS_18710 42264 43121 CDS product PhnD/SsuA/transferrin family substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140661.1 protein_id gnl|my_center|LOCUS_18710 44777 43263 gene locus_tag LOCUS_18720 44777 43263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18720 47010 44785 gene locus_tag LOCUS_18730 47010 44785 CDS product peptidase domain-containing ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681480.1 protein_id gnl|my_center|LOCUS_18730 47601 47233 gene locus_tag LOCUS_18740 47601 47233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18740 48268 47831 gene locus_tag LOCUS_18750 48268 47831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18750 48570 49778 gene locus_tag LOCUS_18760 48570 49778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18760 52320 49852 gene locus_tag LOCUS_18770 52320 49852 CDS product ATP-dependent Clp protease ATP-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056163.1 protein_id gnl|my_center|LOCUS_18770 53278 52778 gene locus_tag LOCUS_18780 gene rimI 53278 52778 CDS product ribosomal protein S18-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056322.1 protein_id gnl|my_center|LOCUS_18780 53558 54871 gene locus_tag LOCUS_18790 gene lysA 53558 54871 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057598.1 protein_id gnl|my_center|LOCUS_18790 55075 56001 gene locus_tag LOCUS_18800 gene cdaA 55075 56001 CDS product diadenylate cyclase CdaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057599.1 protein_id gnl|my_center|LOCUS_18800 55998 56747 gene locus_tag LOCUS_18810 gene uppS 55998 56747 CDS product polyprenyl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920928.1 protein_id gnl|my_center|LOCUS_18810 57104 56832 gene locus_tag LOCUS_18820 57104 56832 CDS product DUF3143 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055972.1 protein_id gnl|my_center|LOCUS_18820 57712 57158 gene locus_tag LOCUS_18830 57712 57158 CDS product J domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055973.1 protein_id gnl|my_center|LOCUS_18830 58840 57845 gene locus_tag LOCUS_18840 58840 57845 CDS product J domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057983.1 protein_id gnl|my_center|LOCUS_18840 61198 59072 gene locus_tag LOCUS_18850 gene dnaK 61198 59072 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920992.1 protein_id gnl|my_center|LOCUS_18850 61316 62161 gene locus_tag LOCUS_18860 61316 62161 CDS product M28 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000721273.1 protein_id gnl|my_center|LOCUS_18860 63169 62231 gene locus_tag LOCUS_18870 63169 62231 CDS product bestrophin family ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058043.1 protein_id gnl|my_center|LOCUS_18870 65074 64823 gene locus_tag LOCUS_18880 65074 64823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18880 65439 65221 gene locus_tag LOCUS_18890 65439 65221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18890 66055 66270 gene locus_tag LOCUS_18900 66055 66270 CDS product DUF2945 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143235.1 protein_id gnl|my_center|LOCUS_18900 67543 66476 gene locus_tag LOCUS_18910 67543 66476 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142872.1 protein_id gnl|my_center|LOCUS_18910 67654 68496 gene locus_tag LOCUS_18920 67654 68496 CDS product YaaW family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920905.1 protein_id gnl|my_center|LOCUS_18920 68493 69932 gene locus_tag LOCUS_18930 68493 69932 CDS product O-antigen ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011126018.1 protein_id gnl|my_center|LOCUS_18930 70090 71271 gene locus_tag LOCUS_18940 70090 71271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18940 71977 71318 gene locus_tag LOCUS_18950 gene msrA 71977 71318 CDS product peptide-methionine (S)-S-oxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_096571812.1 protein_id gnl|my_center|LOCUS_18950 74555 72228 gene locus_tag LOCUS_18960 74555 72228 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920752.1 protein_id gnl|my_center|LOCUS_18960 74643 75962 gene locus_tag LOCUS_18970 74643 75962 CDS product proton extrusion protein PcxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226578028.1 protein_id gnl|my_center|LOCUS_18970 76179 77363 gene locus_tag LOCUS_18980 76179 77363 CDS product MltA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056813.1 protein_id gnl|my_center|LOCUS_18980 77323 77532 gene locus_tag LOCUS_18990 77323 77532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18990 78054 78506 gene locus_tag LOCUS_19000 78054 78506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19000 79645 78887 gene locus_tag LOCUS_19010 79645 78887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19010 80089 79874 gene locus_tag LOCUS_19020 80089 79874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19020 81255 80914 gene locus_tag LOCUS_19030 81255 80914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19030 81735 81373 gene locus_tag LOCUS_19040 81735 81373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19040 82225 81875 gene locus_tag LOCUS_19050 82225 81875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19050 82711 82361 gene locus_tag LOCUS_19060 82711 82361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19060 83131 83469 gene locus_tag LOCUS_19070 83131 83469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19070 84225 83494 gene locus_tag LOCUS_19080 84225 83494 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144237.1 protein_id gnl|my_center|LOCUS_19080 85168 84386 gene locus_tag LOCUS_19090 gene udp 85168 84386 CDS product uridine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211528.1 protein_id gnl|my_center|LOCUS_19090 85409 85194 gene locus_tag LOCUS_19100 85409 85194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19100 87966 85534 gene locus_tag LOCUS_19110 87966 85534 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920521.1 protein_id gnl|my_center|LOCUS_19110 88597 88124 gene locus_tag LOCUS_19120 88597 88124 CDS product hemerythrin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226147.1 protein_id gnl|my_center|LOCUS_19120 >Feature sequence019 3365 327 gene locus_tag LOCUS_19130 3365 327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19130 3330 3545 gene locus_tag LOCUS_19140 3330 3545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19140 4345 6495 gene locus_tag LOCUS_19150 gene glyS 4345 6495 CDS product glycine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_198128218.1 protein_id gnl|my_center|LOCUS_19150 6544 8001 gene locus_tag LOCUS_19160 gene murD 6544 8001 CDS product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055928.1 protein_id gnl|my_center|LOCUS_19160 8404 9045 gene locus_tag LOCUS_19170 8404 9045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141518.1 protein_id gnl|my_center|LOCUS_19170 9056 9850 gene locus_tag LOCUS_19180 9056 9850 CDS product pentapeptide repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015184994.1 protein_id gnl|my_center|LOCUS_19180 11471 10797 gene locus_tag LOCUS_19190 11471 10797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19190 11914 12669 gene locus_tag LOCUS_19200 11914 12669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19200 13267 12896 gene locus_tag LOCUS_19210 13267 12896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19210 13388 13729 gene locus_tag LOCUS_19220 13388 13729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19220 13918 14601 gene locus_tag LOCUS_19230 13918 14601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19230 15320 14985 gene locus_tag LOCUS_19240 15320 14985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19240 15624 15313 gene locus_tag LOCUS_19250 15624 15313 CDS product DUF433 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_096894563.1 protein_id gnl|my_center|LOCUS_19250 16335 15766 gene locus_tag LOCUS_19260 16335 15766 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141560.1 protein_id gnl|my_center|LOCUS_19260 17959 16493 gene locus_tag LOCUS_19270 gene xylB 17959 16493 CDS product xylulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583285.1 protein_id gnl|my_center|LOCUS_19270 18711 18097 gene locus_tag LOCUS_19280 18711 18097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19280 19408 18938 gene locus_tag LOCUS_19290 19408 18938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19290 20028 19444 gene locus_tag LOCUS_19300 20028 19444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19300 20648 23572 gene locus_tag LOCUS_19310 20648 23572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19310 24560 23769 gene locus_tag LOCUS_19320 24560 23769 CDS product YdcF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140925.1 protein_id gnl|my_center|LOCUS_19320 25458 26282 gene locus_tag LOCUS_19330 25458 26282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19330 27039 28232 gene locus_tag LOCUS_19340 27039 28232 CDS product PstS family phosphate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928412.1 protein_id gnl|my_center|LOCUS_19340 28598 30199 gene locus_tag LOCUS_19350 28598 30199 CDS product iron uptake porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920919.1 protein_id gnl|my_center|LOCUS_19350 30742 30341 gene locus_tag LOCUS_19360 30742 30341 CDS product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056265.1 protein_id gnl|my_center|LOCUS_19360 31740 30961 gene locus_tag LOCUS_19370 31740 30961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19370 32768 31869 gene locus_tag LOCUS_19380 32768 31869 CDS product TauD/TfdA family dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004528360.1 protein_id gnl|my_center|LOCUS_19380 33411 32872 gene locus_tag LOCUS_19390 gene cysC 33411 32872 CDS product adenylyl-sulfate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140515.1 protein_id gnl|my_center|LOCUS_19390 34280 33468 gene locus_tag LOCUS_19400 34280 33468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19400 35020 34484 gene locus_tag LOCUS_19410 35020 34484 CDS product chromate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089256.1 protein_id gnl|my_center|LOCUS_19410 35601 35032 gene locus_tag LOCUS_19420 35601 35032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19420 37316 36708 gene locus_tag LOCUS_19430 37316 36708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19430 37769 38635 gene locus_tag LOCUS_19440 37769 38635 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001283934.1 protein_id gnl|my_center|LOCUS_19440 38750 39415 gene locus_tag LOCUS_19450 38750 39415 CDS product AzlC family ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001088307.1 protein_id gnl|my_center|LOCUS_19450 39408 39725 gene locus_tag LOCUS_19460 39408 39725 CDS product AzlD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461993.1 protein_id gnl|my_center|LOCUS_19460 39925 40470 gene locus_tag LOCUS_19470 39925 40470 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056354.1 protein_id gnl|my_center|LOCUS_19470 41344 40904 gene locus_tag LOCUS_19480 41344 40904 CDS product DUF202 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545148.1 protein_id gnl|my_center|LOCUS_19480 42562 41837 gene locus_tag LOCUS_19490 42562 41837 CDS product CadD family cadmium resistance transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002485755.1 protein_id gnl|my_center|LOCUS_19490 43130 44053 gene locus_tag LOCUS_19500 43130 44053 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143980.1 protein_id gnl|my_center|LOCUS_19500 44299 44736 gene locus_tag LOCUS_19510 44299 44736 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056354.1 protein_id gnl|my_center|LOCUS_19510 45477 44788 gene locus_tag LOCUS_19520 45477 44788 CDS product cadmium resistance transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000633409.1 protein_id gnl|my_center|LOCUS_19520 45540 46205 gene locus_tag LOCUS_19530 45540 46205 CDS product cadmium resistance transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000258897.1 protein_id gnl|my_center|LOCUS_19530 46985 46188 gene locus_tag LOCUS_19540 46985 46188 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_223173767.1 protein_id gnl|my_center|LOCUS_19540 47443 48180 gene locus_tag LOCUS_19550 47443 48180 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036955.1 protein_id gnl|my_center|LOCUS_19550 48908 48219 gene locus_tag LOCUS_19560 48908 48219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19560 50069 48993 gene locus_tag LOCUS_19570 gene acsF 50069 48993 CDS product magnesium-protoporphyrin IX monomethyl ester (oxidative) cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920870.1 protein_id gnl|my_center|LOCUS_19570 50598 51128 gene locus_tag LOCUS_19580 50598 51128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19580 51805 51125 gene locus_tag LOCUS_19590 51805 51125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19590 52356 52030 gene locus_tag LOCUS_19600 52356 52030 CDS product MoaD/ThiS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056827.1 protein_id gnl|my_center|LOCUS_19600 53784 52480 gene locus_tag LOCUS_19610 gene thrC 53784 52480 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056826.1 protein_id gnl|my_center|LOCUS_19610 54258 54004 gene locus_tag LOCUS_19620 54258 54004 CDS product MoaD/ThiS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144349.1 protein_id gnl|my_center|LOCUS_19620 54976 54359 gene locus_tag LOCUS_19630 54976 54359 CDS product J domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920873.1 protein_id gnl|my_center|LOCUS_19630 55774 55181 gene locus_tag LOCUS_19640 55774 55181 CDS product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056914.1 protein_id gnl|my_center|LOCUS_19640 56505 55807 gene locus_tag LOCUS_19650 56505 55807 CDS product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125538.1 protein_id gnl|my_center|LOCUS_19650 56770 58017 gene locus_tag LOCUS_19660 56770 58017 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058010.1 protein_id gnl|my_center|LOCUS_19660 58115 58501 gene locus_tag LOCUS_19670 58115 58501 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001017671.1 protein_id gnl|my_center|LOCUS_19670 58590 59189 gene locus_tag LOCUS_19680 58590 59189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19680 59423 59265 gene locus_tag LOCUS_19690 59423 59265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19690 59470 60222 gene locus_tag LOCUS_19700 59470 60222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_19700 60243 60770 gene locus_tag LOCUS_19710 60243 60770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_19710 60828 61886 gene locus_tag LOCUS_19720 60828 61886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19720 61832 64894 gene locus_tag LOCUS_19730 61832 64894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19730 66238 65162 gene locus_tag LOCUS_19740 66238 65162 CDS product PIN/TRAM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055863.1 protein_id gnl|my_center|LOCUS_19740 66595 67677 gene locus_tag LOCUS_19750 gene hemW 66595 67677 CDS product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099799709.1 protein_id gnl|my_center|LOCUS_19750 68004 67795 gene locus_tag LOCUS_19760 68004 67795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19760 68174 70660 gene locus_tag LOCUS_19770 68174 70660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19770 70752 71018 gene locus_tag LOCUS_19780 70752 71018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19780 71087 71461 gene locus_tag LOCUS_19790 71087 71461 CDS product DUF433 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142158.1 protein_id gnl|my_center|LOCUS_19790 71468 71803 gene locus_tag LOCUS_19800 71468 71803 CDS product DUF5615 family PIN-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142925.1 protein_id gnl|my_center|LOCUS_19800 72329 71922 gene locus_tag LOCUS_19810 72329 71922 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058102.1 protein_id gnl|my_center|LOCUS_19810 72419 73621 gene locus_tag LOCUS_19820 72419 73621 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058101.1 protein_id gnl|my_center|LOCUS_19820 73688 74305 gene locus_tag LOCUS_19830 73688 74305 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886490.1 protein_id gnl|my_center|LOCUS_19830 75850 74900 gene locus_tag LOCUS_19840 gene speE 75850 74900 CDS product polyamine aminopropyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583812.1 protein_id gnl|my_center|LOCUS_19840 76341 75871 gene locus_tag LOCUS_19850 76341 75871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19850 76706 76888 gene locus_tag LOCUS_19860 76706 76888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19860 79247 76947 gene locus_tag LOCUS_19870 79247 76947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19870 81065 79305 gene locus_tag LOCUS_19880 81065 79305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19880 81532 81873 gene locus_tag LOCUS_19890 81532 81873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19890 81962 83464 gene locus_tag LOCUS_19900 81962 83464 CDS product phenylacetate--CoA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928913.1 protein_id gnl|my_center|LOCUS_19900 83688 84863 gene locus_tag LOCUS_19910 83688 84863 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972257.1 protein_id gnl|my_center|LOCUS_19910 85872 84967 gene locus_tag LOCUS_19920 85872 84967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19920 86765 85872 gene locus_tag LOCUS_19930 86765 85872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19930 >Feature sequence020 1066 176 gene locus_tag LOCUS_19940 1066 176 CDS product DUF3365 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023174491.1 protein_id gnl|my_center|LOCUS_19940 1382 2239 gene locus_tag LOCUS_19950 1382 2239 CDS product PhnD/SsuA/transferrin family substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140661.1 protein_id gnl|my_center|LOCUS_19950 3912 2281 gene locus_tag LOCUS_19960 3912 2281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19960 4468 4004 gene locus_tag LOCUS_19970 4468 4004 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002668289.1 protein_id gnl|my_center|LOCUS_19970 5161 4640 gene locus_tag LOCUS_19980 5161 4640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19980 5645 5421 gene locus_tag LOCUS_19990 5645 5421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19990 6023 5799 gene locus_tag LOCUS_20000 6023 5799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20000 6409 6182 gene locus_tag LOCUS_20010 6409 6182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20010 6791 6567 gene locus_tag LOCUS_20020 6791 6567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20020 7087 6857 gene locus_tag LOCUS_20030 7087 6857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20030 8547 7216 gene locus_tag LOCUS_20040 8547 7216 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258472.1 protein_id gnl|my_center|LOCUS_20040 9085 8708 gene locus_tag LOCUS_20050 9085 8708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20050 10429 9173 gene locus_tag LOCUS_20060 10429 9173 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006095218.1 protein_id gnl|my_center|LOCUS_20060 11154 10480 gene locus_tag LOCUS_20070 11154 10480 CDS product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074285.1 protein_id gnl|my_center|LOCUS_20070 14754 11395 gene locus_tag LOCUS_20080 14754 11395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20080 17123 15567 gene locus_tag LOCUS_20090 17123 15567 CDS product flavin monoamine oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_130055498.1 protein_id gnl|my_center|LOCUS_20090 17886 20330 gene locus_tag LOCUS_20100 gene glf 17886 20330 CDS product UDP-galactopyranose mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162305162.1 protein_id gnl|my_center|LOCUS_20100 20630 22858 gene locus_tag LOCUS_20110 20630 22858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20110 23000 23986 gene locus_tag LOCUS_20120 gene galE 23000 23986 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920997.1 protein_id gnl|my_center|LOCUS_20120 29252 24009 gene locus_tag LOCUS_20130 29252 24009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20130 29928 29551 gene locus_tag LOCUS_20140 29928 29551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029512.1 protein_id gnl|my_center|LOCUS_20140 31215 30127 gene locus_tag LOCUS_20150 gene galK 31215 30127 CDS product galactokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011381253.1 protein_id gnl|my_center|LOCUS_20150 32509 31409 gene locus_tag LOCUS_20160 32509 31409 CDS product M24 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582708.1 protein_id gnl|my_center|LOCUS_20160 33630 32800 gene locus_tag LOCUS_20170 33630 32800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20170 34340 34086 gene locus_tag LOCUS_20180 34340 34086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20180 36024 37127 gene locus_tag LOCUS_20190 36024 37127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20190 37124 37870 gene locus_tag LOCUS_20200 37124 37870 CDS product HAD-IA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522658.1 protein_id gnl|my_center|LOCUS_20200 38401 37922 gene locus_tag LOCUS_20210 38401 37922 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143400.1 protein_id gnl|my_center|LOCUS_20210 39542 38550 gene locus_tag LOCUS_20220 39542 38550 CDS product sugar-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528410.1 protein_id gnl|my_center|LOCUS_20220 40555 39752 gene locus_tag LOCUS_20230 40555 39752 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257603.1 protein_id gnl|my_center|LOCUS_20230 40708 42054 gene locus_tag LOCUS_20240 40708 42054 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197580.1 protein_id gnl|my_center|LOCUS_20240 42383 43183 gene locus_tag LOCUS_20250 42383 43183 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550807.1 protein_id gnl|my_center|LOCUS_20250 43186 44007 gene locus_tag LOCUS_20260 43186 44007 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003369336.1 protein_id gnl|my_center|LOCUS_20260 44127 45230 gene locus_tag LOCUS_20270 gene ugpC 44127 45230 CDS product sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267680.1 protein_id gnl|my_center|LOCUS_20270 45235 46791 gene locus_tag LOCUS_20280 45235 46791 CDS product mannitol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730628.1 protein_id gnl|my_center|LOCUS_20280 48272 46950 gene locus_tag LOCUS_20290 48272 46950 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897250.1 protein_id gnl|my_center|LOCUS_20290 48359 49915 gene locus_tag LOCUS_20300 48359 49915 CDS product FGGY family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970040.1 protein_id gnl|my_center|LOCUS_20300 50186 51766 gene locus_tag LOCUS_20310 50186 51766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20310 52311 53837 gene locus_tag LOCUS_20320 gene katX 52311 53837 CDS product catalase KatX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243042.1 protein_id gnl|my_center|LOCUS_20320 55073 53970 gene locus_tag LOCUS_20330 gene galT 55073 53970 CDS product galactose-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229184.1 protein_id gnl|my_center|LOCUS_20330 56938 55052 gene locus_tag LOCUS_20340 56938 55052 CDS product glycoside hydrolase family 2 TIM barrel-domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229244.1 protein_id gnl|my_center|LOCUS_20340 57829 57620 gene locus_tag LOCUS_20350 57829 57620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20350 58212 59927 gene locus_tag LOCUS_20360 gene hflX 58212 59927 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144128.1 protein_id gnl|my_center|LOCUS_20360 59944 60822 gene locus_tag LOCUS_20370 59944 60822 CDS product isoaspartyl peptidase/L-asparaginase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525045.1 protein_id gnl|my_center|LOCUS_20370 61072 62346 gene locus_tag LOCUS_20380 61072 62346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20380 62380 63402 gene locus_tag LOCUS_20390 62380 63402 CDS product hemerythrin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142279.1 protein_id gnl|my_center|LOCUS_20390 64174 64725 gene locus_tag LOCUS_20400 64174 64725 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393013.1 protein_id gnl|my_center|LOCUS_20400 64725 65336 gene locus_tag LOCUS_20410 64725 65336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20410 65340 65738 gene locus_tag LOCUS_20420 65340 65738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197530034.1 protein_id gnl|my_center|LOCUS_20420 65731 66456 gene locus_tag LOCUS_20430 65731 66456 CDS product DUF72 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403241.1 protein_id gnl|my_center|LOCUS_20430 67681 69144 gene locus_tag LOCUS_20440 67681 69144 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584110.1 protein_id gnl|my_center|LOCUS_20440 70168 69419 gene locus_tag LOCUS_20450 gene ndhK 70168 69419 CDS product photosynthetic/respiratory NAD(P)H-quinone oxidoreductase subunit K inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056552.1 protein_id gnl|my_center|LOCUS_20450 71583 70402 gene locus_tag LOCUS_20460 71583 70402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20460 72965 72771 gene locus_tag LOCUS_20470 gene rpsU 72965 72771 CDS product 30S ribosomal protein S21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124743.1 protein_id gnl|my_center|LOCUS_20470 73442 73128 gene locus_tag LOCUS_20480 73442 73128 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058088.1 protein_id gnl|my_center|LOCUS_20480 74432 75391 gene locus_tag LOCUS_20490 74432 75391 CDS product calcium-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338726.1 protein_id gnl|my_center|LOCUS_20490 76707 75739 gene locus_tag LOCUS_20500 76707 75739 CDS product TIGR03885 family FMN-dependent LLM class oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975020.1 protein_id gnl|my_center|LOCUS_20500 78419 77616 gene locus_tag LOCUS_20510 78419 77616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20510 79290 80807 gene locus_tag LOCUS_20520 79290 80807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20520 80920 81762 gene locus_tag LOCUS_20530 80920 81762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20530 82193 82705 gene locus_tag LOCUS_20540 82193 82705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20540 83873 82959 gene locus_tag LOCUS_20550 83873 82959 CDS product DUF3365 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023174491.1 protein_id gnl|my_center|LOCUS_20550 >Feature sequence021 693 448 gene locus_tag LOCUS_20560 693 448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20560 5086 2411 gene locus_tag LOCUS_20570 5086 2411 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056205.1 protein_id gnl|my_center|LOCUS_20570 6014 5202 gene locus_tag LOCUS_20580 gene proC 6014 5202 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140706.1 protein_id gnl|my_center|LOCUS_20580 6751 6161 gene locus_tag LOCUS_20590 6751 6161 CDS product cell division protein SepF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057058.1 protein_id gnl|my_center|LOCUS_20590 7846 7172 gene locus_tag LOCUS_20600 7846 7172 CDS product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056880.1 protein_id gnl|my_center|LOCUS_20600 8055 7843 gene locus_tag LOCUS_20610 8055 7843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20610 9891 8266 gene locus_tag LOCUS_20620 9891 8266 CDS product anthranilate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920668.1 protein_id gnl|my_center|LOCUS_20620 10193 10266 gene locus_tag LOCUS_t00160 10193 10266 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 10649 11563 gene locus_tag LOCUS_20630 10649 11563 CDS product PhnD/SsuA/transferrin family substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140661.1 protein_id gnl|my_center|LOCUS_20630 11852 13108 gene locus_tag LOCUS_20640 11852 13108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20640 14288 13365 gene locus_tag LOCUS_20650 14288 13365 CDS product DUF3365 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023174491.1 protein_id gnl|my_center|LOCUS_20650 14872 16785 gene locus_tag LOCUS_20660 14872 16785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20660 17069 17968 gene locus_tag LOCUS_20670 17069 17968 CDS product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228704.1 protein_id gnl|my_center|LOCUS_20670 18799 17978 gene locus_tag LOCUS_20680 18799 17978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20680 19068 20519 gene locus_tag LOCUS_20690 19068 20519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193329014.1 protein_id gnl|my_center|LOCUS_20690 21058 21519 gene locus_tag LOCUS_20700 gene rimP 21058 21519 CDS product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929303.1 protein_id gnl|my_center|LOCUS_20700 21720 23000 gene locus_tag LOCUS_20710 gene nusA 21720 23000 CDS product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057772.1 protein_id gnl|my_center|LOCUS_20710 23131 23400 gene locus_tag LOCUS_20720 23131 23400 CDS product YlxR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057771.1 protein_id gnl|my_center|LOCUS_20720 23580 23768 gene locus_tag LOCUS_20730 23580 23768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20730 23837 27055 gene locus_tag LOCUS_20740 gene infB 23837 27055 CDS product translation initiation factor IF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056909.1 protein_id gnl|my_center|LOCUS_20740 27593 27790 gene locus_tag LOCUS_20750 27593 27790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056763.1 protein_id gnl|my_center|LOCUS_20750 28372 27836 gene locus_tag LOCUS_20760 28372 27836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20760 28788 30473 gene locus_tag LOCUS_20770 28788 30473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20770 31757 31134 gene locus_tag LOCUS_20780 31757 31134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20780 32592 33191 gene locus_tag LOCUS_20790 32592 33191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20790 33494 34567 gene locus_tag LOCUS_20800 33494 34567 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057458.1 protein_id gnl|my_center|LOCUS_20800 34651 37917 gene locus_tag LOCUS_20810 34651 37917 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143976.1 protein_id gnl|my_center|LOCUS_20810 38487 38720 gene locus_tag LOCUS_20820 38487 38720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20820 39457 39188 gene locus_tag LOCUS_20830 39457 39188 CDS product DUF3493 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143785.1 protein_id gnl|my_center|LOCUS_20830 39480 39551 gene locus_tag LOCUS_t00170 39480 39551 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 41212 39812 gene locus_tag LOCUS_20840 41212 39812 CDS product sugar porter family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_133829731.1 protein_id gnl|my_center|LOCUS_20840 42701 44524 gene locus_tag LOCUS_20850 42701 44524 CDS product iron uptake porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920919.1 protein_id gnl|my_center|LOCUS_20850 44937 45197 gene locus_tag LOCUS_20860 44937 45197 CDS product chlororespiratory reduction protein 7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920866.1 protein_id gnl|my_center|LOCUS_20860 45795 45247 gene locus_tag LOCUS_20870 45795 45247 CDS product DUF2854 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056635.1 protein_id gnl|my_center|LOCUS_20870 45961 46140 gene locus_tag LOCUS_20880 45961 46140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057262.1 protein_id gnl|my_center|LOCUS_20880 46706 46290 gene locus_tag LOCUS_20890 46706 46290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20890 48981 46879 gene locus_tag LOCUS_20900 gene ppk1 48981 46879 CDS product polyphosphate kinase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921077.1 protein_id gnl|my_center|LOCUS_20900 49204 49494 gene locus_tag LOCUS_20910 49204 49494 CDS product DUF2442 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626074.1 protein_id gnl|my_center|LOCUS_20910 49491 51065 gene locus_tag LOCUS_20920 49491 51065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20920 51406 52287 gene locus_tag LOCUS_20930 51406 52287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20930 53465 52824 gene locus_tag LOCUS_20940 53465 52824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057755.1 protein_id gnl|my_center|LOCUS_20940 53770 53609 gene locus_tag LOCUS_20950 53770 53609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20950 53769 54260 gene locus_tag LOCUS_20960 53769 54260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057012.1 protein_id gnl|my_center|LOCUS_20960 55821 54376 gene locus_tag LOCUS_20970 55821 54376 CDS product S-layer homology domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057642.1 protein_id gnl|my_center|LOCUS_20970 56777 55890 gene locus_tag LOCUS_20980 56777 55890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20980 58064 59275 gene locus_tag LOCUS_20990 58064 59275 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055884.1 protein_id gnl|my_center|LOCUS_20990 60162 59734 gene locus_tag LOCUS_21000 60162 59734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21000 60553 60269 gene locus_tag LOCUS_21010 60553 60269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21010 61716 60952 gene locus_tag LOCUS_21020 61716 60952 CDS product PIG-L family deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143042.1 protein_id gnl|my_center|LOCUS_21020 62003 61686 gene locus_tag LOCUS_21030 62003 61686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21030 62901 64280 gene locus_tag LOCUS_21040 62901 64280 CDS product aminopeptidase P family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140097.1 protein_id gnl|my_center|LOCUS_21040 64403 64609 gene locus_tag LOCUS_21050 64403 64609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21050 66032 64920 gene locus_tag LOCUS_21060 66032 64920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21060 66986 68440 gene locus_tag LOCUS_21070 gene ffh 66986 68440 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057808.1 protein_id gnl|my_center|LOCUS_21070 69750 68470 gene locus_tag LOCUS_21080 gene tnpB 69750 68470 CDS product IS200/IS605 family element RNA-guided endonuclease TnpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_054297574.1 protein_id gnl|my_center|LOCUS_21080 70317 70577 gene locus_tag LOCUS_21090 70317 70577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21090 70540 70968 gene locus_tag LOCUS_21100 70540 70968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21100 71349 71525 gene locus_tag LOCUS_21110 gene rpsU 71349 71525 CDS product 30S ribosomal protein S21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055893.1 protein_id gnl|my_center|LOCUS_21110 71762 72733 gene locus_tag LOCUS_21120 71762 72733 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055892.1 protein_id gnl|my_center|LOCUS_21120 72935 73339 gene locus_tag LOCUS_21130 72935 73339 CDS product heme utilization protein HuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920696.1 protein_id gnl|my_center|LOCUS_21130 73947 73489 gene locus_tag LOCUS_21140 73947 73489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888810.1 protein_id gnl|my_center|LOCUS_21140 74417 74049 gene locus_tag LOCUS_21150 74417 74049 CDS product roadblock/LC7 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057825.1 protein_id gnl|my_center|LOCUS_21150 75125 74577 gene locus_tag LOCUS_21160 75125 74577 CDS product ATP/GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057826.1 protein_id gnl|my_center|LOCUS_21160 75962 75408 gene locus_tag LOCUS_21170 75962 75408 CDS product protoglobin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920963.1 protein_id gnl|my_center|LOCUS_21170 76745 76110 gene locus_tag LOCUS_21180 76745 76110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21180 77948 77070 gene locus_tag LOCUS_21190 77948 77070 CDS product DUF4388 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057827.1 protein_id gnl|my_center|LOCUS_21190 78584 79246 gene locus_tag LOCUS_21200 78584 79246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929385.1 protein_id gnl|my_center|LOCUS_21200 79334 81142 gene locus_tag LOCUS_21210 79334 81142 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142666.1 protein_id gnl|my_center|LOCUS_21210 81272 81356 gene locus_tag LOCUS_t00180 81272 81356 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 81449 81520 gene locus_tag LOCUS_t00190 81449 81520 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 82655 81789 gene locus_tag LOCUS_21220 82655 81789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21220 82889 82710 gene locus_tag LOCUS_21230 82889 82710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21230 >Feature sequence022 509 868 gene locus_tag LOCUS_21240 509 868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21240 945 1223 gene locus_tag LOCUS_21250 945 1223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21250 1933 1370 gene locus_tag LOCUS_21260 1933 1370 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140580.1 protein_id gnl|my_center|LOCUS_21260 2122 2700 gene locus_tag LOCUS_21270 2122 2700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21270 2902 3126 gene locus_tag LOCUS_21280 2902 3126 CDS product DUF433 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142391.1 protein_id gnl|my_center|LOCUS_21280 3123 3455 gene locus_tag LOCUS_21290 3123 3455 CDS product DUF5615 family PIN-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142392.1 protein_id gnl|my_center|LOCUS_21290 3773 4117 gene locus_tag LOCUS_21300 3773 4117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21300 4093 8265 gene locus_tag LOCUS_21310 4093 8265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21310 9918 8476 gene locus_tag LOCUS_21320 gene nifD 9918 8476 CDS product nitrogenase molybdenum-iron protein alpha chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084552.1 protein_id gnl|my_center|LOCUS_21320 11013 10120 gene locus_tag LOCUS_21330 gene nifH 11013 10120 CDS product nitrogenase iron protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533491.1 protein_id gnl|my_center|LOCUS_21330 11983 11627 gene locus_tag LOCUS_21340 11983 11627 CDS product group 1 truncated hemoglobin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947457.1 protein_id gnl|my_center|LOCUS_21340 13083 12181 gene locus_tag LOCUS_21350 gene nifU 13083 12181 CDS product Fe-S cluster assembly protein NifU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937968.1 protein_id gnl|my_center|LOCUS_21350 14456 13164 gene locus_tag LOCUS_21360 gene nifS 14456 13164 CDS product cysteine desulfurase NifS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937967.1 protein_id gnl|my_center|LOCUS_21360 14790 14440 gene locus_tag LOCUS_21370 14790 14440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21370 16266 14929 gene locus_tag LOCUS_21380 gene nifB 16266 14929 CDS product nitrogenase cofactor biosynthesis protein NifB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084568.1 protein_id gnl|my_center|LOCUS_21380 17707 18651 gene locus_tag LOCUS_21390 17707 18651 CDS product NAD(P)-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000643856.1 protein_id gnl|my_center|LOCUS_21390 18882 19058 gene locus_tag LOCUS_21400 18882 19058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21400 19497 20210 gene locus_tag LOCUS_21410 gene cysE 19497 20210 CDS product serine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056695.1 protein_id gnl|my_center|LOCUS_21410 20213 20458 gene locus_tag LOCUS_21420 20213 20458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21420 20646 20843 gene locus_tag LOCUS_21430 20646 20843 CDS product DUF2949 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921037.1 protein_id gnl|my_center|LOCUS_21430 21677 22813 gene locus_tag LOCUS_21440 gene nifV 21677 22813 CDS product homocitrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941605.1 protein_id gnl|my_center|LOCUS_21440 22800 23084 gene locus_tag LOCUS_21450 22800 23084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21450 23164 23367 gene locus_tag LOCUS_21460 23164 23367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21460 23551 24162 gene locus_tag LOCUS_21470 23551 24162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21470 25259 24228 gene locus_tag LOCUS_21480 gene add 25259 24228 CDS product adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256408.1 protein_id gnl|my_center|LOCUS_21480 28939 25457 gene locus_tag LOCUS_21490 28939 25457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21490 34332 28936 gene locus_tag LOCUS_21500 34332 28936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21500 34754 34536 gene locus_tag LOCUS_21510 34754 34536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21510 36859 35822 gene locus_tag LOCUS_21520 36859 35822 CDS product zinc-dependent alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838331.1 protein_id gnl|my_center|LOCUS_21520 38377 36977 gene locus_tag LOCUS_21530 38377 36977 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141660.1 protein_id gnl|my_center|LOCUS_21530 39229 38768 gene locus_tag LOCUS_21540 39229 38768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21540 40766 39363 gene locus_tag LOCUS_21550 40766 39363 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141661.1 protein_id gnl|my_center|LOCUS_21550 41192 40806 gene locus_tag LOCUS_21560 41192 40806 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143544.1 protein_id gnl|my_center|LOCUS_21560 41413 41192 gene locus_tag LOCUS_21570 41413 41192 CDS product type II toxin-antitoxin system Phd/YefM family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142023.1 protein_id gnl|my_center|LOCUS_21570 44069 42405 gene locus_tag LOCUS_21580 44069 42405 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140483.1 protein_id gnl|my_center|LOCUS_21580 45040 44642 gene locus_tag LOCUS_21590 45040 44642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21590 47895 45238 gene locus_tag LOCUS_21600 47895 45238 CDS product glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141168.1 protein_id gnl|my_center|LOCUS_21600 48086 47892 gene locus_tag LOCUS_21610 48086 47892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21610 49018 48341 gene locus_tag LOCUS_21620 49018 48341 CDS product NADPH-dependent F420 reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140957.1 protein_id gnl|my_center|LOCUS_21620 49803 49054 gene locus_tag LOCUS_21630 49803 49054 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902034.1 protein_id gnl|my_center|LOCUS_21630 50553 49843 gene locus_tag LOCUS_21640 50553 49843 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928484.1 protein_id gnl|my_center|LOCUS_21640 51284 50550 gene locus_tag LOCUS_21650 51284 50550 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144187.1 protein_id gnl|my_center|LOCUS_21650 52084 51503 gene locus_tag LOCUS_21660 52084 51503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21660 52892 52125 gene locus_tag LOCUS_21670 52892 52125 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288522.1 protein_id gnl|my_center|LOCUS_21670 53658 52918 gene locus_tag LOCUS_21680 53658 52918 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144187.1 protein_id gnl|my_center|LOCUS_21680 54526 53639 gene locus_tag LOCUS_21690 54526 53639 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729831.1 protein_id gnl|my_center|LOCUS_21690 54759 54550 gene locus_tag LOCUS_21700 54759 54550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21700 55580 54774 gene locus_tag LOCUS_21710 55580 54774 CDS product aquaporin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197530129.1 protein_id gnl|my_center|LOCUS_21710 56606 55665 gene locus_tag LOCUS_21720 56606 55665 CDS product NADP-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020817.1 protein_id gnl|my_center|LOCUS_21720 57390 56650 gene locus_tag LOCUS_21730 57390 56650 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144187.1 protein_id gnl|my_center|LOCUS_21730 58223 57507 gene locus_tag LOCUS_21740 58223 57507 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115034.1 protein_id gnl|my_center|LOCUS_21740 59447 58242 gene locus_tag LOCUS_21750 59447 58242 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405030.1 protein_id gnl|my_center|LOCUS_21750 60202 59528 gene locus_tag LOCUS_21760 60202 59528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21760 61533 60439 gene locus_tag LOCUS_21770 61533 60439 CDS product alkene reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021039.1 protein_id gnl|my_center|LOCUS_21770 62327 61689 gene locus_tag LOCUS_21780 62327 61689 CDS product antibiotic biosynthesis monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143820.1 protein_id gnl|my_center|LOCUS_21780 63991 62567 gene locus_tag LOCUS_21790 63991 62567 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_088430287.1 protein_id gnl|my_center|LOCUS_21790 67315 64106 gene locus_tag LOCUS_21800 67315 64106 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143976.1 protein_id gnl|my_center|LOCUS_21800 68873 67515 gene locus_tag LOCUS_21810 68873 67515 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143975.1 protein_id gnl|my_center|LOCUS_21810 69677 70051 gene locus_tag LOCUS_21820 69677 70051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21820 70260 70727 gene locus_tag LOCUS_21830 70260 70727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21830 72095 73003 gene locus_tag LOCUS_21840 gene nifH 72095 73003 CDS product nitrogenase iron protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533491.1 protein_id gnl|my_center|LOCUS_21840 74117 73635 gene locus_tag LOCUS_21850 74117 73635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21850 74783 74196 gene locus_tag LOCUS_21860 gene hemJ 74783 74196 CDS product protoporphyrinogen oxidase HemJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143033.1 protein_id gnl|my_center|LOCUS_21860 75837 74983 gene locus_tag LOCUS_21870 75837 74983 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142803.1 protein_id gnl|my_center|LOCUS_21870 77144 75942 gene locus_tag LOCUS_21880 77144 75942 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920975.1 protein_id gnl|my_center|LOCUS_21880 77665 77192 gene locus_tag LOCUS_21890 gene psbQ 77665 77192 CDS product photosystem II protein PsbQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057892.1 protein_id gnl|my_center|LOCUS_21890 78095 78550 gene locus_tag LOCUS_21900 78095 78550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056982.1 protein_id gnl|my_center|LOCUS_21900 79000 78578 gene locus_tag LOCUS_21910 79000 78578 CDS product DUF393 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143244.1 protein_id gnl|my_center|LOCUS_21910 79142 80053 gene locus_tag LOCUS_21920 79142 80053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21920 80285 80527 gene locus_tag LOCUS_21930 80285 80527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21930 >Feature sequence023 242 2548 gene locus_tag LOCUS_21940 242 2548 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971984.1 protein_id gnl|my_center|LOCUS_21940 2493 2939 gene locus_tag LOCUS_21950 2493 2939 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389344.1 protein_id gnl|my_center|LOCUS_21950 3073 4248 gene locus_tag LOCUS_21960 3073 4248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21960 4691 5512 gene locus_tag LOCUS_21970 4691 5512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21970 6173 5532 gene locus_tag LOCUS_21980 gene trmB 6173 5532 CDS product tRNA (guanosine(46)-N7)-methyltransferase TrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057818.1 protein_id gnl|my_center|LOCUS_21980 6303 7346 gene locus_tag LOCUS_21990 6303 7346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21990 7459 8628 gene locus_tag LOCUS_22000 7459 8628 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057388.1 protein_id gnl|my_center|LOCUS_22000 9882 8665 gene locus_tag LOCUS_22010 9882 8665 CDS product FIST C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140828.1 protein_id gnl|my_center|LOCUS_22010 10271 10498 gene locus_tag LOCUS_22020 10271 10498 CDS product Calvin cycle protein CP12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057657.1 protein_id gnl|my_center|LOCUS_22020 10705 10553 gene locus_tag LOCUS_22030 10705 10553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22030 10805 11401 gene locus_tag LOCUS_22040 10805 11401 CDS product DUF3177 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057787.1 protein_id gnl|my_center|LOCUS_22040 11488 11787 gene locus_tag LOCUS_22050 11488 11787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921006.1 protein_id gnl|my_center|LOCUS_22050 12170 13792 gene locus_tag LOCUS_22060 gene guaA 12170 13792 CDS product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058250.1 protein_id gnl|my_center|LOCUS_22060 15706 14819 gene locus_tag LOCUS_22070 15706 14819 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920864.1 protein_id gnl|my_center|LOCUS_22070 16029 16376 gene locus_tag LOCUS_22080 16029 16376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056501.1 protein_id gnl|my_center|LOCUS_22080 16979 16743 gene locus_tag LOCUS_22090 16979 16743 CDS product DUF4327 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058280.1 protein_id gnl|my_center|LOCUS_22090 18907 17315 gene locus_tag LOCUS_22100 18907 17315 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056886.1 protein_id gnl|my_center|LOCUS_22100 19654 19229 gene locus_tag LOCUS_22110 gene rbfA 19654 19229 CDS product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057468.1 protein_id gnl|my_center|LOCUS_22110 19948 19742 gene locus_tag LOCUS_22120 19948 19742 CDS product DUF751 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057323.1 protein_id gnl|my_center|LOCUS_22120 20107 20961 gene locus_tag LOCUS_22130 20107 20961 CDS product DNA adenine methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393238.1 protein_id gnl|my_center|LOCUS_22130 21433 20945 gene locus_tag LOCUS_22140 21433 20945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444248.1 protein_id gnl|my_center|LOCUS_22140 23428 22208 gene locus_tag LOCUS_22150 23428 22208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22150 24467 23805 gene locus_tag LOCUS_22160 24467 23805 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055998.1 protein_id gnl|my_center|LOCUS_22160 24586 25908 gene locus_tag LOCUS_22170 gene larC 24586 25908 CDS product nickel pincer cofactor biosynthesis protein LarC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058129.1 protein_id gnl|my_center|LOCUS_22170 27004 26258 gene locus_tag LOCUS_22180 27004 26258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22180 27653 27111 gene locus_tag LOCUS_22190 27653 27111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22190 28346 29254 gene locus_tag LOCUS_22200 28346 29254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22200 30409 30726 gene locus_tag LOCUS_22210 30409 30726 CDS product DUF3007 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143232.1 protein_id gnl|my_center|LOCUS_22210 30857 31159 gene locus_tag LOCUS_22220 30857 31159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22220 31429 32073 gene locus_tag LOCUS_22230 31429 32073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22230 33810 34733 gene locus_tag LOCUS_22240 33810 34733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22240 34730 38614 gene locus_tag LOCUS_22250 34730 38614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22250 38789 40948 gene locus_tag LOCUS_22260 38789 40948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22260 41008 44037 gene locus_tag LOCUS_22270 41008 44037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22270 44221 44769 gene locus_tag LOCUS_22280 44221 44769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22280 47016 45013 gene locus_tag LOCUS_22290 47016 45013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22290 47180 47665 gene locus_tag LOCUS_22300 47180 47665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099799199.1 protein_id gnl|my_center|LOCUS_22300 50381 48012 gene locus_tag LOCUS_22310 50381 48012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22310 50583 50741 gene locus_tag LOCUS_22320 50583 50741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22320 50991 52031 gene locus_tag LOCUS_22330 50991 52031 CDS product folate-binding protein YgfZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057784.1 protein_id gnl|my_center|LOCUS_22330 53192 52041 gene locus_tag LOCUS_22340 53192 52041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22340 53591 53304 gene locus_tag LOCUS_22350 53591 53304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22350 54648 53674 gene locus_tag LOCUS_22360 54648 53674 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921231.1 protein_id gnl|my_center|LOCUS_22360 54943 56349 gene locus_tag LOCUS_22370 54943 56349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22370 56312 56764 gene locus_tag LOCUS_22380 56312 56764 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878970.1 protein_id gnl|my_center|LOCUS_22380 57645 57013 gene locus_tag LOCUS_22390 57645 57013 CDS product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722009.1 protein_id gnl|my_center|LOCUS_22390 58099 58452 gene locus_tag LOCUS_22400 58099 58452 CDS product STAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057408.1 protein_id gnl|my_center|LOCUS_22400 59206 58457 gene locus_tag LOCUS_22410 59206 58457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22410 59756 59199 gene locus_tag LOCUS_22420 59756 59199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057906.1 protein_id gnl|my_center|LOCUS_22420 60342 60016 gene locus_tag LOCUS_22430 gene rpsF 60342 60016 CDS product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140437.1 protein_id gnl|my_center|LOCUS_22430 60863 61636 gene locus_tag LOCUS_22440 60863 61636 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057118.1 protein_id gnl|my_center|LOCUS_22440 62116 61640 gene locus_tag LOCUS_22450 62116 61640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143287.1 protein_id gnl|my_center|LOCUS_22450 62398 62201 gene locus_tag LOCUS_22460 62398 62201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057807.1 protein_id gnl|my_center|LOCUS_22460 62933 64216 gene locus_tag LOCUS_22470 62933 64216 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057961.1 protein_id gnl|my_center|LOCUS_22470 64420 65466 gene locus_tag LOCUS_22480 64420 65466 CDS product MraY family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057962.1 protein_id gnl|my_center|LOCUS_22480 65570 66820 gene locus_tag LOCUS_22490 65570 66820 CDS product competence/damage-inducible protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_073594983.1 protein_id gnl|my_center|LOCUS_22490 68913 66943 gene locus_tag LOCUS_22500 gene acs 68913 66943 CDS product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056731.1 protein_id gnl|my_center|LOCUS_22500 70106 69420 gene locus_tag LOCUS_22510 70106 69420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22510 71185 70103 gene locus_tag LOCUS_22520 71185 70103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22520 71501 72235 gene locus_tag LOCUS_22530 71501 72235 CDS product DUF475 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056123.1 protein_id gnl|my_center|LOCUS_22530 72749 72300 gene locus_tag LOCUS_22540 gene ndk 72749 72300 CDS product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056122.1 protein_id gnl|my_center|LOCUS_22540 72945 74960 gene locus_tag LOCUS_22550 gene speA 72945 74960 CDS product biosynthetic arginine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057644.1 protein_id gnl|my_center|LOCUS_22550 76179 75013 gene locus_tag LOCUS_22560 76179 75013 CDS product NDP-sugar synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056459.1 protein_id gnl|my_center|LOCUS_22560 77519 76677 gene locus_tag LOCUS_22570 77519 76677 CDS product ScpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920913.1 protein_id gnl|my_center|LOCUS_22570 78017 77658 gene locus_tag LOCUS_22580 78017 77658 CDS product LapA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920916.1 protein_id gnl|my_center|LOCUS_22580 79340 78288 gene locus_tag LOCUS_22590 79340 78288 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058096.1 protein_id gnl|my_center|LOCUS_22590 79469 80113 gene locus_tag LOCUS_22600 gene pdxH 79469 80113 CDS product pyridoxamine 5'-phosphate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188935.1 protein_id gnl|my_center|LOCUS_22600 >Feature sequence024 338 484 gene locus_tag LOCUS_22610 338 484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22610 1003 3129 gene locus_tag LOCUS_22620 1003 3129 CDS product DNA/RNA non-specific endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921723.1 protein_id gnl|my_center|LOCUS_22620 3408 4235 gene locus_tag LOCUS_22630 3408 4235 CDS product PD-(D/E)XK nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056927.1 protein_id gnl|my_center|LOCUS_22630 4265 4903 gene locus_tag LOCUS_22640 4265 4903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22640 5090 7420 gene locus_tag LOCUS_22650 gene recJ 5090 7420 CDS product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056029.1 protein_id gnl|my_center|LOCUS_22650 7644 7417 gene locus_tag LOCUS_22660 7644 7417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22660 8578 7682 gene locus_tag LOCUS_22670 8578 7682 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228409.1 protein_id gnl|my_center|LOCUS_22670 9310 8840 gene locus_tag LOCUS_22680 9310 8840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22680 9798 9337 gene locus_tag LOCUS_22690 9798 9337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22690 10160 9837 gene locus_tag LOCUS_22700 10160 9837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22700 10373 10996 gene locus_tag LOCUS_22710 10373 10996 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966747.1 protein_id gnl|my_center|LOCUS_22710 11182 11379 gene locus_tag LOCUS_22720 11182 11379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22720 12006 11401 gene locus_tag LOCUS_22730 12006 11401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22730 12405 13748 gene locus_tag LOCUS_22740 12405 13748 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172187164.1 protein_id gnl|my_center|LOCUS_22740 13895 14866 gene locus_tag LOCUS_22750 13895 14866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22750 14920 15615 gene locus_tag LOCUS_22760 14920 15615 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057103.1 protein_id gnl|my_center|LOCUS_22760 16750 16469 gene locus_tag LOCUS_22770 16750 16469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22770 17224 17769 gene locus_tag LOCUS_22780 17224 17769 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098375.1 protein_id gnl|my_center|LOCUS_22780 17823 18209 gene locus_tag LOCUS_22790 17823 18209 CDS product NAD(P)H-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141521.1 protein_id gnl|my_center|LOCUS_22790 19389 19117 gene locus_tag LOCUS_22800 19389 19117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22800 20320 22503 gene locus_tag LOCUS_22810 20320 22503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22810 22685 24268 gene locus_tag LOCUS_22820 22685 24268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22820 24418 25065 gene locus_tag LOCUS_22830 24418 25065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22830 26704 25295 gene locus_tag LOCUS_22840 26704 25295 CDS product PrsW family glutamic-type intramembrane protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140772.1 protein_id gnl|my_center|LOCUS_22840 27549 26950 gene locus_tag LOCUS_22850 27549 26950 CDS product DJ-1/PfpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920714.1 protein_id gnl|my_center|LOCUS_22850 28223 27774 gene locus_tag LOCUS_22860 28223 27774 CDS product nitrate reductase associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057196.1 protein_id gnl|my_center|LOCUS_22860 28695 28240 gene locus_tag LOCUS_22870 28695 28240 CDS product phosphate-starvation-inducible PsiE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058266.1 protein_id gnl|my_center|LOCUS_22870 31049 28797 gene locus_tag LOCUS_22880 31049 28797 CDS product nitrate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921160.1 protein_id gnl|my_center|LOCUS_22880 33031 31529 gene locus_tag LOCUS_22890 33031 31529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22890 34780 33206 gene locus_tag LOCUS_22900 34780 33206 CDS product ferredoxin--nitrite reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057189.1 protein_id gnl|my_center|LOCUS_22900 35149 36366 gene locus_tag LOCUS_22910 35149 36366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22910 36468 37418 gene locus_tag LOCUS_22920 36468 37418 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057199.1 protein_id gnl|my_center|LOCUS_22920 37485 38573 gene locus_tag LOCUS_22930 37485 38573 CDS product anthranilate phosphoribosyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057198.1 protein_id gnl|my_center|LOCUS_22930 38874 38689 gene locus_tag LOCUS_22940 gene rpsU 38874 38689 CDS product 30S ribosomal protein S21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124743.1 protein_id gnl|my_center|LOCUS_22940 39457 39125 gene locus_tag LOCUS_22950 39457 39125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22950 40755 39856 gene locus_tag LOCUS_22960 40755 39856 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920959.1 protein_id gnl|my_center|LOCUS_22960 41151 40768 gene locus_tag LOCUS_22970 41151 40768 CDS product aspartate 1-decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144212.1 protein_id gnl|my_center|LOCUS_22970 41775 41254 gene locus_tag LOCUS_22980 41775 41254 CDS product inorganic diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921201.1 protein_id gnl|my_center|LOCUS_22980 44628 43657 gene locus_tag LOCUS_22990 44628 43657 CDS product DUF362 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920773.1 protein_id gnl|my_center|LOCUS_22990 46135 44699 gene locus_tag LOCUS_23000 46135 44699 CDS product aspartate ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141457.1 protein_id gnl|my_center|LOCUS_23000 46277 46813 gene locus_tag LOCUS_23010 gene pgsA 46277 46813 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140305.1 protein_id gnl|my_center|LOCUS_23010 47847 46918 gene locus_tag LOCUS_23020 47847 46918 CDS product SMP-30/gluconolactonase/LRE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197530013.1 protein_id gnl|my_center|LOCUS_23020 49073 48135 gene locus_tag LOCUS_23030 49073 48135 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125025.1 protein_id gnl|my_center|LOCUS_23030 49346 50485 gene locus_tag LOCUS_23040 49346 50485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23040 50922 51557 gene locus_tag LOCUS_23050 50922 51557 CDS product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125542.1 protein_id gnl|my_center|LOCUS_23050 52018 53097 gene locus_tag LOCUS_23060 gene gmd 52018 53097 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056481.1 protein_id gnl|my_center|LOCUS_23060 53121 54065 gene locus_tag LOCUS_23070 53121 54065 CDS product GDP-L-fucose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056480.1 protein_id gnl|my_center|LOCUS_23070 54624 54151 gene locus_tag LOCUS_23080 54624 54151 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000151333.1 protein_id gnl|my_center|LOCUS_23080 54774 55334 gene locus_tag LOCUS_23090 54774 55334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_23090 55309 55968 gene locus_tag LOCUS_23100 55309 55968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_23100 56056 56643 gene locus_tag LOCUS_23110 56056 56643 CDS product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140761.1 protein_id gnl|my_center|LOCUS_23110 56648 57478 gene locus_tag LOCUS_23120 56648 57478 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057222.1 protein_id gnl|my_center|LOCUS_23120 58154 57480 gene locus_tag LOCUS_23130 58154 57480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23130 60289 59075 gene locus_tag LOCUS_23140 60289 59075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23140 61553 60483 gene locus_tag LOCUS_23150 61553 60483 CDS product PstS family phosphate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057692.1 protein_id gnl|my_center|LOCUS_23150 62211 64823 gene locus_tag LOCUS_23160 62211 64823 CDS product DUF3656 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140940.1 protein_id gnl|my_center|LOCUS_23160 64978 65919 gene locus_tag LOCUS_23170 64978 65919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23170 66746 65991 gene locus_tag LOCUS_23180 66746 65991 CDS product Nif3-like dinuclear metal center hexameric protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889091.1 protein_id gnl|my_center|LOCUS_23180 67910 66882 gene locus_tag LOCUS_23190 67910 66882 CDS product chemotaxis protein CheB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970589.1 protein_id gnl|my_center|LOCUS_23190 68407 68090 gene locus_tag LOCUS_23200 gene trxA 68407 68090 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921014.1 protein_id gnl|my_center|LOCUS_23200 69668 68574 gene locus_tag LOCUS_23210 69668 68574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23210 70572 69883 gene locus_tag LOCUS_23220 70572 69883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23220 71799 70657 gene locus_tag LOCUS_23230 71799 70657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23230 72435 72163 gene locus_tag LOCUS_23240 72435 72163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23240 72727 72503 gene locus_tag LOCUS_23250 72727 72503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23250 73027 72794 gene locus_tag LOCUS_23260 73027 72794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23260 73724 73404 gene locus_tag LOCUS_23270 73724 73404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23270 74584 74979 gene locus_tag LOCUS_23280 74584 74979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_23280 76349 75201 gene locus_tag LOCUS_23290 76349 75201 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056563.1 protein_id gnl|my_center|LOCUS_23290 76842 76663 gene locus_tag LOCUS_23300 76842 76663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23300 77502 77882 gene locus_tag LOCUS_23310 77502 77882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055984.1 protein_id gnl|my_center|LOCUS_23310 >Feature sequence025 794 168 gene locus_tag LOCUS_23320 gene mtnB 794 168 CDS product methylthioribulose 1-phosphate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000111958.1 protein_id gnl|my_center|LOCUS_23320 1445 894 gene locus_tag LOCUS_23330 1445 894 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000201440.1 protein_id gnl|my_center|LOCUS_23330 2664 1732 gene locus_tag LOCUS_23340 2664 1732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23340 3201 3034 gene locus_tag LOCUS_23350 3201 3034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23350 3667 5913 gene locus_tag LOCUS_23360 3667 5913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23360 5885 6913 gene locus_tag LOCUS_23370 5885 6913 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266394.1 protein_id gnl|my_center|LOCUS_23370 7700 7092 gene locus_tag LOCUS_23380 7700 7092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23380 8939 8109 gene locus_tag LOCUS_23390 gene pstB 8939 8109 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256172.1 protein_id gnl|my_center|LOCUS_23390 10082 9180 gene locus_tag LOCUS_23400 gene pstA 10082 9180 CDS product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140014.1 protein_id gnl|my_center|LOCUS_23400 11029 10088 gene locus_tag LOCUS_23410 gene pstC 11029 10088 CDS product phosphate ABC transporter permease subunit PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405018.1 protein_id gnl|my_center|LOCUS_23410 11366 11133 gene locus_tag LOCUS_23420 11366 11133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_23420 12449 12712 gene locus_tag LOCUS_23430 12449 12712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007358131.1 protein_id gnl|my_center|LOCUS_23430 13123 12902 gene locus_tag LOCUS_23440 13123 12902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23440 13988 13425 gene locus_tag LOCUS_23450 gene ssuE 13988 13425 CDS product NADPH-dependent FMN reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142759.1 protein_id gnl|my_center|LOCUS_23450 15307 14144 gene locus_tag LOCUS_23460 gene ssuD 15307 14144 CDS product FMNH2-dependent alkanesulfonate monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089747.1 protein_id gnl|my_center|LOCUS_23460 15792 16808 gene locus_tag LOCUS_23470 15792 16808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23470 16828 18555 gene locus_tag LOCUS_23480 16828 18555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23480 18764 18994 gene locus_tag LOCUS_23490 18764 18994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_23490 18998 19471 gene locus_tag LOCUS_23500 18998 19471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_23500 20425 20087 gene locus_tag LOCUS_23510 20425 20087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23510 21065 20790 gene locus_tag LOCUS_23520 21065 20790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23520 21102 22142 gene locus_tag LOCUS_23530 21102 22142 CDS product NADP(H)-dependent aldo-keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526891.1 protein_id gnl|my_center|LOCUS_23530 22998 22288 gene locus_tag LOCUS_23540 22998 22288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23540 23639 23890 gene locus_tag LOCUS_23550 23639 23890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23550 24958 26025 gene locus_tag LOCUS_23560 24958 26025 CDS product NADH:flavin oxidoreductase/NADH oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143817.1 protein_id gnl|my_center|LOCUS_23560 26160 26990 gene locus_tag LOCUS_23570 26160 26990 CDS product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143390.1 protein_id gnl|my_center|LOCUS_23570 26944 27273 gene locus_tag LOCUS_23580 26944 27273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23580 27366 27605 gene locus_tag LOCUS_23590 27366 27605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23590 27901 28245 gene locus_tag LOCUS_23600 27901 28245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23600 28238 28669 gene locus_tag LOCUS_23610 28238 28669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23610 28846 30318 gene locus_tag LOCUS_23620 gene dacB 28846 30318 CDS product D-alanyl-D-alanine carboxypeptidase/D-alanyl-D-alanine-endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057215.1 protein_id gnl|my_center|LOCUS_23620 30588 30304 gene locus_tag LOCUS_23630 30588 30304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23630 31409 30588 gene locus_tag LOCUS_23640 31409 30588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23640 32055 31528 gene locus_tag LOCUS_23650 32055 31528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23650 33478 32270 gene locus_tag LOCUS_23660 33478 32270 CDS product DNA double-strand break repair nuclease NurA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144027.1 protein_id gnl|my_center|LOCUS_23660 34342 33557 gene locus_tag LOCUS_23670 34342 33557 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142041.1 protein_id gnl|my_center|LOCUS_23670 34709 35353 gene locus_tag LOCUS_23680 34709 35353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23680 36384 35533 gene locus_tag LOCUS_23690 36384 35533 CDS product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929260.1 protein_id gnl|my_center|LOCUS_23690 37287 36442 gene locus_tag LOCUS_23700 37287 36442 CDS product metal ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143302.1 protein_id gnl|my_center|LOCUS_23700 37489 38415 gene locus_tag LOCUS_23710 37489 38415 CDS product zinc ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197530028.1 protein_id gnl|my_center|LOCUS_23710 38826 39917 gene locus_tag LOCUS_23720 38826 39917 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057430.1 protein_id gnl|my_center|LOCUS_23720 41779 41072 gene locus_tag LOCUS_23730 41779 41072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23730 43079 41838 gene locus_tag LOCUS_23740 gene tnpB 43079 41838 CDS product IS200/IS605 family element RNA-guided endonuclease TnpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_054297574.1 protein_id gnl|my_center|LOCUS_23740 43839 45209 gene locus_tag LOCUS_23750 43839 45209 CDS product DUF697 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057130.1 protein_id gnl|my_center|LOCUS_23750 46113 45229 gene locus_tag LOCUS_23760 gene ylqF 46113 45229 CDS product ribosome biogenesis GTPase YlqF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057347.1 protein_id gnl|my_center|LOCUS_23760 46705 46334 gene locus_tag LOCUS_23770 46705 46334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23770 47622 46759 gene locus_tag LOCUS_23780 47622 46759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23780 48394 47846 gene locus_tag LOCUS_23790 48394 47846 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892027.1 protein_id gnl|my_center|LOCUS_23790 49248 48400 gene locus_tag LOCUS_23800 gene fdhD 49248 48400 CDS product formate dehydrogenase accessory sulfurtransferase FdhD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031006.1 protein_id gnl|my_center|LOCUS_23800 50834 49497 gene locus_tag LOCUS_23810 50834 49497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23810 52187 54166 gene locus_tag LOCUS_23820 52187 54166 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929287.1 protein_id gnl|my_center|LOCUS_23820 54498 56006 gene locus_tag LOCUS_23830 54498 56006 CDS product SulP family inorganic anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234986.1 protein_id gnl|my_center|LOCUS_23830 56659 60618 gene locus_tag LOCUS_23840 56659 60618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23840 61561 61890 gene locus_tag LOCUS_23850 61561 61890 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015154861.1 protein_id gnl|my_center|LOCUS_23850 62237 63391 gene locus_tag LOCUS_23860 gene arsB 62237 63391 CDS product ACR3 family arsenite efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118066.1 protein_id gnl|my_center|LOCUS_23860 63404 64072 gene locus_tag LOCUS_23870 gene arsH 63404 64072 CDS product arsenical resistance protein ArsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928410.1 protein_id gnl|my_center|LOCUS_23870 64053 64514 gene locus_tag LOCUS_23880 gene arsC 64053 64514 CDS product arsenate reductase, glutathione/glutaredoxin type inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140008.1 protein_id gnl|my_center|LOCUS_23880 65703 64768 gene locus_tag LOCUS_23890 65703 64768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23890 65756 66532 gene locus_tag LOCUS_23900 65756 66532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23900 66561 67604 gene locus_tag LOCUS_23910 66561 67604 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810382.1 protein_id gnl|my_center|LOCUS_23910 67608 69026 gene locus_tag LOCUS_23920 67608 69026 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005098467.1 protein_id gnl|my_center|LOCUS_23920 69929 69135 gene locus_tag LOCUS_23930 69929 69135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23930 70322 71788 gene locus_tag LOCUS_23940 gene allB 70322 71788 CDS product allantoinase AllB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002399799.1 protein_id gnl|my_center|LOCUS_23940 72098 72544 gene locus_tag LOCUS_23950 72098 72544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23950 72805 74193 gene locus_tag LOCUS_23960 gene hisS 72805 74193 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036976.1 protein_id gnl|my_center|LOCUS_23960 74430 75335 gene locus_tag LOCUS_23970 74430 75335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23970 75493 76500 gene locus_tag LOCUS_23980 75493 76500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23980 76539 76931 gene locus_tag LOCUS_23990 76539 76931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23990 77408 76944 gene locus_tag LOCUS_24000 77408 76944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24000 77726 77487 gene locus_tag LOCUS_24010 77726 77487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24010 >Feature sequence026 998 474 gene locus_tag LOCUS_24020 998 474 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921042.1 protein_id gnl|my_center|LOCUS_24020 1960 1139 gene locus_tag LOCUS_24030 1960 1139 CDS product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142777.1 protein_id gnl|my_center|LOCUS_24030 2329 1973 gene locus_tag LOCUS_24040 gene rplT 2329 1973 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125971.1 protein_id gnl|my_center|LOCUS_24040 2549 2352 gene locus_tag LOCUS_24050 gene rpmI 2549 2352 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125970.1 protein_id gnl|my_center|LOCUS_24050 2623 2976 gene locus_tag LOCUS_24060 2623 2976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24060 2991 3245 gene locus_tag LOCUS_24070 2991 3245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24070 3917 3396 gene locus_tag LOCUS_24080 3917 3396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24080 6356 4041 gene locus_tag LOCUS_24090 6356 4041 CDS product ATP-dependent helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056167.1 protein_id gnl|my_center|LOCUS_24090 6629 8362 gene locus_tag LOCUS_24100 6629 8362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24100 8624 10924 gene locus_tag LOCUS_24110 8624 10924 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971984.1 protein_id gnl|my_center|LOCUS_24110 10931 11410 gene locus_tag LOCUS_24120 10931 11410 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259372.1 protein_id gnl|my_center|LOCUS_24120 11413 14712 gene locus_tag LOCUS_24130 11413 14712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24130 14742 15863 gene locus_tag LOCUS_24140 14742 15863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24140 16372 22440 gene locus_tag LOCUS_24150 16372 22440 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000686845.1 protein_id gnl|my_center|LOCUS_24150 22593 23165 gene locus_tag LOCUS_24160 gene lepB 22593 23165 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056260.1 protein_id gnl|my_center|LOCUS_24160 23786 23253 gene locus_tag LOCUS_24170 23786 23253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24170 24174 23809 gene locus_tag LOCUS_24180 24174 23809 CDS product TM2 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143142.1 protein_id gnl|my_center|LOCUS_24180 24601 24924 gene locus_tag LOCUS_24190 24601 24924 CDS product DUF1825 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057879.1 protein_id gnl|my_center|LOCUS_24190 26906 24981 gene locus_tag LOCUS_24200 26906 24981 CDS product penicillin-binding protein 1A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099797673.1 protein_id gnl|my_center|LOCUS_24200 27082 28251 gene locus_tag LOCUS_24210 gene tyrS 27082 28251 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055905.1 protein_id gnl|my_center|LOCUS_24210 28432 29145 gene locus_tag LOCUS_24220 gene pyrF 28432 29145 CDS product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141657.1 protein_id gnl|my_center|LOCUS_24220 29142 29789 gene locus_tag LOCUS_24230 29142 29789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24230 30036 29722 gene locus_tag LOCUS_24240 30036 29722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24240 30965 30279 gene locus_tag LOCUS_24250 30965 30279 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142403.1 protein_id gnl|my_center|LOCUS_24250 31646 32176 gene locus_tag LOCUS_24260 31646 32176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24260 32543 33739 gene locus_tag LOCUS_24270 32543 33739 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546471.1 protein_id gnl|my_center|LOCUS_24270 34580 33810 gene locus_tag LOCUS_24280 34580 33810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24280 37880 35268 gene locus_tag LOCUS_24290 gene priA 37880 35268 CDS product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920687.1 protein_id gnl|my_center|LOCUS_24290 39081 40250 gene locus_tag LOCUS_24300 gene rpoD 39081 40250 CDS product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920727.1 protein_id gnl|my_center|LOCUS_24300 40446 40940 gene locus_tag LOCUS_24310 40446 40940 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928842.1 protein_id gnl|my_center|LOCUS_24310 41528 43636 gene locus_tag LOCUS_24320 41528 43636 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142114.1 protein_id gnl|my_center|LOCUS_24320 43678 43983 gene locus_tag LOCUS_24330 43678 43983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24330 43952 44137 gene locus_tag LOCUS_24340 43952 44137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24340 44492 44749 gene locus_tag LOCUS_24350 44492 44749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24350 45638 44751 gene locus_tag LOCUS_24360 gene truB 45638 44751 CDS product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057445.1 protein_id gnl|my_center|LOCUS_24360 47520 45913 gene locus_tag LOCUS_24370 47520 45913 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920921.1 protein_id gnl|my_center|LOCUS_24370 49455 47905 gene locus_tag LOCUS_24380 49455 47905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24380 50019 49543 gene locus_tag LOCUS_24390 50019 49543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24390 52235 50085 gene locus_tag LOCUS_24400 52235 50085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24400 52372 52761 gene locus_tag LOCUS_24410 52372 52761 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014497752.1 protein_id gnl|my_center|LOCUS_24410 52754 53083 gene locus_tag LOCUS_24420 52754 53083 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084909.1 protein_id gnl|my_center|LOCUS_24420 54096 53236 gene locus_tag LOCUS_24430 54096 53236 CDS product protochlorophyllide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056423.1 protein_id gnl|my_center|LOCUS_24430 55546 54371 gene locus_tag LOCUS_24440 55546 54371 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674457.1 protein_id gnl|my_center|LOCUS_24440 55947 57896 gene locus_tag LOCUS_24450 55947 57896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24450 58867 58094 gene locus_tag LOCUS_24460 58867 58094 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937416.1 protein_id gnl|my_center|LOCUS_24460 59106 59987 gene locus_tag LOCUS_24470 59106 59987 CDS product basic amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392640.1 protein_id gnl|my_center|LOCUS_24470 60079 60795 gene locus_tag LOCUS_24480 60079 60795 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392641.1 protein_id gnl|my_center|LOCUS_24480 61055 61864 gene locus_tag LOCUS_24490 61055 61864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24490 61971 62708 gene locus_tag LOCUS_24500 61971 62708 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242574.1 protein_id gnl|my_center|LOCUS_24500 64153 62846 gene locus_tag LOCUS_24510 gene tyrP 64153 62846 CDS product tyrosine transporter TyrP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000797560.1 protein_id gnl|my_center|LOCUS_24510 65740 64343 gene locus_tag LOCUS_24520 65740 64343 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928961.1 protein_id gnl|my_center|LOCUS_24520 66752 65871 gene locus_tag LOCUS_24530 66752 65871 CDS product aspartoacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124406.1 protein_id gnl|my_center|LOCUS_24530 67159 66929 gene locus_tag LOCUS_24540 67159 66929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24540 67488 67201 gene locus_tag LOCUS_24550 67488 67201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24550 67873 69297 gene locus_tag LOCUS_24560 67873 69297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24560 69294 69737 gene locus_tag LOCUS_24570 69294 69737 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943873.1 protein_id gnl|my_center|LOCUS_24570 69751 72045 gene locus_tag LOCUS_24580 69751 72045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24580 73292 72498 gene locus_tag LOCUS_24590 73292 72498 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404373.1 protein_id gnl|my_center|LOCUS_24590 73397 74356 gene locus_tag LOCUS_24600 73397 74356 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143349.1 protein_id gnl|my_center|LOCUS_24600 75427 74738 gene locus_tag LOCUS_24610 75427 74738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24610 75617 76402 gene locus_tag LOCUS_24620 75617 76402 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229587.1 protein_id gnl|my_center|LOCUS_24620 76708 77094 gene locus_tag LOCUS_24630 76708 77094 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023172237.1 protein_id gnl|my_center|LOCUS_24630 >Feature sequence027 142 774 gene locus_tag LOCUS_24640 142 774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24640 1113 1451 gene locus_tag LOCUS_24650 1113 1451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24650 1750 2328 gene locus_tag LOCUS_24660 1750 2328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24660 2798 4084 gene locus_tag LOCUS_24670 2798 4084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24670 4706 4146 gene locus_tag LOCUS_24680 4706 4146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24680 5423 4923 gene locus_tag LOCUS_24690 5423 4923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24690 5718 5488 gene locus_tag LOCUS_24700 5718 5488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24700 7685 6354 gene locus_tag LOCUS_24710 7685 6354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24710 9242 7725 gene locus_tag LOCUS_24720 9242 7725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24720 11420 9384 gene locus_tag LOCUS_24730 11420 9384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24730 11744 11442 gene locus_tag LOCUS_24740 11744 11442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24740 13109 11760 gene locus_tag LOCUS_24750 13109 11760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24750 15744 13726 gene locus_tag LOCUS_24760 15744 13726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24760 16502 16080 gene locus_tag LOCUS_24770 16502 16080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24770 17081 16575 gene locus_tag LOCUS_24780 17081 16575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24780 17802 19382 gene locus_tag LOCUS_24790 gene serA 17802 19382 CDS product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056180.1 protein_id gnl|my_center|LOCUS_24790 19460 20383 gene locus_tag LOCUS_24800 gene prmA 19460 20383 CDS product 50S ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056181.1 protein_id gnl|my_center|LOCUS_24800 20798 21250 gene locus_tag LOCUS_24810 20798 21250 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056717.1 protein_id gnl|my_center|LOCUS_24810 21569 22933 gene locus_tag LOCUS_24820 21569 22933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399369.1 protein_id gnl|my_center|LOCUS_24820 24168 23089 gene locus_tag LOCUS_24830 gene ugpC 24168 23089 CDS product sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004079960.1 protein_id gnl|my_center|LOCUS_24830 25171 24290 gene locus_tag LOCUS_24840 25171 24290 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173998.1 protein_id gnl|my_center|LOCUS_24840 26103 25198 gene locus_tag LOCUS_24850 26103 25198 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173997.1 protein_id gnl|my_center|LOCUS_24850 27469 26156 gene locus_tag LOCUS_24860 27469 26156 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173996.1 protein_id gnl|my_center|LOCUS_24860 27966 28151 gene locus_tag LOCUS_24870 27966 28151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24870 28438 31023 gene locus_tag LOCUS_24880 28438 31023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24880 31267 31947 gene locus_tag LOCUS_24890 31267 31947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24890 32105 33238 gene locus_tag LOCUS_24900 32105 33238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24900 33428 34927 gene locus_tag LOCUS_24910 33428 34927 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000649908.1 protein_id gnl|my_center|LOCUS_24910 34920 35654 gene locus_tag LOCUS_24920 34920 35654 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000590223.1 protein_id gnl|my_center|LOCUS_24920 36273 35713 gene locus_tag LOCUS_24930 36273 35713 CDS product DUF2808 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143972.1 protein_id gnl|my_center|LOCUS_24930 36551 37036 gene locus_tag LOCUS_24940 36551 37036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24940 37388 37089 gene locus_tag LOCUS_24950 37388 37089 CDS product TMEM165/GDT1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055881.1 protein_id gnl|my_center|LOCUS_24950 37831 37406 gene locus_tag LOCUS_24960 37831 37406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24960 38612 39418 gene locus_tag LOCUS_24970 38612 39418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24970 39740 40795 gene locus_tag LOCUS_24980 39740 40795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24980 41507 41157 gene locus_tag LOCUS_24990 41507 41157 CDS product YkgJ family cysteine cluster protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056500.1 protein_id gnl|my_center|LOCUS_24990 43883 41961 gene locus_tag LOCUS_25000 43883 41961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25000 43991 44212 gene locus_tag LOCUS_25010 43991 44212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25010 44287 44706 gene locus_tag LOCUS_25020 44287 44706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25020 44792 46786 gene locus_tag LOCUS_25030 44792 46786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25030 46846 47808 gene locus_tag LOCUS_25040 46846 47808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25040 47838 48815 gene locus_tag LOCUS_25050 47838 48815 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526405.1 protein_id gnl|my_center|LOCUS_25050 48812 49906 gene locus_tag LOCUS_25060 48812 49906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25060 49903 51885 gene locus_tag LOCUS_25070 49903 51885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25070 52138 52980 gene locus_tag LOCUS_25080 52138 52980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25080 53065 53415 gene locus_tag LOCUS_25090 53065 53415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25090 53412 54470 gene locus_tag LOCUS_25100 53412 54470 CDS product RNA-directed DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680154.1 protein_id gnl|my_center|LOCUS_25100 55937 55011 gene locus_tag LOCUS_25110 55937 55011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25110 56156 56401 gene locus_tag LOCUS_25120 56156 56401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25120 56867 59338 gene locus_tag LOCUS_25130 56867 59338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25130 59937 59446 gene locus_tag LOCUS_25140 59937 59446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25140 59948 60235 gene locus_tag LOCUS_25150 59948 60235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25150 61983 60676 gene locus_tag LOCUS_25160 gene sbcD 61983 60676 CDS product exonuclease subunit SbcD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057812.1 protein_id gnl|my_center|LOCUS_25160 63060 62032 gene locus_tag LOCUS_25170 63060 62032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25170 64240 63515 gene locus_tag LOCUS_25180 gene cysH 64240 63515 CDS product phosphoadenosine phosphosulfate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099798830.1 protein_id gnl|my_center|LOCUS_25180 64808 65089 gene locus_tag LOCUS_25190 64808 65089 CDS product glutaredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056266.1 protein_id gnl|my_center|LOCUS_25190 65667 66773 gene locus_tag LOCUS_25200 65667 66773 CDS product galactokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548167.1 protein_id gnl|my_center|LOCUS_25200 66760 67644 gene locus_tag LOCUS_25210 gene galU 66760 67644 CDS product UTP--glucose-1-phosphate uridylyltransferase GalU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721495.1 protein_id gnl|my_center|LOCUS_25210 68405 67782 gene locus_tag LOCUS_25220 68405 67782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25220 68602 69999 gene locus_tag LOCUS_25230 68602 69999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25230 70395 70147 gene locus_tag LOCUS_25240 70395 70147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25240 70688 71827 gene locus_tag LOCUS_25250 70688 71827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25250 72010 72240 gene locus_tag LOCUS_25260 72010 72240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25260 72218 72655 gene locus_tag LOCUS_25270 72218 72655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25270 73150 73497 gene locus_tag LOCUS_25280 73150 73497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25280 74733 74128 gene locus_tag LOCUS_25290 74733 74128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25290 76012 74726 gene locus_tag LOCUS_25300 76012 74726 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009994245.1 protein_id gnl|my_center|LOCUS_25300 76188 77222 gene locus_tag LOCUS_25310 76188 77222 CDS product RelA/SpoT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943079.1 protein_id gnl|my_center|LOCUS_25310 >Feature sequence028 211 483 gene locus_tag LOCUS_25320 211 483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25320 571 816 gene locus_tag LOCUS_25330 571 816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25330 1327 2508 gene locus_tag LOCUS_25340 1327 2508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25340 2535 3638 gene locus_tag LOCUS_25350 2535 3638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25350 3635 4651 gene locus_tag LOCUS_25360 3635 4651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25360 4695 5471 gene locus_tag LOCUS_25370 4695 5471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25370 6027 7082 gene locus_tag LOCUS_25380 6027 7082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25380 7184 10801 gene locus_tag LOCUS_25390 7184 10801 CDS product GLUG motif-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113036.1 protein_id gnl|my_center|LOCUS_25390 10966 13515 gene locus_tag LOCUS_25400 10966 13515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25400 14273 13752 gene locus_tag LOCUS_25410 14273 13752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141199.1 protein_id gnl|my_center|LOCUS_25410 14591 14274 gene locus_tag LOCUS_25420 14591 14274 CDS product DUF1778 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141200.1 protein_id gnl|my_center|LOCUS_25420 15350 14661 gene locus_tag LOCUS_25430 15350 14661 CDS product DUF928 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057555.1 protein_id gnl|my_center|LOCUS_25430 17886 15529 gene locus_tag LOCUS_25440 17886 15529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25440 18838 17876 gene locus_tag LOCUS_25450 18838 17876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25450 19412 18873 gene locus_tag LOCUS_25460 19412 18873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25460 20313 19804 gene locus_tag LOCUS_25470 20313 19804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25470 20994 20554 gene locus_tag LOCUS_25480 20994 20554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197530034.1 protein_id gnl|my_center|LOCUS_25480 21691 22734 gene locus_tag LOCUS_25490 21691 22734 CDS product BMP family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011054139.1 protein_id gnl|my_center|LOCUS_25490 22957 24429 gene locus_tag LOCUS_25500 22957 24429 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262223.1 protein_id gnl|my_center|LOCUS_25500 24584 25648 gene locus_tag LOCUS_25510 24584 25648 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082660.1 protein_id gnl|my_center|LOCUS_25510 25788 26309 gene locus_tag LOCUS_25520 25788 26309 CDS product DUF1772 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975889.1 protein_id gnl|my_center|LOCUS_25520 26892 26482 gene locus_tag LOCUS_25530 26892 26482 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082839.1 protein_id gnl|my_center|LOCUS_25530 27454 28662 gene locus_tag LOCUS_25540 27454 28662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25540 28924 29859 gene locus_tag LOCUS_25550 28924 29859 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583516.1 protein_id gnl|my_center|LOCUS_25550 30465 30854 gene locus_tag LOCUS_25560 30465 30854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25560 31419 30829 gene locus_tag LOCUS_25570 31419 30829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25570 32354 31776 gene locus_tag LOCUS_25580 gene upp 32354 31776 CDS product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947952.1 protein_id gnl|my_center|LOCUS_25580 33934 32675 gene locus_tag LOCUS_25590 33934 32675 CDS product URC4/urg3 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444165.1 protein_id gnl|my_center|LOCUS_25590 35331 34072 gene locus_tag LOCUS_25600 35331 34072 CDS product GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729093.1 protein_id gnl|my_center|LOCUS_25600 35749 36219 gene locus_tag LOCUS_25610 35749 36219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25610 36341 36544 gene locus_tag LOCUS_25620 36341 36544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_25620 36913 37113 gene locus_tag LOCUS_25630 36913 37113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_25630 37193 37666 gene locus_tag LOCUS_25640 37193 37666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25640 37825 39210 gene locus_tag LOCUS_25650 37825 39210 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531130.1 protein_id gnl|my_center|LOCUS_25650 39408 40454 gene locus_tag LOCUS_25660 gene rtcA 39408 40454 CDS product RNA 3'-terminal phosphate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878932.1 protein_id gnl|my_center|LOCUS_25660 40606 41709 gene locus_tag LOCUS_25670 40606 41709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25670 41850 42923 gene locus_tag LOCUS_25680 41850 42923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25680 45066 43222 gene locus_tag LOCUS_25690 gene ilvD 45066 43222 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084436.1 protein_id gnl|my_center|LOCUS_25690 46319 45828 gene locus_tag LOCUS_25700 gene ruvC 46319 45828 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_190407846.1 protein_id gnl|my_center|LOCUS_25700 46496 47863 gene locus_tag LOCUS_25710 46496 47863 CDS product YvcK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920957.1 protein_id gnl|my_center|LOCUS_25710 48000 48464 gene locus_tag LOCUS_25720 gene tsaE 48000 48464 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393647.1 protein_id gnl|my_center|LOCUS_25720 50665 49343 gene locus_tag LOCUS_25730 50665 49343 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056513.1 protein_id gnl|my_center|LOCUS_25730 50960 51607 gene locus_tag LOCUS_25740 gene lepB 50960 51607 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920934.1 protein_id gnl|my_center|LOCUS_25740 52918 51662 gene locus_tag LOCUS_25750 52918 51662 CDS product CCA tRNA nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056562.1 protein_id gnl|my_center|LOCUS_25750 53026 53274 gene locus_tag LOCUS_25760 53026 53274 CDS product Ycf34 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058288.1 protein_id gnl|my_center|LOCUS_25760 53413 54081 gene locus_tag LOCUS_25770 gene tsaB 53413 54081 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929495.1 protein_id gnl|my_center|LOCUS_25770 54056 54277 gene locus_tag LOCUS_25780 54056 54277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25780 54779 56245 gene locus_tag LOCUS_25790 54779 56245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25790 56393 57316 gene locus_tag LOCUS_25800 56393 57316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25800 58767 57505 gene locus_tag LOCUS_25810 58767 57505 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057168.1 protein_id gnl|my_center|LOCUS_25810 58952 59968 gene locus_tag LOCUS_25820 58952 59968 CDS product potassium channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140935.1 protein_id gnl|my_center|LOCUS_25820 60066 61211 gene locus_tag LOCUS_25830 60066 61211 CDS product NAD-dependent epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141070.1 protein_id gnl|my_center|LOCUS_25830 61799 61239 gene locus_tag LOCUS_25840 61799 61239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25840 62504 62298 gene locus_tag LOCUS_25850 62504 62298 CDS product glycogen debranching protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921159.1 protein_id gnl|my_center|LOCUS_25850 64037 63288 gene locus_tag LOCUS_25860 64037 63288 CDS product DevA family ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056490.1 protein_id gnl|my_center|LOCUS_25860 64904 64074 gene locus_tag LOCUS_25870 64904 64074 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970686.1 protein_id gnl|my_center|LOCUS_25870 66115 64946 gene locus_tag LOCUS_25880 gene devC 66115 64946 CDS product ABC transporter permease DevC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141427.1 protein_id gnl|my_center|LOCUS_25880 66524 66195 gene locus_tag LOCUS_25890 66524 66195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25890 68091 66808 gene locus_tag LOCUS_25900 68091 66808 CDS product ABC exporter membrane fusion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056492.1 protein_id gnl|my_center|LOCUS_25900 68701 68135 gene locus_tag LOCUS_25910 68701 68135 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001124477.1 protein_id gnl|my_center|LOCUS_25910 68833 69621 gene locus_tag LOCUS_25920 68833 69621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229185.1 protein_id gnl|my_center|LOCUS_25920 69885 72920 gene locus_tag LOCUS_25930 69885 72920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25930 74176 72965 gene locus_tag LOCUS_25940 74176 72965 CDS product RNA-guided endonuclease TnpB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254458.1 protein_id gnl|my_center|LOCUS_25940 74234 74419 gene locus_tag LOCUS_25950 74234 74419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25950 74916 74623 gene locus_tag LOCUS_25960 74916 74623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25960 75529 75002 gene locus_tag LOCUS_25970 75529 75002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_25970 75866 75561 gene locus_tag LOCUS_25980 75866 75561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_25980 76019 76882 gene locus_tag LOCUS_25990 76019 76882 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226695.1 protein_id gnl|my_center|LOCUS_25990 >Feature sequence029 198 1277 gene locus_tag LOCUS_26000 198 1277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26000 1932 3461 gene locus_tag LOCUS_26010 1932 3461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26010 4616 3639 gene locus_tag LOCUS_26020 4616 3639 CDS product carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140505.1 protein_id gnl|my_center|LOCUS_26020 5065 5334 gene locus_tag LOCUS_26030 5065 5334 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057702.1 protein_id gnl|my_center|LOCUS_26030 5786 6442 gene locus_tag LOCUS_26040 5786 6442 CDS product DUF6391 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140118.1 protein_id gnl|my_center|LOCUS_26040 6723 7751 gene locus_tag LOCUS_26050 gene rfaE1 6723 7751 CDS product D-glycero-beta-D-manno-heptose-7-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057610.1 protein_id gnl|my_center|LOCUS_26050 8066 7824 gene locus_tag LOCUS_26060 8066 7824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26060 8269 8802 gene locus_tag LOCUS_26070 8269 8802 CDS product Ycf51 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056935.1 protein_id gnl|my_center|LOCUS_26070 9355 8867 gene locus_tag LOCUS_26080 9355 8867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26080 9617 10840 gene locus_tag LOCUS_26090 9617 10840 CDS product iron-containing alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197524107.1 protein_id gnl|my_center|LOCUS_26090 10946 12130 gene locus_tag LOCUS_26100 10946 12130 CDS product aspartate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057885.1 protein_id gnl|my_center|LOCUS_26100 12448 13494 gene locus_tag LOCUS_26110 12448 13494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26110 14236 13550 gene locus_tag LOCUS_26120 14236 13550 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141809.1 protein_id gnl|my_center|LOCUS_26120 14496 15140 gene locus_tag LOCUS_26130 gene hisG 14496 15140 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056035.1 protein_id gnl|my_center|LOCUS_26130 15156 15860 gene locus_tag LOCUS_26140 15156 15860 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119492.1 protein_id gnl|my_center|LOCUS_26140 16456 15899 gene locus_tag LOCUS_26150 16456 15899 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_166172348.1 protein_id gnl|my_center|LOCUS_26150 16682 19210 gene locus_tag LOCUS_26160 16682 19210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26160 19207 19650 gene locus_tag LOCUS_26170 19207 19650 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143422.1 protein_id gnl|my_center|LOCUS_26170 19715 21964 gene locus_tag LOCUS_26180 19715 21964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26180 22486 21977 gene locus_tag LOCUS_26190 22486 21977 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001101141.1 protein_id gnl|my_center|LOCUS_26190 22609 24489 gene locus_tag LOCUS_26200 22609 24489 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056407.1 protein_id gnl|my_center|LOCUS_26200 25735 24749 gene locus_tag LOCUS_26210 25735 24749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26210 27109 27852 gene locus_tag LOCUS_26220 27109 27852 CDS product Mut7-C RNAse domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080909.1 protein_id gnl|my_center|LOCUS_26220 28054 27824 gene locus_tag LOCUS_26230 28054 27824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26230 28281 28057 gene locus_tag LOCUS_26240 28281 28057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26240 29515 28406 gene locus_tag LOCUS_26250 gene proB 29515 28406 CDS product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057952.1 protein_id gnl|my_center|LOCUS_26250 30717 30160 gene locus_tag LOCUS_26260 30717 30160 CDS product YqeG family HAD IIIA-type phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056346.1 protein_id gnl|my_center|LOCUS_26260 31881 30805 gene locus_tag LOCUS_26270 gene mltG 31881 30805 CDS product endolytic transglycosylase MltG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141130.1 protein_id gnl|my_center|LOCUS_26270 32538 31966 gene locus_tag LOCUS_26280 32538 31966 CDS product DUF3727 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057704.1 protein_id gnl|my_center|LOCUS_26280 33242 32673 gene locus_tag LOCUS_26290 gene ruvX 33242 32673 CDS product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058162.1 protein_id gnl|my_center|LOCUS_26290 34505 33249 gene locus_tag LOCUS_26300 34505 33249 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143371.1 protein_id gnl|my_center|LOCUS_26300 34895 34695 gene locus_tag LOCUS_26310 34895 34695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26310 37133 35541 gene locus_tag LOCUS_26320 37133 35541 CDS product B12-binding domain-containing radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144225.1 protein_id gnl|my_center|LOCUS_26320 38145 38987 gene locus_tag LOCUS_26330 38145 38987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26330 39535 40650 gene locus_tag LOCUS_26340 39535 40650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26340 41742 40783 gene locus_tag LOCUS_26350 41742 40783 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056589.1 protein_id gnl|my_center|LOCUS_26350 42941 41886 gene locus_tag LOCUS_26360 gene hemE 42941 41886 CDS product uroporphyrinogen decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125231.1 protein_id gnl|my_center|LOCUS_26360 43878 45944 gene locus_tag LOCUS_26370 43878 45944 CDS product oligopeptidase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140133.1 protein_id gnl|my_center|LOCUS_26370 46130 45993 gene locus_tag LOCUS_26380 46130 45993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26380 46270 46533 gene locus_tag LOCUS_26390 46270 46533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26390 47540 46614 gene locus_tag LOCUS_26400 47540 46614 CDS product LD-carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055901.1 protein_id gnl|my_center|LOCUS_26400 48722 47649 gene locus_tag LOCUS_26410 48722 47649 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_106290870.1 protein_id gnl|my_center|LOCUS_26410 53511 49012 gene locus_tag LOCUS_26420 53511 49012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26420 55060 53894 gene locus_tag LOCUS_26430 55060 53894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26430 56412 55186 gene locus_tag LOCUS_26440 56412 55186 CDS product RNA-guided endonuclease TnpB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041233550.1 protein_id gnl|my_center|LOCUS_26440 57694 56798 gene locus_tag LOCUS_26450 57694 56798 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056617.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_26450 57693 57926 gene locus_tag LOCUS_26460 57693 57926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26460 58878 58387 gene locus_tag LOCUS_26470 58878 58387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26470 59389 58805 gene locus_tag LOCUS_26480 59389 58805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_26480 59672 60181 gene locus_tag LOCUS_26490 59672 60181 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000582845.1 protein_id gnl|my_center|LOCUS_26490 60191 60388 gene locus_tag LOCUS_26500 60191 60388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26500 62082 60436 gene locus_tag LOCUS_26510 62082 60436 CDS product Ppx/GppA phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057517.1 protein_id gnl|my_center|LOCUS_26510 62324 63238 gene locus_tag LOCUS_26520 62324 63238 CDS product 4-hydroxybenzoate solanesyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143417.1 protein_id gnl|my_center|LOCUS_26520 63391 63996 gene locus_tag LOCUS_26530 63391 63996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26530 64119 64610 gene locus_tag LOCUS_26540 64119 64610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26540 65697 64633 gene locus_tag LOCUS_26550 65697 64633 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143057.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_26550 66015 65731 gene locus_tag LOCUS_26560 66015 65731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26560 66682 66041 gene locus_tag LOCUS_26570 66682 66041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26570 67688 66630 gene locus_tag LOCUS_26580 67688 66630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26580 68513 67809 gene locus_tag LOCUS_26590 68513 67809 CDS product NADH dehydrogenase subunit K inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140751.1 protein_id gnl|my_center|LOCUS_26590 68779 69432 gene locus_tag LOCUS_26600 68779 69432 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_140158357.1 protein_id gnl|my_center|LOCUS_26600 69598 73299 gene locus_tag LOCUS_26610 69598 73299 CDS product NB-ARC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144339.1 protein_id gnl|my_center|LOCUS_26610 74690 73347 gene locus_tag LOCUS_26620 74690 73347 CDS product 2Fe-2S iron-sulfur cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530417.1 protein_id gnl|my_center|LOCUS_26620 75252 74755 gene locus_tag LOCUS_26630 75252 74755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26630 >Feature sequence030 799 110 gene locus_tag LOCUS_26640 799 110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26640 783 926 gene locus_tag LOCUS_26650 783 926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26650 1874 1239 gene locus_tag LOCUS_26660 gene dhaL 1874 1239 CDS product dihydroxyacetone kinase subunit DhaL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257203.1 protein_id gnl|my_center|LOCUS_26660 2951 1878 gene locus_tag LOCUS_26670 gene dhaK 2951 1878 CDS product dihydroxyacetone kinase subunit DhaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938278.1 protein_id gnl|my_center|LOCUS_26670 3581 4405 gene locus_tag LOCUS_26680 3581 4405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26680 4878 5234 gene locus_tag LOCUS_26690 4878 5234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26690 5899 5318 gene locus_tag LOCUS_26700 5899 5318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26700 6325 6017 gene locus_tag LOCUS_26710 6325 6017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26710 8703 6397 gene locus_tag LOCUS_26720 8703 6397 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056504.1 protein_id gnl|my_center|LOCUS_26720 9929 9009 gene locus_tag LOCUS_26730 9929 9009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26730 11139 9889 gene locus_tag LOCUS_26740 11139 9889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26740 11767 11234 gene locus_tag LOCUS_26750 gene def 11767 11234 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071316.1 protein_id gnl|my_center|LOCUS_26750 13322 12096 gene locus_tag LOCUS_26760 13322 12096 CDS product HhoA/HhoB/HtrA family serine endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056518.1 protein_id gnl|my_center|LOCUS_26760 13497 14873 gene locus_tag LOCUS_26770 gene dnaA 13497 14873 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056451.1 protein_id gnl|my_center|LOCUS_26770 15264 16427 gene locus_tag LOCUS_26780 gene dnaN 15264 16427 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124156.1 protein_id gnl|my_center|LOCUS_26780 17764 16586 gene locus_tag LOCUS_26790 17764 16586 CDS product TRC40/GET3/ArsA family transport-energizing ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057679.1 protein_id gnl|my_center|LOCUS_26790 18197 17808 gene locus_tag LOCUS_26800 18197 17808 CDS product DUF2358 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929025.1 protein_id gnl|my_center|LOCUS_26800 19701 19084 gene locus_tag LOCUS_26810 19701 19084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929368.1 protein_id gnl|my_center|LOCUS_26810 20743 19802 gene locus_tag LOCUS_26820 20743 19802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26820 20794 21033 gene locus_tag LOCUS_26830 20794 21033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26830 22404 21127 gene locus_tag LOCUS_26840 22404 21127 CDS product DUF4912 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057902.1 protein_id gnl|my_center|LOCUS_26840 23765 22899 gene locus_tag LOCUS_26850 23765 22899 CDS product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056403.1 protein_id gnl|my_center|LOCUS_26850 26572 24224 gene locus_tag LOCUS_26860 26572 24224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26860 26820 26596 gene locus_tag LOCUS_26870 26820 26596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26870 27299 28336 gene locus_tag LOCUS_26880 gene pdhA 27299 28336 CDS product pyruvate dehydrogenase (acetyl-transferring) E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057011.1 protein_id gnl|my_center|LOCUS_26880 28486 29322 gene locus_tag LOCUS_26890 28486 29322 CDS product aldose epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920915.1 protein_id gnl|my_center|LOCUS_26890 29383 29454 gene locus_tag LOCUS_t00200 29383 29454 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 29726 30805 gene locus_tag LOCUS_26900 gene fba 29726 30805 CDS product fructose-bisphosphate aldolase class II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056231.1 protein_id gnl|my_center|LOCUS_26900 32744 30897 gene locus_tag LOCUS_26910 32744 30897 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928942.1 protein_id gnl|my_center|LOCUS_26910 33916 33098 gene locus_tag LOCUS_26920 33916 33098 CDS product carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056764.1 protein_id gnl|my_center|LOCUS_26920 35013 38258 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gttacaatttctacgaatccctattagggattgaaac 39408 38341 gene locus_tag LOCUS_26930 39408 38341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26930 40453 39734 gene locus_tag LOCUS_26940 40453 39734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26940 41861 40602 gene locus_tag LOCUS_26950 41861 40602 CDS product M28 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929074.1 protein_id gnl|my_center|LOCUS_26950 42384 41893 gene locus_tag LOCUS_26960 42384 41893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141315.1 protein_id gnl|my_center|LOCUS_26960 42791 42384 gene locus_tag LOCUS_26970 42791 42384 CDS product DUF6152 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928747.1 protein_id gnl|my_center|LOCUS_26970 43215 42832 gene locus_tag LOCUS_26980 43215 42832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26980 44749 43469 gene locus_tag LOCUS_26990 44749 43469 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141685.1 protein_id gnl|my_center|LOCUS_26990 45558 44881 gene locus_tag LOCUS_27000 45558 44881 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141809.1 protein_id gnl|my_center|LOCUS_27000 45738 46037 gene locus_tag LOCUS_27010 45738 46037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27010 46173 46865 gene locus_tag LOCUS_27020 46173 46865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27020 46862 49762 gene locus_tag LOCUS_27030 46862 49762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27030 49900 50511 gene locus_tag LOCUS_27040 49900 50511 CDS product MarC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973815.1 protein_id gnl|my_center|LOCUS_27040 51732 50500 gene locus_tag LOCUS_27050 51732 50500 CDS product RNA-guided endonuclease TnpB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459437.1 protein_id gnl|my_center|LOCUS_27050 53470 52088 gene locus_tag LOCUS_27060 53470 52088 CDS product pentapeptide repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_036265354.1 protein_id gnl|my_center|LOCUS_27060 54784 57519 gene locus_tag LOCUS_27070 54784 57519 CDS product zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928590.1 protein_id gnl|my_center|LOCUS_27070 58316 57582 gene locus_tag LOCUS_27080 58316 57582 CDS product DUF1995 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058055.1 protein_id gnl|my_center|LOCUS_27080 59960 58791 gene locus_tag LOCUS_27090 59960 58791 CDS product cysteine desulfurase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056757.1 protein_id gnl|my_center|LOCUS_27090 60439 61812 gene locus_tag LOCUS_27100 60439 61812 CDS product DUF655 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058172.1 protein_id gnl|my_center|LOCUS_27100 62278 62775 gene locus_tag LOCUS_27110 62278 62775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27110 62929 63165 gene locus_tag LOCUS_27120 62929 63165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27120 63361 63651 gene locus_tag LOCUS_27130 63361 63651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27130 63856 65049 gene locus_tag LOCUS_27140 63856 65049 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920820.1 protein_id gnl|my_center|LOCUS_27140 65384 66034 gene locus_tag LOCUS_27150 65384 66034 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920819.1 protein_id gnl|my_center|LOCUS_27150 66482 66084 gene locus_tag LOCUS_27160 66482 66084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27160 66856 67749 gene locus_tag LOCUS_27170 66856 67749 CDS product phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001224475.1 protein_id gnl|my_center|LOCUS_27170 69155 67914 gene locus_tag LOCUS_27180 69155 67914 CDS product molybdopterin molybdotransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143728.1 protein_id gnl|my_center|LOCUS_27180 69700 71232 gene locus_tag LOCUS_27190 69700 71232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27190 71426 71971 gene locus_tag LOCUS_27200 71426 71971 CDS product RDD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920976.1 protein_id gnl|my_center|LOCUS_27200 72212 72427 gene locus_tag LOCUS_27210 gene rpsR 72212 72427 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057896.1 protein_id gnl|my_center|LOCUS_27210 72537 74597 gene locus_tag LOCUS_27220 72537 74597 CDS product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056499.1 protein_id gnl|my_center|LOCUS_27220 75242 74622 gene locus_tag LOCUS_27230 75242 74622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27230 >Feature sequence031 792 286 gene locus_tag LOCUS_27240 792 286 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124513.1 protein_id gnl|my_center|LOCUS_27240 1407 3497 gene locus_tag LOCUS_27250 1407 3497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27250 4140 3796 gene locus_tag LOCUS_27260 4140 3796 CDS product DUF1815 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_126987665.1 protein_id gnl|my_center|LOCUS_27260 5309 5094 gene locus_tag LOCUS_27270 5309 5094 CDS product DUF2839 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_106498686.1 protein_id gnl|my_center|LOCUS_27270 7018 5435 gene locus_tag LOCUS_27280 7018 5435 CDS product helicase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920839.1 protein_id gnl|my_center|LOCUS_27280 7182 8153 gene locus_tag LOCUS_27290 7182 8153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27290 8802 8563 gene locus_tag LOCUS_27300 8802 8563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27300 9110 10636 gene locus_tag LOCUS_27310 gene lysS 9110 10636 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056067.1 protein_id gnl|my_center|LOCUS_27310 11267 12106 gene locus_tag LOCUS_27320 11267 12106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27320 12855 12655 gene locus_tag LOCUS_27330 12855 12655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27330 13297 12995 gene locus_tag LOCUS_27340 13297 12995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27340 13630 13397 gene locus_tag LOCUS_27350 13630 13397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27350 14947 14165 gene locus_tag LOCUS_27360 14947 14165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27360 16541 14988 gene locus_tag LOCUS_27370 16541 14988 CDS product HlyD family type I secretion periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004536091.1 protein_id gnl|my_center|LOCUS_27370 19705 16634 gene locus_tag LOCUS_27380 19705 16634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27380 22237 21506 gene locus_tag LOCUS_27390 22237 21506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27390 23802 23344 gene locus_tag LOCUS_27400 23802 23344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27400 24835 23936 gene locus_tag LOCUS_27410 24835 23936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27410 29324 26115 gene locus_tag LOCUS_27420 29324 26115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27420 32162 29676 gene locus_tag LOCUS_27430 32162 29676 CDS product GH116 family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099797719.1 protein_id gnl|my_center|LOCUS_27430 32413 32225 gene locus_tag LOCUS_27440 32413 32225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27440 34521 33976 gene locus_tag LOCUS_27450 34521 33976 CDS product GIY-YIG nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057421.1 protein_id gnl|my_center|LOCUS_27450 34933 34604 gene locus_tag LOCUS_27460 34933 34604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140556.1 protein_id gnl|my_center|LOCUS_27460 35456 36511 gene locus_tag LOCUS_27470 35456 36511 CDS product low specificity L-threonine aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389904.1 protein_id gnl|my_center|LOCUS_27470 37255 36656 gene locus_tag LOCUS_27480 37255 36656 CDS product Vat family streptogramin A O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_078927652.1 protein_id gnl|my_center|LOCUS_27480 39749 37383 gene locus_tag LOCUS_27490 39749 37383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27490 42385 40076 gene locus_tag LOCUS_27500 gene bcsB 42385 40076 CDS product cellulose biosynthesis cyclic di-GMP-binding regulatory protein BcsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263700.1 protein_id gnl|my_center|LOCUS_27500 43746 42586 gene locus_tag LOCUS_27510 43746 42586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27510 46385 44004 gene locus_tag LOCUS_27520 46385 44004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27520 48280 46382 gene locus_tag LOCUS_27530 48280 46382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27530 48797 49480 gene locus_tag LOCUS_27540 48797 49480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27540 50338 50655 gene locus_tag LOCUS_27550 gene rpsT 50338 50655 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057030.1 protein_id gnl|my_center|LOCUS_27550 50735 51520 gene locus_tag LOCUS_27560 50735 51520 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057029.1 protein_id gnl|my_center|LOCUS_27560 52239 55538 gene locus_tag LOCUS_27570 gene rpoB 52239 55538 CDS product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056489.1 protein_id gnl|my_center|LOCUS_27570 55706 57583 gene locus_tag LOCUS_27580 55706 57583 CDS product DNA-directed RNA polymerase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056488.1 protein_id gnl|my_center|LOCUS_27580 57790 61767 gene locus_tag LOCUS_27590 57790 61767 CDS product DNA-directed RNA polymerase subunit beta'' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056487.1 protein_id gnl|my_center|LOCUS_27590 62695 63408 gene locus_tag LOCUS_27600 62695 63408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004555960.1 protein_id gnl|my_center|LOCUS_27600 69164 63450 gene locus_tag LOCUS_27610 69164 63450 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000686845.1 protein_id gnl|my_center|LOCUS_27610 71274 69625 gene locus_tag LOCUS_27620 71274 69625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27620 72161 73537 gene locus_tag LOCUS_27630 gene hisD 72161 73537 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058085.1 protein_id gnl|my_center|LOCUS_27630 73717 74142 gene locus_tag LOCUS_27640 73717 74142 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920646.1 protein_id gnl|my_center|LOCUS_27640 >Feature sequence032 1602 109 gene locus_tag LOCUS_27650 1602 109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27650 2632 1586 gene locus_tag LOCUS_27660 2632 1586 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001273465.1 protein_id gnl|my_center|LOCUS_27660 4323 3163 gene locus_tag LOCUS_27670 4323 3163 CDS product anhydro-N-acetylmuramic acid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058228.1 protein_id gnl|my_center|LOCUS_27670 5618 4416 gene locus_tag LOCUS_27680 gene kdpDN 5618 4416 CDS product KdpD-like non-kinase potassium sensor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011181481.1 protein_id gnl|my_center|LOCUS_27680 6338 5733 gene locus_tag LOCUS_27690 gene kdpC 6338 5733 CDS product K(+)-transporting ATPase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140578.1 protein_id gnl|my_center|LOCUS_27690 6731 6396 gene locus_tag LOCUS_27700 6731 6396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27700 8879 6783 gene locus_tag LOCUS_27710 gene kdpB 8879 6783 CDS product potassium-transporting ATPase subunit KdpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140577.1 protein_id gnl|my_center|LOCUS_27710 10634 8925 gene locus_tag LOCUS_27720 gene kdpA 10634 8925 CDS product potassium-transporting ATPase subunit KdpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140576.1 protein_id gnl|my_center|LOCUS_27720 11267 12370 gene locus_tag LOCUS_27730 11267 12370 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928544.1 protein_id gnl|my_center|LOCUS_27730 12431 13120 gene locus_tag LOCUS_27740 12431 13120 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023174178.1 protein_id gnl|my_center|LOCUS_27740 14375 13203 gene locus_tag LOCUS_27750 14375 13203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27750 14891 15580 gene locus_tag LOCUS_27760 14891 15580 CDS product phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071542407.1 protein_id gnl|my_center|LOCUS_27760 16841 15627 gene locus_tag LOCUS_27770 16841 15627 CDS product DUF790 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141365.1 protein_id gnl|my_center|LOCUS_27770 18433 16898 gene locus_tag LOCUS_27780 18433 16898 CDS product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141364.1 protein_id gnl|my_center|LOCUS_27780 18742 21570 gene locus_tag LOCUS_27790 18742 21570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27790 21728 23572 gene locus_tag LOCUS_27800 21728 23572 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143667.1 protein_id gnl|my_center|LOCUS_27800 23701 23970 gene locus_tag LOCUS_27810 23701 23970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141573.1 protein_id gnl|my_center|LOCUS_27810 23974 24396 gene locus_tag LOCUS_27820 23974 24396 CDS product PIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141572.1 protein_id gnl|my_center|LOCUS_27820 24664 25707 gene locus_tag LOCUS_27830 24664 25707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27830 25804 27882 gene locus_tag LOCUS_27840 25804 27882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27840 28404 28982 gene locus_tag LOCUS_27850 28404 28982 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141366.1 protein_id gnl|my_center|LOCUS_27850 29038 29298 gene locus_tag LOCUS_27860 29038 29298 CDS product DUF433 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142391.1 protein_id gnl|my_center|LOCUS_27860 30276 29413 gene locus_tag LOCUS_27870 30276 29413 CDS product WYL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142464.1 protein_id gnl|my_center|LOCUS_27870 30593 33247 gene locus_tag LOCUS_27880 30593 33247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27880 33261 34277 gene locus_tag LOCUS_27890 33261 34277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27890 34281 35042 gene locus_tag LOCUS_27900 34281 35042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27900 35035 37320 gene locus_tag LOCUS_27910 35035 37320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27910 37298 38203 gene locus_tag LOCUS_27920 37298 38203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27920 38196 38789 gene locus_tag LOCUS_27930 gene cas4 38196 38789 CDS product CRISPR-associated protein Cas4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392031.1 protein_id gnl|my_center|LOCUS_27930 38843 39847 gene locus_tag LOCUS_27940 gene cas1 38843 39847 CDS product CRISPR-associated endonuclease Cas1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256457.1 protein_id gnl|my_center|LOCUS_27940 39870 40157 gene locus_tag LOCUS_27950 39870 40157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27950 40370 44319 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gttgaaatttcattaactccctattagggattgaaac 44617 44390 gene locus_tag LOCUS_27960 44617 44390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27960 44834 44607 gene locus_tag LOCUS_27970 44834 44607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27970 45097 44840 gene locus_tag LOCUS_27980 45097 44840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27980 45458 46876 gene locus_tag LOCUS_27990 45458 46876 CDS product glycoside hydrolase family 10 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231519.1 protein_id gnl|my_center|LOCUS_27990 47800 46913 gene locus_tag LOCUS_28000 47800 46913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28000 48382 48113 gene locus_tag LOCUS_28010 48382 48113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28010 48772 49521 gene locus_tag LOCUS_28020 48772 49521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28020 49518 50159 gene locus_tag LOCUS_28030 49518 50159 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_207649561.1 protein_id gnl|my_center|LOCUS_28030 50215 51135 gene locus_tag LOCUS_28040 50215 51135 CDS product glycine betaine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393187.1 protein_id gnl|my_center|LOCUS_28040 51279 52016 gene locus_tag LOCUS_28050 51279 52016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28050 52255 53232 gene locus_tag LOCUS_28060 52255 53232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28060 53257 53934 gene locus_tag LOCUS_28070 53257 53934 CDS product DevA family ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056490.1 protein_id gnl|my_center|LOCUS_28070 54194 54481 gene locus_tag LOCUS_28080 54194 54481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28080 54551 56419 gene locus_tag LOCUS_28090 gene ggt 54551 56419 CDS product gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000595064.1 protein_id gnl|my_center|LOCUS_28090 56718 56467 gene locus_tag LOCUS_28100 56718 56467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_198123594.1 protein_id gnl|my_center|LOCUS_28100 57578 56982 gene locus_tag LOCUS_28110 57578 56982 CDS product DUF1802 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009935899.1 protein_id gnl|my_center|LOCUS_28110 58599 59192 gene locus_tag LOCUS_28120 58599 59192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28120 59402 59962 gene locus_tag LOCUS_28130 59402 59962 CDS product L,D-transpeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099798971.1 protein_id gnl|my_center|LOCUS_28130 60041 61000 gene locus_tag LOCUS_28140 60041 61000 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056897.1 protein_id gnl|my_center|LOCUS_28140 61556 64285 gene locus_tag LOCUS_28150 61556 64285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28150 65286 64339 gene locus_tag LOCUS_28160 65286 64339 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142331.1 protein_id gnl|my_center|LOCUS_28160 65518 66390 gene locus_tag LOCUS_28170 65518 66390 CDS product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056438.1 protein_id gnl|my_center|LOCUS_28170 67088 66483 gene locus_tag LOCUS_28180 67088 66483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28180 67279 67788 gene locus_tag LOCUS_28190 67279 67788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920753.1 protein_id gnl|my_center|LOCUS_28190 68134 67862 gene locus_tag LOCUS_28200 68134 67862 CDS product YggT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056384.1 protein_id gnl|my_center|LOCUS_28200 68641 68291 gene locus_tag LOCUS_28210 68641 68291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28210 69369 68719 gene locus_tag LOCUS_28220 gene upp 69369 68719 CDS product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920929.1 protein_id gnl|my_center|LOCUS_28220 69869 71362 gene locus_tag LOCUS_28230 gene crtH 69869 71362 CDS product carotene isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_036891794.1 protein_id gnl|my_center|LOCUS_28230 72141 71944 gene locus_tag LOCUS_28240 72141 71944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28240 >Feature sequence033 546 124 gene locus_tag LOCUS_28250 546 124 CDS product TIGR02588 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142148.1 protein_id gnl|my_center|LOCUS_28250 1436 543 gene locus_tag LOCUS_28260 1436 543 CDS product TIGR02587 family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142149.1 protein_id gnl|my_center|LOCUS_28260 1896 2078 gene locus_tag LOCUS_28270 1896 2078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28270 2518 2246 gene locus_tag LOCUS_28280 2518 2246 CDS product GlsB/YeaQ/YmgE family stress response membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000511323.1 protein_id gnl|my_center|LOCUS_28280 4616 3897 gene locus_tag LOCUS_28290 4616 3897 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144387.1 protein_id gnl|my_center|LOCUS_28290 5055 7454 gene locus_tag LOCUS_28300 5055 7454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28300 7813 8244 gene locus_tag LOCUS_28310 7813 8244 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963160.1 protein_id gnl|my_center|LOCUS_28310 8455 9783 gene locus_tag LOCUS_28320 8455 9783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28320 9844 10968 gene locus_tag LOCUS_28330 9844 10968 CDS product hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143115.1 protein_id gnl|my_center|LOCUS_28330 11411 11845 gene locus_tag LOCUS_28340 11411 11845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28340 12307 11846 gene locus_tag LOCUS_28350 12307 11846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28350 13069 14271 gene locus_tag LOCUS_28360 13069 14271 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140500.1 protein_id gnl|my_center|LOCUS_28360 14674 15909 gene locus_tag LOCUS_28370 14674 15909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28370 16058 16918 gene locus_tag LOCUS_28380 16058 16918 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_211477755.1 protein_id gnl|my_center|LOCUS_28380 16932 17897 gene locus_tag LOCUS_28390 16932 17897 CDS product threo-3-hydroxy-L-aspartate ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143857.1 protein_id gnl|my_center|LOCUS_28390 17962 18516 gene locus_tag LOCUS_28400 17962 18516 CDS product RNA 2'-phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029338.1 protein_id gnl|my_center|LOCUS_28400 19908 18538 gene locus_tag LOCUS_28410 19908 18538 CDS product lipid-A-disaccharide synthase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057470.1 protein_id gnl|my_center|LOCUS_28410 20059 22191 gene locus_tag LOCUS_28420 20059 22191 CDS product BamA/TamA family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057626.1 protein_id gnl|my_center|LOCUS_28420 22429 24111 gene locus_tag LOCUS_28430 22429 24111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28430 25150 24188 gene locus_tag LOCUS_28440 25150 24188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28440 26433 25525 gene locus_tag LOCUS_28450 26433 25525 CDS product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202085.1 protein_id gnl|my_center|LOCUS_28450 26823 26476 gene locus_tag LOCUS_28460 26823 26476 CDS product type II toxin-antitoxin system PemK/MazF family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250020.1 protein_id gnl|my_center|LOCUS_28460 27053 26823 gene locus_tag LOCUS_28470 27053 26823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28470 27190 27059 gene locus_tag LOCUS_28480 27190 27059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28480 29768 27552 gene locus_tag LOCUS_28490 gene psaB 29768 27552 CDS product photosystem I core protein PsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056579.1 protein_id gnl|my_center|LOCUS_28490 32151 29893 gene locus_tag LOCUS_28500 gene psaA 32151 29893 CDS product photosystem I core protein PsaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920748.1 protein_id gnl|my_center|LOCUS_28500 32783 34564 gene locus_tag LOCUS_28510 32783 34564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28510 35518 34571 gene locus_tag LOCUS_28520 35518 34571 CDS product glutaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056446.1 protein_id gnl|my_center|LOCUS_28520 35583 37100 gene locus_tag LOCUS_28530 35583 37100 CDS product thioredoxin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_073595568.1 protein_id gnl|my_center|LOCUS_28530 37905 37363 gene locus_tag LOCUS_28540 37905 37363 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140692.1 protein_id gnl|my_center|LOCUS_28540 38574 38386 gene locus_tag LOCUS_28550 38574 38386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28550 38768 40213 gene locus_tag LOCUS_28560 38768 40213 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584110.1 protein_id gnl|my_center|LOCUS_28560 40441 40896 gene locus_tag LOCUS_28570 40441 40896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28570 40905 41285 gene locus_tag LOCUS_28580 40905 41285 CDS product DUF952 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886888.1 protein_id gnl|my_center|LOCUS_28580 41480 44542 gene locus_tag LOCUS_28590 41480 44542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28590 44590 44778 gene locus_tag LOCUS_28600 44590 44778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28600 44775 46163 gene locus_tag LOCUS_28610 44775 46163 CDS product AtzE family amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965237.1 protein_id gnl|my_center|LOCUS_28610 46517 46314 gene locus_tag LOCUS_28620 46517 46314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28620 47320 46637 gene locus_tag LOCUS_28630 47320 46637 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058278.1 protein_id gnl|my_center|LOCUS_28630 48986 49333 gene locus_tag LOCUS_28640 48986 49333 CDS product YbaB/EbfC family nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056570.1 protein_id gnl|my_center|LOCUS_28640 49478 49897 gene locus_tag LOCUS_28650 49478 49897 CDS product low molecular weight protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057647.1 protein_id gnl|my_center|LOCUS_28650 51022 50582 gene locus_tag LOCUS_28660 51022 50582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28660 53267 52026 gene locus_tag LOCUS_28670 53267 52026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28670 54006 54608 gene locus_tag LOCUS_28680 54006 54608 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976326.1 protein_id gnl|my_center|LOCUS_28680 54913 55971 gene locus_tag LOCUS_28690 54913 55971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_28690 56826 57014 gene locus_tag LOCUS_28700 56826 57014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28700 58214 57213 gene locus_tag LOCUS_28710 gene murB 58214 57213 CDS product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056225.1 protein_id gnl|my_center|LOCUS_28710 59832 58369 gene locus_tag LOCUS_28720 gene murC 59832 58369 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056226.1 protein_id gnl|my_center|LOCUS_28720 60172 60789 gene locus_tag LOCUS_28730 gene nadD 60172 60789 CDS product nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460892.1 protein_id gnl|my_center|LOCUS_28730 60914 61930 gene locus_tag LOCUS_28740 60914 61930 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140533.1 protein_id gnl|my_center|LOCUS_28740 63040 61991 gene locus_tag LOCUS_28750 gene thiL 63040 61991 CDS product thiamine-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921033.1 protein_id gnl|my_center|LOCUS_28750 64397 63210 gene locus_tag LOCUS_28760 64397 63210 CDS product LL-diaminopimelate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_124972844.1 protein_id gnl|my_center|LOCUS_28760 64954 64625 gene locus_tag LOCUS_28770 gene trxA 64954 64625 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393175.1 protein_id gnl|my_center|LOCUS_28770 67141 66368 gene locus_tag LOCUS_28780 67141 66368 CDS product PspA/IM30 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057529.1 protein_id gnl|my_center|LOCUS_28780 68018 67305 gene locus_tag LOCUS_28790 68018 67305 CDS product PspA/IM30 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140900.1 protein_id gnl|my_center|LOCUS_28790 69502 68162 gene locus_tag LOCUS_28800 69502 68162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28800 69633 70199 gene locus_tag LOCUS_28810 69633 70199 CDS product DUF721 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056696.1 protein_id gnl|my_center|LOCUS_28810 >Feature sequence034 1779 466 gene locus_tag LOCUS_28820 1779 466 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_135257956.1 protein_id gnl|my_center|LOCUS_28820 2937 1795 gene locus_tag LOCUS_28830 2937 1795 CDS product PepSY-associated TM helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140316.1 protein_id gnl|my_center|LOCUS_28830 5741 3021 gene locus_tag LOCUS_28840 5741 3021 CDS product TonB-dependent siderophore receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015154897.1 protein_id gnl|my_center|LOCUS_28840 6371 11740 gene locus_tag LOCUS_28850 6371 11740 CDS product non-ribosomal peptide synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105031.1 protein_id gnl|my_center|LOCUS_28850 11802 12668 gene locus_tag LOCUS_28860 11802 12668 CDS product TauD/TfdA family dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141895.1 protein_id gnl|my_center|LOCUS_28860 12790 18741 gene locus_tag LOCUS_28870 12790 18741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28870 18919 20913 gene locus_tag LOCUS_28880 18919 20913 CDS product carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533539.1 protein_id gnl|my_center|LOCUS_28880 20957 21835 gene locus_tag LOCUS_28890 20957 21835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28890 21894 27500 gene locus_tag LOCUS_28900 21894 27500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28900 27516 33962 gene locus_tag LOCUS_28910 27516 33962 CDS product non-ribosomal peptide synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000503026.1 protein_id gnl|my_center|LOCUS_28910 33966 39980 gene locus_tag LOCUS_28920 33966 39980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28920 40154 41182 gene locus_tag LOCUS_28930 40154 41182 CDS product TauD/TfdA family dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267343.1 protein_id gnl|my_center|LOCUS_28930 41202 45689 gene locus_tag LOCUS_28940 41202 45689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28940 45818 46573 gene locus_tag LOCUS_28950 45818 46573 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011181634.1 protein_id gnl|my_center|LOCUS_28950 46600 48024 gene locus_tag LOCUS_28960 46600 48024 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973242.1 protein_id gnl|my_center|LOCUS_28960 48147 48473 gene locus_tag LOCUS_28970 48147 48473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28970 48680 48525 gene locus_tag LOCUS_28980 48680 48525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28980 48752 49936 gene locus_tag LOCUS_28990 48752 49936 CDS product RNA-guided endonuclease TnpB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041233550.1 protein_id gnl|my_center|LOCUS_28990 50078 50305 gene locus_tag LOCUS_29000 50078 50305 CDS product MbtH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003089636.1 protein_id gnl|my_center|LOCUS_29000 52548 50389 gene locus_tag LOCUS_29010 52548 50389 CDS product acylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205421589.1 protein_id gnl|my_center|LOCUS_29010 53404 53880 gene locus_tag LOCUS_29020 53404 53880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29020 53922 54341 gene locus_tag LOCUS_29030 53922 54341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29030 54378 54905 gene locus_tag LOCUS_29040 54378 54905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29040 56095 55487 gene locus_tag LOCUS_29050 56095 55487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29050 56682 56098 gene locus_tag LOCUS_29060 56682 56098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29060 57058 56666 gene locus_tag LOCUS_29070 57058 56666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29070 58250 57384 gene locus_tag LOCUS_29080 58250 57384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29080 58950 58231 gene locus_tag LOCUS_29090 58950 58231 CDS product RNA polymerase sigma factor SigF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056585.1 protein_id gnl|my_center|LOCUS_29090 60164 59820 gene locus_tag LOCUS_29100 60164 59820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29100 60780 61541 gene locus_tag LOCUS_29110 60780 61541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29110 62915 62337 gene locus_tag LOCUS_29120 62915 62337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29120 64711 62930 gene locus_tag LOCUS_29130 64711 62930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29130 65482 64838 gene locus_tag LOCUS_29140 65482 64838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29140 66703 66524 gene locus_tag LOCUS_29150 66703 66524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_29150 66799 67146 gene locus_tag LOCUS_29160 66799 67146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29160 67385 67143 gene locus_tag LOCUS_29170 67385 67143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29170 70953 68767 gene locus_tag LOCUS_29180 70953 68767 CDS product acylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205421589.1 protein_id gnl|my_center|LOCUS_29180 >Feature sequence035 3484 224 gene locus_tag LOCUS_29190 3484 224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29190 3851 4216 gene locus_tag LOCUS_29200 3851 4216 CDS product DUF6464 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057913.1 protein_id gnl|my_center|LOCUS_29200 5268 4273 gene locus_tag LOCUS_29210 gene fmt 5268 4273 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_198406043.1 protein_id gnl|my_center|LOCUS_29210 6600 7937 gene locus_tag LOCUS_29220 6600 7937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29220 8648 8340 gene locus_tag LOCUS_29230 gene minE 8648 8340 CDS product cell division topological specificity factor MinE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057853.1 protein_id gnl|my_center|LOCUS_29230 9485 8679 gene locus_tag LOCUS_29240 gene minD 9485 8679 CDS product septum site-determining protein MinD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057852.1 protein_id gnl|my_center|LOCUS_29240 10781 9624 gene locus_tag LOCUS_29250 10781 9624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29250 12240 10870 gene locus_tag LOCUS_29260 12240 10870 CDS product four-carbon acid sugar kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140919.1 protein_id gnl|my_center|LOCUS_29260 12913 12248 gene locus_tag LOCUS_29270 12913 12248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29270 15620 12981 gene locus_tag LOCUS_29280 15620 12981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29280 16330 15704 gene locus_tag LOCUS_29290 16330 15704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29290 18066 16585 gene locus_tag LOCUS_29300 18066 16585 CDS product DUF697 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057130.1 protein_id gnl|my_center|LOCUS_29300 18239 19003 gene locus_tag LOCUS_29310 gene tpiA 18239 19003 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099798681.1 protein_id gnl|my_center|LOCUS_29310 19118 19921 gene locus_tag LOCUS_29320 gene folP 19118 19921 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057362.1 protein_id gnl|my_center|LOCUS_29320 20754 19918 gene locus_tag LOCUS_29330 20754 19918 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142171.1 protein_id gnl|my_center|LOCUS_29330 21321 21488 gene locus_tag LOCUS_29340 21321 21488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29340 23410 21767 gene locus_tag LOCUS_29350 23410 21767 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920921.1 protein_id gnl|my_center|LOCUS_29350 25161 23542 gene locus_tag LOCUS_29360 25161 23542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29360 26622 25639 gene locus_tag LOCUS_29370 26622 25639 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057738.1 protein_id gnl|my_center|LOCUS_29370 27460 26792 gene locus_tag LOCUS_29380 gene hisB 27460 26792 CDS product imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055988.1 protein_id gnl|my_center|LOCUS_29380 28375 27578 gene locus_tag LOCUS_29390 gene fabI 28375 27578 CDS product enoyl-ACP reductase FabI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057530.1 protein_id gnl|my_center|LOCUS_29390 28881 29552 gene locus_tag LOCUS_29400 gene ntcA 28881 29552 CDS product global nitrogen regulator NtcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920910.1 protein_id gnl|my_center|LOCUS_29400 29768 31258 gene locus_tag LOCUS_29410 29768 31258 CDS product DUF3084 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057621.1 protein_id gnl|my_center|LOCUS_29410 31401 31856 gene locus_tag LOCUS_29420 gene ruvX 31401 31856 CDS product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920731.1 protein_id gnl|my_center|LOCUS_29420 32213 31935 gene locus_tag LOCUS_29430 32213 31935 CDS product DUF3146 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058048.1 protein_id gnl|my_center|LOCUS_29430 32570 34078 gene locus_tag LOCUS_29440 32570 34078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29440 36489 34333 gene locus_tag LOCUS_29450 36489 34333 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058027.1 protein_id gnl|my_center|LOCUS_29450 37471 42003 gene locus_tag LOCUS_29460 37471 42003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29460 42253 43089 gene locus_tag LOCUS_29470 42253 43089 CDS product SWIM zinc finger family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142264.1 protein_id gnl|my_center|LOCUS_29470 43277 43576 gene locus_tag LOCUS_29480 43277 43576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29480 43874 44119 gene locus_tag LOCUS_29490 43874 44119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29490 44116 44610 gene locus_tag LOCUS_29500 44116 44610 CDS product DUF3368 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_225807463.1 protein_id gnl|my_center|LOCUS_29500 45237 44611 gene locus_tag LOCUS_29510 45237 44611 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140938.1 protein_id gnl|my_center|LOCUS_29510 46198 45311 gene locus_tag LOCUS_29520 46198 45311 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143114.1 protein_id gnl|my_center|LOCUS_29520 47064 46318 gene locus_tag LOCUS_29530 47064 46318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29530 47327 47779 gene locus_tag LOCUS_29540 47327 47779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29540 47847 49199 gene locus_tag LOCUS_29550 47847 49199 CDS product pentapeptide repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012166117.1 protein_id gnl|my_center|LOCUS_29550 50166 49318 gene locus_tag LOCUS_29560 50166 49318 CDS product fatty acid desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057556.1 protein_id gnl|my_center|LOCUS_29560 50398 51582 gene locus_tag LOCUS_29570 50398 51582 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142861.1 protein_id gnl|my_center|LOCUS_29570 51942 52436 gene locus_tag LOCUS_29580 gene msrB 51942 52436 CDS product peptide-methionine (R)-S-oxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528493.1 protein_id gnl|my_center|LOCUS_29580 52770 53015 gene locus_tag LOCUS_29590 52770 53015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29590 54809 53232 gene locus_tag LOCUS_29600 54809 53232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29600 55215 57200 gene locus_tag LOCUS_29610 55215 57200 CDS product amylo-alpha-1,6-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_190697803.1 protein_id gnl|my_center|LOCUS_29610 57385 57615 gene locus_tag LOCUS_29620 57385 57615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29620 58444 57671 gene locus_tag LOCUS_29630 gene map 58444 57671 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142406.1 protein_id gnl|my_center|LOCUS_29630 59463 58450 gene locus_tag LOCUS_29640 59463 58450 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928617.1 protein_id gnl|my_center|LOCUS_29640 59930 60229 gene locus_tag LOCUS_29650 59930 60229 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125585.1 protein_id gnl|my_center|LOCUS_29650 60786 61088 gene locus_tag LOCUS_29660 60786 61088 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125585.1 protein_id gnl|my_center|LOCUS_29660 62864 61365 gene locus_tag LOCUS_29670 62864 61365 CDS product SpoIID/LytB domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125969.1 protein_id gnl|my_center|LOCUS_29670 63290 63550 gene locus_tag LOCUS_29680 63290 63550 CDS product sulfiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056018.1 protein_id gnl|my_center|LOCUS_29680 63603 64088 gene locus_tag LOCUS_29690 63603 64088 CDS product Dps family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086103.1 protein_id gnl|my_center|LOCUS_29690 64093 64827 gene locus_tag LOCUS_29700 64093 64827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29700 65010 65345 gene locus_tag LOCUS_29710 65010 65345 CDS product STAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057408.1 protein_id gnl|my_center|LOCUS_29710 66487 65342 gene locus_tag LOCUS_29720 66487 65342 CDS product SpoIIE family protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056995.1 protein_id gnl|my_center|LOCUS_29720 67338 66571 gene locus_tag LOCUS_29730 67338 66571 CDS product DUF1350 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058307.1 protein_id gnl|my_center|LOCUS_29730 68403 67612 gene locus_tag LOCUS_29740 68403 67612 CDS product ABC-2 family transporter protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143432.1 protein_id gnl|my_center|LOCUS_29740 69474 68443 gene locus_tag LOCUS_29750 69474 68443 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016873987.1 protein_id gnl|my_center|LOCUS_29750 70166 69609 gene locus_tag LOCUS_29760 70166 69609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140615.1 protein_id gnl|my_center|LOCUS_29760 >Feature sequence036 1949 1791 gene locus_tag LOCUS_29770 1949 1791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29770 2042 2956 gene locus_tag LOCUS_29780 2042 2956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29780 3832 2981 gene locus_tag LOCUS_29790 3832 2981 CDS product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056252.1 protein_id gnl|my_center|LOCUS_29790 3902 4843 gene locus_tag LOCUS_29800 3902 4843 CDS product MnmC family methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920906.1 protein_id gnl|my_center|LOCUS_29800 5325 6533 gene locus_tag LOCUS_29810 5325 6533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29810 6621 7991 gene locus_tag LOCUS_29820 gene glmU 6621 7991 CDS product bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920683.1 protein_id gnl|my_center|LOCUS_29820 9019 8054 gene locus_tag LOCUS_29830 9019 8054 CDS product isoaspartyl peptidase/L-asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056551.1 protein_id gnl|my_center|LOCUS_29830 9576 10004 gene locus_tag LOCUS_29840 9576 10004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29840 10215 11354 gene locus_tag LOCUS_29850 10215 11354 CDS product quinone-dependent dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056427.1 protein_id gnl|my_center|LOCUS_29850 11896 11393 gene locus_tag LOCUS_29860 11896 11393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29860 13035 12436 gene locus_tag LOCUS_29870 13035 12436 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531462.1 protein_id gnl|my_center|LOCUS_29870 13377 15476 gene locus_tag LOCUS_29880 13377 15476 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058305.1 protein_id gnl|my_center|LOCUS_29880 15679 17028 gene locus_tag LOCUS_29890 gene gor 15679 17028 CDS product glutathione-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057447.1 protein_id gnl|my_center|LOCUS_29890 17152 18531 gene locus_tag LOCUS_29900 gene gor 17152 18531 CDS product glutathione-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057447.1 protein_id gnl|my_center|LOCUS_29900 18537 19172 gene locus_tag LOCUS_29910 18537 19172 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057562.1 protein_id gnl|my_center|LOCUS_29910 19273 20424 gene locus_tag LOCUS_29920 19273 20424 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056136.1 protein_id gnl|my_center|LOCUS_29920 21199 20645 gene locus_tag LOCUS_29930 21199 20645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29930 22571 22008 gene locus_tag LOCUS_29940 22571 22008 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057925.1 protein_id gnl|my_center|LOCUS_29940 23698 27147 gene locus_tag LOCUS_29950 23698 27147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29950 27436 28743 gene locus_tag LOCUS_29960 27436 28743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29960 28791 28861 gene locus_tag LOCUS_t00210 28791 28861 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 29793 28987 gene locus_tag LOCUS_29970 gene pstB 29793 28987 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124749.1 protein_id gnl|my_center|LOCUS_29970 30739 29846 gene locus_tag LOCUS_29980 gene pstA 30739 29846 CDS product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140450.1 protein_id gnl|my_center|LOCUS_29980 31703 30759 gene locus_tag LOCUS_29990 gene pstC 31703 30759 CDS product phosphate ABC transporter permease subunit PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140449.1 protein_id gnl|my_center|LOCUS_29990 32987 31803 gene locus_tag LOCUS_30000 gene pstS 32987 31803 CDS product phosphate ABC transporter substrate-binding protein PstS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197530168.1 protein_id gnl|my_center|LOCUS_30000 33772 34362 gene locus_tag LOCUS_30010 33772 34362 CDS product biotin transporter BioY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_198406022.1 protein_id gnl|my_center|LOCUS_30010 34545 35036 gene locus_tag LOCUS_30020 gene lspA 34545 35036 CDS product signal peptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058252.1 protein_id gnl|my_center|LOCUS_30020 36220 35519 gene locus_tag LOCUS_30030 36220 35519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30030 36666 38936 gene locus_tag LOCUS_30040 36666 38936 CDS product transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057331.1 protein_id gnl|my_center|LOCUS_30040 40728 39181 gene locus_tag LOCUS_30050 40728 39181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30050 41354 40725 gene locus_tag LOCUS_30060 41354 40725 CDS product DUF3038 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099799761.1 protein_id gnl|my_center|LOCUS_30060 41744 42262 gene locus_tag LOCUS_30070 41744 42262 CDS product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058171.1 protein_id gnl|my_center|LOCUS_30070 42302 43369 gene locus_tag LOCUS_30080 42302 43369 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057101.1 protein_id gnl|my_center|LOCUS_30080 43453 43740 gene locus_tag LOCUS_30090 43453 43740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30090 45627 43969 gene locus_tag LOCUS_30100 45627 43969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30100 47482 45983 gene locus_tag LOCUS_30110 gene purF 47482 45983 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057521.1 protein_id gnl|my_center|LOCUS_30110 50000 47634 gene locus_tag LOCUS_30120 gene purL 50000 47634 CDS product phosphoribosylformylglycinamidine synthase subunit PurL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057520.1 protein_id gnl|my_center|LOCUS_30120 52654 52169 gene locus_tag LOCUS_30130 52654 52169 CDS product allophycocyanin subunit alpha-B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920894.1 protein_id gnl|my_center|LOCUS_30130 52780 54192 gene locus_tag LOCUS_30140 gene rlmD 52780 54192 CDS product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056786.1 protein_id gnl|my_center|LOCUS_30140 54573 55040 gene locus_tag LOCUS_30150 54573 55040 CDS product anti-sigma regulatory factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083625306.1 protein_id gnl|my_center|LOCUS_30150 55395 55111 gene locus_tag LOCUS_30160 55395 55111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30160 55470 55823 gene locus_tag LOCUS_30170 55470 55823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30170 55825 57216 gene locus_tag LOCUS_30180 gene asnS 55825 57216 CDS product asparagine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058304.1 protein_id gnl|my_center|LOCUS_30180 57416 58321 gene locus_tag LOCUS_30190 57416 58321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30190 58866 58363 gene locus_tag LOCUS_30200 58866 58363 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199373.1 protein_id gnl|my_center|LOCUS_30200 60118 58901 gene locus_tag LOCUS_30210 60118 58901 CDS product Na+/H+ antiporter NhaC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964062.1 protein_id gnl|my_center|LOCUS_30210 60383 61273 gene locus_tag LOCUS_30220 60383 61273 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454832.1 protein_id gnl|my_center|LOCUS_30220 61801 62109 gene locus_tag LOCUS_30230 61801 62109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30230 62980 62285 gene locus_tag LOCUS_30240 62980 62285 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056891.1 protein_id gnl|my_center|LOCUS_30240 64007 64318 gene locus_tag LOCUS_30250 gene groES 64007 64318 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056041.1 protein_id gnl|my_center|LOCUS_30250 64406 66046 gene locus_tag LOCUS_30260 gene groL 64406 66046 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056040.1 protein_id gnl|my_center|LOCUS_30260 67733 66405 gene locus_tag LOCUS_30270 67733 66405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30270 67931 69253 gene locus_tag LOCUS_30280 67931 69253 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932301.1 protein_id gnl|my_center|LOCUS_30280 69260 69445 gene locus_tag LOCUS_30290 69260 69445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30290 69478 69972 gene locus_tag LOCUS_30300 69478 69972 CDS product gluconokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208329.1 protein_id gnl|my_center|LOCUS_30300 >Feature sequence037 1655 303 gene locus_tag LOCUS_30310 1655 303 CDS product serine/threonine-protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056941.1 protein_id gnl|my_center|LOCUS_30310 2987 1674 gene locus_tag LOCUS_30320 2987 1674 CDS product serine/threonine-protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056941.1 protein_id gnl|my_center|LOCUS_30320 4486 3587 gene locus_tag LOCUS_30330 4486 3587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30330 4844 6352 gene locus_tag LOCUS_30340 4844 6352 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933081.1 protein_id gnl|my_center|LOCUS_30340 6658 7143 gene locus_tag LOCUS_30350 6658 7143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_30350 7188 7493 gene locus_tag LOCUS_30360 7188 7493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30360 7469 7777 gene locus_tag LOCUS_30370 7469 7777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30370 8688 8284 gene locus_tag LOCUS_30380 8688 8284 CDS product DUF4112 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967229.1 protein_id gnl|my_center|LOCUS_30380 9282 8830 gene locus_tag LOCUS_30390 9282 8830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140049.1 protein_id gnl|my_center|LOCUS_30390 9819 9307 gene locus_tag LOCUS_30400 9819 9307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30400 10196 11176 gene locus_tag LOCUS_30410 10196 11176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30410 11812 13095 gene locus_tag LOCUS_30420 11812 13095 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000024498.1 protein_id gnl|my_center|LOCUS_30420 14018 13134 gene locus_tag LOCUS_30430 14018 13134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30430 14747 15010 gene locus_tag LOCUS_30440 14747 15010 CDS product DUF3148 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921047.1 protein_id gnl|my_center|LOCUS_30440 15047 15604 gene locus_tag LOCUS_30450 15047 15604 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057036.1 protein_id gnl|my_center|LOCUS_30450 15923 16357 gene locus_tag LOCUS_30460 15923 16357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30460 16741 16364 gene locus_tag LOCUS_30470 16741 16364 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144197.1 protein_id gnl|my_center|LOCUS_30470 20612 16713 gene locus_tag LOCUS_30480 20612 16713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30480 21523 24141 gene locus_tag LOCUS_30490 gene ppsA 21523 24141 CDS product phosphoenolpyruvate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056610.1 protein_id gnl|my_center|LOCUS_30490 24258 24785 gene locus_tag LOCUS_30500 24258 24785 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058205.1 protein_id gnl|my_center|LOCUS_30500 27003 25189 gene locus_tag LOCUS_30510 27003 25189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30510 27672 28382 gene locus_tag LOCUS_30520 27672 28382 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986854.1 protein_id gnl|my_center|LOCUS_30520 28463 29497 gene locus_tag LOCUS_30530 28463 29497 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259230.1 protein_id gnl|my_center|LOCUS_30530 30522 30797 gene locus_tag LOCUS_30540 30522 30797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30540 31310 32422 gene locus_tag LOCUS_30550 31310 32422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30550 33794 32544 gene locus_tag LOCUS_30560 33794 32544 CDS product HhoA/HhoB/HtrA family serine endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056518.1 protein_id gnl|my_center|LOCUS_30560 34238 34534 gene locus_tag LOCUS_30570 34238 34534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30570 35688 34849 gene locus_tag LOCUS_30580 35688 34849 CDS product prephenate/arogenate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921244.1 protein_id gnl|my_center|LOCUS_30580 36070 36264 gene locus_tag LOCUS_30590 36070 36264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30590 36399 36992 gene locus_tag LOCUS_30600 36399 36992 CDS product DUF1517 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141514.1 protein_id gnl|my_center|LOCUS_30600 37062 37964 gene locus_tag LOCUS_30610 37062 37964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141513.1 protein_id gnl|my_center|LOCUS_30610 39075 38017 gene locus_tag LOCUS_30620 gene aroF 39075 38017 CDS product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056213.1 protein_id gnl|my_center|LOCUS_30620 40145 39678 gene locus_tag LOCUS_30630 40145 39678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30630 40427 40158 gene locus_tag LOCUS_30640 gene rpsO 40427 40158 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057049.1 protein_id gnl|my_center|LOCUS_30640 40859 43513 gene locus_tag LOCUS_30650 40859 43513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30650 43645 46893 gene locus_tag LOCUS_30660 43645 46893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30660 46883 47260 gene locus_tag LOCUS_30670 46883 47260 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144197.1 protein_id gnl|my_center|LOCUS_30670 47461 47910 gene locus_tag LOCUS_30680 47461 47910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30680 47983 48270 gene locus_tag LOCUS_30690 47983 48270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30690 50194 48500 gene locus_tag LOCUS_30700 50194 48500 CDS product alpha-amylase family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928779.1 protein_id gnl|my_center|LOCUS_30700 51456 50614 gene locus_tag LOCUS_30710 51456 50614 CDS product cyanophycinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015942561.1 protein_id gnl|my_center|LOCUS_30710 52142 51903 gene locus_tag LOCUS_30720 52142 51903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30720 52688 52482 gene locus_tag LOCUS_30730 52688 52482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144412.1 protein_id gnl|my_center|LOCUS_30730 53264 52701 gene locus_tag LOCUS_30740 gene def 53264 52701 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057513.1 protein_id gnl|my_center|LOCUS_30740 54468 53479 gene locus_tag LOCUS_30750 54468 53479 CDS product polyphosphate kinase 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118674.1 protein_id gnl|my_center|LOCUS_30750 54426 54665 gene locus_tag LOCUS_30760 54426 54665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30760 54720 55538 gene locus_tag LOCUS_30770 54720 55538 CDS product DUF3598 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141575.1 protein_id gnl|my_center|LOCUS_30770 55700 57526 gene locus_tag LOCUS_30780 55700 57526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30780 58105 57881 gene locus_tag LOCUS_30790 58105 57881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30790 58248 59285 gene locus_tag LOCUS_30800 58248 59285 CDS product RNA-guided endonuclease TnpB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082517.1 protein_id gnl|my_center|LOCUS_30800 60711 59344 gene locus_tag LOCUS_30810 60711 59344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30810 61103 60966 gene locus_tag LOCUS_30820 61103 60966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30820 62046 61561 gene locus_tag LOCUS_30830 62046 61561 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004545799.1 protein_id gnl|my_center|LOCUS_30830 62870 62295 gene locus_tag LOCUS_30840 gene aat 62870 62295 CDS product leucyl/phenylalanyl-tRNA--protein transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920768.1 protein_id gnl|my_center|LOCUS_30840 62971 63300 gene locus_tag LOCUS_30850 62971 63300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056249.1 protein_id gnl|my_center|LOCUS_30850 63674 63372 gene locus_tag LOCUS_30860 gene rpsN 63674 63372 CDS product 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057663.1 protein_id gnl|my_center|LOCUS_30860 64529 63813 gene locus_tag LOCUS_30870 gene nth 64529 63813 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057478.1 protein_id gnl|my_center|LOCUS_30870 65608 64505 gene locus_tag LOCUS_30880 gene rseP 65608 64505 CDS product RIP metalloprotease RseP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057479.1 protein_id gnl|my_center|LOCUS_30880 67069 65789 gene locus_tag LOCUS_30890 gene serS 67069 65789 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057392.1 protein_id gnl|my_center|LOCUS_30890 68305 67736 gene locus_tag LOCUS_30900 68305 67736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30900 68861 69208 gene locus_tag LOCUS_30910 68861 69208 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057790.1 protein_id gnl|my_center|LOCUS_30910 69264 69791 gene locus_tag LOCUS_30920 69264 69791 CDS product cofactor assembly of complex C subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056472.1 protein_id gnl|my_center|LOCUS_30920 >Feature sequence038 847 179 gene locus_tag LOCUS_30930 847 179 CDS product DUF1361 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140730.1 protein_id gnl|my_center|LOCUS_30930 1634 1158 gene locus_tag LOCUS_30940 1634 1158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30940 2715 1795 gene locus_tag LOCUS_30950 2715 1795 CDS product SMP-30/gluconolactonase/LRE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063173824.1 protein_id gnl|my_center|LOCUS_30950 2925 3602 gene locus_tag LOCUS_30960 2925 3602 CDS product energy-coupling factor ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197530095.1 protein_id gnl|my_center|LOCUS_30960 3614 3988 gene locus_tag LOCUS_30970 3614 3988 CDS product PDGLE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140295.1 protein_id gnl|my_center|LOCUS_30970 4018 4794 gene locus_tag LOCUS_30980 gene cbiQ 4018 4794 CDS product cobalt ECF transporter T component CbiQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140294.1 protein_id gnl|my_center|LOCUS_30980 4807 5613 gene locus_tag LOCUS_30990 4807 5613 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140293.1 protein_id gnl|my_center|LOCUS_30990 6464 5634 gene locus_tag LOCUS_31000 6464 5634 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_166908820.1 protein_id gnl|my_center|LOCUS_31000 7251 6445 gene locus_tag LOCUS_31010 gene cbiQ 7251 6445 CDS product cobalt ECF transporter T component CbiQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058272.1 protein_id gnl|my_center|LOCUS_31010 7549 7235 gene locus_tag LOCUS_31020 7549 7235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31020 8538 7816 gene locus_tag LOCUS_31030 8538 7816 CDS product energy-coupling factor ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_108306299.1 protein_id gnl|my_center|LOCUS_31030 9190 10206 gene locus_tag LOCUS_31040 9190 10206 CDS product multicopper oxidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143280.1 protein_id gnl|my_center|LOCUS_31040 11348 11830 gene locus_tag LOCUS_31050 11348 11830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31050 12296 13330 gene locus_tag LOCUS_31060 12296 13330 CDS product helix-hairpin-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143279.1 protein_id gnl|my_center|LOCUS_31060 13432 13977 gene locus_tag LOCUS_31070 13432 13977 CDS product ferritin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003025263.1 protein_id gnl|my_center|LOCUS_31070 14061 15029 gene locus_tag LOCUS_31080 14061 15029 CDS product FTR1 family iron permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143278.1 protein_id gnl|my_center|LOCUS_31080 15100 15903 gene locus_tag LOCUS_31090 15100 15903 CDS product MOSC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113973.1 protein_id gnl|my_center|LOCUS_31090 16026 16697 gene locus_tag LOCUS_31100 16026 16697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31100 16930 16703 gene locus_tag LOCUS_31110 16930 16703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31110 17516 17124 gene locus_tag LOCUS_31120 17516 17124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31120 18295 21942 gene locus_tag LOCUS_31130 18295 21942 CDS product NB-ARC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144339.1 protein_id gnl|my_center|LOCUS_31130 22021 22878 gene locus_tag LOCUS_31140 22021 22878 CDS product ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004534169.1 protein_id gnl|my_center|LOCUS_31140 24945 23017 gene locus_tag LOCUS_31150 24945 23017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31150 26633 25062 gene locus_tag LOCUS_31160 26633 25062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31160 27058 27423 gene locus_tag LOCUS_31170 27058 27423 CDS product BON domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023174551.1 protein_id gnl|my_center|LOCUS_31170 28466 27519 gene locus_tag LOCUS_31180 28466 27519 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056888.1 protein_id gnl|my_center|LOCUS_31180 29015 29548 gene locus_tag LOCUS_31190 gene infC 29015 29548 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_106456574.1 protein_id gnl|my_center|LOCUS_31190 29923 30238 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq ccgttaggcgaagaggttatgtaaag 31857 30892 gene locus_tag LOCUS_31200 31857 30892 CDS product phosphate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939747.1 protein_id gnl|my_center|LOCUS_31200 32416 31973 gene locus_tag LOCUS_31210 32416 31973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31210 32877 33842 gene locus_tag LOCUS_31220 32877 33842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057618.1 protein_id gnl|my_center|LOCUS_31220 33845 34243 gene locus_tag LOCUS_31230 33845 34243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31230 35728 34310 gene locus_tag LOCUS_31240 35728 34310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_073592997.1 protein_id gnl|my_center|LOCUS_31240 36720 36304 gene locus_tag LOCUS_31250 gene psb27 36720 36304 CDS product photosystem II protein Psb27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058295.1 protein_id gnl|my_center|LOCUS_31250 36820 36635 gene locus_tag LOCUS_31260 36820 36635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31260 37970 36831 gene locus_tag LOCUS_31270 gene cofH 37970 36831 CDS product 7,8-didemethyl-8-hydroxy-5-deazariboflavin synthase subunit CofH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057436.1 protein_id gnl|my_center|LOCUS_31270 39270 38017 gene locus_tag LOCUS_31280 39270 38017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31280 40827 39307 gene locus_tag LOCUS_31290 40827 39307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31290 41773 43149 gene locus_tag LOCUS_31300 41773 43149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31300 43453 44703 gene locus_tag LOCUS_31310 43453 44703 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_039737632.1 protein_id gnl|my_center|LOCUS_31310 44765 46552 gene locus_tag LOCUS_31320 44765 46552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31320 47182 46577 gene locus_tag LOCUS_31330 47182 46577 CDS product DUF3318 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058121.1 protein_id gnl|my_center|LOCUS_31330 49356 47695 gene locus_tag LOCUS_31340 49356 47695 CDS product iron uptake porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058157.1 protein_id gnl|my_center|LOCUS_31340 50189 49512 gene locus_tag LOCUS_31350 50189 49512 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142793.1 protein_id gnl|my_center|LOCUS_31350 52882 50645 gene locus_tag LOCUS_31360 52882 50645 CDS product PhoX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140564.1 protein_id gnl|my_center|LOCUS_31360 54044 53358 gene locus_tag LOCUS_31370 gene phoU 54044 53358 CDS product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583268.1 protein_id gnl|my_center|LOCUS_31370 55368 54055 gene locus_tag LOCUS_31380 55368 54055 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056769.1 protein_id gnl|my_center|LOCUS_31380 56171 55410 gene locus_tag LOCUS_31390 56171 55410 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056437.1 protein_id gnl|my_center|LOCUS_31390 57247 57879 gene locus_tag LOCUS_31400 57247 57879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_31400 57977 58360 gene locus_tag LOCUS_31410 57977 58360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31410 60326 59553 gene locus_tag LOCUS_31420 gene hisA 60326 59553 CDS product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino]imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056071.1 protein_id gnl|my_center|LOCUS_31420 61560 60370 gene locus_tag LOCUS_31430 61560 60370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31430 61917 61570 gene locus_tag LOCUS_31440 61917 61570 CDS product DUF3593 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144013.1 protein_id gnl|my_center|LOCUS_31440 62261 61914 gene locus_tag LOCUS_31450 62261 61914 CDS product DUF2499 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057277.1 protein_id gnl|my_center|LOCUS_31450 62256 63344 gene locus_tag LOCUS_31460 gene csaB 62256 63344 CDS product polysaccharide pyruvyl transferase CsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057733.1 protein_id gnl|my_center|LOCUS_31460 63788 63444 gene locus_tag LOCUS_31470 63788 63444 CDS product DUF5519 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000010317.1 protein_id gnl|my_center|LOCUS_31470 64635 63922 gene locus_tag LOCUS_31480 64635 63922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31480 65825 65082 gene locus_tag LOCUS_31490 65825 65082 CDS product DevA family ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056490.1 protein_id gnl|my_center|LOCUS_31490 67011 65845 gene locus_tag LOCUS_31500 gene devC 67011 65845 CDS product ABC transporter permease DevC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056491.1 protein_id gnl|my_center|LOCUS_31500 68165 67041 gene locus_tag LOCUS_31510 68165 67041 CDS product ABC exporter membrane fusion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141428.1 protein_id gnl|my_center|LOCUS_31510 68417 68926 gene locus_tag LOCUS_31520 68417 68926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31520 68997 69476 gene locus_tag LOCUS_31530 68997 69476 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143135.1 protein_id gnl|my_center|LOCUS_31530 >Feature sequence039 653 1210 gene locus_tag LOCUS_31540 gene efp 653 1210 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057134.1 protein_id gnl|my_center|LOCUS_31540 1341 1886 gene locus_tag LOCUS_31550 gene accB 1341 1886 CDS product acetyl-CoA carboxylase biotin carboxyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921156.1 protein_id gnl|my_center|LOCUS_31550 1952 2296 gene locus_tag LOCUS_31560 1952 2296 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929420.1 protein_id gnl|my_center|LOCUS_31560 3201 2584 gene locus_tag LOCUS_31570 3201 2584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31570 4076 3267 gene locus_tag LOCUS_31580 4076 3267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31580 5971 4169 gene locus_tag LOCUS_31590 5971 4169 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056620.1 protein_id gnl|my_center|LOCUS_31590 6054 7460 gene locus_tag LOCUS_31600 6054 7460 CDS product glycerol acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141145.1 protein_id gnl|my_center|LOCUS_31600 7723 8631 gene locus_tag LOCUS_31610 7723 8631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31610 9224 8637 gene locus_tag LOCUS_31620 9224 8637 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392284.1 protein_id gnl|my_center|LOCUS_31620 11014 9464 gene locus_tag LOCUS_31630 11014 9464 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142503.1 protein_id gnl|my_center|LOCUS_31630 12416 11097 gene locus_tag LOCUS_31640 gene rimO 12416 11097 CDS product 30S ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057404.1 protein_id gnl|my_center|LOCUS_31640 13258 13440 gene locus_tag LOCUS_31650 13258 13440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31650 13466 14314 gene locus_tag LOCUS_31660 13466 14314 CDS product BtpA/SgcQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056034.1 protein_id gnl|my_center|LOCUS_31660 14457 15422 gene locus_tag LOCUS_31670 14457 15422 CDS product vitamin K epoxide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920721.1 protein_id gnl|my_center|LOCUS_31670 15733 17940 gene locus_tag LOCUS_31680 15733 17940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31680 18606 18944 gene locus_tag LOCUS_31690 18606 18944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31690 20631 18958 gene locus_tag LOCUS_31700 gene nadB 20631 18958 CDS product L-aspartate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058240.1 protein_id gnl|my_center|LOCUS_31700 21506 21045 gene locus_tag LOCUS_31710 21506 21045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31710 22537 21881 gene locus_tag LOCUS_31720 22537 21881 CDS product DUF3120 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_190832035.1 protein_id gnl|my_center|LOCUS_31720 22814 23764 gene locus_tag LOCUS_31730 22814 23764 CDS product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056584.1 protein_id gnl|my_center|LOCUS_31730 23936 24898 gene locus_tag LOCUS_31740 23936 24898 CDS product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143271.1 protein_id gnl|my_center|LOCUS_31740 25952 25062 gene locus_tag LOCUS_31750 25952 25062 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000748460.1 protein_id gnl|my_center|LOCUS_31750 26778 25969 gene locus_tag LOCUS_31760 26778 25969 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003372869.1 protein_id gnl|my_center|LOCUS_31760 26900 27991 gene locus_tag LOCUS_31770 26900 27991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31770 28411 29409 gene locus_tag LOCUS_31780 28411 29409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_31780 30184 29789 gene locus_tag LOCUS_31790 30184 29789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31790 30561 30181 gene locus_tag LOCUS_31800 30561 30181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31800 32291 31398 gene locus_tag LOCUS_31810 32291 31398 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732470.1 protein_id gnl|my_center|LOCUS_31810 32687 34030 gene locus_tag LOCUS_31820 32687 34030 CDS product TIGR03279 family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057484.1 protein_id gnl|my_center|LOCUS_31820 34340 36955 gene locus_tag LOCUS_31830 34340 36955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31830 37927 42690 gene locus_tag LOCUS_31840 37927 42690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_31840 42668 43876 gene locus_tag LOCUS_31850 42668 43876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31850 44091 45185 gene locus_tag LOCUS_31860 44091 45185 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546841.1 protein_id gnl|my_center|LOCUS_31860 45815 47158 gene locus_tag LOCUS_31870 45815 47158 CDS product sorbosone dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142597.1 protein_id gnl|my_center|LOCUS_31870 47913 47155 gene locus_tag LOCUS_31880 47913 47155 CDS product HEAT repeat domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056184.1 protein_id gnl|my_center|LOCUS_31880 48588 48058 gene locus_tag LOCUS_31890 48588 48058 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929341.1 protein_id gnl|my_center|LOCUS_31890 49470 49069 gene locus_tag LOCUS_31900 49470 49069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31900 50628 49477 gene locus_tag LOCUS_31910 50628 49477 CDS product AmpG family muropeptide MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056626.1 protein_id gnl|my_center|LOCUS_31910 52353 50890 gene locus_tag LOCUS_31920 52353 50890 CDS product DNA phosphorothioation-associated putative methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005109925.1 protein_id gnl|my_center|LOCUS_31920 52858 52469 gene locus_tag LOCUS_31930 gene dndE 52858 52469 CDS product DNA sulfur modification protein DndE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012296384.1 protein_id gnl|my_center|LOCUS_31930 54919 52925 gene locus_tag LOCUS_31940 gene dndD 54919 52925 CDS product DNA sulfur modification protein DndD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005109923.1 protein_id gnl|my_center|LOCUS_31940 56676 55066 gene locus_tag LOCUS_31950 gene dndC 56676 55066 CDS product DNA phosphorothioation system sulfurtransferase DndC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005109921.1 protein_id gnl|my_center|LOCUS_31950 56840 58438 gene locus_tag LOCUS_31960 56840 58438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31960 58822 59868 gene locus_tag LOCUS_31970 58822 59868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31970 60368 59895 gene locus_tag LOCUS_31980 60368 59895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31980 62795 60723 gene locus_tag LOCUS_31990 62795 60723 CDS product SMC family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016398.1 protein_id gnl|my_center|LOCUS_31990 62980 62792 gene locus_tag LOCUS_32000 62980 62792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32000 64705 63341 gene locus_tag LOCUS_32010 64705 63341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32010 65569 64964 gene locus_tag LOCUS_32020 gene lexA 65569 64964 CDS product transcriptional repressor LexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125487.1 protein_id gnl|my_center|LOCUS_32020 66657 65731 gene locus_tag LOCUS_32030 gene argF 66657 65731 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920816.1 protein_id gnl|my_center|LOCUS_32030 67019 67090 gene locus_tag LOCUS_t00220 67019 67090 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 67130 67900 gene locus_tag LOCUS_32040 67130 67900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32040 68947 67940 gene locus_tag LOCUS_32050 68947 67940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32050 >Feature sequence040 359 790 gene locus_tag LOCUS_32060 359 790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32060 3250 1280 gene locus_tag LOCUS_32070 gene dnaG 3250 1280 CDS product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057157.1 protein_id gnl|my_center|LOCUS_32070 3406 4758 gene locus_tag LOCUS_32080 3406 4758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32080 5464 6222 gene locus_tag LOCUS_32090 5464 6222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32090 6348 7388 gene locus_tag LOCUS_32100 6348 7388 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005091697.1 protein_id gnl|my_center|LOCUS_32100 8705 7851 gene locus_tag LOCUS_32110 8705 7851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32110 9630 8857 gene locus_tag LOCUS_32120 9630 8857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32120 10287 10460 gene locus_tag LOCUS_32130 10287 10460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32130 11147 10740 gene locus_tag LOCUS_32140 11147 10740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32140 11607 12494 gene locus_tag LOCUS_32150 11607 12494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141312.1 protein_id gnl|my_center|LOCUS_32150 13063 12551 gene locus_tag LOCUS_32160 13063 12551 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000256461.1 protein_id gnl|my_center|LOCUS_32160 13782 14696 gene locus_tag LOCUS_32170 13782 14696 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207505.1 protein_id gnl|my_center|LOCUS_32170 15656 14721 gene locus_tag LOCUS_32180 15656 14721 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143348.1 protein_id gnl|my_center|LOCUS_32180 15966 16316 gene locus_tag LOCUS_32190 15966 16316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32190 16758 17501 gene locus_tag LOCUS_32200 16758 17501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32200 18161 19153 gene locus_tag LOCUS_32210 18161 19153 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001237475.1 protein_id gnl|my_center|LOCUS_32210 19283 20836 gene locus_tag LOCUS_32220 19283 20836 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001089388.1 protein_id gnl|my_center|LOCUS_32220 20833 21831 gene locus_tag LOCUS_32230 20833 21831 CDS product ribose ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095095.1 protein_id gnl|my_center|LOCUS_32230 24044 22152 gene locus_tag LOCUS_32240 24044 22152 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140636.1 protein_id gnl|my_center|LOCUS_32240 25734 24208 gene locus_tag LOCUS_32250 gene kaiC 25734 24208 CDS product circadian clock protein KaiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259117.1 protein_id gnl|my_center|LOCUS_32250 26078 25806 gene locus_tag LOCUS_32260 26078 25806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32260 26319 27965 gene locus_tag LOCUS_32270 26319 27965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32270 27962 28834 gene locus_tag LOCUS_32280 27962 28834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32280 29609 32623 gene locus_tag LOCUS_32290 29609 32623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32290 32795 33535 gene locus_tag LOCUS_32300 32795 33535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32300 33748 37371 gene locus_tag LOCUS_32310 33748 37371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32310 38682 38855 gene locus_tag LOCUS_32320 38682 38855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_32320 38958 39161 gene locus_tag LOCUS_32330 38958 39161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_32330 39284 40051 gene locus_tag LOCUS_32340 39284 40051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32340 40737 43748 gene locus_tag LOCUS_32350 40737 43748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32350 43857 45458 gene locus_tag LOCUS_32360 43857 45458 CDS product HlyD family type I secretion periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172625978.1 protein_id gnl|my_center|LOCUS_32360 48844 45872 gene locus_tag LOCUS_32370 48844 45872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32370 49779 48913 gene locus_tag LOCUS_32380 49779 48913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32380 51571 50117 gene locus_tag LOCUS_32390 51571 50117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32390 53684 51615 gene locus_tag LOCUS_32400 53684 51615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32400 55332 54037 gene locus_tag LOCUS_32410 55332 54037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32410 57065 57562 gene locus_tag LOCUS_32420 57065 57562 CDS product DUF427 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058277.1 protein_id gnl|my_center|LOCUS_32420 57756 58220 gene locus_tag LOCUS_32430 57756 58220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32430 58228 59388 gene locus_tag LOCUS_32440 58228 59388 CDS product class III poly(R)-hydroxyalkanoic acid synthase subunit PhaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037305.1 protein_id gnl|my_center|LOCUS_32440 59541 59966 gene locus_tag LOCUS_32450 59541 59966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32450 61178 59970 gene locus_tag LOCUS_32460 61178 59970 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142255.1 protein_id gnl|my_center|LOCUS_32460 61950 61687 gene locus_tag LOCUS_32470 61950 61687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32470 62254 63456 gene locus_tag LOCUS_32480 62254 63456 CDS product thiolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228024.1 protein_id gnl|my_center|LOCUS_32480 63848 64885 gene locus_tag LOCUS_32490 63848 64885 CDS product hemerythrin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142279.1 protein_id gnl|my_center|LOCUS_32490 65142 65864 gene locus_tag LOCUS_32500 gene fabG 65142 65864 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942248.1 protein_id gnl|my_center|LOCUS_32500 65881 66768 gene locus_tag LOCUS_32510 65881 66768 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256673.1 protein_id gnl|my_center|LOCUS_32510 66796 67812 gene locus_tag LOCUS_32520 66796 67812 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140745.1 protein_id gnl|my_center|LOCUS_32520 67843 68397 gene locus_tag LOCUS_32530 67843 68397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32530 >Feature sequence041 1167 241 gene locus_tag LOCUS_32540 gene murQ 1167 241 CDS product N-acetylmuramic acid 6-phosphate etherase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057013.1 protein_id gnl|my_center|LOCUS_32540 1680 1258 gene locus_tag LOCUS_32550 1680 1258 CDS product DUF3110 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056170.1 protein_id gnl|my_center|LOCUS_32550 2984 1728 gene locus_tag LOCUS_32560 2984 1728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32560 3730 9489 gene locus_tag LOCUS_32570 3730 9489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32570 10250 9486 gene locus_tag LOCUS_32580 10250 9486 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057678.1 protein_id gnl|my_center|LOCUS_32580 11548 10361 gene locus_tag LOCUS_32590 11548 10361 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011176601.1 protein_id gnl|my_center|LOCUS_32590 12848 11643 gene locus_tag LOCUS_32600 12848 11643 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012165757.1 protein_id gnl|my_center|LOCUS_32600 12949 14865 gene locus_tag LOCUS_32610 gene shc 12949 14865 CDS product squalene--hopene cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058142.1 protein_id gnl|my_center|LOCUS_32610 15296 14982 gene locus_tag LOCUS_32620 15296 14982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32620 15504 15277 gene locus_tag LOCUS_32630 15504 15277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32630 17169 15589 gene locus_tag LOCUS_32640 17169 15589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32640 17675 17938 gene locus_tag LOCUS_32650 17675 17938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32650 18042 19139 gene locus_tag LOCUS_32660 18042 19139 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058109.1 protein_id gnl|my_center|LOCUS_32660 19841 19296 gene locus_tag LOCUS_32670 19841 19296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32670 21178 20423 gene locus_tag LOCUS_32680 21178 20423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32680 22297 21350 gene locus_tag LOCUS_32690 22297 21350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32690 22993 25878 gene locus_tag LOCUS_32700 22993 25878 CDS product glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142684.1 protein_id gnl|my_center|LOCUS_32700 25875 26216 gene locus_tag LOCUS_32710 25875 26216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32710 26568 27113 gene locus_tag LOCUS_32720 26568 27113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32720 27546 28424 gene locus_tag LOCUS_32730 27546 28424 CDS product lipid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525079.1 protein_id gnl|my_center|LOCUS_32730 28479 29084 gene locus_tag LOCUS_32740 28479 29084 CDS product exopolysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067671.1 protein_id gnl|my_center|LOCUS_32740 29406 29699 gene locus_tag LOCUS_32750 29406 29699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32750 30882 29728 gene locus_tag LOCUS_32760 30882 29728 CDS product RNA-guided endonuclease TnpB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289074.1 protein_id gnl|my_center|LOCUS_32760 31760 31185 gene locus_tag LOCUS_32770 31760 31185 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143802.1 protein_id gnl|my_center|LOCUS_32770 33127 32006 gene locus_tag LOCUS_32780 gene aroB 33127 32006 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056627.1 protein_id gnl|my_center|LOCUS_32780 33697 33317 gene locus_tag LOCUS_32790 33697 33317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32790 33775 33963 gene locus_tag LOCUS_32800 33775 33963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32800 35044 34034 gene locus_tag LOCUS_32810 gene bioB 35044 34034 CDS product biotin synthase BioB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962410.1 protein_id gnl|my_center|LOCUS_32810 35185 35757 gene locus_tag LOCUS_32820 35185 35757 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197529990.1 protein_id gnl|my_center|LOCUS_32820 35839 37296 gene locus_tag LOCUS_32830 35839 37296 CDS product YdiU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193345479.1 protein_id gnl|my_center|LOCUS_32830 38038 38682 gene locus_tag LOCUS_32840 38038 38682 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975511.1 protein_id gnl|my_center|LOCUS_32840 39936 39118 gene locus_tag LOCUS_32850 39936 39118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32850 40391 40059 gene locus_tag LOCUS_32860 40391 40059 CDS product DUF565 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057010.1 protein_id gnl|my_center|LOCUS_32860 40783 41391 gene locus_tag LOCUS_32870 40783 41391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32870 41645 43498 gene locus_tag LOCUS_32880 41645 43498 CDS product glycosyltransferase family 39 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143571.1 protein_id gnl|my_center|LOCUS_32880 47273 43503 gene locus_tag LOCUS_32890 47273 43503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32890 48439 48750 gene locus_tag LOCUS_32900 48439 48750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32900 48859 49182 gene locus_tag LOCUS_32910 gene kaiB 48859 49182 CDS product circadian clock protein KaiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056333.1 protein_id gnl|my_center|LOCUS_32910 49271 50833 gene locus_tag LOCUS_32920 gene kaiC 49271 50833 CDS product circadian clock protein KaiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056334.1 protein_id gnl|my_center|LOCUS_32920 50905 53070 gene locus_tag LOCUS_32930 50905 53070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32930 53318 53695 gene locus_tag LOCUS_32940 53318 53695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32940 53924 54430 gene locus_tag LOCUS_32950 53924 54430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099798166.1 protein_id gnl|my_center|LOCUS_32950 54523 55302 gene locus_tag LOCUS_32960 54523 55302 CDS product photosystem II S4 domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140394.1 protein_id gnl|my_center|LOCUS_32960 56196 55411 gene locus_tag LOCUS_32970 56196 55411 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057728.1 protein_id gnl|my_center|LOCUS_32970 56356 57681 gene locus_tag LOCUS_32980 56356 57681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32980 57915 59342 gene locus_tag LOCUS_32990 57915 59342 CDS product RNA-guided endonuclease TnpB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041233550.1 protein_id gnl|my_center|LOCUS_32990 59435 59508 gene locus_tag LOCUS_t00230 59435 59508 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 59922 60296 gene locus_tag LOCUS_33000 59922 60296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33000 62174 60681 gene locus_tag LOCUS_33010 62174 60681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33010 62340 63770 gene locus_tag LOCUS_33020 gene lpdA 62340 63770 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920772.1 protein_id gnl|my_center|LOCUS_33020 63849 64748 gene locus_tag LOCUS_33030 gene trpC 63849 64748 CDS product indole-3-glycerol phosphate synthase TrpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056545.1 protein_id gnl|my_center|LOCUS_33030 64845 65099 gene locus_tag LOCUS_33040 64845 65099 CDS product DUF5340 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058031.1 protein_id gnl|my_center|LOCUS_33040 66039 67223 gene locus_tag LOCUS_33050 66039 67223 CDS product RNA-guided endonuclease TnpB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897221.1 protein_id gnl|my_center|LOCUS_33050 67421 67657 gene locus_tag LOCUS_33060 67421 67657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33060 67729 68454 gene locus_tag LOCUS_33070 67729 68454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33070 >Feature sequence042 1486 890 gene locus_tag LOCUS_33080 1486 890 CDS product CPBP family intramembrane metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056337.1 protein_id gnl|my_center|LOCUS_33080 2625 1558 gene locus_tag LOCUS_33090 2625 1558 CDS product DUF3326 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056519.1 protein_id gnl|my_center|LOCUS_33090 2924 2748 gene locus_tag LOCUS_33100 2924 2748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33100 3260 2946 gene locus_tag LOCUS_33110 3260 2946 CDS product 2Fe-2S iron-sulfur cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056338.1 protein_id gnl|my_center|LOCUS_33110 3519 6185 gene locus_tag LOCUS_33120 gene acnB 3519 6185 CDS product bifunctional aconitate hydratase 2/2-methylisocitrate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099797887.1 protein_id gnl|my_center|LOCUS_33120 6546 7226 gene locus_tag LOCUS_33130 6546 7226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33130 8570 7527 gene locus_tag LOCUS_33140 8570 7527 CDS product DUF1611 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903345.1 protein_id gnl|my_center|LOCUS_33140 9606 8554 gene locus_tag LOCUS_33150 9606 8554 CDS product dipeptide epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903344.1 protein_id gnl|my_center|LOCUS_33150 9756 10304 gene locus_tag LOCUS_33160 9756 10304 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080176.1 protein_id gnl|my_center|LOCUS_33160 11560 10637 gene locus_tag LOCUS_33170 11560 10637 CDS product nucleoside hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071727514.1 protein_id gnl|my_center|LOCUS_33170 11574 12005 gene locus_tag LOCUS_33180 11574 12005 CDS product nucleoside deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172598099.1 protein_id gnl|my_center|LOCUS_33180 12537 12938 gene locus_tag LOCUS_33190 12537 12938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33190 14016 13066 gene locus_tag LOCUS_33200 gene rbsK 14016 13066 CDS product ribokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257591.1 protein_id gnl|my_center|LOCUS_33200 14537 14157 gene locus_tag LOCUS_33210 14537 14157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33210 14764 14534 gene locus_tag LOCUS_33220 14764 14534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33220 15449 14868 gene locus_tag LOCUS_33230 15449 14868 CDS product sugar O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141816.1 protein_id gnl|my_center|LOCUS_33230 15656 16837 gene locus_tag LOCUS_33240 15656 16837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33240 18137 16827 gene locus_tag LOCUS_33250 18137 16827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33250 19318 18944 gene locus_tag LOCUS_33260 gene folB 19318 18944 CDS product dihydroneopterin aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099798382.1 protein_id gnl|my_center|LOCUS_33260 19474 21273 gene locus_tag LOCUS_33270 gene menD 19474 21273 CDS product 2-succinyl-5-enolpyruvyl-6-hydroxy-3-cyclohexene-1-carboxylic-acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055985.1 protein_id gnl|my_center|LOCUS_33270 21719 22987 gene locus_tag LOCUS_33280 21719 22987 CDS product RNA-guided endonuclease TnpB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000942660.1 protein_id gnl|my_center|LOCUS_33280 25079 22989 gene locus_tag LOCUS_33290 25079 22989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33290 25264 25049 gene locus_tag LOCUS_33300 25264 25049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33300 25508 26305 gene locus_tag LOCUS_33310 25508 26305 CDS product TIGR00297 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_073550381.1 protein_id gnl|my_center|LOCUS_33310 26494 27252 gene locus_tag LOCUS_33320 26494 27252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33320 27201 29924 gene locus_tag LOCUS_33330 27201 29924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33330 30164 30625 gene locus_tag LOCUS_33340 30164 30625 CDS product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056265.1 protein_id gnl|my_center|LOCUS_33340 31317 30649 gene locus_tag LOCUS_33350 31317 30649 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125221.1 protein_id gnl|my_center|LOCUS_33350 31850 32473 gene locus_tag LOCUS_33360 31850 32473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33360 33494 32760 gene locus_tag LOCUS_33370 33494 32760 CDS product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920927.1 protein_id gnl|my_center|LOCUS_33370 33698 35275 gene locus_tag LOCUS_33380 33698 35275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33380 35289 38009 gene locus_tag LOCUS_33390 35289 38009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33390 39342 38263 gene locus_tag LOCUS_33400 39342 38263 CDS product ATP-dependent 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388802.1 protein_id gnl|my_center|LOCUS_33400 40091 39843 gene locus_tag LOCUS_33410 40091 39843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33410 42208 40178 gene locus_tag LOCUS_33420 gene sir 42208 40178 CDS product sulfite reductase, ferredoxin dependent inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920675.1 protein_id gnl|my_center|LOCUS_33420 43082 42537 gene locus_tag LOCUS_33430 43082 42537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33430 43254 43066 gene locus_tag LOCUS_33440 43254 43066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33440 43382 44380 gene locus_tag LOCUS_33450 43382 44380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33450 45513 46508 gene locus_tag LOCUS_33460 45513 46508 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928745.1 protein_id gnl|my_center|LOCUS_33460 47248 46616 gene locus_tag LOCUS_33470 47248 46616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33470 49131 47785 gene locus_tag LOCUS_33480 49131 47785 CDS product trans-splicing intein-formed DNA polymerase III subunit alpha C-terminal partner DnaE-C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057904.1 protein_id gnl|my_center|LOCUS_33480 49329 50783 gene locus_tag LOCUS_33490 gene gatA 49329 50783 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920797.1 protein_id gnl|my_center|LOCUS_33490 51810 50824 gene locus_tag LOCUS_33500 51810 50824 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057337.1 protein_id gnl|my_center|LOCUS_33500 51952 52836 gene locus_tag LOCUS_33510 51952 52836 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929219.1 protein_id gnl|my_center|LOCUS_33510 53215 54324 gene locus_tag LOCUS_33520 53215 54324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33520 55129 56415 gene locus_tag LOCUS_33530 55129 56415 CDS product serine/threonine-protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058264.1 protein_id gnl|my_center|LOCUS_33530 56456 57976 gene locus_tag LOCUS_33540 56456 57976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33540 58750 58070 gene locus_tag LOCUS_33550 58750 58070 CDS product HAD-IA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142341.1 protein_id gnl|my_center|LOCUS_33550 58947 59720 gene locus_tag LOCUS_33560 58947 59720 CDS product glucosamine-6-phosphate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762537.1 protein_id gnl|my_center|LOCUS_33560 60438 60010 gene locus_tag LOCUS_33570 60438 60010 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404734.1 protein_id gnl|my_center|LOCUS_33570 60790 60416 gene locus_tag LOCUS_33580 60790 60416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33580 61681 60908 gene locus_tag LOCUS_33590 61681 60908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33590 62694 61747 gene locus_tag LOCUS_33600 62694 61747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33600 63440 64933 gene locus_tag LOCUS_33610 63440 64933 CDS product multicopper oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071802696.1 protein_id gnl|my_center|LOCUS_33610 65815 65600 gene locus_tag LOCUS_33620 65815 65600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33620 65985 68102 gene locus_tag LOCUS_33630 65985 68102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33630 >Feature sequence043 131 487 gene locus_tag LOCUS_33640 131 487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33640 375 650 gene locus_tag LOCUS_33650 375 650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33650 1431 592 gene locus_tag LOCUS_33660 1431 592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33660 2052 1501 gene locus_tag LOCUS_33670 2052 1501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055861.1 protein_id gnl|my_center|LOCUS_33670 3368 2472 gene locus_tag LOCUS_33680 gene argB 3368 2472 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057248.1 protein_id gnl|my_center|LOCUS_33680 4170 3607 gene locus_tag LOCUS_33690 4170 3607 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056726.1 protein_id gnl|my_center|LOCUS_33690 5865 4243 gene locus_tag LOCUS_33700 5865 4243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33700 6344 6535 gene locus_tag LOCUS_33710 6344 6535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33710 7256 6546 gene locus_tag LOCUS_33720 7256 6546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33720 7979 7356 gene locus_tag LOCUS_33730 7979 7356 CDS product flavin prenyltransferase UbiX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_198405961.1 protein_id gnl|my_center|LOCUS_33730 10533 8173 gene locus_tag LOCUS_33740 10533 8173 CDS product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057710.1 protein_id gnl|my_center|LOCUS_33740 11682 12485 gene locus_tag LOCUS_33750 11682 12485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057732.1 protein_id gnl|my_center|LOCUS_33750 13149 12544 gene locus_tag LOCUS_33760 gene clpP 13149 12544 CDS product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056360.1 protein_id gnl|my_center|LOCUS_33760 14357 16423 gene locus_tag LOCUS_33770 14357 16423 CDS product thioredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920751.1 protein_id gnl|my_center|LOCUS_33770 17715 21005 gene locus_tag LOCUS_33780 17715 21005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33780 21042 21584 gene locus_tag LOCUS_33790 21042 21584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33790 21795 22538 gene locus_tag LOCUS_33800 21795 22538 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140728.1 protein_id gnl|my_center|LOCUS_33800 22623 23249 gene locus_tag LOCUS_33810 22623 23249 CDS product molybdenum cofactor guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197530085.1 protein_id gnl|my_center|LOCUS_33810 23360 23878 gene locus_tag LOCUS_33820 gene ilvN 23360 23878 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056724.1 protein_id gnl|my_center|LOCUS_33820 24439 24248 gene locus_tag LOCUS_33830 24439 24248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33830 26826 24619 gene locus_tag LOCUS_33840 26826 24619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33840 28081 27074 gene locus_tag LOCUS_33850 28081 27074 CDS product zinc-dependent alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055856.1 protein_id gnl|my_center|LOCUS_33850 30039 28270 gene locus_tag LOCUS_33860 30039 28270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33860 31639 30653 gene locus_tag LOCUS_33870 gene arsS 31639 30653 CDS product arsenosugar biosynthesis radical SAM protein ArsS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272452.1 protein_id gnl|my_center|LOCUS_33870 32776 31808 gene locus_tag LOCUS_33880 gene arsM 32776 31808 CDS product arsenosugar biosynthesis arsenite methyltransferase ArsM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143344.1 protein_id gnl|my_center|LOCUS_33880 33487 33200 gene locus_tag LOCUS_33890 33487 33200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33890 34425 35624 gene locus_tag LOCUS_33900 34425 35624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33900 36407 35691 gene locus_tag LOCUS_33910 36407 35691 CDS product DUF4079 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057843.1 protein_id gnl|my_center|LOCUS_33910 36737 36486 gene locus_tag LOCUS_33920 36737 36486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33920 37090 39390 gene locus_tag LOCUS_33930 37090 39390 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057632.1 protein_id gnl|my_center|LOCUS_33930 41043 39460 gene locus_tag LOCUS_33940 41043 39460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33940 43032 41422 gene locus_tag LOCUS_33950 43032 41422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33950 43404 43796 gene locus_tag LOCUS_33960 43404 43796 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480246.1 protein_id gnl|my_center|LOCUS_33960 44995 44072 gene locus_tag LOCUS_33970 44995 44072 CDS product NAD(+) kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056335.1 protein_id gnl|my_center|LOCUS_33970 45305 45000 gene locus_tag LOCUS_33980 gene nuoK 45305 45000 CDS product NADH-quinone oxidoreductase subunit NuoK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056517.1 protein_id gnl|my_center|LOCUS_33980 46015 45404 gene locus_tag LOCUS_33990 46015 45404 CDS product NADH-quinone oxidoreductase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056516.1 protein_id gnl|my_center|LOCUS_33990 46693 46112 gene locus_tag LOCUS_34000 gene ndhI 46693 46112 CDS product NAD(P)H-quinone oxidoreductase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056515.1 protein_id gnl|my_center|LOCUS_34000 47908 46790 gene locus_tag LOCUS_34010 gene nuoH 47908 46790 CDS product NADH-quinone oxidoreductase subunit NuoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_126985484.1 protein_id gnl|my_center|LOCUS_34010 49482 48346 gene locus_tag LOCUS_34020 49482 48346 CDS product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058225.1 protein_id gnl|my_center|LOCUS_34020 50092 49598 gene locus_tag LOCUS_34030 gene sixA 50092 49598 CDS product phosphohistidine phosphatase SixA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057106.1 protein_id gnl|my_center|LOCUS_34030 51497 50214 gene locus_tag LOCUS_34040 51497 50214 CDS product bifunctional oligoribonuclease/PAP phosphatase NrnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057105.1 protein_id gnl|my_center|LOCUS_34040 52398 51901 gene locus_tag LOCUS_34050 52398 51901 CDS product HNH endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056347.1 protein_id gnl|my_center|LOCUS_34050 52696 53883 gene locus_tag LOCUS_34060 gene alr 52696 53883 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056313.1 protein_id gnl|my_center|LOCUS_34060 54004 54086 gene locus_tag LOCUS_t00240 54004 54086 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 55324 56397 gene locus_tag LOCUS_34070 55324 56397 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099797661.1 protein_id gnl|my_center|LOCUS_34070 56464 56841 gene locus_tag LOCUS_34080 56464 56841 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056419.1 protein_id gnl|my_center|LOCUS_34080 56847 57341 gene locus_tag LOCUS_34090 56847 57341 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056418.1 protein_id gnl|my_center|LOCUS_34090 57405 60215 gene locus_tag LOCUS_34100 57405 60215 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920715.1 protein_id gnl|my_center|LOCUS_34100 60311 63358 gene locus_tag LOCUS_34110 60311 63358 CDS product hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056416.1 protein_id gnl|my_center|LOCUS_34110 64031 64405 gene locus_tag LOCUS_34120 64031 64405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34120 64878 65315 gene locus_tag LOCUS_34130 64878 65315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34130 65753 65469 gene locus_tag LOCUS_34140 65753 65469 CDS product DUF427 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259052.1 protein_id gnl|my_center|LOCUS_34140 66988 66758 gene locus_tag LOCUS_34150 66988 66758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34150 >Feature sequence044 734 1786 gene locus_tag LOCUS_34160 734 1786 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004530666.1 protein_id gnl|my_center|LOCUS_34160 2008 4821 gene locus_tag LOCUS_34170 2008 4821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34170 5452 4925 gene locus_tag LOCUS_34180 5452 4925 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004408018.1 protein_id gnl|my_center|LOCUS_34180 6825 5554 gene locus_tag LOCUS_34190 6825 5554 CDS product inorganic phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707483.1 protein_id gnl|my_center|LOCUS_34190 7977 6931 gene locus_tag LOCUS_34200 7977 6931 CDS product zinc-dependent dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920875.1 protein_id gnl|my_center|LOCUS_34200 8617 8081 gene locus_tag LOCUS_34210 8617 8081 CDS product PIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_097615831.1 protein_id gnl|my_center|LOCUS_34210 9145 8684 gene locus_tag LOCUS_34220 9145 8684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34220 9350 11122 gene locus_tag LOCUS_34230 9350 11122 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057660.1 protein_id gnl|my_center|LOCUS_34230 11228 11440 gene locus_tag LOCUS_34240 11228 11440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34240 13114 12215 gene locus_tag LOCUS_34250 13114 12215 CDS product ferritin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142304.1 protein_id gnl|my_center|LOCUS_34250 14247 13192 gene locus_tag LOCUS_34260 14247 13192 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057211.1 protein_id gnl|my_center|LOCUS_34260 14552 14752 gene locus_tag LOCUS_34270 14552 14752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34270 16288 14873 gene locus_tag LOCUS_34280 gene glnA 16288 14873 CDS product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057427.1 protein_id gnl|my_center|LOCUS_34280 16654 17163 gene locus_tag LOCUS_34290 gene apcB 16654 17163 CDS product allophycocyanin subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057869.1 protein_id gnl|my_center|LOCUS_34290 18418 18885 gene locus_tag LOCUS_34300 18418 18885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34300 19475 20068 gene locus_tag LOCUS_34310 19475 20068 CDS product serine esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013614293.1 protein_id gnl|my_center|LOCUS_34310 20108 20815 gene locus_tag LOCUS_34320 20108 20815 CDS product haloacid dehalogenase type II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028987.1 protein_id gnl|my_center|LOCUS_34320 21190 22176 gene locus_tag LOCUS_34330 21190 22176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34330 22473 22171 gene locus_tag LOCUS_34340 22473 22171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34340 22775 23203 gene locus_tag LOCUS_34350 22775 23203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34350 23210 23389 gene locus_tag LOCUS_34360 23210 23389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34360 23696 23959 gene locus_tag LOCUS_34370 23696 23959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_169153852.1 protein_id gnl|my_center|LOCUS_34370 25513 24002 gene locus_tag LOCUS_34380 25513 24002 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003107137.1 protein_id gnl|my_center|LOCUS_34380 25954 27081 gene locus_tag LOCUS_34390 25954 27081 CDS product ATP/GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846705.1 protein_id gnl|my_center|LOCUS_34390 27078 27827 gene locus_tag LOCUS_34400 27078 27827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34400 29071 28052 gene locus_tag LOCUS_34410 29071 28052 CDS product NADP-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478363.1 protein_id gnl|my_center|LOCUS_34410 29372 29800 gene locus_tag LOCUS_34420 29372 29800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34420 29807 30643 gene locus_tag LOCUS_34430 29807 30643 CDS product TlyA family rRNA (cytidine-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057297.1 protein_id gnl|my_center|LOCUS_34430 32277 30778 gene locus_tag LOCUS_34440 32277 30778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34440 32741 34345 gene locus_tag LOCUS_34450 32741 34345 CDS product adenylate/guanylate cyclase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257013.1 protein_id gnl|my_center|LOCUS_34450 34805 36172 gene locus_tag LOCUS_34460 34805 36172 CDS product NAD-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142799.1 protein_id gnl|my_center|LOCUS_34460 36211 37854 gene locus_tag LOCUS_34470 36211 37854 CDS product acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920935.1 protein_id gnl|my_center|LOCUS_34470 38921 38172 gene locus_tag LOCUS_34480 38921 38172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34480 39997 38984 gene locus_tag LOCUS_34490 39997 38984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34490 40398 39937 gene locus_tag LOCUS_34500 40398 39937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34500 42371 41220 gene locus_tag LOCUS_34510 42371 41220 CDS product alanine--glyoxylate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_036892385.1 protein_id gnl|my_center|LOCUS_34510 43037 45901 gene locus_tag LOCUS_34520 43037 45901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34520 45989 48193 gene locus_tag LOCUS_34530 45989 48193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34530 48241 48633 gene locus_tag LOCUS_34540 48241 48633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34540 50203 48986 gene locus_tag LOCUS_34550 50203 48986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056196.1 protein_id gnl|my_center|LOCUS_34550 50387 50211 gene locus_tag LOCUS_34560 50387 50211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34560 52363 50405 gene locus_tag LOCUS_34570 gene mnmG 52363 50405 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056385.1 protein_id gnl|my_center|LOCUS_34570 52626 53546 gene locus_tag LOCUS_34580 52626 53546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34580 53863 54096 gene locus_tag LOCUS_34590 53863 54096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34590 54103 54501 gene locus_tag LOCUS_34600 54103 54501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34600 54876 55448 gene locus_tag LOCUS_34610 54876 55448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34610 55480 56217 gene locus_tag LOCUS_34620 55480 56217 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963188.1 protein_id gnl|my_center|LOCUS_34620 56224 56799 gene locus_tag LOCUS_34630 56224 56799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34630 56948 60415 gene locus_tag LOCUS_34640 56948 60415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34640 61152 60886 gene locus_tag LOCUS_34650 61152 60886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34650 61968 61567 gene locus_tag LOCUS_34660 61968 61567 CDS product DUF1636 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086045.1 protein_id gnl|my_center|LOCUS_34660 62305 62640 gene locus_tag LOCUS_34670 62305 62640 CDS product c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103126030.1 protein_id gnl|my_center|LOCUS_34670 63233 62742 gene locus_tag LOCUS_34680 63233 62742 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_153437081.1 protein_id gnl|my_center|LOCUS_34680 64485 63583 gene locus_tag LOCUS_34690 64485 63583 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_145268175.1 protein_id gnl|my_center|LOCUS_34690 65615 66553 gene locus_tag LOCUS_34700 gene soj 65615 66553 CDS product sporulation initiation inhibitor protein Soj inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003219244.1 protein_id gnl|my_center|LOCUS_34700 >Feature sequence045 1579 521 gene locus_tag LOCUS_34710 1579 521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34710 2638 2021 gene locus_tag LOCUS_34720 2638 2021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34720 5152 2879 gene locus_tag LOCUS_34730 5152 2879 CDS product bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920718.1 protein_id gnl|my_center|LOCUS_34730 5442 5789 gene locus_tag LOCUS_34740 5442 5789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34740 6250 7908 gene locus_tag LOCUS_34750 6250 7908 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056296.1 protein_id gnl|my_center|LOCUS_34750 8995 8054 gene locus_tag LOCUS_34760 8995 8054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34760 10291 9512 gene locus_tag LOCUS_34770 10291 9512 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890768.1 protein_id gnl|my_center|LOCUS_34770 12145 10442 gene locus_tag LOCUS_34780 12145 10442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34780 12773 14065 gene locus_tag LOCUS_34790 gene tnpB 12773 14065 CDS product IS200/IS605 family element RNA-guided endonuclease TnpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_054297574.1 protein_id gnl|my_center|LOCUS_34790 14192 15760 gene locus_tag LOCUS_34800 14192 15760 CDS product FAD-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003020815.1 protein_id gnl|my_center|LOCUS_34800 17558 16047 gene locus_tag LOCUS_34810 gene ilvA 17558 16047 CDS product threonine ammonia-lyase, biosynthetic inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189002.1 protein_id gnl|my_center|LOCUS_34810 18026 17637 gene locus_tag LOCUS_34820 18026 17637 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141769.1 protein_id gnl|my_center|LOCUS_34820 18264 18031 gene locus_tag LOCUS_34830 18264 18031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34830 19034 19435 gene locus_tag LOCUS_34840 19034 19435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_34840 19470 21830 gene locus_tag LOCUS_34850 19470 21830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_34850 22270 21890 gene locus_tag LOCUS_34860 22270 21890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34860 22517 22260 gene locus_tag LOCUS_34870 22517 22260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34870 23458 22856 gene locus_tag LOCUS_34880 23458 22856 CDS product 2OG-Fe(II) oxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929521.1 protein_id gnl|my_center|LOCUS_34880 24543 24127 gene locus_tag LOCUS_34890 24543 24127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065260.1 protein_id gnl|my_center|LOCUS_34890 24704 26929 gene locus_tag LOCUS_34900 24704 26929 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928938.1 protein_id gnl|my_center|LOCUS_34900 27013 27135 gene locus_tag LOCUS_34910 27013 27135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34910 27645 27184 gene locus_tag LOCUS_34920 27645 27184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34920 32322 27667 gene locus_tag LOCUS_34930 32322 27667 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814813.1 protein_id gnl|my_center|LOCUS_34930 34453 32471 gene locus_tag LOCUS_34940 34453 32471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34940 34854 34570 gene locus_tag LOCUS_34950 34854 34570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34950 35630 34908 gene locus_tag LOCUS_34960 35630 34908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34960 36245 35802 gene locus_tag LOCUS_34970 36245 35802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34970 36544 36245 gene locus_tag LOCUS_34980 36544 36245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34980 38136 37240 gene locus_tag LOCUS_34990 38136 37240 CDS product pirin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522639.1 protein_id gnl|my_center|LOCUS_34990 38611 38336 gene locus_tag LOCUS_35000 38611 38336 CDS product UBP-type zinc finger domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727177.1 protein_id gnl|my_center|LOCUS_35000 39308 40336 gene locus_tag LOCUS_35010 39308 40336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35010 41659 40802 gene locus_tag LOCUS_35020 41659 40802 CDS product neutral zinc metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095112.1 protein_id gnl|my_center|LOCUS_35020 41899 42711 gene locus_tag LOCUS_35030 gene nudC 41899 42711 CDS product NAD(+) diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021453.1 protein_id gnl|my_center|LOCUS_35030 42769 43593 gene locus_tag LOCUS_35040 42769 43593 CDS product zinc-dependent peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073205.1 protein_id gnl|my_center|LOCUS_35040 44318 43752 gene locus_tag LOCUS_35050 44318 43752 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057636.1 protein_id gnl|my_center|LOCUS_35050 44876 44625 gene locus_tag LOCUS_35060 44876 44625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35060 46088 45048 gene locus_tag LOCUS_35070 46088 45048 CDS product agmatinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964304.1 protein_id gnl|my_center|LOCUS_35070 46309 48111 gene locus_tag LOCUS_35080 46309 48111 CDS product DUF262 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_065612062.1 protein_id gnl|my_center|LOCUS_35080 49992 48289 gene locus_tag LOCUS_35090 49992 48289 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482837.1 protein_id gnl|my_center|LOCUS_35090 48934 49019 gene locus_tag LOCUS_t00250 48934 49019 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 51340 49997 gene locus_tag LOCUS_35100 51340 49997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35100 51695 51462 gene locus_tag LOCUS_35110 51695 51462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35110 51988 52728 gene locus_tag LOCUS_35120 51988 52728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35120 52760 55120 gene locus_tag LOCUS_35130 52760 55120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35130 56254 55433 gene locus_tag LOCUS_35140 56254 55433 CDS product high frequency lysogenization protein HflD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929266.1 protein_id gnl|my_center|LOCUS_35140 56685 56251 gene locus_tag LOCUS_35150 56685 56251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35150 57708 56863 gene locus_tag LOCUS_35160 57708 56863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35160 58661 57960 gene locus_tag LOCUS_35170 58661 57960 CDS product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142086.1 protein_id gnl|my_center|LOCUS_35170 59001 58690 gene locus_tag LOCUS_35180 59001 58690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35180 59986 59006 gene locus_tag LOCUS_35190 59986 59006 CDS product sodium-dependent bicarbonate transport family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124396.1 protein_id gnl|my_center|LOCUS_35190 60235 60516 gene locus_tag LOCUS_35200 60235 60516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35200 61681 60605 gene locus_tag LOCUS_35210 61681 60605 CDS product glycoside hydrolase family 10 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057137.1 protein_id gnl|my_center|LOCUS_35210 62791 62567 gene locus_tag LOCUS_35220 62791 62567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35220 62958 63995 gene locus_tag LOCUS_35230 62958 63995 CDS product RNA-guided endonuclease TnpB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082517.1 protein_id gnl|my_center|LOCUS_35230 64100 64990 gene locus_tag LOCUS_35240 64100 64990 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125344.1 protein_id gnl|my_center|LOCUS_35240 65239 65066 gene locus_tag LOCUS_35250 65239 65066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35250 65947 66105 gene locus_tag LOCUS_35260 65947 66105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35260 >Feature sequence046 400 651 gene locus_tag LOCUS_35270 400 651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007358131.1 protein_id gnl|my_center|LOCUS_35270 2014 2547 gene locus_tag LOCUS_35280 2014 2547 CDS product DUF305 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258297.1 protein_id gnl|my_center|LOCUS_35280 2828 3025 gene locus_tag LOCUS_35290 2828 3025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35290 3442 3636 gene locus_tag LOCUS_35300 3442 3636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35300 3682 5943 gene locus_tag LOCUS_35310 3682 5943 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461874.1 protein_id gnl|my_center|LOCUS_35310 6089 6655 gene locus_tag LOCUS_35320 6089 6655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35320 6819 7232 gene locus_tag LOCUS_35330 gene cueR 6819 7232 CDS product Cu(I)-responsive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010635698.1 protein_id gnl|my_center|LOCUS_35330 7472 7660 gene locus_tag LOCUS_35340 7472 7660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35340 7673 8554 gene locus_tag LOCUS_35350 7673 8554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142031.1 protein_id gnl|my_center|LOCUS_35350 8629 10023 gene locus_tag LOCUS_35360 8629 10023 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143975.1 protein_id gnl|my_center|LOCUS_35360 10236 13250 gene locus_tag LOCUS_35370 10236 13250 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143976.1 protein_id gnl|my_center|LOCUS_35370 13381 13629 gene locus_tag LOCUS_35380 13381 13629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_35380 13946 15604 gene locus_tag LOCUS_35390 13946 15604 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142028.1 protein_id gnl|my_center|LOCUS_35390 15620 18763 gene locus_tag LOCUS_35400 15620 18763 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142029.1 protein_id gnl|my_center|LOCUS_35400 18815 19315 gene locus_tag LOCUS_35410 18815 19315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35410 19534 20238 gene locus_tag LOCUS_35420 19534 20238 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141809.1 protein_id gnl|my_center|LOCUS_35420 20225 21625 gene locus_tag LOCUS_35430 20225 21625 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141685.1 protein_id gnl|my_center|LOCUS_35430 21931 21734 gene locus_tag LOCUS_35440 21931 21734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35440 22238 21864 gene locus_tag LOCUS_35450 22238 21864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35450 23004 22597 gene locus_tag LOCUS_35460 23004 22597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35460 23542 23751 gene locus_tag LOCUS_35470 23542 23751 CDS product molybdopterin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021259.1 protein_id gnl|my_center|LOCUS_35470 24316 23903 gene locus_tag LOCUS_35480 gene tnpA 24316 23903 CDS product IS200/IS605 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103036865.1 protein_id gnl|my_center|LOCUS_35480 25608 24760 gene locus_tag LOCUS_35490 25608 24760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35490 26991 25801 gene locus_tag LOCUS_35500 26991 25801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35500 27410 28384 gene locus_tag LOCUS_35510 27410 28384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35510 28411 28794 gene locus_tag LOCUS_35520 28411 28794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35520 28791 29798 gene locus_tag LOCUS_35530 28791 29798 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086224.1 protein_id gnl|my_center|LOCUS_35530 29829 30206 gene locus_tag LOCUS_35540 29829 30206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35540 30453 31031 gene locus_tag LOCUS_35550 30453 31031 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141560.1 protein_id gnl|my_center|LOCUS_35550 31315 31106 gene locus_tag LOCUS_35560 31315 31106 CDS product molybdopterin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021259.1 protein_id gnl|my_center|LOCUS_35560 31759 32337 gene locus_tag LOCUS_35570 31759 32337 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142405.1 protein_id gnl|my_center|LOCUS_35570 36449 32424 gene locus_tag LOCUS_35580 36449 32424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35580 36949 36446 gene locus_tag LOCUS_35590 36949 36446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35590 37817 37305 gene locus_tag LOCUS_35600 37817 37305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35600 39818 38055 gene locus_tag LOCUS_35610 39818 38055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35610 40314 41348 gene locus_tag LOCUS_35620 40314 41348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35620 42366 41545 gene locus_tag LOCUS_35630 gene modA 42366 41545 CDS product molybdate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860975.1 protein_id gnl|my_center|LOCUS_35630 43751 42630 gene locus_tag LOCUS_35640 gene nifV 43751 42630 CDS product homocitrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941605.1 protein_id gnl|my_center|LOCUS_35640 45263 44244 gene locus_tag LOCUS_35650 45263 44244 CDS product TOBE-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057527.1 protein_id gnl|my_center|LOCUS_35650 45455 45925 gene locus_tag LOCUS_35660 45455 45925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35660 46188 45937 gene locus_tag LOCUS_35670 46188 45937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35670 46705 46415 gene locus_tag LOCUS_35680 46705 46415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35680 47599 46709 gene locus_tag LOCUS_35690 gene cysW 47599 46709 CDS product sulfate ABC transporter permease subunit CysW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056131.1 protein_id gnl|my_center|LOCUS_35690 48470 47586 gene locus_tag LOCUS_35700 gene cysT 48470 47586 CDS product sulfate ABC transporter permease subunit CysT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056130.1 protein_id gnl|my_center|LOCUS_35700 49703 48675 gene locus_tag LOCUS_35710 49703 48675 CDS product sulfate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056129.1 protein_id gnl|my_center|LOCUS_35710 50778 50005 gene locus_tag LOCUS_35720 50778 50005 CDS product class II glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194094.1 protein_id gnl|my_center|LOCUS_35720 51166 52272 gene locus_tag LOCUS_35730 51166 52272 CDS product sulfate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056129.1 protein_id gnl|my_center|LOCUS_35730 53103 52465 gene locus_tag LOCUS_35740 53103 52465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35740 53728 54483 gene locus_tag LOCUS_35750 53728 54483 CDS product CbiX/SirB N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057734.1 protein_id gnl|my_center|LOCUS_35750 54480 55274 gene locus_tag LOCUS_35760 gene cobA 54480 55274 CDS product uroporphyrinogen-III C-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142574.1 protein_id gnl|my_center|LOCUS_35760 56322 55501 gene locus_tag LOCUS_35770 56322 55501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35770 56705 56361 gene locus_tag LOCUS_35780 56705 56361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35780 58659 57658 gene locus_tag LOCUS_35790 58659 57658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35790 59109 59279 gene locus_tag LOCUS_35800 59109 59279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35800 60594 63959 gene locus_tag LOCUS_35810 60594 63959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35810 >Feature sequence047 1883 3154 gene locus_tag LOCUS_35820 1883 3154 CDS product DUF4255 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258026.1 protein_id gnl|my_center|LOCUS_35820 3440 5671 gene locus_tag LOCUS_35830 3440 5671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141408.1 protein_id gnl|my_center|LOCUS_35830 5684 7969 gene locus_tag LOCUS_35840 5684 7969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141407.1 protein_id gnl|my_center|LOCUS_35840 8065 8898 gene locus_tag LOCUS_35850 8065 8898 CDS product Pvc16 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144085.1 protein_id gnl|my_center|LOCUS_35850 8929 10587 gene locus_tag LOCUS_35860 8929 10587 CDS product phage tail sheath subtilisin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144086.1 protein_id gnl|my_center|LOCUS_35860 10636 11088 gene locus_tag LOCUS_35870 10636 11088 CDS product phage tail protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144087.1 protein_id gnl|my_center|LOCUS_35870 11179 11655 gene locus_tag LOCUS_35880 11179 11655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35880 11667 12011 gene locus_tag LOCUS_35890 11667 12011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144090.1 protein_id gnl|my_center|LOCUS_35890 12034 12414 gene locus_tag LOCUS_35900 12034 12414 CDS product phage tail assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144091.1 protein_id gnl|my_center|LOCUS_35900 12557 14833 gene locus_tag LOCUS_35910 12557 14833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35910 15361 14840 gene locus_tag LOCUS_35920 15361 14840 CDS product FHA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140433.1 protein_id gnl|my_center|LOCUS_35920 17549 15417 gene locus_tag LOCUS_35930 17549 15417 CDS product serine/threonine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140434.1 protein_id gnl|my_center|LOCUS_35930 18267 17590 gene locus_tag LOCUS_35940 18267 17590 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144083.1 protein_id gnl|my_center|LOCUS_35940 19395 18280 gene locus_tag LOCUS_35950 19395 18280 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929451.1 protein_id gnl|my_center|LOCUS_35950 20154 19942 gene locus_tag LOCUS_35960 20154 19942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35960 20192 20455 gene locus_tag LOCUS_35970 20192 20455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35970 20452 20862 gene locus_tag LOCUS_35980 20452 20862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35980 22106 20976 gene locus_tag LOCUS_35990 22106 20976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35990 22938 22309 gene locus_tag LOCUS_36000 22938 22309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36000 28727 23001 gene locus_tag LOCUS_36010 28727 23001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36010 29550 29047 gene locus_tag LOCUS_36020 29550 29047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36020 30288 29572 gene locus_tag LOCUS_36030 30288 29572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36030 31485 30331 gene locus_tag LOCUS_36040 31485 30331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36040 32107 33732 gene locus_tag LOCUS_36050 32107 33732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36050 34077 35750 gene locus_tag LOCUS_36060 34077 35750 CDS product ShlB/FhaC/HecB family hemolysin secretion/activation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099799342.1 protein_id gnl|my_center|LOCUS_36060 36292 37569 gene locus_tag LOCUS_36070 36292 37569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36070 37939 37709 gene locus_tag LOCUS_36080 37939 37709 CDS product type II toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545347.1 protein_id gnl|my_center|LOCUS_36080 38183 37995 gene locus_tag LOCUS_36090 38183 37995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36090 42860 38253 gene locus_tag LOCUS_36100 42860 38253 CDS product CHAT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057482.1 protein_id gnl|my_center|LOCUS_36100 43223 43882 gene locus_tag LOCUS_36110 43223 43882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36110 43984 44742 gene locus_tag LOCUS_36120 43984 44742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36120 45819 44755 gene locus_tag LOCUS_36130 45819 44755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36130 47967 45973 gene locus_tag LOCUS_36140 47967 45973 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_095509668.1 protein_id gnl|my_center|LOCUS_36140 49174 47975 gene locus_tag LOCUS_36150 49174 47975 CDS product DUF4159 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141410.1 protein_id gnl|my_center|LOCUS_36150 50179 49181 gene locus_tag LOCUS_36160 50179 49181 CDS product phage tail protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141411.1 protein_id gnl|my_center|LOCUS_36160 52401 50191 gene locus_tag LOCUS_36170 52401 50191 CDS product putative baseplate assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141412.1 protein_id gnl|my_center|LOCUS_36170 52820 52404 gene locus_tag LOCUS_36180 52820 52404 CDS product GPW/gp25 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928771.1 protein_id gnl|my_center|LOCUS_36180 53445 52948 gene locus_tag LOCUS_36190 53445 52948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36190 55242 53479 gene locus_tag LOCUS_36200 55242 53479 CDS product VgrG-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140428.1 protein_id gnl|my_center|LOCUS_36200 55933 55277 gene locus_tag LOCUS_36210 55933 55277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36210 59692 55964 gene locus_tag LOCUS_36220 59692 55964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36220 60231 59713 gene locus_tag LOCUS_36230 60231 59713 CDS product phage tail protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140431.1 protein_id gnl|my_center|LOCUS_36230 60476 60231 gene locus_tag LOCUS_36240 60476 60231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36240 60838 62481 gene locus_tag LOCUS_36250 60838 62481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36250 >Feature sequence048 215 427 gene locus_tag LOCUS_36260 215 427 CDS product chlorophyll a/b-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142054.1 protein_id gnl|my_center|LOCUS_36260 2004 667 gene locus_tag LOCUS_36270 2004 667 CDS product ArsB/NhaD family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430161.1 protein_id gnl|my_center|LOCUS_36270 2872 2180 gene locus_tag LOCUS_36280 2872 2180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36280 3821 2985 gene locus_tag LOCUS_36290 3821 2985 CDS product nitrate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920966.1 protein_id gnl|my_center|LOCUS_36290 5310 3898 gene locus_tag LOCUS_36300 5310 3898 CDS product CmpA/NrtA family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929421.1 protein_id gnl|my_center|LOCUS_36300 6476 5628 gene locus_tag LOCUS_36310 gene ntrB 6476 5628 CDS product nitrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096249.1 protein_id gnl|my_center|LOCUS_36310 7025 8218 gene locus_tag LOCUS_36320 7025 8218 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142255.1 protein_id gnl|my_center|LOCUS_36320 8231 8425 gene locus_tag LOCUS_36330 8231 8425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36330 9791 8625 gene locus_tag LOCUS_36340 9791 8625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36340 10501 10872 gene locus_tag LOCUS_36350 10501 10872 CDS product SgcJ/EcaC family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143984.1 protein_id gnl|my_center|LOCUS_36350 11759 11355 gene locus_tag LOCUS_36360 11759 11355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36360 12163 11894 gene locus_tag LOCUS_36370 12163 11894 CDS product YciI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056004.1 protein_id gnl|my_center|LOCUS_36370 14692 12260 gene locus_tag LOCUS_36380 gene pheT 14692 12260 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920733.1 protein_id gnl|my_center|LOCUS_36380 14882 15469 gene locus_tag LOCUS_36390 14882 15469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36390 16988 15564 gene locus_tag LOCUS_36400 16988 15564 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099797661.1 protein_id gnl|my_center|LOCUS_36400 17579 18280 gene locus_tag LOCUS_36410 17579 18280 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000003197.1 protein_id gnl|my_center|LOCUS_36410 18296 19111 gene locus_tag LOCUS_36420 18296 19111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36420 19170 21359 gene locus_tag LOCUS_36430 19170 21359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36430 22131 22904 gene locus_tag LOCUS_36440 gene rfbF 22131 22904 CDS product glucose-1-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142205.1 protein_id gnl|my_center|LOCUS_36440 23051 24268 gene locus_tag LOCUS_36450 gene lhgO 23051 24268 CDS product L-2-hydroxyglutarate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142204.1 protein_id gnl|my_center|LOCUS_36450 24768 25793 gene locus_tag LOCUS_36460 24768 25793 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142203.1 protein_id gnl|my_center|LOCUS_36460 26263 27213 gene locus_tag LOCUS_36470 26263 27213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36470 27379 28386 gene locus_tag LOCUS_36480 27379 28386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36480 28438 29289 gene locus_tag LOCUS_36490 28438 29289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141312.1 protein_id gnl|my_center|LOCUS_36490 29421 29972 gene locus_tag LOCUS_36500 gene rfbC 29421 29972 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142202.1 protein_id gnl|my_center|LOCUS_36500 30054 31364 gene locus_tag LOCUS_36510 30054 31364 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142201.1 protein_id gnl|my_center|LOCUS_36510 31563 32771 gene locus_tag LOCUS_36520 31563 32771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36520 33073 34173 gene locus_tag LOCUS_36530 33073 34173 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966352.1 protein_id gnl|my_center|LOCUS_36530 34375 36429 gene locus_tag LOCUS_36540 34375 36429 CDS product polysaccharide biosynthesis tyrosine autokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143774.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_36540 37813 38667 gene locus_tag LOCUS_36550 37813 38667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36550 38903 40762 gene locus_tag LOCUS_36560 38903 40762 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928959.1 protein_id gnl|my_center|LOCUS_36560 41089 42264 gene locus_tag LOCUS_36570 41089 42264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36570 42357 43349 gene locus_tag LOCUS_36580 42357 43349 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941294.1 protein_id gnl|my_center|LOCUS_36580 43426 44628 gene locus_tag LOCUS_36590 43426 44628 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004552050.1 protein_id gnl|my_center|LOCUS_36590 44546 45544 gene locus_tag LOCUS_36600 44546 45544 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004552051.1 protein_id gnl|my_center|LOCUS_36600 45598 47067 gene locus_tag LOCUS_36610 45598 47067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004540305.1 protein_id gnl|my_center|LOCUS_36610 48199 47093 gene locus_tag LOCUS_36620 48199 47093 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140478.1 protein_id gnl|my_center|LOCUS_36620 49453 48506 gene locus_tag LOCUS_36630 49453 48506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931913.1 protein_id gnl|my_center|LOCUS_36630 50424 49486 gene locus_tag LOCUS_36640 50424 49486 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249955.1 protein_id gnl|my_center|LOCUS_36640 51648 50539 gene locus_tag LOCUS_36650 51648 50539 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140478.1 protein_id gnl|my_center|LOCUS_36650 55834 53648 gene locus_tag LOCUS_36660 55834 53648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004533167.1 protein_id gnl|my_center|LOCUS_36660 57697 58866 gene locus_tag LOCUS_36670 57697 58866 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004544567.1 protein_id gnl|my_center|LOCUS_36670 58900 59409 gene locus_tag LOCUS_36680 58900 59409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36680 59598 60734 gene locus_tag LOCUS_36690 59598 60734 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973141.1 protein_id gnl|my_center|LOCUS_36690 61322 60951 gene locus_tag LOCUS_36700 61322 60951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36700 61777 61469 gene locus_tag LOCUS_36710 61777 61469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36710 62315 62671 gene locus_tag LOCUS_36720 62315 62671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36720 <63416 62843 gene locus_tag LOCUS_36730 <63416 62843 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164928965.1:CHAT domain-containing protein >Feature sequence049 182 760 gene locus_tag LOCUS_36740 182 760 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142465.1 protein_id gnl|my_center|LOCUS_36740 1029 1301 gene locus_tag LOCUS_36750 1029 1301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36750 1989 2336 gene locus_tag LOCUS_36760 1989 2336 CDS product YtxH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920785.1 protein_id gnl|my_center|LOCUS_36760 2351 2929 gene locus_tag LOCUS_36770 2351 2929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057414.1 protein_id gnl|my_center|LOCUS_36770 3118 3930 gene locus_tag LOCUS_36780 3118 3930 CDS product TPM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197524138.1 protein_id gnl|my_center|LOCUS_36780 5385 4204 gene locus_tag LOCUS_36790 gene tnpB 5385 4204 CDS product IS200/IS605 family element RNA-guided endonuclease TnpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020316.1 protein_id gnl|my_center|LOCUS_36790 5401 5613 gene locus_tag LOCUS_36800 5401 5613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36800 6388 5702 gene locus_tag LOCUS_36810 6388 5702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056056.1 protein_id gnl|my_center|LOCUS_36810 7254 6424 gene locus_tag LOCUS_36820 gene dapB 7254 6424 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920961.1 protein_id gnl|my_center|LOCUS_36820 9009 7306 gene locus_tag LOCUS_36830 9009 7306 CDS product NAD+ synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057022.1 protein_id gnl|my_center|LOCUS_36830 9389 9195 gene locus_tag LOCUS_36840 9389 9195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36840 10260 9514 gene locus_tag LOCUS_36850 10260 9514 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057021.1 protein_id gnl|my_center|LOCUS_36850 10941 10351 gene locus_tag LOCUS_36860 10941 10351 CDS product nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057020.1 protein_id gnl|my_center|LOCUS_36860 12452 10992 gene locus_tag LOCUS_36870 12452 10992 CDS product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057019.1 protein_id gnl|my_center|LOCUS_36870 13397 13549 gene locus_tag LOCUS_36880 13397 13549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36880 14290 13667 gene locus_tag LOCUS_36890 14290 13667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140502.1 protein_id gnl|my_center|LOCUS_36890 15255 15019 gene locus_tag LOCUS_36900 15255 15019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36900 15322 15555 gene locus_tag LOCUS_36910 15322 15555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36910 16189 15569 gene locus_tag LOCUS_36920 16189 15569 CDS product SEC59/DGK1/VTE5 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057874.1 protein_id gnl|my_center|LOCUS_36920 16590 17297 gene locus_tag LOCUS_36930 16590 17297 CDS product M15 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058294.1 protein_id gnl|my_center|LOCUS_36930 17781 17308 gene locus_tag LOCUS_36940 17781 17308 CDS product tryptophan-rich sensory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933324.1 protein_id gnl|my_center|LOCUS_36940 18408 17935 gene locus_tag LOCUS_36950 18408 17935 CDS product tryptophan-rich sensory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061381.1 protein_id gnl|my_center|LOCUS_36950 20547 18595 gene locus_tag LOCUS_36960 20547 18595 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140584.1 protein_id gnl|my_center|LOCUS_36960 21129 22724 gene locus_tag LOCUS_36970 21129 22724 CDS product alkaline phosphatase D family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140493.1 protein_id gnl|my_center|LOCUS_36970 23424 22747 gene locus_tag LOCUS_36980 23424 22747 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056571.1 protein_id gnl|my_center|LOCUS_36980 24566 23592 gene locus_tag LOCUS_36990 gene era 24566 23592 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055911.1 protein_id gnl|my_center|LOCUS_36990 25957 24773 gene locus_tag LOCUS_37000 25957 24773 CDS product M14 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073716.1 protein_id gnl|my_center|LOCUS_37000 26384 29422 gene locus_tag LOCUS_37010 26384 29422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37010 30127 29456 gene locus_tag LOCUS_37020 30127 29456 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099798139.1 protein_id gnl|my_center|LOCUS_37020 30304 31704 gene locus_tag LOCUS_37030 30304 31704 CDS product carotenoid oxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228721.1 protein_id gnl|my_center|LOCUS_37030 32308 31889 gene locus_tag LOCUS_37040 32308 31889 CDS product PIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680561.1 protein_id gnl|my_center|LOCUS_37040 32655 32305 gene locus_tag LOCUS_37050 32655 32305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37050 33985 33071 gene locus_tag LOCUS_37060 33985 33071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37060 34283 34930 gene locus_tag LOCUS_37070 34283 34930 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140938.1 protein_id gnl|my_center|LOCUS_37070 35037 35603 gene locus_tag LOCUS_37080 35037 35603 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141894.1 protein_id gnl|my_center|LOCUS_37080 39269 35721 gene locus_tag LOCUS_37090 gene metH 39269 35721 CDS product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921137.1 protein_id gnl|my_center|LOCUS_37090 40472 41173 gene locus_tag LOCUS_37100 40472 41173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37100 42328 41240 gene locus_tag LOCUS_37110 42328 41240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37110 42450 42719 gene locus_tag LOCUS_37120 42450 42719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37120 43241 44992 gene locus_tag LOCUS_37130 43241 44992 CDS product ShlB/FhaC/HecB family hemolysin secretion/activation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099799342.1 protein_id gnl|my_center|LOCUS_37130 45117 47873 gene locus_tag LOCUS_37140 45117 47873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37140 50433 48316 gene locus_tag LOCUS_37150 50433 48316 CDS product CHASE2 domain-containing serine/threonine-protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_204368676.1 protein_id gnl|my_center|LOCUS_37150 50674 50492 gene locus_tag LOCUS_37160 50674 50492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37160 52319 50667 gene locus_tag LOCUS_37170 52319 50667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37170 55771 52481 gene locus_tag LOCUS_37180 55771 52481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37180 56203 56961 gene locus_tag LOCUS_37190 56203 56961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37190 59440 57731 gene locus_tag LOCUS_37200 gene ribBA 59440 57731 CDS product bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920923.1 protein_id gnl|my_center|LOCUS_37200 59679 60737 gene locus_tag LOCUS_37210 gene argC 59679 60737 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058053.1 protein_id gnl|my_center|LOCUS_37210 61093 61572 gene locus_tag LOCUS_37220 61093 61572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37220 >Feature sequence050 233 1471 gene locus_tag LOCUS_37230 gene tnpB 233 1471 CDS product IS200/IS605 family element RNA-guided endonuclease TnpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_054297574.1 protein_id gnl|my_center|LOCUS_37230 1601 1792 gene locus_tag LOCUS_37240 1601 1792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37240 3002 1872 gene locus_tag LOCUS_37250 3002 1872 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878413.1 protein_id gnl|my_center|LOCUS_37250 3257 4147 gene locus_tag LOCUS_37260 3257 4147 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143349.1 protein_id gnl|my_center|LOCUS_37260 5124 4429 gene locus_tag LOCUS_37270 5124 4429 CDS product DJ-1/PfpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087053.1 protein_id gnl|my_center|LOCUS_37270 6107 5217 gene locus_tag LOCUS_37280 6107 5217 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143217.1 protein_id gnl|my_center|LOCUS_37280 6606 6172 gene locus_tag LOCUS_37290 6606 6172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37290 7279 6614 gene locus_tag LOCUS_37300 7279 6614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37300 7916 8752 gene locus_tag LOCUS_37310 7916 8752 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932424.1 protein_id gnl|my_center|LOCUS_37310 8754 9308 gene locus_tag LOCUS_37320 8754 9308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37320 9668 9378 gene locus_tag LOCUS_37330 9668 9378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37330 9885 10346 gene locus_tag LOCUS_37340 9885 10346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37340 10679 10464 gene locus_tag LOCUS_37350 10679 10464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37350 11432 10755 gene locus_tag LOCUS_37360 11432 10755 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533045.1 protein_id gnl|my_center|LOCUS_37360 11535 13157 gene locus_tag LOCUS_37370 11535 13157 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057237.1 protein_id gnl|my_center|LOCUS_37370 13537 13992 gene locus_tag LOCUS_37380 13537 13992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37380 13995 15701 gene locus_tag LOCUS_37390 13995 15701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37390 15756 17123 gene locus_tag LOCUS_37400 15756 17123 CDS product coenzyme F390 synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389719.1 protein_id gnl|my_center|LOCUS_37400 17288 17848 gene locus_tag LOCUS_37410 17288 17848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37410 18960 18409 gene locus_tag LOCUS_37420 18960 18409 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921658.1 protein_id gnl|my_center|LOCUS_37420 19129 19695 gene locus_tag LOCUS_37430 19129 19695 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966373.1 protein_id gnl|my_center|LOCUS_37430 20915 19773 gene locus_tag LOCUS_37440 gene bla 20915 19773 CDS product class A beta-lactamase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975615.1 protein_id gnl|my_center|LOCUS_37440 21686 21060 gene locus_tag LOCUS_37450 21686 21060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37450 22344 23144 gene locus_tag LOCUS_37460 22344 23144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37460 24155 23436 gene locus_tag LOCUS_37470 24155 23436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_37470 24609 24304 gene locus_tag LOCUS_37480 24609 24304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_37480 28996 25010 gene locus_tag LOCUS_37490 28996 25010 CDS product magnesium chelatase subunit H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056126.1 protein_id gnl|my_center|LOCUS_37490 29352 30725 gene locus_tag LOCUS_37500 29352 30725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057390.1 protein_id gnl|my_center|LOCUS_37500 31146 30757 gene locus_tag LOCUS_37510 31146 30757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140108.1 protein_id gnl|my_center|LOCUS_37510 31709 32545 gene locus_tag LOCUS_37520 31709 32545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37520 34542 32638 gene locus_tag LOCUS_37530 gene ftsH 34542 32638 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_225914010.1 protein_id gnl|my_center|LOCUS_37530 35357 35902 gene locus_tag LOCUS_37540 35357 35902 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056276.1 protein_id gnl|my_center|LOCUS_37540 37186 36146 gene locus_tag LOCUS_37550 37186 36146 CDS product ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928444.1 protein_id gnl|my_center|LOCUS_37550 37969 38541 gene locus_tag LOCUS_37560 37969 38541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37560 38732 40006 gene locus_tag LOCUS_37570 38732 40006 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057231.1 protein_id gnl|my_center|LOCUS_37570 40391 42211 gene locus_tag LOCUS_37580 gene ilvB 40391 42211 CDS product biosynthetic-type acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057136.1 protein_id gnl|my_center|LOCUS_37580 43055 42504 gene locus_tag LOCUS_37590 43055 42504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37590 43169 44092 gene locus_tag LOCUS_37600 43169 44092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37600 44868 44182 gene locus_tag LOCUS_37610 44868 44182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37610 46360 45527 gene locus_tag LOCUS_37620 46360 45527 CDS product MOSC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903268.1 protein_id gnl|my_center|LOCUS_37620 46788 47768 gene locus_tag LOCUS_37630 46788 47768 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257134.1 protein_id gnl|my_center|LOCUS_37630 48563 48730 gene locus_tag LOCUS_37640 48563 48730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37640 48739 48918 gene locus_tag LOCUS_37650 48739 48918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37650 49008 50162 gene locus_tag LOCUS_37660 49008 50162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37660 50190 51059 gene locus_tag LOCUS_37670 50190 51059 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966063.1 protein_id gnl|my_center|LOCUS_37670 51072 51872 gene locus_tag LOCUS_37680 51072 51872 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974810.1 protein_id gnl|my_center|LOCUS_37680 51865 52482 gene locus_tag LOCUS_37690 51865 52482 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528837.1 protein_id gnl|my_center|LOCUS_37690 52517 53551 gene locus_tag LOCUS_37700 52517 53551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37700 55614 53641 gene locus_tag LOCUS_37710 55614 53641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37710 55888 57603 gene locus_tag LOCUS_37720 55888 57603 CDS product fumarate reductase/succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206683.1 protein_id gnl|my_center|LOCUS_37720 57651 57878 gene locus_tag LOCUS_37730 57651 57878 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005058882.1 protein_id gnl|my_center|LOCUS_37730 57889 58863 gene locus_tag LOCUS_37740 57889 58863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37740 58856 59935 gene locus_tag LOCUS_37750 58856 59935 CDS product Mrp/NBP35 family ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921045.1 protein_id gnl|my_center|LOCUS_37750 60063 60935 gene locus_tag LOCUS_37760 60063 60935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_37760 60937 61317 gene locus_tag LOCUS_37770 60937 61317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_37770 >Feature sequence051 695 36 gene locus_tag LOCUS_37780 695 36 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37780 1616 930 gene locus_tag LOCUS_37790 1616 930 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023174178.1 protein_id gnl|my_center|LOCUS_37790 2721 1618 gene locus_tag LOCUS_37800 2721 1618 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928544.1 protein_id gnl|my_center|LOCUS_37800 3344 5029 gene locus_tag LOCUS_37810 gene kdpA 3344 5029 CDS product potassium-transporting ATPase subunit KdpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140576.1 protein_id gnl|my_center|LOCUS_37810 5013 7133 gene locus_tag LOCUS_37820 gene kdpB 5013 7133 CDS product potassium-transporting ATPase subunit KdpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140577.1 protein_id gnl|my_center|LOCUS_37820 7156 7395 gene locus_tag LOCUS_37830 7156 7395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37830 7395 7661 gene locus_tag LOCUS_37840 7395 7661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37840 7832 8422 gene locus_tag LOCUS_37850 gene kdpC 7832 8422 CDS product K(+)-transporting ATPase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140578.1 protein_id gnl|my_center|LOCUS_37850 8446 9567 gene locus_tag LOCUS_37860 8446 9567 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883956.1 protein_id gnl|my_center|LOCUS_37860 9986 9657 gene locus_tag LOCUS_37870 9986 9657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37870 11861 9987 gene locus_tag LOCUS_37880 11861 9987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37880 13362 11932 gene locus_tag LOCUS_37890 13362 11932 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920904.1 protein_id gnl|my_center|LOCUS_37890 14262 14062 gene locus_tag LOCUS_37900 14262 14062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37900 15531 14299 gene locus_tag LOCUS_37910 gene xseA 15531 14299 CDS product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259569.1 protein_id gnl|my_center|LOCUS_37910 15819 16907 gene locus_tag LOCUS_37920 gene recA 15819 16907 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057924.1 protein_id gnl|my_center|LOCUS_37920 17619 16960 gene locus_tag LOCUS_37930 17619 16960 CDS product Na(+)/H(+) antiporter subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057649.1 protein_id gnl|my_center|LOCUS_37930 18278 17616 gene locus_tag LOCUS_37940 18278 17616 CDS product DUF4040 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057650.1 protein_id gnl|my_center|LOCUS_37940 18556 18275 gene locus_tag LOCUS_37950 18556 18275 CDS product monovalent cation/H(+) antiporter subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920932.1 protein_id gnl|my_center|LOCUS_37950 18804 18553 gene locus_tag LOCUS_37960 18804 18553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057652.1 protein_id gnl|my_center|LOCUS_37960 19190 18801 gene locus_tag LOCUS_37970 19190 18801 CDS product Na+/H+ antiporter subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057653.1 protein_id gnl|my_center|LOCUS_37970 20620 19187 gene locus_tag LOCUS_37980 20620 19187 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920933.1 protein_id gnl|my_center|LOCUS_37980 20952 20617 gene locus_tag LOCUS_37990 20952 20617 CDS product cation:proton antiporter subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057655.1 protein_id gnl|my_center|LOCUS_37990 21302 20946 gene locus_tag LOCUS_38000 21302 20946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38000 21779 23050 gene locus_tag LOCUS_38010 21779 23050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38010 23165 24274 gene locus_tag LOCUS_38020 23165 24274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38020 24955 24572 gene locus_tag LOCUS_38030 24955 24572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38030 25453 25001 gene locus_tag LOCUS_38040 25453 25001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38040 27194 25782 gene locus_tag LOCUS_38050 27194 25782 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_088430287.1 protein_id gnl|my_center|LOCUS_38050 27807 27475 gene locus_tag LOCUS_38060 27807 27475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38060 28037 27846 gene locus_tag LOCUS_38070 28037 27846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38070 30750 29221 gene locus_tag LOCUS_38080 30750 29221 CDS product serine/threonine-protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057166.1 protein_id gnl|my_center|LOCUS_38080 33048 31750 gene locus_tag LOCUS_38090 gene hemL 33048 31750 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099797681.1 protein_id gnl|my_center|LOCUS_38090 33178 33363 gene locus_tag LOCUS_38100 33178 33363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38100 33420 34112 gene locus_tag LOCUS_38110 gene hisIE 33420 34112 CDS product bifunctional phosphoribosyl-AMP cyclohydrolase/phosphoribosyl-ATP diphosphatase HisIE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056088.1 protein_id gnl|my_center|LOCUS_38110 34643 34215 gene locus_tag LOCUS_38120 34643 34215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38120 35347 35087 gene locus_tag LOCUS_38130 35347 35087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38130 35664 36563 gene locus_tag LOCUS_38140 35664 36563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38140 36594 37550 gene locus_tag LOCUS_38150 36594 37550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38150 37579 39513 gene locus_tag LOCUS_38160 37579 39513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38160 42319 39857 gene locus_tag LOCUS_38170 42319 39857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38170 42933 43130 gene locus_tag LOCUS_38180 42933 43130 CDS product DUF2811 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056228.1 protein_id gnl|my_center|LOCUS_38180 44555 43836 gene locus_tag LOCUS_38190 44555 43836 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259229.1 protein_id gnl|my_center|LOCUS_38190 45238 45864 gene locus_tag LOCUS_38200 45238 45864 CDS product CPP1-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058181.1 protein_id gnl|my_center|LOCUS_38200 46734 46036 gene locus_tag LOCUS_38210 46734 46036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38210 47963 46833 gene locus_tag LOCUS_38220 gene hppD 47963 46833 CDS product 4-hydroxyphenylpyruvate dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000810922.1 protein_id gnl|my_center|LOCUS_38220 48919 48101 gene locus_tag LOCUS_38230 48919 48101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38230 49798 50619 gene locus_tag LOCUS_38240 49798 50619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38240 52390 50741 gene locus_tag LOCUS_38250 52390 50741 CDS product NCS2 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929181.1 protein_id gnl|my_center|LOCUS_38250 52669 53247 gene locus_tag LOCUS_38260 52669 53247 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141969.1 protein_id gnl|my_center|LOCUS_38260 53318 53668 gene locus_tag LOCUS_38270 53318 53668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38270 55714 53882 gene locus_tag LOCUS_38280 55714 53882 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057670.1 protein_id gnl|my_center|LOCUS_38280 56778 59336 gene locus_tag LOCUS_38290 56778 59336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38290 60006 59371 gene locus_tag LOCUS_38300 60006 59371 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140352.1 protein_id gnl|my_center|LOCUS_38300 61007 60300 gene locus_tag LOCUS_38310 61007 60300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38310 61184 61318 gene locus_tag LOCUS_38320 61184 61318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38320 >Feature sequence052 57 242 gene locus_tag LOCUS_38330 57 242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38330 344 640 gene locus_tag LOCUS_38340 344 640 CDS product 2Fe-2S iron-sulfur cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057369.1 protein_id gnl|my_center|LOCUS_38340 1436 4564 gene locus_tag LOCUS_38350 1436 4564 CDS product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928531.1 protein_id gnl|my_center|LOCUS_38350 4696 5388 gene locus_tag LOCUS_38360 4696 5388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38360 6320 5478 gene locus_tag LOCUS_38370 gene dapF 6320 5478 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058127.1 protein_id gnl|my_center|LOCUS_38370 6416 6637 gene locus_tag LOCUS_38380 6416 6637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058128.1 protein_id gnl|my_center|LOCUS_38380 8959 6689 gene locus_tag LOCUS_38390 8959 6689 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056388.1 protein_id gnl|my_center|LOCUS_38390 9343 10275 gene locus_tag LOCUS_38400 9343 10275 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057801.1 protein_id gnl|my_center|LOCUS_38400 10384 10926 gene locus_tag LOCUS_38410 10384 10926 CDS product late competence development ComFB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056693.1 protein_id gnl|my_center|LOCUS_38410 11641 10970 gene locus_tag LOCUS_38420 11641 10970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38420 12601 13257 gene locus_tag LOCUS_38430 12601 13257 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057943.1 protein_id gnl|my_center|LOCUS_38430 13351 14052 gene locus_tag LOCUS_38440 13351 14052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38440 14514 14110 gene locus_tag LOCUS_38450 14514 14110 CDS product gamma-glutamylcyclotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920821.1 protein_id gnl|my_center|LOCUS_38450 14766 14602 gene locus_tag LOCUS_38460 14766 14602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38460 15142 17727 gene locus_tag LOCUS_38470 gene leuS 15142 17727 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057933.1 protein_id gnl|my_center|LOCUS_38470 17879 18403 gene locus_tag LOCUS_38480 17879 18403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38480 18675 18902 gene locus_tag LOCUS_38490 18675 18902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38490 18895 19113 gene locus_tag LOCUS_38500 18895 19113 CDS product type II toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545347.1 protein_id gnl|my_center|LOCUS_38500 19360 19187 gene locus_tag LOCUS_38510 19360 19187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38510 19593 20063 gene locus_tag LOCUS_38520 19593 20063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38520 20334 21248 gene locus_tag LOCUS_38530 20334 21248 CDS product putative selenate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125171.1 protein_id gnl|my_center|LOCUS_38530 21270 21722 gene locus_tag LOCUS_38540 21270 21722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38540 22682 21933 gene locus_tag LOCUS_38550 22682 21933 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894813.1 protein_id gnl|my_center|LOCUS_38550 23335 22754 gene locus_tag LOCUS_38560 23335 22754 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223840.1 protein_id gnl|my_center|LOCUS_38560 23740 24489 gene locus_tag LOCUS_38570 gene phnC 23740 24489 CDS product phosphonate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548759.1 protein_id gnl|my_center|LOCUS_38570 24680 26245 gene locus_tag LOCUS_38580 gene phnE 24680 26245 CDS product phosphonate ABC transporter, permease protein PhnE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727091.1 protein_id gnl|my_center|LOCUS_38580 27057 26323 gene locus_tag LOCUS_38590 27057 26323 CDS product redoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005465158.1 protein_id gnl|my_center|LOCUS_38590 27379 27798 gene locus_tag LOCUS_38600 gene spo0F 27379 27798 CDS product sporulation initiation phosphotransferase Spo0F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000398594.1 protein_id gnl|my_center|LOCUS_38600 27795 28955 gene locus_tag LOCUS_38610 27795 28955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38610 29065 29355 gene locus_tag LOCUS_38620 29065 29355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38620 29468 30178 gene locus_tag LOCUS_38630 29468 30178 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083227.1 protein_id gnl|my_center|LOCUS_38630 30337 30735 gene locus_tag LOCUS_38640 30337 30735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38640 32117 30765 gene locus_tag LOCUS_38650 32117 30765 CDS product selenium-binding family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010977998.1 protein_id gnl|my_center|LOCUS_38650 32782 32180 gene locus_tag LOCUS_38660 32782 32180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38660 33512 33952 gene locus_tag LOCUS_38670 33512 33952 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928802.1 protein_id gnl|my_center|LOCUS_38670 34730 34146 gene locus_tag LOCUS_38680 34730 34146 CDS product HdeD family acid-resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965451.1 protein_id gnl|my_center|LOCUS_38680 35943 34942 gene locus_tag LOCUS_38690 35943 34942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38690 36880 36293 gene locus_tag LOCUS_38700 36880 36293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38700 37652 38581 gene locus_tag LOCUS_38710 37652 38581 CDS product trypsin-like peptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143730.1 protein_id gnl|my_center|LOCUS_38710 38647 39483 gene locus_tag LOCUS_38720 38647 39483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38720 39480 40127 gene locus_tag LOCUS_38730 39480 40127 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197530046.1 protein_id gnl|my_center|LOCUS_38730 40403 40582 gene locus_tag LOCUS_38740 40403 40582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38740 40851 40579 gene locus_tag LOCUS_38750 40851 40579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007358131.1 protein_id gnl|my_center|LOCUS_38750 41417 42460 gene locus_tag LOCUS_38760 gene fni 41417 42460 CDS product type 2 isopentenyl-diphosphate Delta-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057243.1 protein_id gnl|my_center|LOCUS_38760 42631 44469 gene locus_tag LOCUS_38770 gene sppA 42631 44469 CDS product signal peptide peptidase SppA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765466.1 protein_id gnl|my_center|LOCUS_38770 44608 44889 gene locus_tag LOCUS_38780 44608 44889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38780 45328 44960 gene locus_tag LOCUS_38790 45328 44960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38790 45692 46660 gene locus_tag LOCUS_38800 45692 46660 CDS product RsmB/NOP family class I SAM-dependent RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920841.1 protein_id gnl|my_center|LOCUS_38800 47310 46852 gene locus_tag LOCUS_38810 gene rplI 47310 46852 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058245.1 protein_id gnl|my_center|LOCUS_38810 48420 47647 gene locus_tag LOCUS_38820 gene gloB 48420 47647 CDS product hydroxyacylglutathione hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057476.1 protein_id gnl|my_center|LOCUS_38820 48967 49890 gene locus_tag LOCUS_38830 48967 49890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38830 49989 50846 gene locus_tag LOCUS_38840 49989 50846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38840 50892 52049 gene locus_tag LOCUS_38850 50892 52049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38850 52292 54535 gene locus_tag LOCUS_38860 52292 54535 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928959.1 protein_id gnl|my_center|LOCUS_38860 54540 55751 gene locus_tag LOCUS_38870 54540 55751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38870 55788 56747 gene locus_tag LOCUS_38880 55788 56747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38880 56863 57858 gene locus_tag LOCUS_38890 56863 57858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38890 57869 58801 gene locus_tag LOCUS_38900 57869 58801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38900 59550 59113 gene locus_tag LOCUS_38910 59550 59113 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932411.1 protein_id gnl|my_center|LOCUS_38910 59859 60632 gene locus_tag LOCUS_38920 59859 60632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38920 >Feature sequence053 2282 156 gene locus_tag LOCUS_38930 2282 156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38930 3638 2916 gene locus_tag LOCUS_38940 3638 2916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38940 3739 4644 gene locus_tag LOCUS_38950 3739 4644 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056604.1 protein_id gnl|my_center|LOCUS_38950 5437 8109 gene locus_tag LOCUS_38960 5437 8109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38960 8970 11936 gene locus_tag LOCUS_38970 8970 11936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38970 12640 12284 gene locus_tag LOCUS_38980 12640 12284 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001259906.1 protein_id gnl|my_center|LOCUS_38980 12719 13042 gene locus_tag LOCUS_38990 gene trxA 12719 13042 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125291.1 protein_id gnl|my_center|LOCUS_38990 13216 14010 gene locus_tag LOCUS_39000 13216 14010 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088129.1 protein_id gnl|my_center|LOCUS_39000 14159 15274 gene locus_tag LOCUS_39010 14159 15274 CDS product alkene reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388234.1 protein_id gnl|my_center|LOCUS_39010 15353 16024 gene locus_tag LOCUS_39020 15353 16024 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231196.1 protein_id gnl|my_center|LOCUS_39020 16177 15947 gene locus_tag LOCUS_39030 16177 15947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39030 16290 16571 gene locus_tag LOCUS_39040 16290 16571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39040 16653 17351 gene locus_tag LOCUS_39050 16653 17351 CDS product glutathione S-transferase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930296.1 protein_id gnl|my_center|LOCUS_39050 17886 18296 gene locus_tag LOCUS_39060 17886 18296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39060 18456 18725 gene locus_tag LOCUS_39070 18456 18725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39070 18762 19466 gene locus_tag LOCUS_39080 18762 19466 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525154.1 protein_id gnl|my_center|LOCUS_39080 20439 23027 gene locus_tag LOCUS_39090 20439 23027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39090 23885 28243 gene locus_tag LOCUS_39100 23885 28243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39100 28537 34008 gene locus_tag LOCUS_39110 28537 34008 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000686845.1 protein_id gnl|my_center|LOCUS_39110 34027 34395 gene locus_tag LOCUS_39120 34027 34395 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085647.1 protein_id gnl|my_center|LOCUS_39120 34420 36603 gene locus_tag LOCUS_39130 34420 36603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39130 36629 37546 gene locus_tag LOCUS_39140 36629 37546 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948298.1 protein_id gnl|my_center|LOCUS_39140 37937 37575 gene locus_tag LOCUS_39150 37937 37575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39150 38137 38604 gene locus_tag LOCUS_39160 38137 38604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39160 39755 38655 gene locus_tag LOCUS_39170 gene prfA 39755 38655 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056003.1 protein_id gnl|my_center|LOCUS_39170 40102 39860 gene locus_tag LOCUS_39180 gene rpmE 40102 39860 CDS product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055965.1 protein_id gnl|my_center|LOCUS_39180 40604 40810 gene locus_tag LOCUS_39190 40604 40810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39190 41393 40977 gene locus_tag LOCUS_39200 gene rpsI 41393 40977 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055964.1 protein_id gnl|my_center|LOCUS_39200 41854 41393 gene locus_tag LOCUS_39210 gene rplM 41854 41393 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055963.1 protein_id gnl|my_center|LOCUS_39210 43032 42205 gene locus_tag LOCUS_39220 gene truA 43032 42205 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055962.1 protein_id gnl|my_center|LOCUS_39220 43666 43316 gene locus_tag LOCUS_39230 gene rplQ 43666 43316 CDS product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055961.1 protein_id gnl|my_center|LOCUS_39230 44653 43706 gene locus_tag LOCUS_39240 44653 43706 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143560.1 protein_id gnl|my_center|LOCUS_39240 45401 45003 gene locus_tag LOCUS_39250 gene rpsK 45401 45003 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055959.1 protein_id gnl|my_center|LOCUS_39250 45836 45456 gene locus_tag LOCUS_39260 gene rpsM 45836 45456 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055958.1 protein_id gnl|my_center|LOCUS_39260 46725 46501 gene locus_tag LOCUS_39270 gene infA 46725 46501 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055956.1 protein_id gnl|my_center|LOCUS_39270 47473 46922 gene locus_tag LOCUS_39280 47473 46922 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222620.1 protein_id gnl|my_center|LOCUS_39280 48786 47473 gene locus_tag LOCUS_39290 gene secY 48786 47473 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055954.1 protein_id gnl|my_center|LOCUS_39290 49307 48858 gene locus_tag LOCUS_39300 gene rplO 49307 48858 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055953.1 protein_id gnl|my_center|LOCUS_39300 50053 49529 gene locus_tag LOCUS_39310 gene rpsE 50053 49529 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055952.1 protein_id gnl|my_center|LOCUS_39310 50489 50127 gene locus_tag LOCUS_39320 gene rplR 50489 50127 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055951.1 protein_id gnl|my_center|LOCUS_39320 51037 50492 gene locus_tag LOCUS_39330 gene rplF 51037 50492 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055950.1 protein_id gnl|my_center|LOCUS_39330 51532 51131 gene locus_tag LOCUS_39340 gene rpsH 51532 51131 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055949.1 protein_id gnl|my_center|LOCUS_39340 52101 51553 gene locus_tag LOCUS_39350 gene rplE 52101 51553 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055948.1 protein_id gnl|my_center|LOCUS_39350 52567 52211 gene locus_tag LOCUS_39360 gene rplX 52567 52211 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055947.1 protein_id gnl|my_center|LOCUS_39360 52935 52567 gene locus_tag LOCUS_39370 gene rplN 52935 52567 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055946.1 protein_id gnl|my_center|LOCUS_39370 53231 52983 gene locus_tag LOCUS_39380 gene rpsQ 53231 52983 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055945.1 protein_id gnl|my_center|LOCUS_39380 53478 53245 gene locus_tag LOCUS_39390 53478 53245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39390 53859 53482 gene locus_tag LOCUS_39400 gene rplP 53859 53482 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055943.1 protein_id gnl|my_center|LOCUS_39400 54744 53977 gene locus_tag LOCUS_39410 gene rpsC 54744 53977 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055942.1 protein_id gnl|my_center|LOCUS_39410 55149 54784 gene locus_tag LOCUS_39420 gene rplV 55149 54784 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055941.1 protein_id gnl|my_center|LOCUS_39420 55528 55250 gene locus_tag LOCUS_39430 gene rpsS 55528 55250 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055940.1 protein_id gnl|my_center|LOCUS_39430 56512 55649 gene locus_tag LOCUS_39440 gene rplB 56512 55649 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055939.1 protein_id gnl|my_center|LOCUS_39440 56831 56517 gene locus_tag LOCUS_39450 56831 56517 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055938.1 protein_id gnl|my_center|LOCUS_39450 57456 56824 gene locus_tag LOCUS_39460 gene rplD 57456 56824 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055937.1 protein_id gnl|my_center|LOCUS_39460 58166 57525 gene locus_tag LOCUS_39470 gene rplC 58166 57525 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055936.1 protein_id gnl|my_center|LOCUS_39470 59048 59524 gene locus_tag LOCUS_39480 gene ndhN 59048 59524 CDS product photosynthetic/respiratory NAD(P)H-quinone oxidoreductase subunit N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056972.1 protein_id gnl|my_center|LOCUS_39480 60478 59657 gene locus_tag LOCUS_39490 60478 59657 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_211328137.1 protein_id gnl|my_center|LOCUS_39490 >Feature sequence054 1279 1557 gene locus_tag LOCUS_39500 1279 1557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39500 2268 1822 gene locus_tag LOCUS_39510 2268 1822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39510 2594 2268 gene locus_tag LOCUS_39520 2594 2268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39520 3074 2748 gene locus_tag LOCUS_39530 3074 2748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39530 3313 3071 gene locus_tag LOCUS_39540 3313 3071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39540 3600 4604 gene locus_tag LOCUS_39550 3600 4604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39550 4614 5699 gene locus_tag LOCUS_39560 4614 5699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39560 5741 6586 gene locus_tag LOCUS_39570 5741 6586 CDS product heavy metal-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_093950166.1 protein_id gnl|my_center|LOCUS_39570 7264 7959 gene locus_tag LOCUS_39580 7264 7959 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928651.1 protein_id gnl|my_center|LOCUS_39580 10098 7900 gene locus_tag LOCUS_39590 10098 7900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39590 11076 10660 gene locus_tag LOCUS_39600 11076 10660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39600 11989 11735 gene locus_tag LOCUS_39610 11989 11735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39610 14176 12008 gene locus_tag LOCUS_39620 14176 12008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39620 14529 14200 gene locus_tag LOCUS_39630 14529 14200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39630 15231 14536 gene locus_tag LOCUS_39640 15231 14536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39640 15514 15332 gene locus_tag LOCUS_39650 15514 15332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39650 15793 15545 gene locus_tag LOCUS_39660 15793 15545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39660 16221 15793 gene locus_tag LOCUS_39670 16221 15793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39670 16605 16348 gene locus_tag LOCUS_39680 16605 16348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39680 16864 16622 gene locus_tag LOCUS_39690 16864 16622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39690 17205 16861 gene locus_tag LOCUS_39700 17205 16861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39700 18283 17207 gene locus_tag LOCUS_39710 18283 17207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39710 18609 18788 gene locus_tag LOCUS_39720 18609 18788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39720 21639 19006 gene locus_tag LOCUS_39730 21639 19006 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929449.1 protein_id gnl|my_center|LOCUS_39730 22818 21871 gene locus_tag LOCUS_39740 22818 21871 CDS product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143340.1 protein_id gnl|my_center|LOCUS_39740 23534 22815 gene locus_tag LOCUS_39750 23534 22815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39750 24495 24037 gene locus_tag LOCUS_39760 24495 24037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39760 26082 24499 gene locus_tag LOCUS_39770 26082 24499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39770 27389 26085 gene locus_tag LOCUS_39780 27389 26085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39780 27808 27392 gene locus_tag LOCUS_39790 27808 27392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39790 28731 27805 gene locus_tag LOCUS_39800 28731 27805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39800 29113 28712 gene locus_tag LOCUS_39810 29113 28712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39810 29935 30453 gene locus_tag LOCUS_39820 29935 30453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39820 30450 31220 gene locus_tag LOCUS_39830 30450 31220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39830 31392 32330 gene locus_tag LOCUS_39840 31392 32330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39840 34415 33084 gene locus_tag LOCUS_39850 34415 33084 CDS product lamin tail domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929361.1 protein_id gnl|my_center|LOCUS_39850 35505 34510 gene locus_tag LOCUS_39860 35505 34510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39860 36956 35820 gene locus_tag LOCUS_39870 36956 35820 CDS product DUF3616 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141362.1 protein_id gnl|my_center|LOCUS_39870 37774 38748 gene locus_tag LOCUS_39880 37774 38748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39880 38891 39337 gene locus_tag LOCUS_39890 38891 39337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39890 39466 40896 gene locus_tag LOCUS_39900 39466 40896 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920904.1 protein_id gnl|my_center|LOCUS_39900 41322 41534 gene locus_tag LOCUS_39910 41322 41534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39910 41737 42174 gene locus_tag LOCUS_39920 41737 42174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39920 42331 44919 gene locus_tag LOCUS_39930 42331 44919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39930 46214 48610 gene locus_tag LOCUS_39940 46214 48610 CDS product CHAT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057920.1 protein_id gnl|my_center|LOCUS_39940 48655 48999 gene locus_tag LOCUS_39950 48655 48999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39950 48996 50621 gene locus_tag LOCUS_39960 48996 50621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39960 53213 51660 gene locus_tag LOCUS_39970 53213 51660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39970 55242 53227 gene locus_tag LOCUS_39980 55242 53227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39980 57720 55777 gene locus_tag LOCUS_39990 57720 55777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39990 58404 58000 gene locus_tag LOCUS_40000 58404 58000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40000 59927 59544 gene locus_tag LOCUS_40010 59927 59544 CDS product PIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918726.1 protein_id gnl|my_center|LOCUS_40010 60168 59905 gene locus_tag LOCUS_40020 60168 59905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40020 >Feature sequence055 929 321 gene locus_tag LOCUS_40030 gene clpP 929 321 CDS product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056360.1 protein_id gnl|my_center|LOCUS_40030 1364 1074 gene locus_tag LOCUS_40040 1364 1074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40040 2299 1691 gene locus_tag LOCUS_40050 2299 1691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40050 2646 2284 gene locus_tag LOCUS_40060 2646 2284 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000250563.1 protein_id gnl|my_center|LOCUS_40060 3015 3968 gene locus_tag LOCUS_40070 3015 3968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40070 4439 5227 gene locus_tag LOCUS_40080 4439 5227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40080 5245 5436 gene locus_tag LOCUS_40090 5245 5436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40090 5777 6991 gene locus_tag LOCUS_40100 5777 6991 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227131.1 protein_id gnl|my_center|LOCUS_40100 7425 8159 gene locus_tag LOCUS_40110 7425 8159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40110 8302 9867 gene locus_tag LOCUS_40120 8302 9867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40120 10358 11974 gene locus_tag LOCUS_40130 10358 11974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40130 12765 12022 gene locus_tag LOCUS_40140 12765 12022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40140 13067 14386 gene locus_tag LOCUS_40150 13067 14386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40150 15469 14516 gene locus_tag LOCUS_40160 15469 14516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40160 16914 15520 gene locus_tag LOCUS_40170 16914 15520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40170 17028 17234 gene locus_tag LOCUS_40180 17028 17234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40180 17503 20013 gene locus_tag LOCUS_40190 17503 20013 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_055595104.1 protein_id gnl|my_center|LOCUS_40190 21669 20443 gene locus_tag LOCUS_40200 21669 20443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40200 23160 22441 gene locus_tag LOCUS_40210 23160 22441 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189933225.1 protein_id gnl|my_center|LOCUS_40210 24484 23303 gene locus_tag LOCUS_40220 24484 23303 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545925.1 protein_id gnl|my_center|LOCUS_40220 25994 24735 gene locus_tag LOCUS_40230 25994 24735 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095131.1 protein_id gnl|my_center|LOCUS_40230 27329 26064 gene locus_tag LOCUS_40240 27329 26064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40240 28466 27336 gene locus_tag LOCUS_40250 28466 27336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40250 29635 28463 gene locus_tag LOCUS_40260 29635 28463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40260 30801 29662 gene locus_tag LOCUS_40270 30801 29662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40270 32000 30798 gene locus_tag LOCUS_40280 32000 30798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40280 33214 32003 gene locus_tag LOCUS_40290 33214 32003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40290 33785 33174 gene locus_tag LOCUS_40300 33785 33174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40300 34366 33788 gene locus_tag LOCUS_40310 34366 33788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40310 36189 34378 gene locus_tag LOCUS_40320 36189 34378 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141069.1 protein_id gnl|my_center|LOCUS_40320 37877 36186 gene locus_tag LOCUS_40330 37877 36186 CDS product ABC transporter transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405539.1 protein_id gnl|my_center|LOCUS_40330 38665 38078 gene locus_tag LOCUS_40340 38665 38078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40340 40732 38672 gene locus_tag LOCUS_40350 40732 38672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40350 41323 42222 gene locus_tag LOCUS_40360 41323 42222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40360 42351 43601 gene locus_tag LOCUS_40370 42351 43601 CDS product DUF3500 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123797.1 protein_id gnl|my_center|LOCUS_40370 44376 43897 gene locus_tag LOCUS_40380 44376 43897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40380 47519 44379 gene locus_tag LOCUS_40390 47519 44379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40390 49894 47513 gene locus_tag LOCUS_40400 49894 47513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40400 51143 52114 gene locus_tag LOCUS_40410 51143 52114 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142203.1 protein_id gnl|my_center|LOCUS_40410 52108 52668 gene locus_tag LOCUS_40420 gene rfbC 52108 52668 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142202.1 protein_id gnl|my_center|LOCUS_40420 52870 54150 gene locus_tag LOCUS_40430 52870 54150 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974172.1 protein_id gnl|my_center|LOCUS_40430 54397 55248 gene locus_tag LOCUS_40440 54397 55248 CDS product glucose-1-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142182.1 protein_id gnl|my_center|LOCUS_40440 55501 56154 gene locus_tag LOCUS_40450 55501 56154 CDS product PIG-L family deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142181.1 protein_id gnl|my_center|LOCUS_40450 56232 57548 gene locus_tag LOCUS_40460 56232 57548 CDS product DUF4910 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027082.1 protein_id gnl|my_center|LOCUS_40460 59406 57706 gene locus_tag LOCUS_40470 59406 57706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40470 >Feature sequence056 115 939 gene locus_tag LOCUS_40480 115 939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40480 1637 1152 gene locus_tag LOCUS_40490 gene apcA 1637 1152 CDS product allophycocyanin subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056801.1 protein_id gnl|my_center|LOCUS_40490 4246 3692 gene locus_tag LOCUS_40500 4246 3692 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000201440.1 protein_id gnl|my_center|LOCUS_40500 5295 4351 gene locus_tag LOCUS_40510 gene cysK 5295 4351 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056355.1 protein_id gnl|my_center|LOCUS_40510 5571 7019 gene locus_tag LOCUS_40520 5571 7019 CDS product deoxyribodipyrimidine photo-lyase, 8-HDF type inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056280.1 protein_id gnl|my_center|LOCUS_40520 8339 7383 gene locus_tag LOCUS_40530 8339 7383 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928708.1 protein_id gnl|my_center|LOCUS_40530 8890 9405 gene locus_tag LOCUS_40540 8890 9405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40540 9694 10572 gene locus_tag LOCUS_40550 9694 10572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40550 10792 11469 gene locus_tag LOCUS_40560 10792 11469 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258365.1 protein_id gnl|my_center|LOCUS_40560 11728 14367 gene locus_tag LOCUS_40570 11728 14367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40570 15179 14364 gene locus_tag LOCUS_40580 15179 14364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40580 16684 16962 gene locus_tag LOCUS_40590 16684 16962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40590 17455 18753 gene locus_tag LOCUS_40600 17455 18753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40600 19136 23101 gene locus_tag LOCUS_40610 19136 23101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40610 23363 24631 gene locus_tag LOCUS_40620 gene purD 23363 24631 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920939.1 protein_id gnl|my_center|LOCUS_40620 24905 26830 gene locus_tag LOCUS_40630 24905 26830 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056292.1 protein_id gnl|my_center|LOCUS_40630 27836 27213 gene locus_tag LOCUS_40640 27836 27213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40640 28361 28705 gene locus_tag LOCUS_40650 28361 28705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40650 28665 28889 gene locus_tag LOCUS_40660 28665 28889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40660 29152 29826 gene locus_tag LOCUS_40670 29152 29826 CDS product CadD family cadmium resistance transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002485755.1 protein_id gnl|my_center|LOCUS_40670 30774 30571 gene locus_tag LOCUS_40680 30774 30571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40680 31299 30823 gene locus_tag LOCUS_40690 31299 30823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40690 32098 31844 gene locus_tag LOCUS_40700 32098 31844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40700 32364 32131 gene locus_tag LOCUS_40710 32364 32131 CDS product type II toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813809.1 protein_id gnl|my_center|LOCUS_40710 32587 32357 gene locus_tag LOCUS_40720 32587 32357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40720 36056 32604 gene locus_tag LOCUS_40730 36056 32604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40730 36524 37093 gene locus_tag LOCUS_40740 36524 37093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40740 38059 37751 gene locus_tag LOCUS_40750 38059 37751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40750 38191 38514 gene locus_tag LOCUS_40760 38191 38514 CDS product phasin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056944.1 protein_id gnl|my_center|LOCUS_40760 38591 39115 gene locus_tag LOCUS_40770 38591 39115 CDS product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140843.1 protein_id gnl|my_center|LOCUS_40770 41838 39235 gene locus_tag LOCUS_40780 41838 39235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40780 42489 42076 gene locus_tag LOCUS_40790 42489 42076 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000988700.1 protein_id gnl|my_center|LOCUS_40790 43312 43875 gene locus_tag LOCUS_40800 43312 43875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40800 46935 44218 gene locus_tag LOCUS_40810 46935 44218 CDS product DUF3536 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058103.1 protein_id gnl|my_center|LOCUS_40810 47507 48598 gene locus_tag LOCUS_40820 gene cax 47507 48598 CDS product calcium/proton exchanger inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057620.1 protein_id gnl|my_center|LOCUS_40820 49104 49442 gene locus_tag LOCUS_40830 49104 49442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40830 50007 50810 gene locus_tag LOCUS_40840 50007 50810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40840 53277 50857 gene locus_tag LOCUS_40850 53277 50857 CDS product sucrose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056890.1 protein_id gnl|my_center|LOCUS_40850 53939 53718 gene locus_tag LOCUS_40860 53939 53718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_40860 54464 54225 gene locus_tag LOCUS_40870 54464 54225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_40870 54716 54643 gene locus_tag LOCUS_t00260 54716 54643 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 54829 55209 gene locus_tag LOCUS_40880 54829 55209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40880 55407 56090 gene locus_tag LOCUS_40890 55407 56090 CDS product manganese catalase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144357.1 protein_id gnl|my_center|LOCUS_40890 57150 56851 gene locus_tag LOCUS_40900 57150 56851 CDS product putative quinol monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940931.1 protein_id gnl|my_center|LOCUS_40900 >Feature sequence057 347 541 gene locus_tag LOCUS_40910 347 541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40910 655 915 gene locus_tag LOCUS_40920 655 915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40920 1492 1779 gene locus_tag LOCUS_40930 1492 1779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40930 2061 2630 gene locus_tag LOCUS_40940 2061 2630 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003109619.1 protein_id gnl|my_center|LOCUS_40940 3485 2760 gene locus_tag LOCUS_40950 3485 2760 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143210.1 protein_id gnl|my_center|LOCUS_40950 4557 5633 gene locus_tag LOCUS_40960 4557 5633 CDS product glycosyltransferase family 9 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188715.1 protein_id gnl|my_center|LOCUS_40960 5623 6093 gene locus_tag LOCUS_40970 5623 6093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40970 6610 7578 gene locus_tag LOCUS_40980 6610 7578 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004529463.1 protein_id gnl|my_center|LOCUS_40980 7589 9565 gene locus_tag LOCUS_40990 7589 9565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40990 9954 10169 gene locus_tag LOCUS_41000 9954 10169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41000 10214 11242 gene locus_tag LOCUS_41010 10214 11242 CDS product glycosyltransferase family 9 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868996.1 protein_id gnl|my_center|LOCUS_41010 11247 12350 gene locus_tag LOCUS_41020 11247 12350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41020 12394 12801 gene locus_tag LOCUS_41030 12394 12801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41030 12808 13617 gene locus_tag LOCUS_41040 12808 13617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41040 13879 14907 gene locus_tag LOCUS_41050 13879 14907 CDS product YihY/virulence factor BrkB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929456.1 protein_id gnl|my_center|LOCUS_41050 15511 16071 gene locus_tag LOCUS_41060 15511 16071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41060 16590 16093 gene locus_tag LOCUS_41070 16590 16093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_41070 17220 16648 gene locus_tag LOCUS_41080 17220 16648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_41080 17800 19107 gene locus_tag LOCUS_41090 gene purB 17800 19107 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057666.1 protein_id gnl|my_center|LOCUS_41090 19499 19266 gene locus_tag LOCUS_41100 19499 19266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41100 24407 19803 gene locus_tag LOCUS_41110 24407 19803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41110 25993 28197 gene locus_tag LOCUS_41120 25993 28197 CDS product polysaccharide biosynthesis tyrosine autokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144294.1 protein_id gnl|my_center|LOCUS_41120 28288 29256 gene locus_tag LOCUS_41130 28288 29256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41130 29335 30657 gene locus_tag LOCUS_41140 29335 30657 CDS product flippase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000939580.1 protein_id gnl|my_center|LOCUS_41140 30770 31693 gene locus_tag LOCUS_41150 30770 31693 CDS product hemolytic protein HlpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058218.1 protein_id gnl|my_center|LOCUS_41150 31742 33034 gene locus_tag LOCUS_41160 31742 33034 CDS product O-antigen ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257384.1 protein_id gnl|my_center|LOCUS_41160 33015 34280 gene locus_tag LOCUS_41170 33015 34280 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058221.1 protein_id gnl|my_center|LOCUS_41170 34626 35642 gene locus_tag LOCUS_41180 34626 35642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41180 35811 36791 gene locus_tag LOCUS_41190 35811 36791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41190 36891 37757 gene locus_tag LOCUS_41200 36891 37757 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203012.1 protein_id gnl|my_center|LOCUS_41200 37777 38982 gene locus_tag LOCUS_41210 37777 38982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41210 39021 39791 gene locus_tag LOCUS_41220 39021 39791 CDS product WecB/TagA/CpsF family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257381.1 protein_id gnl|my_center|LOCUS_41220 40005 41432 gene locus_tag LOCUS_41230 40005 41432 CDS product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056473.1 protein_id gnl|my_center|LOCUS_41230 45433 41663 gene locus_tag LOCUS_41240 45433 41663 CDS product NB-ARC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144339.1 protein_id gnl|my_center|LOCUS_41240 45595 46677 gene locus_tag LOCUS_41250 gene psbA 45595 46677 CDS product photosystem II q(b) protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057317.1 protein_id gnl|my_center|LOCUS_41250 47388 46837 gene locus_tag LOCUS_41260 47388 46837 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141208.1 protein_id gnl|my_center|LOCUS_41260 47508 48353 gene locus_tag LOCUS_41270 gene ilvE 47508 48353 CDS product branched-chain-amino-acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583718.1 protein_id gnl|my_center|LOCUS_41270 48622 50784 gene locus_tag LOCUS_41280 48622 50784 CDS product prolyl oligopeptidase family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226986774.1 protein_id gnl|my_center|LOCUS_41280 51955 50876 gene locus_tag LOCUS_41290 gene splB 51955 50876 CDS product spore photoproduct lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245173.1 protein_id gnl|my_center|LOCUS_41290 53921 52350 gene locus_tag LOCUS_41300 gene lnt 53921 52350 CDS product apolipoprotein N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057504.1 protein_id gnl|my_center|LOCUS_41300 56583 54001 gene locus_tag LOCUS_41310 gene gyrA 56583 54001 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057209.1 protein_id gnl|my_center|LOCUS_41310 57111 56779 gene locus_tag LOCUS_41320 57111 56779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41320 >Feature sequence058 1116 142 gene locus_tag LOCUS_41330 gene nadA 1116 142 CDS product quinolinate synthase NadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056086.1 protein_id gnl|my_center|LOCUS_41330 1240 2199 gene locus_tag LOCUS_41340 1240 2199 CDS product TIGR04168 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235619519.1 protein_id gnl|my_center|LOCUS_41340 2272 2358 gene locus_tag LOCUS_t00270 2272 2358 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 3184 2429 gene locus_tag LOCUS_41350 3184 2429 CDS product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096592.1 protein_id gnl|my_center|LOCUS_41350 3313 4149 gene locus_tag LOCUS_41360 3313 4149 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477847.1 protein_id gnl|my_center|LOCUS_41360 4371 4643 gene locus_tag LOCUS_41370 4371 4643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41370 4640 5092 gene locus_tag LOCUS_41380 4640 5092 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034522187.1 protein_id gnl|my_center|LOCUS_41380 5313 7499 gene locus_tag LOCUS_41390 5313 7499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41390 8619 7717 gene locus_tag LOCUS_41400 8619 7717 CDS product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140989.1 protein_id gnl|my_center|LOCUS_41400 9692 8955 gene locus_tag LOCUS_41410 9692 8955 CDS product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057263.1 protein_id gnl|my_center|LOCUS_41410 9894 10880 gene locus_tag LOCUS_41420 9894 10880 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144236.1 protein_id gnl|my_center|LOCUS_41420 11847 10945 gene locus_tag LOCUS_41430 11847 10945 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140798.1 protein_id gnl|my_center|LOCUS_41430 13348 12008 gene locus_tag LOCUS_41440 gene clpX 13348 12008 CDS product ATP-dependent protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144180.1 protein_id gnl|my_center|LOCUS_41440 14053 13358 gene locus_tag LOCUS_41450 gene clpP 14053 13358 CDS product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056360.1 protein_id gnl|my_center|LOCUS_41450 15820 14342 gene locus_tag LOCUS_41460 gene tig 15820 14342 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144179.1 protein_id gnl|my_center|LOCUS_41460 16648 17694 gene locus_tag LOCUS_41470 16648 17694 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197524132.1 protein_id gnl|my_center|LOCUS_41470 17870 18754 gene locus_tag LOCUS_41480 gene dapA 17870 18754 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057061.1 protein_id gnl|my_center|LOCUS_41480 19067 20839 gene locus_tag LOCUS_41490 19067 20839 CDS product ribonuclease J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057062.1 protein_id gnl|my_center|LOCUS_41490 21543 21115 gene locus_tag LOCUS_41500 21543 21115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41500 22894 21695 gene locus_tag LOCUS_41510 22894 21695 CDS product anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057614.1 protein_id gnl|my_center|LOCUS_41510 23538 23912 gene locus_tag LOCUS_41520 23538 23912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41520 25868 24027 gene locus_tag LOCUS_41530 25868 24027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41530 26175 26351 gene locus_tag LOCUS_41540 26175 26351 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140794.1 protein_id gnl|my_center|LOCUS_41540 26512 27102 gene locus_tag LOCUS_41550 26512 27102 CDS product sulfite oxidase-like oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144254.1 protein_id gnl|my_center|LOCUS_41550 28593 27214 gene locus_tag LOCUS_41560 28593 27214 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948760.1 protein_id gnl|my_center|LOCUS_41560 29930 28833 gene locus_tag LOCUS_41570 29930 28833 CDS product hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143115.1 protein_id gnl|my_center|LOCUS_41570 30276 30674 gene locus_tag LOCUS_41580 30276 30674 CDS product CU044_2847 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227643.1 protein_id gnl|my_center|LOCUS_41580 30658 32325 gene locus_tag LOCUS_41590 30658 32325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41590 32325 35180 gene locus_tag LOCUS_41600 32325 35180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41600 35349 35125 gene locus_tag LOCUS_41610 35349 35125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41610 36586 35615 gene locus_tag LOCUS_41620 36586 35615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41620 36735 36932 gene locus_tag LOCUS_41630 36735 36932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41630 38523 37006 gene locus_tag LOCUS_41640 38523 37006 CDS product amino acid ABC transporter substrate-binding protein/permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896718.1 protein_id gnl|my_center|LOCUS_41640 38926 39672 gene locus_tag LOCUS_41650 38926 39672 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582685.1 protein_id gnl|my_center|LOCUS_41650 39867 40466 gene locus_tag LOCUS_41660 39867 40466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41660 40662 41945 gene locus_tag LOCUS_41670 gene tnpB 40662 41945 CDS product IS200/IS605 family element RNA-guided endonuclease TnpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_054297574.1 protein_id gnl|my_center|LOCUS_41670 41977 42204 gene locus_tag LOCUS_41680 41977 42204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41680 43964 42231 gene locus_tag LOCUS_41690 gene ureC 43964 42231 CDS product urease subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055860.1 protein_id gnl|my_center|LOCUS_41690 44510 43974 gene locus_tag LOCUS_41700 44510 43974 CDS product DUF1349 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528144.1 protein_id gnl|my_center|LOCUS_41700 44935 44627 gene locus_tag LOCUS_41710 44935 44627 CDS product urease subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056185.1 protein_id gnl|my_center|LOCUS_41710 45282 44980 gene locus_tag LOCUS_41720 gene ureA 45282 44980 CDS product urease subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056825.1 protein_id gnl|my_center|LOCUS_41720 46183 45326 gene locus_tag LOCUS_41730 46183 45326 CDS product urease accessory protein UreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056386.1 protein_id gnl|my_center|LOCUS_41730 46527 46724 gene locus_tag LOCUS_41740 46527 46724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41740 48237 46846 gene locus_tag LOCUS_41750 48237 46846 CDS product DUF3370 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_198406273.1 protein_id gnl|my_center|LOCUS_41750 48790 48278 gene locus_tag LOCUS_41760 48790 48278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41760 48858 49493 gene locus_tag LOCUS_41770 gene hisH 48858 49493 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057376.1 protein_id gnl|my_center|LOCUS_41770 49679 50221 gene locus_tag LOCUS_41780 gene rsmD 49679 50221 CDS product 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056896.1 protein_id gnl|my_center|LOCUS_41780 50718 51092 gene locus_tag LOCUS_41790 50718 51092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41790 51371 51207 gene locus_tag LOCUS_41800 51371 51207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41800 54077 51567 gene locus_tag LOCUS_41810 54077 51567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41810 54522 55172 gene locus_tag LOCUS_41820 54522 55172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41820 >Feature sequence059 162 899 gene locus_tag LOCUS_41830 162 899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41830 911 1153 gene locus_tag LOCUS_41840 911 1153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41840 2252 1227 gene locus_tag LOCUS_41850 2252 1227 CDS product glucokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920885.1 protein_id gnl|my_center|LOCUS_41850 2911 2264 gene locus_tag LOCUS_41860 2911 2264 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839415.1 protein_id gnl|my_center|LOCUS_41860 3498 3145 gene locus_tag LOCUS_41870 3498 3145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41870 4085 4366 gene locus_tag LOCUS_41880 4085 4366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41880 7545 4582 gene locus_tag LOCUS_41890 7545 4582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41890 8998 7550 gene locus_tag LOCUS_41900 8998 7550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41900 9909 9295 gene locus_tag LOCUS_41910 9909 9295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41910 10786 10046 gene locus_tag LOCUS_41920 10786 10046 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057841.1 protein_id gnl|my_center|LOCUS_41920 11609 10812 gene locus_tag LOCUS_41930 11609 10812 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051618819.1 protein_id gnl|my_center|LOCUS_41930 12553 11615 gene locus_tag LOCUS_41940 12553 11615 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056398.1 protein_id gnl|my_center|LOCUS_41940 13037 12576 gene locus_tag LOCUS_41950 13037 12576 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086784.1 protein_id gnl|my_center|LOCUS_41950 14005 13055 gene locus_tag LOCUS_41960 14005 13055 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479942.1 protein_id gnl|my_center|LOCUS_41960 15026 14013 gene locus_tag LOCUS_41970 15026 14013 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888753.1 protein_id gnl|my_center|LOCUS_41970 15094 15273 gene locus_tag LOCUS_41980 15094 15273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41980 16362 15697 gene locus_tag LOCUS_41990 16362 15697 CDS product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141890.1 protein_id gnl|my_center|LOCUS_41990 16480 17259 gene locus_tag LOCUS_42000 gene rsmG 16480 17259 CDS product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140710.1 protein_id gnl|my_center|LOCUS_42000 18105 17362 gene locus_tag LOCUS_42010 18105 17362 CDS product superoxide dismutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_165444156.1 protein_id gnl|my_center|LOCUS_42010 19679 18495 gene locus_tag LOCUS_42020 19679 18495 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920725.1 protein_id gnl|my_center|LOCUS_42020 20141 20380 gene locus_tag LOCUS_42030 20141 20380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42030 21205 20495 gene locus_tag LOCUS_42040 gene rpiA 21205 20495 CDS product ribose-5-phosphate isomerase RpiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057113.1 protein_id gnl|my_center|LOCUS_42040 22086 21394 gene locus_tag LOCUS_42050 22086 21394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42050 23368 22061 gene locus_tag LOCUS_42060 23368 22061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42060 23987 23730 gene locus_tag LOCUS_42070 23987 23730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42070 24263 24955 gene locus_tag LOCUS_42080 24263 24955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42080 25468 27375 gene locus_tag LOCUS_42090 gene dxs 25468 27375 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056470.1 protein_id gnl|my_center|LOCUS_42090 27478 27299 gene locus_tag LOCUS_42100 27478 27299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42100 28230 30761 gene locus_tag LOCUS_42110 28230 30761 CDS product DUF3769 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015184012.1 protein_id gnl|my_center|LOCUS_42110 32502 30823 gene locus_tag LOCUS_42120 32502 30823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42120 32606 35848 gene locus_tag LOCUS_42130 32606 35848 CDS product alpha-mannosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928424.1 protein_id gnl|my_center|LOCUS_42130 36147 37199 gene locus_tag LOCUS_42140 36147 37199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42140 37853 38059 gene locus_tag LOCUS_42150 gene psbH 37853 38059 CDS product photosystem II reaction center protein PsbH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057226.1 protein_id gnl|my_center|LOCUS_42150 38240 38512 gene locus_tag LOCUS_42160 38240 38512 CDS product TatA/E family twin arginine-targeting protein translocase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057225.1 protein_id gnl|my_center|LOCUS_42160 38525 39163 gene locus_tag LOCUS_42170 gene pth 38525 39163 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057224.1 protein_id gnl|my_center|LOCUS_42170 39483 39304 gene locus_tag LOCUS_42180 39483 39304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42180 40496 39642 gene locus_tag LOCUS_42190 gene rsmI 40496 39642 CDS product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057354.1 protein_id gnl|my_center|LOCUS_42190 40625 41488 gene locus_tag LOCUS_42200 40625 41488 CDS product PfkB family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731542.1 protein_id gnl|my_center|LOCUS_42200 42018 42872 gene locus_tag LOCUS_42210 42018 42872 CDS product 3'(2'),5'-bisphosphate nucleotidase CysQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125459.1 protein_id gnl|my_center|LOCUS_42210 43132 42887 gene locus_tag LOCUS_42220 43132 42887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42220 43487 43110 gene locus_tag LOCUS_42230 43487 43110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42230 43794 43597 gene locus_tag LOCUS_42240 43794 43597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42240 44637 44831 gene locus_tag LOCUS_42250 44637 44831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42250 45108 45959 gene locus_tag LOCUS_42260 45108 45959 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546238.1 protein_id gnl|my_center|LOCUS_42260 46645 45962 gene locus_tag LOCUS_42270 46645 45962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42270 46903 47229 gene locus_tag LOCUS_42280 46903 47229 CDS product heavy metal-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042440518.1 protein_id gnl|my_center|LOCUS_42280 47643 48272 gene locus_tag LOCUS_42290 47643 48272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929093.1 protein_id gnl|my_center|LOCUS_42290 48646 48386 gene locus_tag LOCUS_42300 48646 48386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42300 49473 48799 gene locus_tag LOCUS_42310 gene sufR 49473 48799 CDS product iron-sulfur cluster biosynthesis transcriptional regulator SufR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056342.1 protein_id gnl|my_center|LOCUS_42310 49707 51146 gene locus_tag LOCUS_42320 gene sufB 49707 51146 CDS product Fe-S cluster assembly protein SufB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056341.1 protein_id gnl|my_center|LOCUS_42320 51304 52092 gene locus_tag LOCUS_42330 gene sufC 51304 52092 CDS product Fe-S cluster assembly ATPase SufC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057741.1 protein_id gnl|my_center|LOCUS_42330 52092 53510 gene locus_tag LOCUS_42340 gene sufD 52092 53510 CDS product Fe-S cluster assembly protein SufD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057742.1 protein_id gnl|my_center|LOCUS_42340 53593 54864 gene locus_tag LOCUS_42350 53593 54864 CDS product SufS family cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057903.1 protein_id gnl|my_center|LOCUS_42350 55036 55599 gene locus_tag LOCUS_42360 55036 55599 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017653748.1 protein_id gnl|my_center|LOCUS_42360 >Feature sequence060 1323 2147 gene locus_tag LOCUS_42370 1323 2147 CDS product DUF4351 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144335.1 protein_id gnl|my_center|LOCUS_42370 2326 2577 gene locus_tag LOCUS_42380 2326 2577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42380 4128 2701 gene locus_tag LOCUS_42390 4128 2701 CDS product TldD/PmbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929201.1 protein_id gnl|my_center|LOCUS_42390 4546 6192 gene locus_tag LOCUS_42400 4546 6192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42400 6478 7668 gene locus_tag LOCUS_42410 6478 7668 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142859.1 protein_id gnl|my_center|LOCUS_42410 8086 9366 gene locus_tag LOCUS_42420 8086 9366 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975891.1 protein_id gnl|my_center|LOCUS_42420 9958 9509 gene locus_tag LOCUS_42430 9958 9509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42430 10161 9955 gene locus_tag LOCUS_42440 10161 9955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42440 10701 11249 gene locus_tag LOCUS_42450 10701 11249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42450 11289 12425 gene locus_tag LOCUS_42460 11289 12425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42460 13837 12659 gene locus_tag LOCUS_42470 13837 12659 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172598138.1 protein_id gnl|my_center|LOCUS_42470 14469 13840 gene locus_tag LOCUS_42480 14469 13840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140615.1 protein_id gnl|my_center|LOCUS_42480 14650 15504 gene locus_tag LOCUS_42490 14650 15504 CDS product FAD-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920712.1 protein_id gnl|my_center|LOCUS_42490 15585 16598 gene locus_tag LOCUS_42500 15585 16598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42500 16591 17556 gene locus_tag LOCUS_42510 16591 17556 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529106.1 protein_id gnl|my_center|LOCUS_42510 17553 18719 gene locus_tag LOCUS_42520 17553 18719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42520 19060 20094 gene locus_tag LOCUS_42530 19060 20094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42530 20640 21386 gene locus_tag LOCUS_42540 20640 21386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42540 21386 21802 gene locus_tag LOCUS_42550 21386 21802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055866.1 protein_id gnl|my_center|LOCUS_42550 23660 23214 gene locus_tag LOCUS_42560 23660 23214 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486148.1 protein_id gnl|my_center|LOCUS_42560 25601 23790 gene locus_tag LOCUS_42570 gene lepA 25601 23790 CDS product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056160.1 protein_id gnl|my_center|LOCUS_42570 26089 26325 gene locus_tag LOCUS_42580 26089 26325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42580 26628 28271 gene locus_tag LOCUS_42590 26628 28271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42590 28345 28995 gene locus_tag LOCUS_42600 28345 28995 CDS product DUF3386 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056760.1 protein_id gnl|my_center|LOCUS_42600 29135 29365 gene locus_tag LOCUS_42610 29135 29365 CDS product NifU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142871.1 protein_id gnl|my_center|LOCUS_42610 29529 31766 gene locus_tag LOCUS_42620 29529 31766 CDS product glycoside hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920844.1 protein_id gnl|my_center|LOCUS_42620 33177 35165 gene locus_tag LOCUS_42630 33177 35165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42630 35358 36392 gene locus_tag LOCUS_42640 35358 36392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42640 36986 36453 gene locus_tag LOCUS_42650 36986 36453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42650 37294 38142 gene locus_tag LOCUS_42660 37294 38142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42660 39180 41105 gene locus_tag LOCUS_42670 39180 41105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42670 41126 42010 gene locus_tag LOCUS_42680 41126 42010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42680 42391 44265 gene locus_tag LOCUS_42690 42391 44265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42690 47458 44285 gene locus_tag LOCUS_42700 47458 44285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42700 48140 47628 gene locus_tag LOCUS_42710 48140 47628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42710 48673 48972 gene locus_tag LOCUS_42720 48673 48972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42720 51925 49265 gene locus_tag LOCUS_42730 51925 49265 CDS product chloride channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144168.1 protein_id gnl|my_center|LOCUS_42730 53552 52221 gene locus_tag LOCUS_42740 53552 52221 CDS product TldD/PmbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141361.1 protein_id gnl|my_center|LOCUS_42740 54477 53614 gene locus_tag LOCUS_42750 54477 53614 CDS product Tab2/Atab2 family RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057821.1 protein_id gnl|my_center|LOCUS_42750 >Feature sequence061 872 423 gene locus_tag LOCUS_42760 872 423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42760 1639 869 gene locus_tag LOCUS_42770 1639 869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42770 1786 2109 gene locus_tag LOCUS_42780 1786 2109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42780 2136 2501 gene locus_tag LOCUS_42790 2136 2501 CDS product four helix bundle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016267883.1 protein_id gnl|my_center|LOCUS_42790 6015 2908 gene locus_tag LOCUS_42800 6015 2908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42800 7366 6380 gene locus_tag LOCUS_42810 7366 6380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42810 7626 7554 gene locus_tag LOCUS_t00280 7626 7554 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 8573 7704 gene locus_tag LOCUS_42820 8573 7704 CDS product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056352.1 protein_id gnl|my_center|LOCUS_42820 8668 9054 gene locus_tag LOCUS_42830 8668 9054 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099799703.1 protein_id gnl|my_center|LOCUS_42830 9936 9130 gene locus_tag LOCUS_42840 9936 9130 CDS product metal ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057898.1 protein_id gnl|my_center|LOCUS_42840 11093 10074 gene locus_tag LOCUS_42850 11093 10074 CDS product metal ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057897.1 protein_id gnl|my_center|LOCUS_42850 11545 13125 gene locus_tag LOCUS_42860 11545 13125 CDS product iron uptake porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058157.1 protein_id gnl|my_center|LOCUS_42860 15128 13395 gene locus_tag LOCUS_42870 15128 13395 CDS product NFACT RNA binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057893.1 protein_id gnl|my_center|LOCUS_42870 16137 15376 gene locus_tag LOCUS_42880 16137 15376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42880 18147 16861 gene locus_tag LOCUS_42890 18147 16861 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143828.1 protein_id gnl|my_center|LOCUS_42890 19162 19398 gene locus_tag LOCUS_42900 19162 19398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42900 19523 19912 gene locus_tag LOCUS_42910 19523 19912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057994.1 protein_id gnl|my_center|LOCUS_42910 20507 19995 gene locus_tag LOCUS_42920 20507 19995 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920888.1 protein_id gnl|my_center|LOCUS_42920 23306 21084 gene locus_tag LOCUS_42930 23306 21084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42930 25275 23638 gene locus_tag LOCUS_42940 25275 23638 CDS product peptide chain release factor 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058039.1 protein_id gnl|my_center|LOCUS_42940 25413 25754 gene locus_tag LOCUS_42950 25413 25754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42950 26111 27091 gene locus_tag LOCUS_42960 gene hemB 26111 27091 CDS product porphobilinogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144341.1 protein_id gnl|my_center|LOCUS_42960 27460 27804 gene locus_tag LOCUS_42970 27460 27804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42970 29154 27967 gene locus_tag LOCUS_42980 29154 27967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141987.1 protein_id gnl|my_center|LOCUS_42980 29648 30631 gene locus_tag LOCUS_42990 29648 30631 CDS product alpha-ketoacid dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056059.1 protein_id gnl|my_center|LOCUS_42990 30842 32254 gene locus_tag LOCUS_43000 gene secD 30842 32254 CDS product protein translocase subunit SecD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056058.1 protein_id gnl|my_center|LOCUS_43000 32251 33231 gene locus_tag LOCUS_43010 gene secF 32251 33231 CDS product protein translocase subunit SecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056057.1 protein_id gnl|my_center|LOCUS_43010 33378 33791 gene locus_tag LOCUS_43020 33378 33791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_045052736.1 protein_id gnl|my_center|LOCUS_43020 33898 34371 gene locus_tag LOCUS_43030 33898 34371 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023171945.1 protein_id gnl|my_center|LOCUS_43030 35254 34322 gene locus_tag LOCUS_43040 35254 34322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43040 36647 36021 gene locus_tag LOCUS_43050 36647 36021 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920984.1 protein_id gnl|my_center|LOCUS_43050 37707 36796 gene locus_tag LOCUS_43060 gene prmC 37707 36796 CDS product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172187304.1 protein_id gnl|my_center|LOCUS_43060 38581 37733 gene locus_tag LOCUS_43070 38581 37733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057863.1 protein_id gnl|my_center|LOCUS_43070 39450 39375 gene locus_tag LOCUS_t00290 39450 39375 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 40318 39767 gene locus_tag LOCUS_43080 40318 39767 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057519.1 protein_id gnl|my_center|LOCUS_43080 40817 41788 gene locus_tag LOCUS_43090 40817 41788 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140798.1 protein_id gnl|my_center|LOCUS_43090 42852 41809 gene locus_tag LOCUS_43100 gene tsaD 42852 41809 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056353.1 protein_id gnl|my_center|LOCUS_43100 43174 43677 gene locus_tag LOCUS_43110 43174 43677 CDS product photosystem I reaction center subunit III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058243.1 protein_id gnl|my_center|LOCUS_43110 44465 44992 gene locus_tag LOCUS_43120 44465 44992 CDS product photosystem I reaction center protein subunit XI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058236.1 protein_id gnl|my_center|LOCUS_43120 46091 45495 gene locus_tag LOCUS_43130 gene gmk 46091 45495 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055909.1 protein_id gnl|my_center|LOCUS_43130 46528 46259 gene locus_tag LOCUS_43140 46528 46259 CDS product DUF370 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965024.1 protein_id gnl|my_center|LOCUS_43140 48103 46976 gene locus_tag LOCUS_43150 48103 46976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_43150 49225 48242 gene locus_tag LOCUS_43160 49225 48242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_43160 50506 49532 gene locus_tag LOCUS_43170 50506 49532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43170 51689 50499 gene locus_tag LOCUS_43180 51689 50499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43180 51894 52367 gene locus_tag LOCUS_43190 51894 52367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43190 53414 52443 gene locus_tag LOCUS_43200 gene sds 53414 52443 CDS product solanesyl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057594.1 protein_id gnl|my_center|LOCUS_43200 >Feature sequence062 1230 2318 gene locus_tag LOCUS_43210 1230 2318 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057430.1 protein_id gnl|my_center|LOCUS_43210 3053 2529 gene locus_tag LOCUS_43220 3053 2529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099798166.1 protein_id gnl|my_center|LOCUS_43220 3801 3283 gene locus_tag LOCUS_43230 3801 3283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43230 4301 3798 gene locus_tag LOCUS_43240 4301 3798 CDS product DUF1622 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140753.1 protein_id gnl|my_center|LOCUS_43240 5628 4627 gene locus_tag LOCUS_43250 5628 4627 CDS product NAD(P)-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207999.1 protein_id gnl|my_center|LOCUS_43250 6951 5803 gene locus_tag LOCUS_43260 6951 5803 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142015.1 protein_id gnl|my_center|LOCUS_43260 8211 7099 gene locus_tag LOCUS_43270 8211 7099 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142014.1 protein_id gnl|my_center|LOCUS_43270 10303 8327 gene locus_tag LOCUS_43280 10303 8327 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142013.1 protein_id gnl|my_center|LOCUS_43280 11665 10352 gene locus_tag LOCUS_43290 11665 10352 CDS product HlyD family efflux transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928915.1 protein_id gnl|my_center|LOCUS_43290 12476 11751 gene locus_tag LOCUS_43300 12476 11751 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256712.1 protein_id gnl|my_center|LOCUS_43300 12852 13613 gene locus_tag LOCUS_43310 12852 13613 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921020.1 protein_id gnl|my_center|LOCUS_43310 14282 13653 gene locus_tag LOCUS_43320 14282 13653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43320 14834 14520 gene locus_tag LOCUS_43330 14834 14520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43330 14935 15450 gene locus_tag LOCUS_43340 14935 15450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43340 15989 15720 gene locus_tag LOCUS_43350 15989 15720 CDS product GlsB/YeaQ/YmgE family stress response membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000511323.1 protein_id gnl|my_center|LOCUS_43350 17203 18480 gene locus_tag LOCUS_43360 17203 18480 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057429.1 protein_id gnl|my_center|LOCUS_43360 18692 18913 gene locus_tag LOCUS_43370 18692 18913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43370 19227 18925 gene locus_tag LOCUS_43380 19227 18925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43380 19326 19568 gene locus_tag LOCUS_43390 19326 19568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43390 19964 21457 gene locus_tag LOCUS_43400 19964 21457 CDS product carotenoid oxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042464373.1 protein_id gnl|my_center|LOCUS_43400 21533 22198 gene locus_tag LOCUS_43410 21533 22198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057488.1 protein_id gnl|my_center|LOCUS_43410 23455 22187 gene locus_tag LOCUS_43420 23455 22187 CDS product flavin monoamine oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003118815.1 protein_id gnl|my_center|LOCUS_43420 23739 24404 gene locus_tag LOCUS_43430 23739 24404 CDS product phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064926.1 protein_id gnl|my_center|LOCUS_43430 24456 25133 gene locus_tag LOCUS_43440 24456 25133 CDS product HPF/RaiA family ribosome-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946938.1 protein_id gnl|my_center|LOCUS_43440 25807 27576 gene locus_tag LOCUS_43450 25807 27576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43450 28263 27697 gene locus_tag LOCUS_43460 28263 27697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43460 29815 28820 gene locus_tag LOCUS_43470 29815 28820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43470 31121 32353 gene locus_tag LOCUS_43480 31121 32353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43480 32562 32350 gene locus_tag LOCUS_43490 gene thiS 32562 32350 CDS product sulfur carrier protein ThiS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056654.1 protein_id gnl|my_center|LOCUS_43490 33628 32555 gene locus_tag LOCUS_43500 33628 32555 CDS product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920956.1 protein_id gnl|my_center|LOCUS_43500 33827 35899 gene locus_tag LOCUS_43510 33827 35899 CDS product DUF1565 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928516.1 protein_id gnl|my_center|LOCUS_43510 39588 36559 gene locus_tag LOCUS_43520 39588 36559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142653.1 protein_id gnl|my_center|LOCUS_43520 40429 39689 gene locus_tag LOCUS_43530 40429 39689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43530 42064 40511 gene locus_tag LOCUS_43540 42064 40511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43540 42345 43358 gene locus_tag LOCUS_43550 42345 43358 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057313.1 protein_id gnl|my_center|LOCUS_43550 43359 44171 gene locus_tag LOCUS_43560 43359 44171 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197524099.1 protein_id gnl|my_center|LOCUS_43560 44394 46238 gene locus_tag LOCUS_43570 44394 46238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43570 46318 46944 gene locus_tag LOCUS_43580 46318 46944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43580 47164 46994 gene locus_tag LOCUS_43590 47164 46994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43590 48003 48806 gene locus_tag LOCUS_43600 gene purU 48003 48806 CDS product formyltetrahydrofolate deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197524116.1 protein_id gnl|my_center|LOCUS_43600 49815 49312 gene locus_tag LOCUS_43610 49815 49312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43610 51111 50044 gene locus_tag LOCUS_43620 51111 50044 CDS product catalase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000516666.1 protein_id gnl|my_center|LOCUS_43620 52837 51275 gene locus_tag LOCUS_43630 52837 51275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43630 >Feature sequence063 1316 81 gene locus_tag LOCUS_43640 1316 81 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404998.1 protein_id gnl|my_center|LOCUS_43640 2236 1322 gene locus_tag LOCUS_43650 2236 1322 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228806.1 protein_id gnl|my_center|LOCUS_43650 3614 2397 gene locus_tag LOCUS_43660 3614 2397 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140060.1 protein_id gnl|my_center|LOCUS_43660 4022 4945 gene locus_tag LOCUS_43670 4022 4945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057923.1 protein_id gnl|my_center|LOCUS_43670 7064 5526 gene locus_tag LOCUS_43680 7064 5526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43680 7681 7607 gene locus_tag LOCUS_t00300 7681 7607 tRNA product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 7753 7682 gene locus_tag LOCUS_t00310 7753 7682 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 8949 7939 gene locus_tag LOCUS_43690 8949 7939 CDS product NAD(P)-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000870126.1 protein_id gnl|my_center|LOCUS_43690 9727 9128 gene locus_tag LOCUS_43700 9727 9128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43700 10276 11541 gene locus_tag LOCUS_43710 10276 11541 CDS product HhoA/HhoB/HtrA family serine endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058268.1 protein_id gnl|my_center|LOCUS_43710 15379 11591 gene locus_tag LOCUS_43720 15379 11591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43720 16837 16157 gene locus_tag LOCUS_43730 16837 16157 CDS product N-acetylmannosamine-6-phosphate 2-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058093.1 protein_id gnl|my_center|LOCUS_43730 17183 18436 gene locus_tag LOCUS_43740 17183 18436 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029132.1 protein_id gnl|my_center|LOCUS_43740 20521 18581 gene locus_tag LOCUS_43750 20521 18581 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056743.1 protein_id gnl|my_center|LOCUS_43750 20695 24711 gene locus_tag LOCUS_43760 gene cobN 20695 24711 CDS product cobaltochelatase subunit CobN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056744.1 protein_id gnl|my_center|LOCUS_43760 24730 25941 gene locus_tag LOCUS_43770 24730 25941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43770 26523 26068 gene locus_tag LOCUS_43780 26523 26068 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143294.1 protein_id gnl|my_center|LOCUS_43780 28127 26880 gene locus_tag LOCUS_43790 28127 26880 CDS product RNA polymerase sigma factor, RpoD/SigA family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193345474.1 protein_id gnl|my_center|LOCUS_43790 29544 28624 gene locus_tag LOCUS_43800 29544 28624 CDS product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143656.1 protein_id gnl|my_center|LOCUS_43800 30457 29579 gene locus_tag LOCUS_43810 gene lipA 30457 29579 CDS product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921111.1 protein_id gnl|my_center|LOCUS_43810 30589 30662 gene locus_tag LOCUS_t00320 30589 30662 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 30932 31117 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq ctttcaacccacccctagccgggatggttgttgaaact 33455 31602 gene locus_tag LOCUS_43820 33455 31602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43820 33570 33815 gene locus_tag LOCUS_43830 33570 33815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43830 35720 33852 gene locus_tag LOCUS_43840 35720 33852 CDS product DUF262 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031064.1 protein_id gnl|my_center|LOCUS_43840 36132 35818 gene locus_tag LOCUS_43850 36132 35818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43850 37145 36966 gene locus_tag LOCUS_43860 37145 36966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43860 37953 37138 gene locus_tag LOCUS_43870 37953 37138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43870 38248 37985 gene locus_tag LOCUS_43880 38248 37985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43880 39586 41121 gene locus_tag LOCUS_43890 39586 41121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43890 41154 42371 gene locus_tag LOCUS_43900 41154 42371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43900 42364 43620 gene locus_tag LOCUS_43910 42364 43620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43910 43855 44592 gene locus_tag LOCUS_43920 43855 44592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43920 44597 45196 gene locus_tag LOCUS_43930 44597 45196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43930 45215 45547 gene locus_tag LOCUS_43940 45215 45547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43940 45560 46651 gene locus_tag LOCUS_43950 45560 46651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43950 46819 47421 gene locus_tag LOCUS_43960 46819 47421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43960 47435 48355 gene locus_tag LOCUS_43970 47435 48355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43970 48367 48975 gene locus_tag LOCUS_43980 48367 48975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43980 49577 49074 gene locus_tag LOCUS_43990 49577 49074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43990 50413 49577 gene locus_tag LOCUS_44000 50413 49577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44000 52215 50476 gene locus_tag LOCUS_44010 52215 50476 CDS product DDE-type integrase/transposase/recombinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117505.1 protein_id gnl|my_center|LOCUS_44010 >Feature sequence064 369 971 gene locus_tag LOCUS_44020 369 971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44020 1573 1319 gene locus_tag LOCUS_44030 1573 1319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44030 2367 4271 gene locus_tag LOCUS_44040 2367 4271 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142700.1 protein_id gnl|my_center|LOCUS_44040 4412 4705 gene locus_tag LOCUS_44050 gene clpS 4412 4705 CDS product ATP-dependent Clp protease adapter ClpS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056930.1 protein_id gnl|my_center|LOCUS_44050 4738 5031 gene locus_tag LOCUS_44060 4738 5031 CDS product DUF2103 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920842.1 protein_id gnl|my_center|LOCUS_44060 5192 5389 gene locus_tag LOCUS_44070 5192 5389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44070 5797 5477 gene locus_tag LOCUS_44080 5797 5477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929519.1 protein_id gnl|my_center|LOCUS_44080 6751 6263 gene locus_tag LOCUS_44090 6751 6263 CDS product molybdenum cofactor biosynthesis protein MoaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144350.1 protein_id gnl|my_center|LOCUS_44090 7457 10267 gene locus_tag LOCUS_44100 7457 10267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44100 10368 13670 gene locus_tag LOCUS_44110 10368 13670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44110 13800 14246 gene locus_tag LOCUS_44120 13800 14246 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000642733.1 protein_id gnl|my_center|LOCUS_44120 14263 16155 gene locus_tag LOCUS_44130 14263 16155 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929287.1 protein_id gnl|my_center|LOCUS_44130 16244 16633 gene locus_tag LOCUS_44140 16244 16633 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140146.1 protein_id gnl|my_center|LOCUS_44140 17335 16787 gene locus_tag LOCUS_44150 gene pyrR 17335 16787 CDS product bifunctional pyr operon transcriptional regulator/uracil phosphoribosyltransferase PyrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921232.1 protein_id gnl|my_center|LOCUS_44150 17469 17332 gene locus_tag LOCUS_44160 17469 17332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44160 18440 17481 gene locus_tag LOCUS_44170 gene cbiB 18440 17481 CDS product adenosylcobinamide-phosphate synthase CbiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058209.1 protein_id gnl|my_center|LOCUS_44170 18918 18475 gene locus_tag LOCUS_44180 18918 18475 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056024.1 protein_id gnl|my_center|LOCUS_44180 19570 19983 gene locus_tag LOCUS_44190 19570 19983 CDS product AbrB family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058006.1 protein_id gnl|my_center|LOCUS_44190 22112 20172 gene locus_tag LOCUS_44200 22112 20172 CDS product chloride channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056000.1 protein_id gnl|my_center|LOCUS_44200 23150 23428 gene locus_tag LOCUS_44210 23150 23428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44210 25130 23508 gene locus_tag LOCUS_44220 25130 23508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44220 27001 25997 gene locus_tag LOCUS_44230 27001 25997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_072379586.1 protein_id gnl|my_center|LOCUS_44230 28819 27521 gene locus_tag LOCUS_44240 28819 27521 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056607.1 protein_id gnl|my_center|LOCUS_44240 29366 28962 gene locus_tag LOCUS_44250 29366 28962 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143896.1 protein_id gnl|my_center|LOCUS_44250 29554 29775 gene locus_tag LOCUS_44260 29554 29775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44260 30059 29778 gene locus_tag LOCUS_44270 30059 29778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007358131.1 protein_id gnl|my_center|LOCUS_44270 30926 31174 gene locus_tag LOCUS_44280 30926 31174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44280 32205 31882 gene locus_tag LOCUS_44290 32205 31882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44290 32444 32205 gene locus_tag LOCUS_44300 32444 32205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44300 32705 33589 gene locus_tag LOCUS_44310 32705 33589 CDS product aspartoacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124406.1 protein_id gnl|my_center|LOCUS_44310 34658 36673 gene locus_tag LOCUS_44320 34658 36673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44320 37926 36739 gene locus_tag LOCUS_44330 gene speY 37926 36739 CDS product deoxyhypusine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920761.1 protein_id gnl|my_center|LOCUS_44330 38666 38145 gene locus_tag LOCUS_44340 38666 38145 CDS product O-acetyl-ADP-ribose deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065167.1 protein_id gnl|my_center|LOCUS_44340 39594 38737 gene locus_tag LOCUS_44350 39594 38737 CDS product glycosyltransferase family A protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257977.1 protein_id gnl|my_center|LOCUS_44350 40116 41219 gene locus_tag LOCUS_44360 40116 41219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44360 41363 42079 gene locus_tag LOCUS_44370 gene cobO 41363 42079 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056120.1 protein_id gnl|my_center|LOCUS_44370 42882 42133 gene locus_tag LOCUS_44380 42882 42133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44380 44862 43879 gene locus_tag LOCUS_44390 44862 43879 CDS product RNA polymerase sigma factor, RpoD/SigA family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193329020.1 protein_id gnl|my_center|LOCUS_44390 47884 46142 gene locus_tag LOCUS_44400 47884 46142 CDS product DUF87 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144388.1 protein_id gnl|my_center|LOCUS_44400 48802 48005 gene locus_tag LOCUS_44410 48802 48005 CDS product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124285.1 protein_id gnl|my_center|LOCUS_44410 49711 50595 gene locus_tag LOCUS_44420 49711 50595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44420 51347 51517 gene locus_tag LOCUS_44430 51347 51517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44430 52449 51514 gene locus_tag LOCUS_44440 52449 51514 CDS product NADP-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020817.1 protein_id gnl|my_center|LOCUS_44440 >Feature sequence065 142 639 gene locus_tag LOCUS_44450 142 639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44450 636 887 gene locus_tag LOCUS_44460 636 887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44460 908 1324 gene locus_tag LOCUS_44470 908 1324 CDS product secondary thiamine-phosphate synthase enzyme YjbQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023174926.1 protein_id gnl|my_center|LOCUS_44470 1365 2111 gene locus_tag LOCUS_44480 1365 2111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44480 2162 2968 gene locus_tag LOCUS_44490 2162 2968 CDS product Nif3-like dinuclear metal center hexameric protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964615.1 protein_id gnl|my_center|LOCUS_44490 3611 4780 gene locus_tag LOCUS_44500 3611 4780 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_073856746.1 protein_id gnl|my_center|LOCUS_44500 5721 5972 gene locus_tag LOCUS_44510 5721 5972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44510 5941 6201 gene locus_tag LOCUS_44520 5941 6201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143670.1 protein_id gnl|my_center|LOCUS_44520 7958 6288 gene locus_tag LOCUS_44530 7958 6288 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056997.1 protein_id gnl|my_center|LOCUS_44530 8476 8607 gene locus_tag LOCUS_44540 8476 8607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44540 9420 8650 gene locus_tag LOCUS_44550 9420 8650 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920882.1 protein_id gnl|my_center|LOCUS_44550 10025 9417 gene locus_tag LOCUS_44560 10025 9417 CDS product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057311.1 protein_id gnl|my_center|LOCUS_44560 10678 10217 gene locus_tag LOCUS_44570 10678 10217 CDS product diacylglycerol kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920902.1 protein_id gnl|my_center|LOCUS_44570 11344 10820 gene locus_tag LOCUS_44580 gene ybeY 11344 10820 CDS product rRNA maturation RNase YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928724.1 protein_id gnl|my_center|LOCUS_44580 12775 11789 gene locus_tag LOCUS_44590 gene prfB 12775 11789 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_126988096.1 protein_id gnl|my_center|LOCUS_44590 14189 13374 gene locus_tag LOCUS_44600 14189 13374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142083.1 protein_id gnl|my_center|LOCUS_44600 14965 16326 gene locus_tag LOCUS_44610 14965 16326 CDS product CmpA/NrtA family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057835.1 protein_id gnl|my_center|LOCUS_44610 16365 17204 gene locus_tag LOCUS_44620 gene ntrB 16365 17204 CDS product nitrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142085.1 protein_id gnl|my_center|LOCUS_44620 17304 19307 gene locus_tag LOCUS_44630 17304 19307 CDS product nitrate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057837.1 protein_id gnl|my_center|LOCUS_44630 19473 20321 gene locus_tag LOCUS_44640 19473 20321 CDS product nitrate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142088.1 protein_id gnl|my_center|LOCUS_44640 20597 22324 gene locus_tag LOCUS_44650 20597 22324 CDS product diflavin flavoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056931.1 protein_id gnl|my_center|LOCUS_44650 22363 23235 gene locus_tag LOCUS_44660 22363 23235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44660 23302 25023 gene locus_tag LOCUS_44670 23302 25023 CDS product diflavin flavoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057213.1 protein_id gnl|my_center|LOCUS_44670 25152 25730 gene locus_tag LOCUS_44680 25152 25730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44680 27366 26071 gene locus_tag LOCUS_44690 27366 26071 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118148.1 protein_id gnl|my_center|LOCUS_44690 27523 27948 gene locus_tag LOCUS_44700 27523 27948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44700 28247 27939 gene locus_tag LOCUS_44710 28247 27939 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879039.1 protein_id gnl|my_center|LOCUS_44710 29089 28361 gene locus_tag LOCUS_44720 29089 28361 CDS product Bax inhibitor-1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920695.1 protein_id gnl|my_center|LOCUS_44720 29596 30369 gene locus_tag LOCUS_44730 29596 30369 CDS product RNA polymerase sigma factor SigF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056585.1 protein_id gnl|my_center|LOCUS_44730 32580 30430 gene locus_tag LOCUS_44740 32580 30430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44740 33210 34265 gene locus_tag LOCUS_44750 33210 34265 CDS product tetraprenyl-beta-curcumene synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001102461.1 protein_id gnl|my_center|LOCUS_44750 34396 35517 gene locus_tag LOCUS_44760 34396 35517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44760 37105 35588 gene locus_tag LOCUS_44770 37105 35588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44770 38411 37377 gene locus_tag LOCUS_44780 38411 37377 CDS product LptF/LptG family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143323.1 protein_id gnl|my_center|LOCUS_44780 39538 38810 gene locus_tag LOCUS_44790 gene lptB 39538 38810 CDS product LPS export ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_045053120.1 protein_id gnl|my_center|LOCUS_44790 40078 39560 gene locus_tag LOCUS_44800 40078 39560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44800 41003 40614 gene locus_tag LOCUS_44810 41003 40614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44810 41365 41000 gene locus_tag LOCUS_44820 41365 41000 CDS product ferredoxin-thioredoxin reductase catalytic domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055968.1 protein_id gnl|my_center|LOCUS_44820 42813 41608 gene locus_tag LOCUS_44830 42813 41608 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057921.1 protein_id gnl|my_center|LOCUS_44830 44901 43111 gene locus_tag LOCUS_44840 gene typA 44901 43111 CDS product translational GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058116.1 protein_id gnl|my_center|LOCUS_44840 45393 45758 gene locus_tag LOCUS_44850 45393 45758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44850 46039 47085 gene locus_tag LOCUS_44860 gene cobW 46039 47085 CDS product cobalamin biosynthesis protein CobW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895644.1 protein_id gnl|my_center|LOCUS_44860 47216 47680 gene locus_tag LOCUS_44870 47216 47680 CDS product ABA4-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143823.1 protein_id gnl|my_center|LOCUS_44870 47870 48199 gene locus_tag LOCUS_44880 47870 48199 CDS product YdhR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265742.1 protein_id gnl|my_center|LOCUS_44880 48650 48432 gene locus_tag LOCUS_44890 48650 48432 CDS product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_095724389.1 protein_id gnl|my_center|LOCUS_44890 49224 48913 gene locus_tag LOCUS_44900 49224 48913 CDS product DUF3181 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920922.1 protein_id gnl|my_center|LOCUS_44900 49598 49341 gene locus_tag LOCUS_44910 49598 49341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057356.1 protein_id gnl|my_center|LOCUS_44910 50478 49762 gene locus_tag LOCUS_44920 50478 49762 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970102.1 protein_id gnl|my_center|LOCUS_44920 50806 50549 gene locus_tag LOCUS_44930 50806 50549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44930 >Feature sequence066 364 200 gene locus_tag LOCUS_44940 364 200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44940 720 908 gene locus_tag LOCUS_44950 720 908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141741.1 protein_id gnl|my_center|LOCUS_44950 2267 981 gene locus_tag LOCUS_44960 2267 981 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057246.1 protein_id gnl|my_center|LOCUS_44960 3647 2421 gene locus_tag LOCUS_44970 gene ispG 3647 2421 CDS product (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056840.1 protein_id gnl|my_center|LOCUS_44970 3889 4098 gene locus_tag LOCUS_44980 3889 4098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44980 4070 4879 gene locus_tag LOCUS_44990 4070 4879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44990 4984 6027 gene locus_tag LOCUS_45000 4984 6027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45000 6795 6058 gene locus_tag LOCUS_45010 6795 6058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45010 7167 8372 gene locus_tag LOCUS_45020 7167 8372 CDS product HhoA/HhoB/HtrA family serine endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056518.1 protein_id gnl|my_center|LOCUS_45020 8793 8446 gene locus_tag LOCUS_45030 8793 8446 CDS product DUF760 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057859.1 protein_id gnl|my_center|LOCUS_45030 9448 8903 gene locus_tag LOCUS_45040 gene scpB 9448 8903 CDS product SMC-Scp complex subunit ScpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056690.1 protein_id gnl|my_center|LOCUS_45040 10269 9619 gene locus_tag LOCUS_45050 gene ispD 10269 9619 CDS product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056453.1 protein_id gnl|my_center|LOCUS_45050 10464 11423 gene locus_tag LOCUS_45060 10464 11423 CDS product glycosyltransferase family 9 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057967.1 protein_id gnl|my_center|LOCUS_45060 11416 12003 gene locus_tag LOCUS_45070 11416 12003 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057968.1 protein_id gnl|my_center|LOCUS_45070 12914 13504 gene locus_tag LOCUS_45080 12914 13504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45080 14117 13644 gene locus_tag LOCUS_45090 14117 13644 CDS product CRR6 family NdhI maturation factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143485.1 protein_id gnl|my_center|LOCUS_45090 15094 15543 gene locus_tag LOCUS_45100 15094 15543 CDS product Fur family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055880.1 protein_id gnl|my_center|LOCUS_45100 18905 15663 gene locus_tag LOCUS_45110 18905 15663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45110 19049 20860 gene locus_tag LOCUS_45120 19049 20860 CDS product DUF3685 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058156.1 protein_id gnl|my_center|LOCUS_45120 21837 20956 gene locus_tag LOCUS_45130 21837 20956 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881131.1 protein_id gnl|my_center|LOCUS_45130 22834 21998 gene locus_tag LOCUS_45140 22834 21998 CDS product HpsJ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056247.1 protein_id gnl|my_center|LOCUS_45140 23803 23162 gene locus_tag LOCUS_45150 23803 23162 CDS product TIGR04282 family arsenosugar biosynthesis glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933082.1 protein_id gnl|my_center|LOCUS_45150 24420 23836 gene locus_tag LOCUS_45160 24420 23836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45160 25156 24347 gene locus_tag LOCUS_45170 25156 24347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45170 26181 25513 gene locus_tag LOCUS_45180 26181 25513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45180 29972 26214 gene locus_tag LOCUS_45190 29972 26214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45190 30539 30303 gene locus_tag LOCUS_45200 gene rpmB 30539 30303 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058293.1 protein_id gnl|my_center|LOCUS_45200 32916 30928 gene locus_tag LOCUS_45210 gene htpG 32916 30928 CDS product molecular chaperone HtpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057033.1 protein_id gnl|my_center|LOCUS_45210 33864 34718 gene locus_tag LOCUS_45220 33864 34718 CDS product sulfonate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091913.1 protein_id gnl|my_center|LOCUS_45220 34952 34728 gene locus_tag LOCUS_45230 34952 34728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45230 34951 36084 gene locus_tag LOCUS_45240 gene ssuD 34951 36084 CDS product FMNH2-dependent alkanesulfonate monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091910.1 protein_id gnl|my_center|LOCUS_45240 36109 36891 gene locus_tag LOCUS_45250 gene ssuC 36109 36891 CDS product aliphatic sulfonate ABC transporter permease SsuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004407339.1 protein_id gnl|my_center|LOCUS_45250 36918 37736 gene locus_tag LOCUS_45260 gene ssuB 36918 37736 CDS product aliphatic sulfonates ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102311.1 protein_id gnl|my_center|LOCUS_45260 37726 38889 gene locus_tag LOCUS_45270 37726 38889 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140985.1 protein_id gnl|my_center|LOCUS_45270 39566 39354 gene locus_tag LOCUS_45280 39566 39354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45280 39951 39616 gene locus_tag LOCUS_45290 39951 39616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45290 40358 39939 gene locus_tag LOCUS_45300 40358 39939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45300 43139 40470 gene locus_tag LOCUS_45310 gene clpB 43139 40470 CDS product ATP-dependent chaperone ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058284.1 protein_id gnl|my_center|LOCUS_45310 45343 43619 gene locus_tag LOCUS_45320 45343 43619 CDS product iron uptake porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057086.1 protein_id gnl|my_center|LOCUS_45320 45924 45490 gene locus_tag LOCUS_45330 gene gloA 45924 45490 CDS product lactoylglutathione lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002216418.1 protein_id gnl|my_center|LOCUS_45330 46692 46063 gene locus_tag LOCUS_45340 46692 46063 CDS product 4Fe-4S single cluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230227.1 protein_id gnl|my_center|LOCUS_45340 47183 48484 gene locus_tag LOCUS_45350 gene eno 47183 48484 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056505.1 protein_id gnl|my_center|LOCUS_45350 48642 48998 gene locus_tag LOCUS_45360 48642 48998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45360 49385 49014 gene locus_tag LOCUS_45370 49385 49014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45370 49825 49517 gene locus_tag LOCUS_45380 49825 49517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45380 50233 49829 gene locus_tag LOCUS_45390 50233 49829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45390 50535 50338 gene locus_tag LOCUS_45400 50535 50338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45400 >Feature sequence067 1138 2532 gene locus_tag LOCUS_45410 1138 2532 CDS product Nramp family divalent metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385749.1 protein_id gnl|my_center|LOCUS_45410 2671 3531 gene locus_tag LOCUS_45420 2671 3531 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810982.1 protein_id gnl|my_center|LOCUS_45420 3574 3726 gene locus_tag LOCUS_45430 3574 3726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45430 3958 4284 gene locus_tag LOCUS_45440 3958 4284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45440 4529 5671 gene locus_tag LOCUS_45450 4529 5671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45450 5681 6805 gene locus_tag LOCUS_45460 5681 6805 CDS product mechanosensitive ion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870654.1 protein_id gnl|my_center|LOCUS_45460 7129 7338 gene locus_tag LOCUS_45470 7129 7338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45470 10033 8717 gene locus_tag LOCUS_45480 gene argJ 10033 8717 CDS product bifunctional glutamate N-acetyltransferase/amino-acid acetyltransferase ArgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057748.1 protein_id gnl|my_center|LOCUS_45480 11119 12300 gene locus_tag LOCUS_45490 11119 12300 CDS product AGE family epimerase/isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766061.1 protein_id gnl|my_center|LOCUS_45490 12350 12949 gene locus_tag LOCUS_45500 12350 12949 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392284.1 protein_id gnl|my_center|LOCUS_45500 12995 13432 gene locus_tag LOCUS_45510 12995 13432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45510 14938 13763 gene locus_tag LOCUS_45520 14938 13763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45520 18724 15128 gene locus_tag LOCUS_45530 18724 15128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45530 22450 18812 gene locus_tag LOCUS_45540 22450 18812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45540 22996 22472 gene locus_tag LOCUS_45550 22996 22472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45550 24531 24130 gene locus_tag LOCUS_45560 24531 24130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45560 24814 25032 gene locus_tag LOCUS_45570 24814 25032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45570 25022 25297 gene locus_tag LOCUS_45580 25022 25297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45580 26000 26320 gene locus_tag LOCUS_45590 26000 26320 CDS product BrnT family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005772654.1 protein_id gnl|my_center|LOCUS_45590 26304 26534 gene locus_tag LOCUS_45600 26304 26534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45600 26906 26571 gene locus_tag LOCUS_45610 26906 26571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45610 27280 26894 gene locus_tag LOCUS_45620 27280 26894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45620 28542 27277 gene locus_tag LOCUS_45630 28542 27277 CDS product RNA-guided endonuclease TnpB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897221.1 protein_id gnl|my_center|LOCUS_45630 28590 28739 gene locus_tag LOCUS_45640 28590 28739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45640 29047 30165 gene locus_tag LOCUS_45650 29047 30165 CDS product aminoglycoside phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813305.1 protein_id gnl|my_center|LOCUS_45650 30162 30725 gene locus_tag LOCUS_45660 30162 30725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45660 31329 30733 gene locus_tag LOCUS_45670 31329 30733 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028173393.1 protein_id gnl|my_center|LOCUS_45670 32280 31342 gene locus_tag LOCUS_45680 32280 31342 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037397659.1 protein_id gnl|my_center|LOCUS_45680 32807 34357 gene locus_tag LOCUS_45690 32807 34357 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000528010.1 protein_id gnl|my_center|LOCUS_45690 34748 35350 gene locus_tag LOCUS_45700 34748 35350 CDS product cytochrome b/b6 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928726.1 protein_id gnl|my_center|LOCUS_45700 35700 35960 gene locus_tag LOCUS_45710 35700 35960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45710 36271 37089 gene locus_tag LOCUS_45720 36271 37089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45720 37751 37227 gene locus_tag LOCUS_45730 37751 37227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45730 37974 38501 gene locus_tag LOCUS_45740 37974 38501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45740 40582 39107 gene locus_tag LOCUS_45750 gene gatB 40582 39107 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058226.1 protein_id gnl|my_center|LOCUS_45750 42352 41084 gene locus_tag LOCUS_45760 42352 41084 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399256.1 protein_id gnl|my_center|LOCUS_45760 42901 42395 gene locus_tag LOCUS_45770 gene hutZ 42901 42395 CDS product heme utilization protein HutZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000372763.1 protein_id gnl|my_center|LOCUS_45770 44351 43515 gene locus_tag LOCUS_45780 44351 43515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_45780 44685 45014 gene locus_tag LOCUS_45790 44685 45014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45790 45193 45795 gene locus_tag LOCUS_45800 45193 45795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45800 46126 45869 gene locus_tag LOCUS_45810 46126 45869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45810 46424 46687 gene locus_tag LOCUS_45820 46424 46687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45820 46917 47234 gene locus_tag LOCUS_45830 46917 47234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45830 48175 47327 gene locus_tag LOCUS_45840 48175 47327 CDS product ISKra4-like element ISGvi7 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929313.1 note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_45840 49335 48958 gene locus_tag LOCUS_45850 49335 48958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45850 49639 49247 gene locus_tag LOCUS_45860 49639 49247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45860 >Feature sequence068 267 2441 gene locus_tag LOCUS_45870 gene topA 267 2441 CDS product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141022.1 protein_id gnl|my_center|LOCUS_45870 2766 2999 gene locus_tag LOCUS_45880 2766 2999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45880 3118 3405 gene locus_tag LOCUS_45890 3118 3405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_45890 3711 7778 gene locus_tag LOCUS_45900 3711 7778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45900 8205 8133 gene locus_tag LOCUS_t00330 8205 8133 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 8959 8234 gene locus_tag LOCUS_45910 8959 8234 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056544.1 protein_id gnl|my_center|LOCUS_45910 9873 8956 gene locus_tag LOCUS_45920 9873 8956 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144354.1 protein_id gnl|my_center|LOCUS_45920 10227 12374 gene locus_tag LOCUS_45930 10227 12374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45930 12495 13052 gene locus_tag LOCUS_45940 12495 13052 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231441.1 protein_id gnl|my_center|LOCUS_45940 13114 13941 gene locus_tag LOCUS_45950 13114 13941 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886674.1 protein_id gnl|my_center|LOCUS_45950 16120 14099 gene locus_tag LOCUS_45960 16120 14099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45960 17065 16829 gene locus_tag LOCUS_45970 17065 16829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45970 17954 19867 gene locus_tag LOCUS_45980 17954 19867 CDS product transketolase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929297.1 protein_id gnl|my_center|LOCUS_45980 21475 20024 gene locus_tag LOCUS_45990 gene amt 21475 20024 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056043.1 protein_id gnl|my_center|LOCUS_45990 22231 21644 gene locus_tag LOCUS_46000 22231 21644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46000 22975 22535 gene locus_tag LOCUS_46010 22975 22535 CDS product archease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942323.1 protein_id gnl|my_center|LOCUS_46010 23924 23040 gene locus_tag LOCUS_46020 23924 23040 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058109.1 protein_id gnl|my_center|LOCUS_46020 24476 23952 gene locus_tag LOCUS_46030 24476 23952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46030 26034 24502 gene locus_tag LOCUS_46040 26034 24502 CDS product RtcB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942327.1 protein_id gnl|my_center|LOCUS_46040 26796 27896 gene locus_tag LOCUS_46050 26796 27896 CDS product alkene reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330337.1 protein_id gnl|my_center|LOCUS_46050 28144 28956 gene locus_tag LOCUS_46060 28144 28956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46060 29751 29029 gene locus_tag LOCUS_46070 29751 29029 CDS product DUF4351 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144335.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_46070 31279 29954 gene locus_tag LOCUS_46080 31279 29954 CDS product dihydrolipoamide acetyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057139.1 protein_id gnl|my_center|LOCUS_46080 31658 32182 gene locus_tag LOCUS_46090 31658 32182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46090 32787 32332 gene locus_tag LOCUS_46100 32787 32332 CDS product YlqD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_166277356.1 protein_id gnl|my_center|LOCUS_46100 34822 32828 gene locus_tag LOCUS_46110 34822 32828 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057141.1 protein_id gnl|my_center|LOCUS_46110 36894 35464 gene locus_tag LOCUS_46120 36894 35464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46120 37530 38639 gene locus_tag LOCUS_46130 37530 38639 CDS product alpha-hydroxy acid oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887674.1 protein_id gnl|my_center|LOCUS_46130 39796 38699 gene locus_tag LOCUS_46140 39796 38699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46140 42261 40078 gene locus_tag LOCUS_46150 gene recQ 42261 40078 CDS product DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929065.1 protein_id gnl|my_center|LOCUS_46150 42387 42785 gene locus_tag LOCUS_46160 42387 42785 CDS product DUF1499 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942956.1 protein_id gnl|my_center|LOCUS_46160 43073 44074 gene locus_tag LOCUS_46170 43073 44074 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525261.1 protein_id gnl|my_center|LOCUS_46170 44210 45784 gene locus_tag LOCUS_46180 44210 45784 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525260.1 protein_id gnl|my_center|LOCUS_46180 45708 46724 gene locus_tag LOCUS_46190 45708 46724 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061668.1 protein_id gnl|my_center|LOCUS_46190 46731 47717 gene locus_tag LOCUS_46200 46731 47717 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024311691.1 protein_id gnl|my_center|LOCUS_46200 >Feature sequence069 168 1091 gene locus_tag LOCUS_46210 168 1091 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096567.1 protein_id gnl|my_center|LOCUS_46210 1241 1642 gene locus_tag LOCUS_46220 1241 1642 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730740.1 protein_id gnl|my_center|LOCUS_46220 1639 2718 gene locus_tag LOCUS_46230 1639 2718 CDS product zinc-dependent alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974446.1 protein_id gnl|my_center|LOCUS_46230 3117 3515 gene locus_tag LOCUS_46240 3117 3515 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210369.1 protein_id gnl|my_center|LOCUS_46240 4646 4179 gene locus_tag LOCUS_46250 4646 4179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46250 4825 6081 gene locus_tag LOCUS_46260 4825 6081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46260 6581 6210 gene locus_tag LOCUS_46270 6581 6210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46270 7047 6685 gene locus_tag LOCUS_46280 7047 6685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46280 7453 7851 gene locus_tag LOCUS_46290 7453 7851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46290 9274 8255 gene locus_tag LOCUS_46300 9274 8255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46300 9350 10096 gene locus_tag LOCUS_46310 9350 10096 CDS product metal ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143302.1 protein_id gnl|my_center|LOCUS_46310 10164 11042 gene locus_tag LOCUS_46320 10164 11042 CDS product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929260.1 protein_id gnl|my_center|LOCUS_46320 12363 11287 gene locus_tag LOCUS_46330 12363 11287 CDS product PD40 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140538.1 protein_id gnl|my_center|LOCUS_46330 13412 12387 gene locus_tag LOCUS_46340 gene hemB 13412 12387 CDS product porphobilinogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056277.1 protein_id gnl|my_center|LOCUS_46340 14340 13588 gene locus_tag LOCUS_46350 14340 13588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_036892606.1 protein_id gnl|my_center|LOCUS_46350 15243 14431 gene locus_tag LOCUS_46360 15243 14431 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125718.1 protein_id gnl|my_center|LOCUS_46360 16031 15240 gene locus_tag LOCUS_46370 16031 15240 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125717.1 protein_id gnl|my_center|LOCUS_46370 17318 16065 gene locus_tag LOCUS_46380 17318 16065 CDS product FAD/NAD(P)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000558755.1 protein_id gnl|my_center|LOCUS_46380 19569 17869 gene locus_tag LOCUS_46390 19569 17869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46390 20262 19912 gene locus_tag LOCUS_46400 20262 19912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46400 21003 20353 gene locus_tag LOCUS_46410 gene folE 21003 20353 CDS product GTP cyclohydrolase I FolE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015079151.1 protein_id gnl|my_center|LOCUS_46410 22191 21112 gene locus_tag LOCUS_46420 22191 21112 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143806.1 protein_id gnl|my_center|LOCUS_46420 22660 22265 gene locus_tag LOCUS_46430 22660 22265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46430 22977 22660 gene locus_tag LOCUS_46440 22977 22660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46440 23944 23525 gene locus_tag LOCUS_46450 23944 23525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46450 24455 24072 gene locus_tag LOCUS_46460 24455 24072 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057330.1 protein_id gnl|my_center|LOCUS_46460 24781 25695 gene locus_tag LOCUS_46470 24781 25695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46470 26447 25785 gene locus_tag LOCUS_46480 26447 25785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46480 27322 26510 gene locus_tag LOCUS_46490 27322 26510 CDS product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124306.1 protein_id gnl|my_center|LOCUS_46490 28233 27319 gene locus_tag LOCUS_46500 gene holA 28233 27319 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140070.1 protein_id gnl|my_center|LOCUS_46500 29310 28519 gene locus_tag LOCUS_46510 29310 28519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46510 31127 29313 gene locus_tag LOCUS_46520 31127 29313 CDS product DNA polymerase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943858.1 protein_id gnl|my_center|LOCUS_46520 32010 33431 gene locus_tag LOCUS_46530 32010 33431 CDS product RNA-guided endonuclease TnpB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041233550.1 protein_id gnl|my_center|LOCUS_46530 34792 33479 gene locus_tag LOCUS_46540 34792 33479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46540 36227 34863 gene locus_tag LOCUS_46550 gene dnaN 36227 34863 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124156.1 protein_id gnl|my_center|LOCUS_46550 37232 36297 gene locus_tag LOCUS_46560 37232 36297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46560 37603 37346 gene locus_tag LOCUS_46570 37603 37346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46570 37823 37605 gene locus_tag LOCUS_46580 37823 37605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46580 38884 37823 gene locus_tag LOCUS_46590 38884 37823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46590 39185 38865 gene locus_tag LOCUS_46600 39185 38865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46600 39871 39182 gene locus_tag LOCUS_46610 39871 39182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46610 40769 39936 gene locus_tag LOCUS_46620 40769 39936 CDS product PRTRC system ThiF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108426.1 protein_id gnl|my_center|LOCUS_46620 41338 40766 gene locus_tag LOCUS_46630 41338 40766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46630 42748 42026 gene locus_tag LOCUS_46640 42748 42026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46640 43212 42790 gene locus_tag LOCUS_46650 43212 42790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46650 43656 43219 gene locus_tag LOCUS_46660 43656 43219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46660 44609 43653 gene locus_tag LOCUS_46670 44609 43653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46670 45223 44720 gene locus_tag LOCUS_46680 45223 44720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46680 >Feature sequence070 1037 312 gene locus_tag LOCUS_46690 1037 312 CDS product GDSL-type esterase/lipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125174.1 protein_id gnl|my_center|LOCUS_46690 2001 1114 gene locus_tag LOCUS_46700 2001 1114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46700 2898 2233 gene locus_tag LOCUS_46710 gene nfi 2898 2233 CDS product deoxyribonuclease V inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258210.1 protein_id gnl|my_center|LOCUS_46710 2878 3069 gene locus_tag LOCUS_46720 2878 3069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46720 3102 3938 gene locus_tag LOCUS_46730 3102 3938 CDS product prohibitin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461868.1 protein_id gnl|my_center|LOCUS_46730 5365 4298 gene locus_tag LOCUS_46740 gene mnmH 5365 4298 CDS product tRNA 2-selenouridine(34) synthase MnmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526161.1 protein_id gnl|my_center|LOCUS_46740 6087 6839 gene locus_tag LOCUS_46750 6087 6839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46750 6944 7909 gene locus_tag LOCUS_46760 6944 7909 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929171.1 protein_id gnl|my_center|LOCUS_46760 9435 8140 gene locus_tag LOCUS_46770 9435 8140 CDS product DNA cytosine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339591.1 protein_id gnl|my_center|LOCUS_46770 10264 11181 gene locus_tag LOCUS_46780 10264 11181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46780 12191 11493 gene locus_tag LOCUS_46790 12191 11493 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140352.1 protein_id gnl|my_center|LOCUS_46790 12555 12388 gene locus_tag LOCUS_46800 12555 12388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46800 12747 14468 gene locus_tag LOCUS_46810 12747 14468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46810 15883 14714 gene locus_tag LOCUS_46820 gene lpxB 15883 14714 CDS product lipid-A-disaccharide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056176.1 protein_id gnl|my_center|LOCUS_46820 16807 15989 gene locus_tag LOCUS_46830 gene lpxA 16807 15989 CDS product acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921189.1 protein_id gnl|my_center|LOCUS_46830 17782 17249 gene locus_tag LOCUS_46840 gene fabZ 17782 17249 CDS product 3-hydroxyacyl-ACP dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125568.1 protein_id gnl|my_center|LOCUS_46840 18794 17898 gene locus_tag LOCUS_46850 gene lpxC 18794 17898 CDS product UDP-3-O-acyl-N-acetylglucosamine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057627.1 protein_id gnl|my_center|LOCUS_46850 21694 18836 gene locus_tag LOCUS_46860 21694 18836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46860 22671 21934 gene locus_tag LOCUS_46870 22671 21934 CDS product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057336.1 protein_id gnl|my_center|LOCUS_46870 23082 23342 gene locus_tag LOCUS_46880 23082 23342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007358131.1 protein_id gnl|my_center|LOCUS_46880 26040 23392 gene locus_tag LOCUS_46890 26040 23392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46890 27257 26124 gene locus_tag LOCUS_46900 27257 26124 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056273.1 protein_id gnl|my_center|LOCUS_46900 27869 27681 gene locus_tag LOCUS_46910 27869 27681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46910 29035 27881 gene locus_tag LOCUS_46920 29035 27881 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056253.1 protein_id gnl|my_center|LOCUS_46920 29404 29751 gene locus_tag LOCUS_46930 29404 29751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057712.1 protein_id gnl|my_center|LOCUS_46930 29847 31358 gene locus_tag LOCUS_46940 29847 31358 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921199.1 protein_id gnl|my_center|LOCUS_46940 31498 31848 gene locus_tag LOCUS_46950 31498 31848 CDS product DUF1257 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024124912.1 protein_id gnl|my_center|LOCUS_46950 32877 32065 gene locus_tag LOCUS_46960 32877 32065 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358274.1 protein_id gnl|my_center|LOCUS_46960 33164 34120 gene locus_tag LOCUS_46970 gene thrB 33164 34120 CDS product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057602.1 protein_id gnl|my_center|LOCUS_46970 34641 36254 gene locus_tag LOCUS_46980 34641 36254 CDS product NAD(P)H-quinone oxidoreductase subunit 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057656.1 protein_id gnl|my_center|LOCUS_46980 37897 36491 gene locus_tag LOCUS_46990 37897 36491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46990 38497 37964 gene locus_tag LOCUS_47000 38497 37964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47000 39208 38954 gene locus_tag LOCUS_47010 39208 38954 CDS product TIGR03643 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964138.1 protein_id gnl|my_center|LOCUS_47010 41190 39349 gene locus_tag LOCUS_47020 gene ftsH3 41190 39349 CDS product ATP-dependent zinc metalloprotease FtsH3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055986.1 protein_id gnl|my_center|LOCUS_47020 42068 41298 gene locus_tag LOCUS_47030 42068 41298 CDS product D-amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057878.1 protein_id gnl|my_center|LOCUS_47030 42853 42155 gene locus_tag LOCUS_47040 42853 42155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058196.1 protein_id gnl|my_center|LOCUS_47040 43488 43120 gene locus_tag LOCUS_47050 43488 43120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47050 44555 44166 gene locus_tag LOCUS_47060 44555 44166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056454.1 protein_id gnl|my_center|LOCUS_47060 >Feature sequence071 2783 1332 gene locus_tag LOCUS_47070 2783 1332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47070 3973 2789 gene locus_tag LOCUS_47080 3973 2789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47080 6121 4454 gene locus_tag LOCUS_47090 6121 4454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47090 6438 7715 gene locus_tag LOCUS_47100 gene ahcY 6438 7715 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058222.1 protein_id gnl|my_center|LOCUS_47100 9412 8540 gene locus_tag LOCUS_47110 gene aroF 9412 8540 CDS product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583420.1 protein_id gnl|my_center|LOCUS_47110 10145 10531 gene locus_tag LOCUS_47120 10145 10531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144333.1 protein_id gnl|my_center|LOCUS_47120 11062 11709 gene locus_tag LOCUS_47130 11062 11709 CDS product pentapeptide repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144233.1 protein_id gnl|my_center|LOCUS_47130 11718 12542 gene locus_tag LOCUS_47140 11718 12542 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902154.1 protein_id gnl|my_center|LOCUS_47140 12597 13520 gene locus_tag LOCUS_47150 12597 13520 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057997.1 protein_id gnl|my_center|LOCUS_47150 14572 13565 gene locus_tag LOCUS_47160 14572 13565 CDS product Rieske 2Fe-2S domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015156906.1 protein_id gnl|my_center|LOCUS_47160 14878 15768 gene locus_tag LOCUS_47170 14878 15768 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929080.1 protein_id gnl|my_center|LOCUS_47170 16242 15808 gene locus_tag LOCUS_47180 16242 15808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47180 16536 16267 gene locus_tag LOCUS_47190 16536 16267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47190 17411 16524 gene locus_tag LOCUS_47200 17411 16524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47200 19120 18194 gene locus_tag LOCUS_47210 19120 18194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47210 20248 19349 gene locus_tag LOCUS_47220 20248 19349 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143319.1 protein_id gnl|my_center|LOCUS_47220 22255 21398 gene locus_tag LOCUS_47230 22255 21398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47230 22958 22308 gene locus_tag LOCUS_47240 22958 22308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47240 24366 23341 gene locus_tag LOCUS_47250 24366 23341 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_135260909.1 protein_id gnl|my_center|LOCUS_47250 25670 25275 gene locus_tag LOCUS_47260 25670 25275 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085221.1 protein_id gnl|my_center|LOCUS_47260 25944 25663 gene locus_tag LOCUS_47270 25944 25663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47270 26314 26511 gene locus_tag LOCUS_47280 26314 26511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47280 27058 26453 gene locus_tag LOCUS_47290 27058 26453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47290 27616 27347 gene locus_tag LOCUS_47300 27616 27347 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388650.1 protein_id gnl|my_center|LOCUS_47300 27988 27764 gene locus_tag LOCUS_47310 27988 27764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47310 28998 28189 gene locus_tag LOCUS_47320 28998 28189 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004536193.1 protein_id gnl|my_center|LOCUS_47320 30077 29010 gene locus_tag LOCUS_47330 30077 29010 CDS product DUF3445 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142342.1 protein_id gnl|my_center|LOCUS_47330 30664 30077 gene locus_tag LOCUS_47340 30664 30077 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228796.1 protein_id gnl|my_center|LOCUS_47340 31753 31328 gene locus_tag LOCUS_47350 31753 31328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47350 33460 31769 gene locus_tag LOCUS_47360 33460 31769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47360 33733 34326 gene locus_tag LOCUS_47370 33733 34326 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258084.1 protein_id gnl|my_center|LOCUS_47370 34424 35170 gene locus_tag LOCUS_47380 34424 35170 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776018.1 protein_id gnl|my_center|LOCUS_47380 35273 36046 gene locus_tag LOCUS_47390 35273 36046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47390 36064 36486 gene locus_tag LOCUS_47400 36064 36486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47400 36559 37203 gene locus_tag LOCUS_47410 36559 37203 CDS product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141890.1 protein_id gnl|my_center|LOCUS_47410 37565 38419 gene locus_tag LOCUS_47420 37565 38419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47420 38842 38567 gene locus_tag LOCUS_47430 38842 38567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47430 39152 38781 gene locus_tag LOCUS_47440 39152 38781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47440 39354 40670 gene locus_tag LOCUS_47450 gene trmFO 39354 40670 CDS product FADH(2)-oxidizing methylenetetrahydrofolate--tRNA-(uracil(54)-C(5))-methyltransferase TrmFO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056303.1 protein_id gnl|my_center|LOCUS_47450 41105 40785 gene locus_tag LOCUS_47460 41105 40785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47460 42401 41718 gene locus_tag LOCUS_47470 42401 41718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47470 42776 42848 gene locus_tag LOCUS_t00340 42776 42848 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 43973 44980 gene locus_tag LOCUS_47480 43973 44980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47480 >Feature sequence072 323 649 gene locus_tag LOCUS_47490 323 649 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125063.1 protein_id gnl|my_center|LOCUS_47490 875 636 gene locus_tag LOCUS_47500 875 636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47500 2837 981 gene locus_tag LOCUS_47510 2837 981 CDS product S8 family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928808.1 protein_id gnl|my_center|LOCUS_47510 2958 3395 gene locus_tag LOCUS_47520 2958 3395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140148.1 protein_id gnl|my_center|LOCUS_47520 3722 3558 gene locus_tag LOCUS_47530 3722 3558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47530 3846 4679 gene locus_tag LOCUS_47540 gene thiD 3846 4679 CDS product bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141510.1 protein_id gnl|my_center|LOCUS_47540 4945 5535 gene locus_tag LOCUS_47550 4945 5535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47550 5884 6222 gene locus_tag LOCUS_47560 5884 6222 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056439.1 protein_id gnl|my_center|LOCUS_47560 6875 6291 gene locus_tag LOCUS_47570 gene rdgB 6875 6291 CDS product RdgB/HAM1 family non-canonical purine NTP pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023172548.1 protein_id gnl|my_center|LOCUS_47570 8494 7055 gene locus_tag LOCUS_47580 8494 7055 CDS product phosphoglucomutase/phosphomannomutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920889.1 protein_id gnl|my_center|LOCUS_47580 9576 8626 gene locus_tag LOCUS_47590 gene pip 9576 8626 CDS product prolyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141435.1 protein_id gnl|my_center|LOCUS_47590 10515 9724 gene locus_tag LOCUS_47600 gene fabG 10515 9724 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000911773.1 protein_id gnl|my_center|LOCUS_47600 10985 12133 gene locus_tag LOCUS_47610 gene lysS 10985 12133 CDS product homocitrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173924.1 protein_id gnl|my_center|LOCUS_47610 13152 12130 gene locus_tag LOCUS_47620 13152 12130 CDS product AbrB family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208458.1 protein_id gnl|my_center|LOCUS_47620 13996 13484 gene locus_tag LOCUS_47630 13996 13484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47630 15153 14002 gene locus_tag LOCUS_47640 15153 14002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47640 16139 15519 gene locus_tag LOCUS_47650 16139 15519 CDS product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889236.1 protein_id gnl|my_center|LOCUS_47650 17456 16383 gene locus_tag LOCUS_47660 17456 16383 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920924.1 protein_id gnl|my_center|LOCUS_47660 17857 18075 gene locus_tag LOCUS_47670 17857 18075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47670 18088 18765 gene locus_tag LOCUS_47680 gene queC 18088 18765 CDS product 7-cyano-7-deazaguanine synthase QueC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057569.1 protein_id gnl|my_center|LOCUS_47680 20155 18800 gene locus_tag LOCUS_47690 20155 18800 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140787.1 protein_id gnl|my_center|LOCUS_47690 21025 20369 gene locus_tag LOCUS_47700 21025 20369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055926.1 protein_id gnl|my_center|LOCUS_47700 21260 21333 gene locus_tag LOCUS_t00350 21260 21333 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 22793 21534 gene locus_tag LOCUS_47710 22793 21534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47710 22969 23592 gene locus_tag LOCUS_47720 gene pyrE 22969 23592 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057665.1 protein_id gnl|my_center|LOCUS_47720 25020 23641 gene locus_tag LOCUS_47730 gene thiC 25020 23641 CDS product phosphomethylpyrimidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921089.1 protein_id gnl|my_center|LOCUS_47730 25410 26036 gene locus_tag LOCUS_47740 25410 26036 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056493.1 protein_id gnl|my_center|LOCUS_47740 26701 28584 gene locus_tag LOCUS_47750 26701 28584 CDS product serine/threonine phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057481.1 protein_id gnl|my_center|LOCUS_47750 28776 29993 gene locus_tag LOCUS_47760 28776 29993 CDS product protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056970.1 protein_id gnl|my_center|LOCUS_47760 30371 30150 gene locus_tag LOCUS_47770 30371 30150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47770 32021 31380 gene locus_tag LOCUS_47780 32021 31380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47780 32797 34170 gene locus_tag LOCUS_47790 gene trxB 32797 34170 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057761.1 protein_id gnl|my_center|LOCUS_47790 34706 34521 gene locus_tag LOCUS_47800 34706 34521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47800 35115 36005 gene locus_tag LOCUS_47810 35115 36005 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920815.1 protein_id gnl|my_center|LOCUS_47810 36135 36338 gene locus_tag LOCUS_47820 36135 36338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47820 36559 37452 gene locus_tag LOCUS_47830 36559 37452 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017291357.1 protein_id gnl|my_center|LOCUS_47830 37696 38544 gene locus_tag LOCUS_47840 37696 38544 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224394.1 protein_id gnl|my_center|LOCUS_47840 40826 40404 gene locus_tag LOCUS_47850 40826 40404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47850 42580 40943 gene locus_tag LOCUS_47860 42580 40943 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056613.1 protein_id gnl|my_center|LOCUS_47860 42762 44567 gene locus_tag LOCUS_47870 42762 44567 CDS product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_199341128.1 protein_id gnl|my_center|LOCUS_47870 >Feature sequence073 506 742 gene locus_tag LOCUS_47880 506 742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47880 882 4373 gene locus_tag LOCUS_47890 882 4373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47890 4741 4370 gene locus_tag LOCUS_47900 4741 4370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47900 7726 5153 gene locus_tag LOCUS_47910 gene mutS 7726 5153 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058073.1 protein_id gnl|my_center|LOCUS_47910 8322 7801 gene locus_tag LOCUS_47920 8322 7801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010567719.1 protein_id gnl|my_center|LOCUS_47920 9539 8331 gene locus_tag LOCUS_47930 9539 8331 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404780.1 protein_id gnl|my_center|LOCUS_47930 10690 9584 gene locus_tag LOCUS_47940 10690 9584 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920638.1 protein_id gnl|my_center|LOCUS_47940 11168 10701 gene locus_tag LOCUS_47950 11168 10701 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057899.1 protein_id gnl|my_center|LOCUS_47950 11801 11385 gene locus_tag LOCUS_47960 11801 11385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47960 12730 12380 gene locus_tag LOCUS_47970 12730 12380 CDS product BON domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023174551.1 protein_id gnl|my_center|LOCUS_47970 14141 13734 gene locus_tag LOCUS_47980 14141 13734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47980 14542 15423 gene locus_tag LOCUS_47990 gene folD 14542 15423 CDS product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920629.1 protein_id gnl|my_center|LOCUS_47990 15682 16608 gene locus_tag LOCUS_48000 15682 16608 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055875.1 protein_id gnl|my_center|LOCUS_48000 16726 17199 gene locus_tag LOCUS_48010 16726 17199 CDS product divergent PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921062.1 protein_id gnl|my_center|LOCUS_48010 17919 17233 gene locus_tag LOCUS_48020 17919 17233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48020 18507 18178 gene locus_tag LOCUS_48030 18507 18178 CDS product DUF2488 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057339.1 protein_id gnl|my_center|LOCUS_48030 19361 18588 gene locus_tag LOCUS_48040 19361 18588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48040 20182 19460 gene locus_tag LOCUS_48050 20182 19460 CDS product pyridoxine 5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056682.1 protein_id gnl|my_center|LOCUS_48050 20630 20280 gene locus_tag LOCUS_48060 20630 20280 CDS product DUF5615 family PIN-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_190909147.1 protein_id gnl|my_center|LOCUS_48060 20935 20627 gene locus_tag LOCUS_48070 20935 20627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48070 21993 21106 gene locus_tag LOCUS_48080 21993 21106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_48080 22369 21896 gene locus_tag LOCUS_48090 22369 21896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_48090 22948 23601 gene locus_tag LOCUS_48100 22948 23601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48100 25379 23859 gene locus_tag LOCUS_48110 25379 23859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48110 26156 27181 gene locus_tag LOCUS_48120 26156 27181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48120 27870 27580 gene locus_tag LOCUS_48130 27870 27580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48130 28754 29002 gene locus_tag LOCUS_48140 28754 29002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_48140 30010 29327 gene locus_tag LOCUS_48150 30010 29327 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143437.1 protein_id gnl|my_center|LOCUS_48150 30666 30187 gene locus_tag LOCUS_48160 30666 30187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48160 31228 31067 gene locus_tag LOCUS_48170 31228 31067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48170 31590 32057 gene locus_tag LOCUS_48180 31590 32057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_48180 32363 32986 gene locus_tag LOCUS_48190 32363 32986 CDS product exopolysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920979.1 protein_id gnl|my_center|LOCUS_48190 34072 32987 gene locus_tag LOCUS_48200 gene cheB 34072 32987 CDS product chemotaxis-specific protein-glutamate methyltransferase CheB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257541.1 protein_id gnl|my_center|LOCUS_48200 36445 34073 gene locus_tag LOCUS_48210 36445 34073 CDS product hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257539.1 protein_id gnl|my_center|LOCUS_48210 37965 36487 gene locus_tag LOCUS_48220 37965 36487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48220 39156 38059 gene locus_tag LOCUS_48230 39156 38059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48230 40469 39291 gene locus_tag LOCUS_48240 40469 39291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48240 41598 42134 gene locus_tag LOCUS_48250 41598 42134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48250 42286 43926 gene locus_tag LOCUS_48260 42286 43926 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056806.1 protein_id gnl|my_center|LOCUS_48260 44825 44283 gene locus_tag LOCUS_48270 44825 44283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48270 >Feature sequence074 5871 196 gene locus_tag LOCUS_48280 5871 196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48280 6495 7460 gene locus_tag LOCUS_48290 6495 7460 CDS product orange carotenoid protein N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140054.1 protein_id gnl|my_center|LOCUS_48290 7939 7550 gene locus_tag LOCUS_48300 7939 7550 CDS product type II toxin-antitoxin system death-on-curing family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932025.1 protein_id gnl|my_center|LOCUS_48300 8117 7926 gene locus_tag LOCUS_48310 8117 7926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48310 8296 8541 gene locus_tag LOCUS_48320 8296 8541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48320 10023 8644 gene locus_tag LOCUS_48330 10023 8644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48330 10668 10174 gene locus_tag LOCUS_48340 10668 10174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48340 11065 10838 gene locus_tag LOCUS_48350 11065 10838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48350 12802 11567 gene locus_tag LOCUS_48360 12802 11567 CDS product LL-diaminopimelate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057937.1 protein_id gnl|my_center|LOCUS_48360 13711 12983 gene locus_tag LOCUS_48370 gene mtnC 13711 12983 CDS product acireductone synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766869.1 protein_id gnl|my_center|LOCUS_48370 14311 13793 gene locus_tag LOCUS_48380 14311 13793 CDS product pentapeptide repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920767.1 protein_id gnl|my_center|LOCUS_48380 15173 14346 gene locus_tag LOCUS_48390 gene ttcA 15173 14346 CDS product tRNA 2-thiocytidine(32) synthetase TtcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000126823.1 protein_id gnl|my_center|LOCUS_48390 15230 15934 gene locus_tag LOCUS_48400 15230 15934 CDS product TIGR04283 family arsenosugar biosynthesis glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256873.1 protein_id gnl|my_center|LOCUS_48400 16266 17810 gene locus_tag LOCUS_48410 16266 17810 CDS product mercuric reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140567.1 protein_id gnl|my_center|LOCUS_48410 19112 17931 gene locus_tag LOCUS_48420 19112 17931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48420 19763 21163 gene locus_tag LOCUS_48430 gene mgtE 19763 21163 CDS product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125941.1 protein_id gnl|my_center|LOCUS_48430 21512 21255 gene locus_tag LOCUS_48440 21512 21255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143542.1 protein_id gnl|my_center|LOCUS_48440 22553 21699 gene locus_tag LOCUS_48450 22553 21699 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140423.1 protein_id gnl|my_center|LOCUS_48450 23371 24993 gene locus_tag LOCUS_48460 23371 24993 CDS product peptide ligase PGM1-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057239.1 protein_id gnl|my_center|LOCUS_48460 25335 27110 gene locus_tag LOCUS_48470 25335 27110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48470 27497 28060 gene locus_tag LOCUS_48480 27497 28060 CDS product pentapeptide repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920705.1 protein_id gnl|my_center|LOCUS_48480 27990 28169 gene locus_tag LOCUS_48490 27990 28169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48490 28311 29495 gene locus_tag LOCUS_48500 28311 29495 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055868.1 protein_id gnl|my_center|LOCUS_48500 30658 29609 gene locus_tag LOCUS_48510 30658 29609 CDS product hemerythrin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142279.1 protein_id gnl|my_center|LOCUS_48510 30917 31657 gene locus_tag LOCUS_48520 30917 31657 CDS product DUF2993 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141748.1 protein_id gnl|my_center|LOCUS_48520 31687 32229 gene locus_tag LOCUS_48530 31687 32229 CDS product DUF2231 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929265.1 protein_id gnl|my_center|LOCUS_48530 32282 32734 gene locus_tag LOCUS_48540 32282 32734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48540 32718 32942 gene locus_tag LOCUS_48550 32718 32942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48550 34099 33476 gene locus_tag LOCUS_48560 34099 33476 CDS product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142691.1 protein_id gnl|my_center|LOCUS_48560 34303 34971 gene locus_tag LOCUS_48570 34303 34971 CDS product SOS response-associated peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142493.1 protein_id gnl|my_center|LOCUS_48570 35148 35603 gene locus_tag LOCUS_48580 35148 35603 CDS product photosystem I assembly protein Ycf3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057365.1 protein_id gnl|my_center|LOCUS_48580 35673 35963 gene locus_tag LOCUS_48590 gene gatC 35673 35963 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057364.1 protein_id gnl|my_center|LOCUS_48590 36084 37064 gene locus_tag LOCUS_48600 36084 37064 CDS product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023173962.1 protein_id gnl|my_center|LOCUS_48600 37568 37356 gene locus_tag LOCUS_48610 37568 37356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48610 37654 38619 gene locus_tag LOCUS_48620 37654 38619 CDS product RNA-guided endonuclease TnpB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403412.1 protein_id gnl|my_center|LOCUS_48620 38913 39092 gene locus_tag LOCUS_48630 38913 39092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48630 39511 40701 gene locus_tag LOCUS_48640 39511 40701 CDS product PstS family phosphate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928412.1 protein_id gnl|my_center|LOCUS_48640 41422 40994 gene locus_tag LOCUS_48650 41422 40994 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000283500.1 protein_id gnl|my_center|LOCUS_48650 41904 41431 gene locus_tag LOCUS_48660 41904 41431 CDS product DUF3531 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056063.1 protein_id gnl|my_center|LOCUS_48660 42970 42017 gene locus_tag LOCUS_48670 42970 42017 CDS product Sll0314/Alr1548 family TPR repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197524124.1 protein_id gnl|my_center|LOCUS_48670 43272 43943 gene locus_tag LOCUS_48680 43272 43943 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920666.1 protein_id gnl|my_center|LOCUS_48680 >Feature sequence075 814 1653 gene locus_tag LOCUS_48690 814 1653 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928642.1 protein_id gnl|my_center|LOCUS_48690 2034 1747 gene locus_tag LOCUS_48700 2034 1747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48700 2718 3284 gene locus_tag LOCUS_48710 2718 3284 CDS product DUF4126 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208071.1 protein_id gnl|my_center|LOCUS_48710 3372 4001 gene locus_tag LOCUS_48720 3372 4001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48720 4514 4077 gene locus_tag LOCUS_48730 4514 4077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48730 4637 5710 gene locus_tag LOCUS_48740 4637 5710 CDS product M28 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000680714.1 protein_id gnl|my_center|LOCUS_48740 6927 5932 gene locus_tag LOCUS_48750 6927 5932 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142186.1 protein_id gnl|my_center|LOCUS_48750 7583 6966 gene locus_tag LOCUS_48760 7583 6966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48760 8862 7888 gene locus_tag LOCUS_48770 8862 7888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48770 10310 9288 gene locus_tag LOCUS_48780 10310 9288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48780 11354 12178 gene locus_tag LOCUS_48790 11354 12178 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942150.1 protein_id gnl|my_center|LOCUS_48790 12194 13495 gene locus_tag LOCUS_48800 12194 13495 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942151.1 protein_id gnl|my_center|LOCUS_48800 13627 15171 gene locus_tag LOCUS_48810 13627 15171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48810 16067 15513 gene locus_tag LOCUS_48820 16067 15513 CDS product general stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001100102.1 protein_id gnl|my_center|LOCUS_48820 16584 20006 gene locus_tag LOCUS_48830 gene treS 16584 20006 CDS product maltose alpha-D-glucosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257046.1 protein_id gnl|my_center|LOCUS_48830 20516 21379 gene locus_tag LOCUS_48840 20516 21379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48840 22502 21834 gene locus_tag LOCUS_48850 22502 21834 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256556.1 protein_id gnl|my_center|LOCUS_48850 23371 22523 gene locus_tag LOCUS_48860 23371 22523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48860 24027 24419 gene locus_tag LOCUS_48870 24027 24419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48870 24603 26048 gene locus_tag LOCUS_48880 24603 26048 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140777.1 protein_id gnl|my_center|LOCUS_48880 26213 27472 gene locus_tag LOCUS_48890 26213 27472 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197530116.1 protein_id gnl|my_center|LOCUS_48890 27474 28160 gene locus_tag LOCUS_48900 27474 28160 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141998.1 protein_id gnl|my_center|LOCUS_48900 31207 28301 gene locus_tag LOCUS_48910 31207 28301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48910 34467 31441 gene locus_tag LOCUS_48920 34467 31441 CDS product SMC family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058009.1 protein_id gnl|my_center|LOCUS_48920 35175 34978 gene locus_tag LOCUS_48930 35175 34978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48930 35330 37840 gene locus_tag LOCUS_48940 35330 37840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48940 38508 39200 gene locus_tag LOCUS_48950 38508 39200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48950 40167 41375 gene locus_tag LOCUS_48960 40167 41375 CDS product S-layer homology domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057279.1 protein_id gnl|my_center|LOCUS_48960 42844 41393 gene locus_tag LOCUS_48970 42844 41393 CDS product GAF domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056050.1 protein_id gnl|my_center|LOCUS_48970 43121 43438 gene locus_tag LOCUS_48980 43121 43438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48980 >Feature sequence076 457 260 gene locus_tag LOCUS_48990 457 260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48990 2500 1304 gene locus_tag LOCUS_49000 gene dxr 2500 1304 CDS product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921140.1 protein_id gnl|my_center|LOCUS_49000 3026 4309 gene locus_tag LOCUS_49010 3026 4309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49010 4460 5668 gene locus_tag LOCUS_49020 4460 5668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49020 5715 7136 gene locus_tag LOCUS_49030 5715 7136 CDS product DUF2079 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124536.1 protein_id gnl|my_center|LOCUS_49030 8030 8950 gene locus_tag LOCUS_49040 8030 8950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49040 14173 9455 gene locus_tag LOCUS_49050 14173 9455 CDS product glutamate synthase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057208.1 protein_id gnl|my_center|LOCUS_49050 15042 17171 gene locus_tag LOCUS_49060 15042 17171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49060 17625 18056 gene locus_tag LOCUS_49070 17625 18056 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023172237.1 protein_id gnl|my_center|LOCUS_49070 18351 18680 gene locus_tag LOCUS_49080 18351 18680 CDS product iron-sulfur cluster assembly accessory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142103.1 protein_id gnl|my_center|LOCUS_49080 18772 19149 gene locus_tag LOCUS_49090 gene rpsL 18772 19149 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057584.1 protein_id gnl|my_center|LOCUS_49090 19747 20217 gene locus_tag LOCUS_49100 gene rpsG 19747 20217 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057585.1 protein_id gnl|my_center|LOCUS_49100 20356 22434 gene locus_tag LOCUS_49110 gene fusA 20356 22434 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057586.1 protein_id gnl|my_center|LOCUS_49110 22457 23686 gene locus_tag LOCUS_49120 gene tuf 22457 23686 CDS product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057587.1 protein_id gnl|my_center|LOCUS_49120 23815 24180 gene locus_tag LOCUS_49130 gene rpsJ 23815 24180 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006042265.1 protein_id gnl|my_center|LOCUS_49130 24569 25057 gene locus_tag LOCUS_49140 24569 25057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49140 25998 25108 gene locus_tag LOCUS_49150 gene pheA 25998 25108 CDS product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_073594784.1 protein_id gnl|my_center|LOCUS_49150 26162 26749 gene locus_tag LOCUS_49160 26162 26749 CDS product DUF1997 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057548.1 protein_id gnl|my_center|LOCUS_49160 28007 27273 gene locus_tag LOCUS_49170 28007 27273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49170 30131 28041 gene locus_tag LOCUS_49180 30131 28041 CDS product Rne/Rng family ribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056445.1 protein_id gnl|my_center|LOCUS_49180 33575 30843 gene locus_tag LOCUS_49190 33575 30843 CDS product TIGR03960 family B12-binding radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058092.1 protein_id gnl|my_center|LOCUS_49190 34039 33674 gene locus_tag LOCUS_49200 34039 33674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49200 34438 34710 gene locus_tag LOCUS_49210 34438 34710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49210 35564 35214 gene locus_tag LOCUS_49220 35564 35214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49220 35811 36092 gene locus_tag LOCUS_49230 gene clpS 35811 36092 CDS product ATP-dependent Clp protease adapter ClpS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024123996.1 protein_id gnl|my_center|LOCUS_49230 36202 36966 gene locus_tag LOCUS_49240 36202 36966 CDS product type II CAAX endopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056065.1 protein_id gnl|my_center|LOCUS_49240 37678 37019 gene locus_tag LOCUS_49250 37678 37019 CDS product pentapeptide repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143183.1 protein_id gnl|my_center|LOCUS_49250 39078 37678 gene locus_tag LOCUS_49260 39078 37678 CDS product DICT sensory domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929211.1 protein_id gnl|my_center|LOCUS_49260 40857 39265 gene locus_tag LOCUS_49270 40857 39265 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057307.1 protein_id gnl|my_center|LOCUS_49270 41396 41791 gene locus_tag LOCUS_49280 41396 41791 CDS product DUF1830 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057308.1 protein_id gnl|my_center|LOCUS_49280 43159 42629 gene locus_tag LOCUS_49290 43159 42629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_49290 >Feature sequence077 1 273 gene locus_tag LOCUS_49300 1 273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49300 2592 346 gene locus_tag LOCUS_49310 2592 346 CDS product ATP-dependent RecD-like DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140631.1 protein_id gnl|my_center|LOCUS_49310 3287 3559 gene locus_tag LOCUS_49320 3287 3559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49320 3952 4245 gene locus_tag LOCUS_49330 3952 4245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49330 5696 4929 gene locus_tag LOCUS_49340 5696 4929 CDS product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894390.1 protein_id gnl|my_center|LOCUS_49340 11117 6216 gene locus_tag LOCUS_49350 11117 6216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49350 11310 11588 gene locus_tag LOCUS_49360 11310 11588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49360 12073 11702 gene locus_tag LOCUS_49370 12073 11702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49370 12292 12489 gene locus_tag LOCUS_49380 12292 12489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49380 12940 12647 gene locus_tag LOCUS_49390 12940 12647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49390 13737 16235 gene locus_tag LOCUS_49400 13737 16235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49400 16637 17167 gene locus_tag LOCUS_49410 16637 17167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49410 17607 17446 gene locus_tag LOCUS_49420 17607 17446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49420 18543 18337 gene locus_tag LOCUS_49430 18543 18337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49430 18683 18880 gene locus_tag LOCUS_49440 18683 18880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49440 18956 19666 gene locus_tag LOCUS_49450 18956 19666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49450 19774 20043 gene locus_tag LOCUS_49460 19774 20043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49460 21009 20683 gene locus_tag LOCUS_49470 21009 20683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49470 21162 22724 gene locus_tag LOCUS_49480 21162 22724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49480 22758 24479 gene locus_tag LOCUS_49490 22758 24479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49490 24667 25194 gene locus_tag LOCUS_49500 24667 25194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49500 25293 25775 gene locus_tag LOCUS_49510 25293 25775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49510 26664 25828 gene locus_tag LOCUS_49520 26664 25828 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013087234.1 protein_id gnl|my_center|LOCUS_49520 28461 27094 gene locus_tag LOCUS_49530 28461 27094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49530 30471 33872 gene locus_tag LOCUS_49540 30471 33872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49540 34217 34026 gene locus_tag LOCUS_49550 34217 34026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49550 34337 34531 gene locus_tag LOCUS_49560 34337 34531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49560 34509 34940 gene locus_tag LOCUS_49570 34509 34940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49570 35050 35475 gene locus_tag LOCUS_49580 35050 35475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49580 35472 35801 gene locus_tag LOCUS_49590 35472 35801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49590 36219 37274 gene locus_tag LOCUS_49600 36219 37274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49600 37287 39707 gene locus_tag LOCUS_49610 37287 39707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49610 39844 40188 gene locus_tag LOCUS_49620 39844 40188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49620 41110 40541 gene locus_tag LOCUS_49630 41110 40541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49630 41380 42408 gene locus_tag LOCUS_49640 41380 42408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49640 >Feature sequence078 601 83 gene locus_tag LOCUS_49650 601 83 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49650 3721 944 gene locus_tag LOCUS_49660 3721 944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49660 6091 7281 gene locus_tag LOCUS_49670 6091 7281 CDS product endo-1,4-beta-xylanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085029.1 protein_id gnl|my_center|LOCUS_49670 7357 7698 gene locus_tag LOCUS_49680 7357 7698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49680 7783 8568 gene locus_tag LOCUS_49690 7783 8568 CDS product WecB/TagA/CpsF family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257381.1 protein_id gnl|my_center|LOCUS_49690 8621 10183 gene locus_tag LOCUS_49700 8621 10183 CDS product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056473.1 protein_id gnl|my_center|LOCUS_49700 11160 13388 gene locus_tag LOCUS_49710 11160 13388 CDS product polysaccharide biosynthesis tyrosine autokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144294.1 protein_id gnl|my_center|LOCUS_49710 13367 13936 gene locus_tag LOCUS_49720 13367 13936 CDS product serine acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002723512.1 protein_id gnl|my_center|LOCUS_49720 13966 15198 gene locus_tag LOCUS_49730 13966 15198 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061719.1 protein_id gnl|my_center|LOCUS_49730 15235 16503 gene locus_tag LOCUS_49740 15235 16503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49740 16734 16528 gene locus_tag LOCUS_49750 16734 16528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49750 17228 17836 gene locus_tag LOCUS_49760 17228 17836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49760 17876 18880 gene locus_tag LOCUS_49770 17876 18880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49770 19012 20064 gene locus_tag LOCUS_49780 19012 20064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49780 20061 21098 gene locus_tag LOCUS_49790 20061 21098 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946498.1 protein_id gnl|my_center|LOCUS_49790 21104 22429 gene locus_tag LOCUS_49800 21104 22429 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338703.1 protein_id gnl|my_center|LOCUS_49800 22426 23484 gene locus_tag LOCUS_49810 22426 23484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49810 23710 25044 gene locus_tag LOCUS_49820 23710 25044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49820 25769 26212 gene locus_tag LOCUS_49830 25769 26212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49830 26215 27327 gene locus_tag LOCUS_49840 26215 27327 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875973.1 protein_id gnl|my_center|LOCUS_49840 27324 28091 gene locus_tag LOCUS_49850 27324 28091 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000780983.1 protein_id gnl|my_center|LOCUS_49850 29588 28296 gene locus_tag LOCUS_49860 29588 28296 CDS product endo-1,4-beta-xylanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920949.1 protein_id gnl|my_center|LOCUS_49860 30371 31462 gene locus_tag LOCUS_49870 30371 31462 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256779.1 protein_id gnl|my_center|LOCUS_49870 31475 32155 gene locus_tag LOCUS_49880 31475 32155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49880 32487 34598 gene locus_tag LOCUS_49890 32487 34598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49890 35403 34774 gene locus_tag LOCUS_49900 35403 34774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49900 35947 35396 gene locus_tag LOCUS_49910 35947 35396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49910 36062 36259 gene locus_tag LOCUS_49920 36062 36259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49920 36492 36271 gene locus_tag LOCUS_49930 36492 36271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49930 36515 38077 gene locus_tag LOCUS_49940 36515 38077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49940 39559 38087 gene locus_tag LOCUS_49950 39559 38087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49950 39735 39998 gene locus_tag LOCUS_49960 39735 39998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49960 40063 42651 gene locus_tag LOCUS_49970 40063 42651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49970 >Feature sequence079 529 239 gene locus_tag LOCUS_49980 529 239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49980 1923 529 gene locus_tag LOCUS_49990 1923 529 CDS product RecQ family ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_085144103.1 note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_49990 2434 2886 gene locus_tag LOCUS_50000 2434 2886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50000 2916 4742 gene locus_tag LOCUS_50010 2916 4742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50010 6055 4817 gene locus_tag LOCUS_50020 6055 4817 CDS product sugar diacid recognition domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262599.1 protein_id gnl|my_center|LOCUS_50020 6304 7086 gene locus_tag LOCUS_50030 6304 7086 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976119.1 protein_id gnl|my_center|LOCUS_50030 7470 9095 gene locus_tag LOCUS_50040 7470 9095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50040 9755 9102 gene locus_tag LOCUS_50050 9755 9102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50050 12076 9932 gene locus_tag LOCUS_50060 12076 9932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50060 16211 12657 gene locus_tag LOCUS_50070 16211 12657 CDS product NB-ARC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144339.1 protein_id gnl|my_center|LOCUS_50070 17474 23302 gene locus_tag LOCUS_50080 17474 23302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50080 23514 23729 gene locus_tag LOCUS_50090 23514 23729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50090 25624 24092 gene locus_tag LOCUS_50100 25624 24092 CDS product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056442.1 protein_id gnl|my_center|LOCUS_50100 25691 26041 gene locus_tag LOCUS_50110 25691 26041 CDS product histidine triad nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056841.1 protein_id gnl|my_center|LOCUS_50110 26270 27352 gene locus_tag LOCUS_50120 gene psbA 26270 27352 CDS product photosystem II q(b) protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057317.1 protein_id gnl|my_center|LOCUS_50120 28390 27494 gene locus_tag LOCUS_50130 28390 27494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50130 28742 29251 gene locus_tag LOCUS_50140 gene recR 28742 29251 CDS product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058038.1 protein_id gnl|my_center|LOCUS_50140 30352 29432 gene locus_tag LOCUS_50150 30352 29432 CDS product ADP-ribosylglycohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038051.1 protein_id gnl|my_center|LOCUS_50150 30496 32019 gene locus_tag LOCUS_50160 30496 32019 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000528010.1 protein_id gnl|my_center|LOCUS_50160 32556 33056 gene locus_tag LOCUS_50170 32556 33056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50170 34180 33785 gene locus_tag LOCUS_50180 34180 33785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50180 34725 34946 gene locus_tag LOCUS_50190 34725 34946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50190 35159 35584 gene locus_tag LOCUS_50200 35159 35584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50200 35776 36834 gene locus_tag LOCUS_50210 35776 36834 CDS product LD-carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963616.1 protein_id gnl|my_center|LOCUS_50210 38032 37481 gene locus_tag LOCUS_50220 38032 37481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50220 38639 38181 gene locus_tag LOCUS_50230 38639 38181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50230 39140 38880 gene locus_tag LOCUS_50240 39140 38880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50240 40025 40732 gene locus_tag LOCUS_50250 40025 40732 CDS product serine esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013614293.1 protein_id gnl|my_center|LOCUS_50250 41205 41459 gene locus_tag LOCUS_50260 41205 41459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50260 41586 41840 gene locus_tag LOCUS_50270 41586 41840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50270 41967 42221 gene locus_tag LOCUS_50280 41967 42221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50280 >Feature sequence080 196 444 gene locus_tag LOCUS_50290 196 444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50290 1407 781 gene locus_tag LOCUS_50300 1407 781 CDS product heme-copper oxidase subunit III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057844.1 protein_id gnl|my_center|LOCUS_50300 3236 1494 gene locus_tag LOCUS_50310 gene ctaD 3236 1494 CDS product cytochrome c oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057845.1 protein_id gnl|my_center|LOCUS_50310 4438 3356 gene locus_tag LOCUS_50320 4438 3356 CDS product cytochrome c oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057846.1 protein_id gnl|my_center|LOCUS_50320 5092 6078 gene locus_tag LOCUS_50330 5092 6078 CDS product heme A synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057731.1 protein_id gnl|my_center|LOCUS_50330 6176 7132 gene locus_tag LOCUS_50340 6176 7132 CDS product heme o synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920945.1 protein_id gnl|my_center|LOCUS_50340 7737 7495 gene locus_tag LOCUS_50350 7737 7495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50350 7943 7734 gene locus_tag LOCUS_50360 7943 7734 CDS product 2-oxoisovalerate dehydrogenase E1 subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545302.1 protein_id gnl|my_center|LOCUS_50360 8846 9718 gene locus_tag LOCUS_50370 8846 9718 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144144.1 protein_id gnl|my_center|LOCUS_50370 10042 11916 gene locus_tag LOCUS_50380 10042 11916 CDS product ABC transporter ATP-binding protein/permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920652.1 protein_id gnl|my_center|LOCUS_50380 12233 12949 gene locus_tag LOCUS_50390 12233 12949 CDS product [2,4-di-O-methyl-alpha-L-fucopyranosyl-(1->3)-alpha-L-rhamnopyranosyl-(1->3)-2-O-methyl-alpha-L-rhamnopyranosyl] dimycocerosyl phenol-phthiocerol 3'''-O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414905.1 protein_id gnl|my_center|LOCUS_50390 13992 13057 gene locus_tag LOCUS_50400 13992 13057 CDS product glycosyltransferase family A protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257977.1 protein_id gnl|my_center|LOCUS_50400 15699 14008 gene locus_tag LOCUS_50410 15699 14008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50410 15770 17461 gene locus_tag LOCUS_50420 15770 17461 CDS product ABC transporter ATP-binding protein/permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920652.1 protein_id gnl|my_center|LOCUS_50420 18264 17530 gene locus_tag LOCUS_50430 18264 17530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50430 18718 18341 gene locus_tag LOCUS_50440 18718 18341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50440 19303 19010 gene locus_tag LOCUS_50450 19303 19010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50450 20392 19463 gene locus_tag LOCUS_50460 20392 19463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50460 21223 20435 gene locus_tag LOCUS_50470 21223 20435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50470 24491 21246 gene locus_tag LOCUS_50480 24491 21246 CDS product type 2 lanthipeptide synthetase LanM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226577.1 protein_id gnl|my_center|LOCUS_50480 24972 24697 gene locus_tag LOCUS_50490 24972 24697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50490 27441 25714 gene locus_tag LOCUS_50500 27441 25714 CDS product potassium channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144393.1 protein_id gnl|my_center|LOCUS_50500 28211 27573 gene locus_tag LOCUS_50510 28211 27573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50510 29529 28348 gene locus_tag LOCUS_50520 29529 28348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50520 32147 29589 gene locus_tag LOCUS_50530 32147 29589 CDS product sigma 54-interacting transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140924.1 protein_id gnl|my_center|LOCUS_50530 32611 33414 gene locus_tag LOCUS_50540 32611 33414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50540 34302 33859 gene locus_tag LOCUS_50550 34302 33859 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000281042.1 protein_id gnl|my_center|LOCUS_50550 34544 34305 gene locus_tag LOCUS_50560 34544 34305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50560 34854 36965 gene locus_tag LOCUS_50570 34854 36965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50570 37522 37220 gene locus_tag LOCUS_50580 37522 37220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50580 39140 37680 gene locus_tag LOCUS_50590 39140 37680 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029141.1 protein_id gnl|my_center|LOCUS_50590 39448 40050 gene locus_tag LOCUS_50600 39448 40050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50600 40047 41210 gene locus_tag LOCUS_50610 40047 41210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50610 >Feature sequence081 126 581 gene locus_tag LOCUS_50620 126 581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50620 614 1354 gene locus_tag LOCUS_50630 614 1354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50630 1395 2051 gene locus_tag LOCUS_50640 1395 2051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50640 2805 2056 gene locus_tag LOCUS_50650 2805 2056 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144387.1 protein_id gnl|my_center|LOCUS_50650 3550 3386 gene locus_tag LOCUS_50660 3550 3386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50660 3614 4831 gene locus_tag LOCUS_50670 gene tnpB 3614 4831 CDS product IS200/IS605 family element RNA-guided endonuclease TnpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_054297574.1 protein_id gnl|my_center|LOCUS_50670 5167 5856 gene locus_tag LOCUS_50680 gene parA 5167 5856 CDS product ParA family partition ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194446.1 protein_id gnl|my_center|LOCUS_50680 5928 6908 gene locus_tag LOCUS_50690 5928 6908 CDS product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143340.1 protein_id gnl|my_center|LOCUS_50690 7134 8108 gene locus_tag LOCUS_50700 7134 8108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50700 8258 8560 gene locus_tag LOCUS_50710 8258 8560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50710 9042 10034 gene locus_tag LOCUS_50720 9042 10034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50720 11053 10328 gene locus_tag LOCUS_50730 11053 10328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50730 19653 11059 gene locus_tag LOCUS_50740 19653 11059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50740 21680 19932 gene locus_tag LOCUS_50750 21680 19932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50750 22584 22057 gene locus_tag LOCUS_50760 22584 22057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_50760 22921 22616 gene locus_tag LOCUS_50770 22921 22616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_50770 23074 23955 gene locus_tag LOCUS_50780 23074 23955 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226695.1 protein_id gnl|my_center|LOCUS_50780 24759 24364 gene locus_tag LOCUS_50790 24759 24364 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728621.1 protein_id gnl|my_center|LOCUS_50790 24860 25852 gene locus_tag LOCUS_50800 24860 25852 CDS product quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000644043.1 protein_id gnl|my_center|LOCUS_50800 26223 26603 gene locus_tag LOCUS_50810 26223 26603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50810 27121 26753 gene locus_tag LOCUS_50820 27121 26753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50820 28087 28533 gene locus_tag LOCUS_50830 28087 28533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50830 28796 35857 gene locus_tag LOCUS_50840 28796 35857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50840 35854 36483 gene locus_tag LOCUS_50850 35854 36483 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141682.1 protein_id gnl|my_center|LOCUS_50850 36710 37270 gene locus_tag LOCUS_50860 36710 37270 CDS product DsbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_091833874.1 protein_id gnl|my_center|LOCUS_50860 37512 38240 gene locus_tag LOCUS_50870 37512 38240 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974330.1 protein_id gnl|my_center|LOCUS_50870 38323 39291 gene locus_tag LOCUS_50880 38323 39291 CDS product zinc-dependent alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119496.1 protein_id gnl|my_center|LOCUS_50880 39429 39737 gene locus_tag LOCUS_50890 39429 39737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50890 40278 40496 gene locus_tag LOCUS_50900 40278 40496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50900 >Feature sequence082 456 1820 gene locus_tag LOCUS_50910 456 1820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50910 2735 1911 gene locus_tag LOCUS_50920 2735 1911 CDS product D-alanyl-D-alanine carboxypeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056776.1 protein_id gnl|my_center|LOCUS_50920 2837 3754 gene locus_tag LOCUS_50930 2837 3754 CDS product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057257.1 protein_id gnl|my_center|LOCUS_50930 4559 4041 gene locus_tag LOCUS_50940 4559 4041 CDS product phosphoribosyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057399.1 protein_id gnl|my_center|LOCUS_50940 4628 6067 gene locus_tag LOCUS_50950 4628 6067 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057361.1 protein_id gnl|my_center|LOCUS_50950 6760 6191 gene locus_tag LOCUS_50960 6760 6191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50960 7101 7781 gene locus_tag LOCUS_50970 7101 7781 CDS product HEAT repeat domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056679.1 protein_id gnl|my_center|LOCUS_50970 7923 8489 gene locus_tag LOCUS_50980 7923 8489 CDS product phycobiliprotein lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920918.1 protein_id gnl|my_center|LOCUS_50980 9680 12661 gene locus_tag LOCUS_50990 9680 12661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50990 12859 14412 gene locus_tag LOCUS_51000 12859 14412 CDS product HlyD family type I secretion periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966765.1 protein_id gnl|my_center|LOCUS_51000 15910 14597 gene locus_tag LOCUS_51010 15910 14597 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056715.1 protein_id gnl|my_center|LOCUS_51010 16284 16988 gene locus_tag LOCUS_51020 16284 16988 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056716.1 protein_id gnl|my_center|LOCUS_51020 18303 17062 gene locus_tag LOCUS_51030 18303 17062 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057446.1 protein_id gnl|my_center|LOCUS_51030 18672 19319 gene locus_tag LOCUS_51040 18672 19319 CDS product cytochrome b6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056639.1 protein_id gnl|my_center|LOCUS_51040 19518 20000 gene locus_tag LOCUS_51050 gene petD 19518 20000 CDS product cytochrome b6-f complex subunit IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056640.1 protein_id gnl|my_center|LOCUS_51050 20206 20643 gene locus_tag LOCUS_51060 20206 20643 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056399.1 protein_id gnl|my_center|LOCUS_51060 21043 22227 gene locus_tag LOCUS_51070 21043 22227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51070 22315 22686 gene locus_tag LOCUS_51080 22315 22686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057511.1 protein_id gnl|my_center|LOCUS_51080 23276 22899 gene locus_tag LOCUS_51090 23276 22899 CDS product DUF1823 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057769.1 protein_id gnl|my_center|LOCUS_51090 23357 23659 gene locus_tag LOCUS_51100 23357 23659 CDS product acylphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143981.1 protein_id gnl|my_center|LOCUS_51100 24494 23673 gene locus_tag LOCUS_51110 24494 23673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51110 25056 24541 gene locus_tag LOCUS_51120 25056 24541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_51120 25577 25077 gene locus_tag LOCUS_51130 25577 25077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_51130 26886 25585 gene locus_tag LOCUS_51140 26886 25585 CDS product proton extrusion protein PcxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226578028.1 protein_id gnl|my_center|LOCUS_51140 27394 28188 gene locus_tag LOCUS_51150 27394 28188 CDS product N-acetylglucosamine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963507.1 protein_id gnl|my_center|LOCUS_51150 28383 30278 gene locus_tag LOCUS_51160 28383 30278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51160 30275 31468 gene locus_tag LOCUS_51170 30275 31468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51170 31833 32846 gene locus_tag LOCUS_51180 31833 32846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_072478723.1 protein_id gnl|my_center|LOCUS_51180 34191 32902 gene locus_tag LOCUS_51190 34191 32902 CDS product FGGY-family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920846.1 protein_id gnl|my_center|LOCUS_51190 34714 35112 gene locus_tag LOCUS_51200 34714 35112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51200 36038 35313 gene locus_tag LOCUS_51210 36038 35313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51210 36485 36949 gene locus_tag LOCUS_51220 36485 36949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920763.1 protein_id gnl|my_center|LOCUS_51220 37043 37621 gene locus_tag LOCUS_51230 37043 37621 CDS product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056062.1 protein_id gnl|my_center|LOCUS_51230 38256 37765 gene locus_tag LOCUS_51240 38256 37765 CDS product YajQ family cyclic di-GMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056636.1 protein_id gnl|my_center|LOCUS_51240 38776 38381 gene locus_tag LOCUS_51250 38776 38381 CDS product MAPEG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056937.1 protein_id gnl|my_center|LOCUS_51250 39311 38808 gene locus_tag LOCUS_51260 39311 38808 CDS product DNA-processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920769.1 protein_id gnl|my_center|LOCUS_51260 39946 39416 gene locus_tag LOCUS_51270 39946 39416 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141429.1 protein_id gnl|my_center|LOCUS_51270 >Feature sequence083 474 824 gene locus_tag LOCUS_51280 474 824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51280 802 1167 gene locus_tag LOCUS_51290 802 1167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51290 3087 1237 gene locus_tag LOCUS_51300 3087 1237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51300 5555 5857 gene locus_tag LOCUS_51310 5555 5857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51310 6000 6344 gene locus_tag LOCUS_51320 6000 6344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51320 6447 7187 gene locus_tag LOCUS_51330 6447 7187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_51330 8314 9006 gene locus_tag LOCUS_51340 8314 9006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51340 9556 12528 gene locus_tag LOCUS_51350 gene pruA 9556 12528 CDS product L-glutamate gamma-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056271.1 protein_id gnl|my_center|LOCUS_51350 12655 13092 gene locus_tag LOCUS_51360 12655 13092 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082236.1 protein_id gnl|my_center|LOCUS_51360 14367 16292 gene locus_tag LOCUS_51370 14367 16292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51370 17582 16488 gene locus_tag LOCUS_51380 17582 16488 CDS product HlyD family secretion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931799.1 protein_id gnl|my_center|LOCUS_51380 18241 19212 gene locus_tag LOCUS_51390 18241 19212 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193905664.1 protein_id gnl|my_center|LOCUS_51390 19308 20387 gene locus_tag LOCUS_51400 19308 20387 CDS product PD40 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140538.1 protein_id gnl|my_center|LOCUS_51400 22187 20661 gene locus_tag LOCUS_51410 22187 20661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51410 24208 22700 gene locus_tag LOCUS_51420 24208 22700 CDS product UbiD family decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058059.1 protein_id gnl|my_center|LOCUS_51420 24474 25097 gene locus_tag LOCUS_51430 24474 25097 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920671.1 protein_id gnl|my_center|LOCUS_51430 26414 25350 gene locus_tag LOCUS_51440 26414 25350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51440 26792 27835 gene locus_tag LOCUS_51450 gene pstS 26792 27835 CDS product phosphate ABC transporter substrate-binding protein PstS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140448.1 protein_id gnl|my_center|LOCUS_51450 27928 28920 gene locus_tag LOCUS_51460 gene pstC 27928 28920 CDS product phosphate ABC transporter permease subunit PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140449.1 protein_id gnl|my_center|LOCUS_51460 29159 30037 gene locus_tag LOCUS_51470 gene pstA 29159 30037 CDS product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140450.1 protein_id gnl|my_center|LOCUS_51470 30087 30866 gene locus_tag LOCUS_51480 gene pstB 30087 30866 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140451.1 protein_id gnl|my_center|LOCUS_51480 31753 34575 gene locus_tag LOCUS_51490 31753 34575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51490 35196 38804 gene locus_tag LOCUS_51500 35196 38804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51500 >Feature sequence084 1619 1759 gene locus_tag LOCUS_51510 1619 1759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51510 3192 3791 gene locus_tag LOCUS_51520 3192 3791 CDS product superoxide dismutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042440414.1 protein_id gnl|my_center|LOCUS_51520 3941 4147 gene locus_tag LOCUS_51530 3941 4147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140926.1 protein_id gnl|my_center|LOCUS_51530 4251 5279 gene locus_tag LOCUS_51540 gene purM 4251 5279 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057648.1 protein_id gnl|my_center|LOCUS_51540 5619 6305 gene locus_tag LOCUS_51550 5619 6305 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920655.1 protein_id gnl|my_center|LOCUS_51550 6699 6424 gene locus_tag LOCUS_51560 6699 6424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51560 8214 6943 gene locus_tag LOCUS_51570 8214 6943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51570 8497 8895 gene locus_tag LOCUS_51580 8497 8895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51580 8939 9973 gene locus_tag LOCUS_51590 8939 9973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51590 10940 10038 gene locus_tag LOCUS_51600 10940 10038 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000423226.1 protein_id gnl|my_center|LOCUS_51600 11131 12600 gene locus_tag LOCUS_51610 11131 12600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51610 13552 12683 gene locus_tag LOCUS_51620 13552 12683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51620 13722 14135 gene locus_tag LOCUS_51630 13722 14135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_51630 14098 14937 gene locus_tag LOCUS_51640 14098 14937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_51640 16854 15253 gene locus_tag LOCUS_51650 16854 15253 CDS product bifunctional pantoate--beta-alanine ligase/(d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058282.1 protein_id gnl|my_center|LOCUS_51650 18138 17005 gene locus_tag LOCUS_51660 18138 17005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51660 19268 19456 gene locus_tag LOCUS_51670 19268 19456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51670 23047 19868 gene locus_tag LOCUS_51680 23047 19868 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974031.1 protein_id gnl|my_center|LOCUS_51680 24549 23200 gene locus_tag LOCUS_51690 24549 23200 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057580.1 protein_id gnl|my_center|LOCUS_51690 25187 24834 gene locus_tag LOCUS_51700 25187 24834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51700 25252 25725 gene locus_tag LOCUS_51710 25252 25725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_51710 25749 25967 gene locus_tag LOCUS_51720 25749 25967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51720 26232 26459 gene locus_tag LOCUS_51730 26232 26459 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143844.1 protein_id gnl|my_center|LOCUS_51730 26737 27699 gene locus_tag LOCUS_51740 26737 27699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51740 28294 28728 gene locus_tag LOCUS_51750 28294 28728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51750 29296 29009 gene locus_tag LOCUS_51760 29296 29009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51760 29574 31052 gene locus_tag LOCUS_51770 gene glgA 29574 31052 CDS product glycogen synthase GlgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011110443.1 protein_id gnl|my_center|LOCUS_51770 31153 31914 gene locus_tag LOCUS_51780 31153 31914 CDS product protein-L-isoaspartate(D-aspartate) O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141698.1 protein_id gnl|my_center|LOCUS_51780 31989 32846 gene locus_tag LOCUS_51790 31989 32846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51790 34338 32902 gene locus_tag LOCUS_51800 34338 32902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51800 34995 34432 gene locus_tag LOCUS_51810 34995 34432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_51810 35408 34959 gene locus_tag LOCUS_51820 35408 34959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_51820 36352 35633 gene locus_tag LOCUS_51830 36352 35633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51830 36601 38016 gene locus_tag LOCUS_51840 36601 38016 CDS product glycerol acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143647.1 protein_id gnl|my_center|LOCUS_51840 38390 38908 gene locus_tag LOCUS_51850 38390 38908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51850 >Feature sequence085 961 194 gene locus_tag LOCUS_51860 961 194 CDS product ChaB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921043.1 protein_id gnl|my_center|LOCUS_51860 1628 1089 gene locus_tag LOCUS_51870 1628 1089 CDS product Dps family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142813.1 protein_id gnl|my_center|LOCUS_51870 2263 1901 gene locus_tag LOCUS_51880 2263 1901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51880 3045 2866 gene locus_tag LOCUS_51890 3045 2866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51890 3575 3186 gene locus_tag LOCUS_51900 3575 3186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51900 4141 4476 gene locus_tag LOCUS_51910 4141 4476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141134.1 protein_id gnl|my_center|LOCUS_51910 5170 5331 gene locus_tag LOCUS_51920 5170 5331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51920 5369 7330 gene locus_tag LOCUS_51930 5369 7330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51930 7305 7904 gene locus_tag LOCUS_51940 7305 7904 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125274.1 protein_id gnl|my_center|LOCUS_51940 8073 8000 gene locus_tag LOCUS_t00360 8073 8000 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 8495 10414 gene locus_tag LOCUS_51950 8495 10414 CDS product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920876.1 protein_id gnl|my_center|LOCUS_51950 11070 10420 gene locus_tag LOCUS_51960 11070 10420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51960 11874 11182 gene locus_tag LOCUS_51970 11874 11182 CDS product lipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057817.1 protein_id gnl|my_center|LOCUS_51970 12586 14457 gene locus_tag LOCUS_51980 12586 14457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51980 15188 14835 gene locus_tag LOCUS_51990 15188 14835 CDS product c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103126030.1 protein_id gnl|my_center|LOCUS_51990 15981 15553 gene locus_tag LOCUS_52000 gene petE 15981 15553 CDS product plastocyanin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125233.1 protein_id gnl|my_center|LOCUS_52000 17071 16580 gene locus_tag LOCUS_52010 gene psbV 17071 16580 CDS product photosystem II cytochrome c-550 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057125.1 protein_id gnl|my_center|LOCUS_52010 17404 17219 gene locus_tag LOCUS_52020 17404 17219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52020 17647 18084 gene locus_tag LOCUS_52030 17647 18084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434832.1 protein_id gnl|my_center|LOCUS_52030 18086 23095 gene locus_tag LOCUS_52040 18086 23095 CDS product DUF4132 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889426.1 protein_id gnl|my_center|LOCUS_52040 24442 23243 gene locus_tag LOCUS_52050 24442 23243 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111136.1 protein_id gnl|my_center|LOCUS_52050 25635 24781 gene locus_tag LOCUS_52060 25635 24781 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257889.1 protein_id gnl|my_center|LOCUS_52060 26366 25716 gene locus_tag LOCUS_52070 26366 25716 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140938.1 protein_id gnl|my_center|LOCUS_52070 27353 26412 gene locus_tag LOCUS_52080 27353 26412 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257890.1 protein_id gnl|my_center|LOCUS_52080 27837 29039 gene locus_tag LOCUS_52090 27837 29039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52090 29103 30437 gene locus_tag LOCUS_52100 29103 30437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52100 30725 32026 gene locus_tag LOCUS_52110 30725 32026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52110 32651 32112 gene locus_tag LOCUS_52120 32651 32112 CDS product phycobiliprotein lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141530.1 protein_id gnl|my_center|LOCUS_52120 33345 34721 gene locus_tag LOCUS_52130 33345 34721 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920707.1 protein_id gnl|my_center|LOCUS_52130 34779 38078 gene locus_tag LOCUS_52140 34779 38078 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057001.1 protein_id gnl|my_center|LOCUS_52140 >Feature sequence086 199 798 gene locus_tag LOCUS_52150 199 798 CDS product cytochrome b/b6 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141154.1 protein_id gnl|my_center|LOCUS_52150 848 1570 gene locus_tag LOCUS_52160 848 1570 CDS product molybdopterin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141153.1 protein_id gnl|my_center|LOCUS_52160 1641 3083 gene locus_tag LOCUS_52170 1641 3083 CDS product bifunctional orotidine-5'-phosphate decarboxylase/orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141081.1 protein_id gnl|my_center|LOCUS_52170 3219 3446 gene locus_tag LOCUS_52180 3219 3446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52180 4029 3607 gene locus_tag LOCUS_52190 4029 3607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52190 5557 4139 gene locus_tag LOCUS_52200 5557 4139 CDS product 16S rRNA (cytosine(967)-C(5))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056064.1 protein_id gnl|my_center|LOCUS_52200 7184 5733 gene locus_tag LOCUS_52210 7184 5733 CDS product glycoside hydrolase 100 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124524.1 protein_id gnl|my_center|LOCUS_52210 8954 10039 gene locus_tag LOCUS_52220 8954 10039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52220 11862 10054 gene locus_tag LOCUS_52230 11862 10054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52230 12196 11912 gene locus_tag LOCUS_52240 12196 11912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52240 12744 12286 gene locus_tag LOCUS_52250 12744 12286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52250 13139 12762 gene locus_tag LOCUS_52260 13139 12762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52260 13540 13139 gene locus_tag LOCUS_52270 13540 13139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52270 14656 13670 gene locus_tag LOCUS_52280 14656 13670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52280 15078 14806 gene locus_tag LOCUS_52290 15078 14806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52290 15248 15096 gene locus_tag LOCUS_52300 15248 15096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52300 16571 15456 gene locus_tag LOCUS_52310 16571 15456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52310 16753 17946 gene locus_tag LOCUS_52320 16753 17946 CDS product Coenzyme F420 hydrogenase/dehydrogenase, beta subunit C-terminal domain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_126986860.1 protein_id gnl|my_center|LOCUS_52320 18413 19774 gene locus_tag LOCUS_52330 18413 19774 CDS product DUF839 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142441.1 protein_id gnl|my_center|LOCUS_52330 20008 21669 gene locus_tag LOCUS_52340 20008 21669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52340 22958 21729 gene locus_tag LOCUS_52350 22958 21729 CDS product methionine gamma-lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143008.1 protein_id gnl|my_center|LOCUS_52350 23043 23858 gene locus_tag LOCUS_52360 23043 23858 CDS product fatty acid desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921038.1 protein_id gnl|my_center|LOCUS_52360 24120 25172 gene locus_tag LOCUS_52370 24120 25172 CDS product fatty acid desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142617.1 protein_id gnl|my_center|LOCUS_52370 25432 26511 gene locus_tag LOCUS_52380 25432 26511 CDS product fatty acid desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142617.1 protein_id gnl|my_center|LOCUS_52380 28101 27001 gene locus_tag LOCUS_52390 28101 27001 CDS product acyl-CoA desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962582.1 protein_id gnl|my_center|LOCUS_52390 29561 28293 gene locus_tag LOCUS_52400 29561 28293 CDS product glutamate-5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071542453.1 protein_id gnl|my_center|LOCUS_52400 29971 29564 gene locus_tag LOCUS_52410 29971 29564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057546.1 protein_id gnl|my_center|LOCUS_52410 30475 30404 gene locus_tag LOCUS_t00370 30475 30404 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 31151 30591 gene locus_tag LOCUS_52420 gene ribH 31151 30591 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055922.1 protein_id gnl|my_center|LOCUS_52420 31541 31353 gene locus_tag LOCUS_52430 gene psbZ 31541 31353 CDS product photosystem II reaction center protein PsbZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057802.1 protein_id gnl|my_center|LOCUS_52430 31828 34599 gene locus_tag LOCUS_52440 31828 34599 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056370.1 protein_id gnl|my_center|LOCUS_52440 35749 34622 gene locus_tag LOCUS_52450 35749 34622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52450 <37284 36544 gene locus_tag LOCUS_52460 <37284 36544 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164929486.1:FG-GAP-like repeat-containing protein >Feature sequence087 827 3046 gene locus_tag LOCUS_52470 827 3046 CDS product phosphoketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_126986862.1 protein_id gnl|my_center|LOCUS_52470 3134 3412 gene locus_tag LOCUS_52480 3134 3412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52480 3345 3695 gene locus_tag LOCUS_52490 3345 3695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52490 3692 3958 gene locus_tag LOCUS_52500 gene grxC 3692 3958 CDS product glutaredoxin 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143672.1 protein_id gnl|my_center|LOCUS_52500 4223 4017 gene locus_tag LOCUS_52510 4223 4017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52510 4904 4677 gene locus_tag LOCUS_52520 4904 4677 CDS product DUF4926 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403415.1 protein_id gnl|my_center|LOCUS_52520 4981 5208 gene locus_tag LOCUS_52530 4981 5208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52530 5213 5464 gene locus_tag LOCUS_52540 5213 5464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52540 6919 5606 gene locus_tag LOCUS_52550 6919 5606 CDS product CO2 hydration protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141007.1 protein_id gnl|my_center|LOCUS_52550 8546 7044 gene locus_tag LOCUS_52560 8546 7044 CDS product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141006.1 protein_id gnl|my_center|LOCUS_52560 9337 8663 gene locus_tag LOCUS_52570 9337 8663 CDS product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142086.1 protein_id gnl|my_center|LOCUS_52570 11365 9503 gene locus_tag LOCUS_52580 11365 9503 CDS product NAD(P)H-quinone oxidoreductase subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056748.1 protein_id gnl|my_center|LOCUS_52580 11863 11663 gene locus_tag LOCUS_52590 11863 11663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_105221820.1 protein_id gnl|my_center|LOCUS_52590 12928 11933 gene locus_tag LOCUS_52600 12928 11933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52600 14294 13017 gene locus_tag LOCUS_52610 14294 13017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52610 15172 14297 gene locus_tag LOCUS_52620 15172 14297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52620 16461 15394 gene locus_tag LOCUS_52630 16461 15394 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197529999.1 protein_id gnl|my_center|LOCUS_52630 17845 16553 gene locus_tag LOCUS_52640 17845 16553 CDS product colanic acid biosynthesis glycosyltransferase WcaL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142460.1 protein_id gnl|my_center|LOCUS_52640 18241 19779 gene locus_tag LOCUS_52650 18241 19779 CDS product lycopene cyclase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142479.1 protein_id gnl|my_center|LOCUS_52650 22365 20059 gene locus_tag LOCUS_52660 22365 20059 CDS product NB-ARC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027844565.1 protein_id gnl|my_center|LOCUS_52660 24077 23136 gene locus_tag LOCUS_52670 24077 23136 CDS product putative 2-dehydropantoate 2-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119289.1 protein_id gnl|my_center|LOCUS_52670 25935 25366 gene locus_tag LOCUS_52680 25935 25366 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029029.1 protein_id gnl|my_center|LOCUS_52680 27425 26070 gene locus_tag LOCUS_52690 27425 26070 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057393.1 protein_id gnl|my_center|LOCUS_52690 28231 27788 gene locus_tag LOCUS_52700 28231 27788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52700 28907 29431 gene locus_tag LOCUS_52710 28907 29431 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001068736.1 protein_id gnl|my_center|LOCUS_52710 30020 29790 gene locus_tag LOCUS_52720 30020 29790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52720 30923 30189 gene locus_tag LOCUS_52730 30923 30189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52730 31824 32156 gene locus_tag LOCUS_52740 31824 32156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52740 32283 33017 gene locus_tag LOCUS_52750 32283 33017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52750 33025 33678 gene locus_tag LOCUS_52760 33025 33678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52760 34296 35411 gene locus_tag LOCUS_52770 34296 35411 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640182.1 protein_id gnl|my_center|LOCUS_52770 35604 36068 gene locus_tag LOCUS_52780 35604 36068 CDS product YbhB/YbcL family Raf kinase inhibitor-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875912.1 protein_id gnl|my_center|LOCUS_52780 >Feature sequence088 228 79 gene locus_tag LOCUS_52790 228 79 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52790 745 362 gene locus_tag LOCUS_52800 745 362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52800 951 1652 gene locus_tag LOCUS_52810 gene parA 951 1652 CDS product ParA family partition ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194446.1 protein_id gnl|my_center|LOCUS_52810 1923 2468 gene locus_tag LOCUS_52820 1923 2468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52820 3434 4444 gene locus_tag LOCUS_52830 3434 4444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52830 4661 6100 gene locus_tag LOCUS_52840 4661 6100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52840 6830 8005 gene locus_tag LOCUS_52850 6830 8005 CDS product ATP-grasp domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_127180013.1 protein_id gnl|my_center|LOCUS_52850 8007 9272 gene locus_tag LOCUS_52860 8007 9272 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000678801.1 protein_id gnl|my_center|LOCUS_52860 9386 10333 gene locus_tag LOCUS_52870 9386 10333 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808170.1 protein_id gnl|my_center|LOCUS_52870 10323 11603 gene locus_tag LOCUS_52880 10323 11603 CDS product ATP-grasp domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010945939.1 protein_id gnl|my_center|LOCUS_52880 11604 12377 gene locus_tag LOCUS_52890 11604 12377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52890 12766 12554 gene locus_tag LOCUS_52900 12766 12554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52900 13978 13463 gene locus_tag LOCUS_52910 13978 13463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52910 14713 16419 gene locus_tag LOCUS_52920 14713 16419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52920 19484 16464 gene locus_tag LOCUS_52930 19484 16464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52930 21534 21340 gene locus_tag LOCUS_52940 21534 21340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52940 22333 22145 gene locus_tag LOCUS_52950 22333 22145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52950 22421 22861 gene locus_tag LOCUS_52960 22421 22861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52960 22866 23606 gene locus_tag LOCUS_52970 22866 23606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52970 23785 24438 gene locus_tag LOCUS_52980 23785 24438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52980 24498 25085 gene locus_tag LOCUS_52990 24498 25085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52990 25089 26525 gene locus_tag LOCUS_53000 25089 26525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53000 26515 26790 gene locus_tag LOCUS_53010 26515 26790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53010 26918 27559 gene locus_tag LOCUS_53020 26918 27559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53020 27599 27841 gene locus_tag LOCUS_53030 27599 27841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53030 27838 28242 gene locus_tag LOCUS_53040 27838 28242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53040 28291 28548 gene locus_tag LOCUS_53050 28291 28548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53050 28545 28952 gene locus_tag LOCUS_53060 gene vapC 28545 28952 CDS product tRNA(fMet)-specific endonuclease VapC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770950.1 protein_id gnl|my_center|LOCUS_53060 28949 29356 gene locus_tag LOCUS_53070 28949 29356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53070 30343 29324 gene locus_tag LOCUS_53080 gene xerD 30343 29324 CDS product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002360354.1 protein_id gnl|my_center|LOCUS_53080 33651 30865 gene locus_tag LOCUS_53090 33651 30865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53090 34065 34700 gene locus_tag LOCUS_53100 34065 34700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53100 34817 35773 gene locus_tag LOCUS_53110 34817 35773 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205421607.1 protein_id gnl|my_center|LOCUS_53110 35880 36170 gene locus_tag LOCUS_53120 35880 36170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53120 >Feature sequence089 387 632 gene locus_tag LOCUS_53130 387 632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53130 625 807 gene locus_tag LOCUS_53140 625 807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53140 1926 1024 gene locus_tag LOCUS_53150 1926 1024 CDS product carotenoid biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056269.1 protein_id gnl|my_center|LOCUS_53150 2902 2021 gene locus_tag LOCUS_53160 2902 2021 CDS product acyl-CoA desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036524.1 protein_id gnl|my_center|LOCUS_53160 3402 5714 gene locus_tag LOCUS_53170 3402 5714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53170 7124 5760 gene locus_tag LOCUS_53180 7124 5760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53180 8225 7467 gene locus_tag LOCUS_53190 gene ubiG 8225 7467 CDS product bifunctional 2-polyprenyl-6-hydroxyphenol methylase/3-demethylubiquinol 3-O-methyltransferase UbiG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947426.1 protein_id gnl|my_center|LOCUS_53190 8570 8364 gene locus_tag LOCUS_53200 8570 8364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53200 9365 12034 gene locus_tag LOCUS_53210 9365 12034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53210 12450 15854 gene locus_tag LOCUS_53220 12450 15854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53220 16766 17917 gene locus_tag LOCUS_53230 16766 17917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53230 18725 24751 gene locus_tag LOCUS_53240 18725 24751 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000686845.1 protein_id gnl|my_center|LOCUS_53240 24837 25466 gene locus_tag LOCUS_53250 24837 25466 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141682.1 protein_id gnl|my_center|LOCUS_53250 25760 26317 gene locus_tag LOCUS_53260 25760 26317 CDS product DsbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_091833874.1 protein_id gnl|my_center|LOCUS_53260 26393 27175 gene locus_tag LOCUS_53270 26393 27175 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142832.1 protein_id gnl|my_center|LOCUS_53270 27343 28146 gene locus_tag LOCUS_53280 27343 28146 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115256.1 protein_id gnl|my_center|LOCUS_53280 28882 28328 gene locus_tag LOCUS_53290 28882 28328 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086720.1 protein_id gnl|my_center|LOCUS_53290 29006 29623 gene locus_tag LOCUS_53300 29006 29623 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046117372.1 protein_id gnl|my_center|LOCUS_53300 29634 30239 gene locus_tag LOCUS_53310 29634 30239 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529397.1 protein_id gnl|my_center|LOCUS_53310 30307 30744 gene locus_tag LOCUS_53320 30307 30744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53320 31021 31197 gene locus_tag LOCUS_53330 31021 31197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53330 31598 33175 gene locus_tag LOCUS_53340 31598 33175 CDS product GMC family oxidoreductase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887610.1 protein_id gnl|my_center|LOCUS_53340 33288 33557 gene locus_tag LOCUS_53350 33288 33557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53350 33587 33772 gene locus_tag LOCUS_53360 33587 33772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53360 33738 34142 gene locus_tag LOCUS_53370 33738 34142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53370 34276 34716 gene locus_tag LOCUS_53380 34276 34716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53380 35866 35177 gene locus_tag LOCUS_53390 35866 35177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53390 >Feature sequence090 194 2470 gene locus_tag LOCUS_53400 194 2470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53400 2659 3621 gene locus_tag LOCUS_53410 2659 3621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958627.1 protein_id gnl|my_center|LOCUS_53410 4203 5177 gene locus_tag LOCUS_53420 4203 5177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53420 5454 6191 gene locus_tag LOCUS_53430 gene phnC 5454 6191 CDS product phosphonate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548759.1 protein_id gnl|my_center|LOCUS_53430 6221 7015 gene locus_tag LOCUS_53440 gene phnE 6221 7015 CDS product phosphonate ABC transporter, permease protein PhnE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095111.1 protein_id gnl|my_center|LOCUS_53440 7784 7116 gene locus_tag LOCUS_53450 7784 7116 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088446.1 protein_id gnl|my_center|LOCUS_53450 9034 8390 gene locus_tag LOCUS_53460 9034 8390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_126986939.1 protein_id gnl|my_center|LOCUS_53460 9338 9090 gene locus_tag LOCUS_53470 9338 9090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53470 9850 10404 gene locus_tag LOCUS_53480 9850 10404 CDS product Dps family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056462.1 protein_id gnl|my_center|LOCUS_53480 10937 14200 gene locus_tag LOCUS_53490 gene carB 10937 14200 CDS product carbamoyl-phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058165.1 protein_id gnl|my_center|LOCUS_53490 14378 15535 gene locus_tag LOCUS_53500 14378 15535 CDS product sulfate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056129.1 protein_id gnl|my_center|LOCUS_53500 15815 16711 gene locus_tag LOCUS_53510 15815 16711 CDS product PstS family phosphate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941760.1 protein_id gnl|my_center|LOCUS_53510 17006 16821 gene locus_tag LOCUS_53520 17006 16821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53520 17958 18914 gene locus_tag LOCUS_53530 17958 18914 CDS product RNA polymerase sigma factor, RpoD/SigA family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056119.1 protein_id gnl|my_center|LOCUS_53530 19195 19539 gene locus_tag LOCUS_53540 19195 19539 CDS product DUF760 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024124133.1 protein_id gnl|my_center|LOCUS_53540 20088 20573 gene locus_tag LOCUS_53550 20088 20573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53550 21205 20591 gene locus_tag LOCUS_53560 21205 20591 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929250.1 protein_id gnl|my_center|LOCUS_53560 21829 21398 gene locus_tag LOCUS_53570 21829 21398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53570 22331 23875 gene locus_tag LOCUS_53580 22331 23875 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920854.1 protein_id gnl|my_center|LOCUS_53580 24057 25466 gene locus_tag LOCUS_53590 24057 25466 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056475.1 protein_id gnl|my_center|LOCUS_53590 26093 26917 gene locus_tag LOCUS_53600 26093 26917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53600 27782 27471 gene locus_tag LOCUS_53610 27782 27471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53610 28513 28241 gene locus_tag LOCUS_53620 28513 28241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53620 29620 28838 gene locus_tag LOCUS_53630 29620 28838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53630 31203 29644 gene locus_tag LOCUS_53640 31203 29644 CDS product HlyD family type I secretion periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268198.1 protein_id gnl|my_center|LOCUS_53640 34455 31381 gene locus_tag LOCUS_53650 34455 31381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53650 >Feature sequence091 121 390 gene locus_tag LOCUS_53660 121 390 CDS product GlsB/YeaQ/YmgE family stress response membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008500746.1 protein_id gnl|my_center|LOCUS_53660 1001 1228 gene locus_tag LOCUS_53670 1001 1228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53670 1449 1784 gene locus_tag LOCUS_53680 1449 1784 CDS product DUF760 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024124133.1 protein_id gnl|my_center|LOCUS_53680 2215 1901 gene locus_tag LOCUS_53690 2215 1901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53690 2784 2389 gene locus_tag LOCUS_53700 2784 2389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53700 3231 2836 gene locus_tag LOCUS_53710 3231 2836 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005062283.1 protein_id gnl|my_center|LOCUS_53710 3638 3273 gene locus_tag LOCUS_53720 3638 3273 CDS product Lin0512 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086800.1 protein_id gnl|my_center|LOCUS_53720 3938 4819 gene locus_tag LOCUS_53730 3938 4819 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000528691.1 protein_id gnl|my_center|LOCUS_53730 5621 6457 gene locus_tag LOCUS_53740 5621 6457 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140126.1 protein_id gnl|my_center|LOCUS_53740 6891 6490 gene locus_tag LOCUS_53750 6891 6490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53750 8905 7610 gene locus_tag LOCUS_53760 8905 7610 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141544.1 protein_id gnl|my_center|LOCUS_53760 10399 9038 gene locus_tag LOCUS_53770 10399 9038 CDS product flavin monoamine oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899946.1 protein_id gnl|my_center|LOCUS_53770 10986 10693 gene locus_tag LOCUS_53780 10986 10693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_53780 11525 11367 gene locus_tag LOCUS_53790 11525 11367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53790 12743 11595 gene locus_tag LOCUS_53800 12743 11595 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257475.1 protein_id gnl|my_center|LOCUS_53800 12834 13790 gene locus_tag LOCUS_53810 12834 13790 CDS product RNA-guided endonuclease TnpB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254458.1 protein_id gnl|my_center|LOCUS_53810 13997 14683 gene locus_tag LOCUS_53820 13997 14683 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393101.1 protein_id gnl|my_center|LOCUS_53820 14714 15427 gene locus_tag LOCUS_53830 14714 15427 CDS product haloacid dehalogenase type II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404012.1 protein_id gnl|my_center|LOCUS_53830 15688 16653 gene locus_tag LOCUS_53840 15688 16653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53840 17011 17931 gene locus_tag LOCUS_53850 17011 17931 CDS product SMP-30/gluconolactonase/LRE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063173824.1 protein_id gnl|my_center|LOCUS_53850 17985 19673 gene locus_tag LOCUS_53860 17985 19673 CDS product ABC transporter ATP-binding protein/permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920652.1 protein_id gnl|my_center|LOCUS_53860 20821 19829 gene locus_tag LOCUS_53870 20821 19829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53870 21686 20856 gene locus_tag LOCUS_53880 21686 20856 CDS product SMP-30/gluconolactonase/LRE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063173824.1 protein_id gnl|my_center|LOCUS_53880 23415 21961 gene locus_tag LOCUS_53890 23415 21961 CDS product PQQ-dependent sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922308.1 protein_id gnl|my_center|LOCUS_53890 24533 23550 gene locus_tag LOCUS_53900 24533 23550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53900 25622 24645 gene locus_tag LOCUS_53910 25622 24645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53910 26192 27235 gene locus_tag LOCUS_53920 26192 27235 CDS product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259079.1 protein_id gnl|my_center|LOCUS_53920 27378 28295 gene locus_tag LOCUS_53930 27378 28295 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124827.1 protein_id gnl|my_center|LOCUS_53930 28632 29906 gene locus_tag LOCUS_53940 28632 29906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53940 30049 31083 gene locus_tag LOCUS_53950 30049 31083 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259081.1 protein_id gnl|my_center|LOCUS_53950 31345 32082 gene locus_tag LOCUS_53960 31345 32082 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259082.1 protein_id gnl|my_center|LOCUS_53960 33142 34167 gene locus_tag LOCUS_53970 33142 34167 CDS product isopenicillin N synthase family oxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101381.1 protein_id gnl|my_center|LOCUS_53970 34683 34171 gene locus_tag LOCUS_53980 34683 34171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53980 >Feature sequence092 719 510 gene locus_tag LOCUS_53990 719 510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53990 1319 3958 gene locus_tag LOCUS_54000 gene alaS 1319 3958 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057938.1 protein_id gnl|my_center|LOCUS_54000 4293 5657 gene locus_tag LOCUS_54010 4293 5657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54010 5848 6087 gene locus_tag LOCUS_54020 5848 6087 CDS product type II toxin-antitoxin system Phd/YefM family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529932.1 protein_id gnl|my_center|LOCUS_54020 6576 6202 gene locus_tag LOCUS_54030 6576 6202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54030 7005 7592 gene locus_tag LOCUS_54040 7005 7592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54040 7564 7941 gene locus_tag LOCUS_54050 7564 7941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54050 8251 8511 gene locus_tag LOCUS_54060 8251 8511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54060 8736 9365 gene locus_tag LOCUS_54070 8736 9365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54070 9635 10087 gene locus_tag LOCUS_54080 9635 10087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54080 10148 10687 gene locus_tag LOCUS_54090 10148 10687 CDS product protein tyrosine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206995.1 protein_id gnl|my_center|LOCUS_54090 10952 10707 gene locus_tag LOCUS_54100 10952 10707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54100 11187 14717 gene locus_tag LOCUS_54110 11187 14717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54110 14860 15246 gene locus_tag LOCUS_54120 14860 15246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54120 15248 16654 gene locus_tag LOCUS_54130 15248 16654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54130 16733 17638 gene locus_tag LOCUS_54140 16733 17638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54140 19001 17814 gene locus_tag LOCUS_54150 19001 17814 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920967.1 protein_id gnl|my_center|LOCUS_54150 19941 19033 gene locus_tag LOCUS_54160 19941 19033 CDS product carotenoid biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056269.1 protein_id gnl|my_center|LOCUS_54160 20283 20708 gene locus_tag LOCUS_54170 20283 20708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54170 21240 20959 gene locus_tag LOCUS_54180 gene rpmA 21240 20959 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140826.1 protein_id gnl|my_center|LOCUS_54180 21795 21274 gene locus_tag LOCUS_54190 21795 21274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54190 22595 23680 gene locus_tag LOCUS_54200 22595 23680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54200 23956 23759 gene locus_tag LOCUS_54210 23956 23759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54210 24021 24392 gene locus_tag LOCUS_54220 24021 24392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_54220 24512 24829 gene locus_tag LOCUS_54230 24512 24829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_54230 26137 25022 gene locus_tag LOCUS_54240 gene bchI 26137 25022 CDS product magnesium chelatase ATPase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920887.1 protein_id gnl|my_center|LOCUS_54240 26523 27101 gene locus_tag LOCUS_54250 26523 27101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54250 27106 29871 gene locus_tag LOCUS_54260 27106 29871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54260 30730 31020 gene locus_tag LOCUS_54270 30730 31020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54270 31233 34376 gene locus_tag LOCUS_54280 31233 34376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54280 >Feature sequence093 133 840 gene locus_tag LOCUS_54290 133 840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_54290 849 1046 gene locus_tag LOCUS_54300 849 1046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54300 1091 2365 gene locus_tag LOCUS_54310 1091 2365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_54310 2488 3720 gene locus_tag LOCUS_54320 2488 3720 CDS product DUF4336 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125209.1 protein_id gnl|my_center|LOCUS_54320 6175 3944 gene locus_tag LOCUS_54330 6175 3944 CDS product FdhF/YdeP family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229107.1 protein_id gnl|my_center|LOCUS_54330 6790 8445 gene locus_tag LOCUS_54340 6790 8445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54340 8505 12173 gene locus_tag LOCUS_54350 8505 12173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54350 12306 13388 gene locus_tag LOCUS_54360 12306 13388 CDS product class I fructose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004295283.1 protein_id gnl|my_center|LOCUS_54360 15054 14536 gene locus_tag LOCUS_54370 15054 14536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54370 16801 16574 gene locus_tag LOCUS_54380 16801 16574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54380 16996 17379 gene locus_tag LOCUS_54390 16996 17379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54390 17604 18770 gene locus_tag LOCUS_54400 17604 18770 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058190.1 protein_id gnl|my_center|LOCUS_54400 20015 18825 gene locus_tag LOCUS_54410 20015 18825 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056224.1 protein_id gnl|my_center|LOCUS_54410 20317 21717 gene locus_tag LOCUS_54420 20317 21717 CDS product damage-control phosphatase ARMT1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404091.1 protein_id gnl|my_center|LOCUS_54420 24470 21945 gene locus_tag LOCUS_54430 24470 21945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54430 25007 24762 gene locus_tag LOCUS_54440 25007 24762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54440 26517 26119 gene locus_tag LOCUS_54450 26517 26119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54450 27319 27113 gene locus_tag LOCUS_54460 27319 27113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54460 28267 29199 gene locus_tag LOCUS_54470 28267 29199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54470 29595 29843 gene locus_tag LOCUS_54480 29595 29843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54480 29974 30375 gene locus_tag LOCUS_54490 29974 30375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54490 32344 30590 gene locus_tag LOCUS_54500 32344 30590 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929004.1 protein_id gnl|my_center|LOCUS_54500 32935 32465 gene locus_tag LOCUS_54510 32935 32465 CDS product DUF3368 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878102.1 protein_id gnl|my_center|LOCUS_54510 33198 32932 gene locus_tag LOCUS_54520 33198 32932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54520 34210 33611 gene locus_tag LOCUS_54530 34210 33611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54530 >Feature sequence094 1161 241 gene locus_tag LOCUS_54540 1161 241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54540 1293 1475 gene locus_tag LOCUS_54550 1293 1475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54550 1743 1552 gene locus_tag LOCUS_54560 1743 1552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54560 2186 3361 gene locus_tag LOCUS_54570 2186 3361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54570 4422 3418 gene locus_tag LOCUS_54580 4422 3418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54580 4714 5271 gene locus_tag LOCUS_54590 4714 5271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056409.1 protein_id gnl|my_center|LOCUS_54590 5347 5991 gene locus_tag LOCUS_54600 5347 5991 CDS product DUF3318 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056895.1 protein_id gnl|my_center|LOCUS_54600 7544 6063 gene locus_tag LOCUS_54610 7544 6063 CDS product esterase-like activity of phytase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530985.1 protein_id gnl|my_center|LOCUS_54610 8632 7835 gene locus_tag LOCUS_54620 8632 7835 CDS product 7-carboxy-7-deazaguanine synthase QueE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099797963.1 protein_id gnl|my_center|LOCUS_54620 8985 10007 gene locus_tag LOCUS_54630 8985 10007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54630 10671 11942 gene locus_tag LOCUS_54640 10671 11942 CDS product WcaI family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265553.1 protein_id gnl|my_center|LOCUS_54640 12343 12939 gene locus_tag LOCUS_54650 gene yqeK 12343 12939 CDS product bis(5'-nucleosyl)-tetraphosphatase (symmetrical) YqeK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057165.1 protein_id gnl|my_center|LOCUS_54650 13066 13527 gene locus_tag LOCUS_54660 gene rsfS 13066 13527 CDS product ribosome silencing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057064.1 protein_id gnl|my_center|LOCUS_54660 13524 14024 gene locus_tag LOCUS_54670 13524 14024 CDS product CGLD27 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056906.1 protein_id gnl|my_center|LOCUS_54670 14111 15064 gene locus_tag LOCUS_54680 14111 15064 CDS product asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_073550332.1 protein_id gnl|my_center|LOCUS_54680 15530 16000 gene locus_tag LOCUS_54690 15530 16000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54690 16059 17516 gene locus_tag LOCUS_54700 16059 17516 CDS product DUF697 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056847.1 protein_id gnl|my_center|LOCUS_54700 17721 18917 gene locus_tag LOCUS_54710 17721 18917 CDS product DNA cytosine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001883155.1 protein_id gnl|my_center|LOCUS_54710 19807 18935 gene locus_tag LOCUS_54720 19807 18935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54720 20072 20752 gene locus_tag LOCUS_54730 gene deoC 20072 20752 CDS product deoxyribose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056922.1 protein_id gnl|my_center|LOCUS_54730 20798 21709 gene locus_tag LOCUS_54740 gene recO 20798 21709 CDS product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140088.1 protein_id gnl|my_center|LOCUS_54740 21837 23345 gene locus_tag LOCUS_54750 21837 23345 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058069.1 protein_id gnl|my_center|LOCUS_54750 23720 24871 gene locus_tag LOCUS_54760 23720 24871 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140086.1 protein_id gnl|my_center|LOCUS_54760 26794 25139 gene locus_tag LOCUS_54770 26794 25139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54770 28043 27246 gene locus_tag LOCUS_54780 28043 27246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54780 28406 28173 gene locus_tag LOCUS_54790 gene secG 28406 28173 CDS product preprotein translocase subunit SecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056943.1 protein_id gnl|my_center|LOCUS_54790 30148 28550 gene locus_tag LOCUS_54800 gene gpmI 30148 28550 CDS product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056006.1 protein_id gnl|my_center|LOCUS_54800 31044 30526 gene locus_tag LOCUS_54810 31044 30526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54810 31213 31013 gene locus_tag LOCUS_54820 31213 31013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_54820 31754 31221 gene locus_tag LOCUS_54830 31754 31221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54830 33546 31852 gene locus_tag LOCUS_54840 33546 31852 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140102.1 protein_id gnl|my_center|LOCUS_54840 >Feature sequence095 993 319 gene locus_tag LOCUS_54850 993 319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_54850 1493 1065 gene locus_tag LOCUS_54860 1493 1065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54860 2040 3803 gene locus_tag LOCUS_54870 2040 3803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54870 5126 3852 gene locus_tag LOCUS_54880 5126 3852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54880 5782 6720 gene locus_tag LOCUS_54890 5782 6720 CDS product DUF5996 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929027.1 protein_id gnl|my_center|LOCUS_54890 7077 8033 gene locus_tag LOCUS_54900 7077 8033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54900 10486 8546 gene locus_tag LOCUS_54910 gene ftsH 10486 8546 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056378.1 protein_id gnl|my_center|LOCUS_54910 10891 10670 gene locus_tag LOCUS_54920 10891 10670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54920 11275 12399 gene locus_tag LOCUS_54930 11275 12399 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099799453.1 protein_id gnl|my_center|LOCUS_54930 13430 14761 gene locus_tag LOCUS_54940 13430 14761 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141651.1 protein_id gnl|my_center|LOCUS_54940 14780 15448 gene locus_tag LOCUS_54950 14780 15448 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928824.1 protein_id gnl|my_center|LOCUS_54950 15905 15546 gene locus_tag LOCUS_54960 15905 15546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54960 16195 17652 gene locus_tag LOCUS_54970 16195 17652 CDS product glycoside hydrolase family 13 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143635.1 protein_id gnl|my_center|LOCUS_54970 18293 17874 gene locus_tag LOCUS_54980 18293 17874 CDS product fasciclin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038968086.1 protein_id gnl|my_center|LOCUS_54980 18452 18688 gene locus_tag LOCUS_54990 18452 18688 CDS product DNA-directed RNA polymerase subunit omega inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141619.1 protein_id gnl|my_center|LOCUS_54990 18712 19323 gene locus_tag LOCUS_55000 18712 19323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55000 19331 19696 gene locus_tag LOCUS_55010 19331 19696 CDS product DUF1818 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057286.1 protein_id gnl|my_center|LOCUS_55010 19749 19822 gene locus_tag LOCUS_t00380 19749 19822 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 21054 21533 gene locus_tag LOCUS_55020 21054 21533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55020 21539 22114 gene locus_tag LOCUS_55030 21539 22114 CDS product DUF924 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143855.1 protein_id gnl|my_center|LOCUS_55030 22326 24314 gene locus_tag LOCUS_55040 22326 24314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55040 24317 27061 gene locus_tag LOCUS_55050 24317 27061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55050 27482 27159 gene locus_tag LOCUS_55060 27482 27159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55060 29458 27734 gene locus_tag LOCUS_55070 29458 27734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55070 31617 30223 gene locus_tag LOCUS_55080 31617 30223 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406369.1 protein_id gnl|my_center|LOCUS_55080 32517 31969 gene locus_tag LOCUS_55090 32517 31969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55090 >Feature sequence096 735 1700 gene locus_tag LOCUS_55100 735 1700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55100 1944 2573 gene locus_tag LOCUS_55110 1944 2573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55110 3418 2570 gene locus_tag LOCUS_55120 3418 2570 CDS product pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056991.1 protein_id gnl|my_center|LOCUS_55120 3566 5290 gene locus_tag LOCUS_55130 3566 5290 CDS product diflavin flavoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056931.1 protein_id gnl|my_center|LOCUS_55130 5334 6086 gene locus_tag LOCUS_55140 5334 6086 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972574.1 protein_id gnl|my_center|LOCUS_55140 6122 7834 gene locus_tag LOCUS_55150 6122 7834 CDS product diflavin flavoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141774.1 protein_id gnl|my_center|LOCUS_55150 8632 7898 gene locus_tag LOCUS_55160 8632 7898 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000257073.1 protein_id gnl|my_center|LOCUS_55160 10183 8903 gene locus_tag LOCUS_55170 10183 8903 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257891.1 protein_id gnl|my_center|LOCUS_55170 10340 11788 gene locus_tag LOCUS_55180 10340 11788 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257067.1 protein_id gnl|my_center|LOCUS_55180 12401 11976 gene locus_tag LOCUS_55190 12401 11976 CDS product putative toxin-antitoxin system toxin component, PIN family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392184.1 protein_id gnl|my_center|LOCUS_55190 12637 12398 gene locus_tag LOCUS_55200 12637 12398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55200 14119 13163 gene locus_tag LOCUS_55210 gene accD 14119 13163 CDS product acetyl-CoA carboxylase, carboxyltransferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057480.1 protein_id gnl|my_center|LOCUS_55210 14540 14325 gene locus_tag LOCUS_55220 14540 14325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55220 15499 14687 gene locus_tag LOCUS_55230 15499 14687 CDS product A24 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099799517.1 protein_id gnl|my_center|LOCUS_55230 15830 15567 gene locus_tag LOCUS_55240 15830 15567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55240 17008 15920 gene locus_tag LOCUS_55250 gene leuB 17008 15920 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057439.1 protein_id gnl|my_center|LOCUS_55250 17266 17778 gene locus_tag LOCUS_55260 17266 17778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55260 18302 19252 gene locus_tag LOCUS_55270 18302 19252 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256383.1 protein_id gnl|my_center|LOCUS_55270 19349 21214 gene locus_tag LOCUS_55280 19349 21214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55280 21497 23413 gene locus_tag LOCUS_55290 21497 23413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55290 24338 23457 gene locus_tag LOCUS_55300 gene sucD 24338 23457 CDS product succinate--CoA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765646.1 protein_id gnl|my_center|LOCUS_55300 25761 24526 gene locus_tag LOCUS_55310 gene sucC 25761 24526 CDS product ADP-forming succinate--CoA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762775.1 protein_id gnl|my_center|LOCUS_55310 27230 26454 gene locus_tag LOCUS_55320 gene fetB 27230 26454 CDS product iron export ABC transporter permease subunit FetB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392685.1 protein_id gnl|my_center|LOCUS_55320 27538 28665 gene locus_tag LOCUS_55330 27538 28665 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124471.1 protein_id gnl|my_center|LOCUS_55330 29508 28759 gene locus_tag LOCUS_55340 29508 28759 CDS product DUF561 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057089.1 protein_id gnl|my_center|LOCUS_55340 31445 29589 gene locus_tag LOCUS_55350 31445 29589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55350 31926 32519 gene locus_tag LOCUS_55360 31926 32519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_55360 32524 32733 gene locus_tag LOCUS_55370 32524 32733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_55370 >Feature sequence097 759 331 gene locus_tag LOCUS_55380 759 331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55380 1368 868 gene locus_tag LOCUS_55390 1368 868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55390 1706 2377 gene locus_tag LOCUS_55400 1706 2377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55400 2427 4385 gene locus_tag LOCUS_55410 2427 4385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55410 4382 5845 gene locus_tag LOCUS_55420 4382 5845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55420 6023 6613 gene locus_tag LOCUS_55430 6023 6613 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083435038.1 protein_id gnl|my_center|LOCUS_55430 7068 6658 gene locus_tag LOCUS_55440 7068 6658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55440 8832 7246 gene locus_tag LOCUS_55450 8832 7246 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056564.1 protein_id gnl|my_center|LOCUS_55450 9051 10184 gene locus_tag LOCUS_55460 9051 10184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55460 10174 10959 gene locus_tag LOCUS_55470 10174 10959 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_073601368.1 protein_id gnl|my_center|LOCUS_55470 11043 11942 gene locus_tag LOCUS_55480 11043 11942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55480 12683 12048 gene locus_tag LOCUS_55490 12683 12048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55490 13174 13854 gene locus_tag LOCUS_55500 13174 13854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55500 14614 13874 gene locus_tag LOCUS_55510 14614 13874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55510 17937 14980 gene locus_tag LOCUS_55520 17937 14980 CDS product UPF0182 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057035.1 protein_id gnl|my_center|LOCUS_55520 18391 17924 gene locus_tag LOCUS_55530 18391 17924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55530 19866 18571 gene locus_tag LOCUS_55540 19866 18571 CDS product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057575.1 protein_id gnl|my_center|LOCUS_55540 21134 20097 gene locus_tag LOCUS_55550 gene glpX 21134 20097 CDS product class II fructose-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057116.1 protein_id gnl|my_center|LOCUS_55550 22239 21322 gene locus_tag LOCUS_55560 22239 21322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55560 22611 22826 gene locus_tag LOCUS_55570 22611 22826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55570 23222 23536 gene locus_tag LOCUS_55580 gene grxC 23222 23536 CDS product glutaredoxin 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143672.1 protein_id gnl|my_center|LOCUS_55580 23634 24125 gene locus_tag LOCUS_55590 23634 24125 CDS product nucleoside deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141055.1 protein_id gnl|my_center|LOCUS_55590 24204 25010 gene locus_tag LOCUS_55600 24204 25010 CDS product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099799326.1 protein_id gnl|my_center|LOCUS_55600 25877 26521 gene locus_tag LOCUS_55610 25877 26521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055990.1 protein_id gnl|my_center|LOCUS_55610 26826 27083 gene locus_tag LOCUS_55620 26826 27083 CDS product BolA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056719.1 protein_id gnl|my_center|LOCUS_55620 27158 27481 gene locus_tag LOCUS_55630 gene grxD 27158 27481 CDS product Grx4 family monothiol glutaredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024125804.1 protein_id gnl|my_center|LOCUS_55630 28627 28385 gene locus_tag LOCUS_55640 28627 28385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141287.1 protein_id gnl|my_center|LOCUS_55640 29188 29955 gene locus_tag LOCUS_55650 29188 29955 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057170.1 protein_id gnl|my_center|LOCUS_55650 30773 29994 gene locus_tag LOCUS_55660 30773 29994 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003535037.1 protein_id gnl|my_center|LOCUS_55660 31522 30956 gene locus_tag LOCUS_55670 31522 30956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056601.1 protein_id gnl|my_center|LOCUS_55670 31833 31606 gene locus_tag LOCUS_55680 31833 31606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55680 32054 31839 gene locus_tag LOCUS_55690 32054 31839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55690 >Feature sequence098 538 329 gene locus_tag LOCUS_55700 538 329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55700 603 848 gene locus_tag LOCUS_55710 603 848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55710 848 1204 gene locus_tag LOCUS_55720 848 1204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55720 1582 2016 gene locus_tag LOCUS_55730 1582 2016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55730 1931 2668 gene locus_tag LOCUS_55740 1931 2668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55740 2899 2690 gene locus_tag LOCUS_55750 2899 2690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55750 5349 3064 gene locus_tag LOCUS_55760 gene glgB 5349 3064 CDS product 1,4-alpha-glucan branching enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056426.1 protein_id gnl|my_center|LOCUS_55760 5782 5549 gene locus_tag LOCUS_55770 5782 5549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55770 6390 6193 gene locus_tag LOCUS_55780 6390 6193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55780 6909 7613 gene locus_tag LOCUS_55790 6909 7613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55790 8143 9747 gene locus_tag LOCUS_55800 8143 9747 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057909.1 protein_id gnl|my_center|LOCUS_55800 9957 11075 gene locus_tag LOCUS_55810 9957 11075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55810 11261 11968 gene locus_tag LOCUS_55820 11261 11968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55820 13285 11996 gene locus_tag LOCUS_55830 13285 11996 CDS product RNA-guided endonuclease TnpB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897221.1 protein_id gnl|my_center|LOCUS_55830 13963 15753 gene locus_tag LOCUS_55840 13963 15753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55840 18606 15979 gene locus_tag LOCUS_55850 18606 15979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55850 20779 18638 gene locus_tag LOCUS_55860 20779 18638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55860 21690 20839 gene locus_tag LOCUS_55870 21690 20839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55870 21898 21716 gene locus_tag LOCUS_55880 21898 21716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55880 22407 23756 gene locus_tag LOCUS_55890 22407 23756 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920917.1 protein_id gnl|my_center|LOCUS_55890 23753 24457 gene locus_tag LOCUS_55900 23753 24457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55900 25580 24633 gene locus_tag LOCUS_55910 25580 24633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55910 25785 26996 gene locus_tag LOCUS_55920 25785 26996 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259387.1 protein_id gnl|my_center|LOCUS_55920 27841 30168 gene locus_tag LOCUS_55930 27841 30168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55930 30419 30228 gene locus_tag LOCUS_55940 30419 30228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55940 30716 31807 gene locus_tag LOCUS_55950 gene thrC 30716 31807 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_198406172.1 protein_id gnl|my_center|LOCUS_55950 >Feature sequence099 279 13 gene locus_tag LOCUS_55960 279 13 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55960 595 290 gene locus_tag LOCUS_55970 595 290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55970 814 1668 gene locus_tag LOCUS_55980 814 1668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55980 2604 1633 gene locus_tag LOCUS_55990 2604 1633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55990 3237 3016 gene locus_tag LOCUS_56000 3237 3016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56000 3731 5092 gene locus_tag LOCUS_56010 3731 5092 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329291.1 protein_id gnl|my_center|LOCUS_56010 6331 5111 gene locus_tag LOCUS_56020 6331 5111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56020 6730 8025 gene locus_tag LOCUS_56030 6730 8025 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929187.1 protein_id gnl|my_center|LOCUS_56030 8306 9472 gene locus_tag LOCUS_56040 8306 9472 CDS product heterodisulfide reductase-related iron-sulfur binding cluster inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143065.1 protein_id gnl|my_center|LOCUS_56040 11354 10935 gene locus_tag LOCUS_56050 11354 10935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56050 11387 11872 gene locus_tag LOCUS_56060 11387 11872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56060 12015 13322 gene locus_tag LOCUS_56070 12015 13322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56070 14714 13539 gene locus_tag LOCUS_56080 14714 13539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56080 14828 16129 gene locus_tag LOCUS_56090 14828 16129 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389104.1 protein_id gnl|my_center|LOCUS_56090 16679 16314 gene locus_tag LOCUS_56100 16679 16314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56100 18012 16921 gene locus_tag LOCUS_56110 18012 16921 CDS product saccharopine dehydrogenase NADP-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141720.1 protein_id gnl|my_center|LOCUS_56110 19857 18163 gene locus_tag LOCUS_56120 19857 18163 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140397.1 protein_id gnl|my_center|LOCUS_56120 20497 21852 gene locus_tag LOCUS_56130 20497 21852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56130 22134 21802 gene locus_tag LOCUS_56140 22134 21802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56140 23039 22344 gene locus_tag LOCUS_56150 23039 22344 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057465.1 protein_id gnl|my_center|LOCUS_56150 24575 23109 gene locus_tag LOCUS_56160 24575 23109 CDS product FAD/NAD(P)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527331.1 protein_id gnl|my_center|LOCUS_56160 26902 25208 gene locus_tag LOCUS_56170 26902 25208 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140397.1 protein_id gnl|my_center|LOCUS_56170 27830 27081 gene locus_tag LOCUS_56180 27830 27081 CDS product DUF2993 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141748.1 protein_id gnl|my_center|LOCUS_56180 29406 28084 gene locus_tag LOCUS_56190 29406 28084 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143056.1 protein_id gnl|my_center|LOCUS_56190 30835 29597 gene locus_tag LOCUS_56200 30835 29597 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143057.1 protein_id gnl|my_center|LOCUS_56200 >Feature sequence100 323 859 gene locus_tag LOCUS_56210 323 859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56210 2039 945 gene locus_tag LOCUS_56220 2039 945 CDS product phosphotransacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057861.1 protein_id gnl|my_center|LOCUS_56220 2806 2432 gene locus_tag LOCUS_56230 2806 2432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057860.1 protein_id gnl|my_center|LOCUS_56230 3007 3981 gene locus_tag LOCUS_56240 3007 3981 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057690.1 protein_id gnl|my_center|LOCUS_56240 3935 5359 gene locus_tag LOCUS_56250 3935 5359 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057691.1 protein_id gnl|my_center|LOCUS_56250 7448 5418 gene locus_tag LOCUS_56260 7448 5418 CDS product DNA polymerase III subunit gamma/tau inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056974.1 protein_id gnl|my_center|LOCUS_56260 7760 8464 gene locus_tag LOCUS_56270 7760 8464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56270 8789 12523 gene locus_tag LOCUS_56280 8789 12523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56280 13095 12562 gene locus_tag LOCUS_56290 13095 12562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56290 13493 13305 gene locus_tag LOCUS_56300 gene rpsU 13493 13305 CDS product 30S ribosomal protein S21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124743.1 protein_id gnl|my_center|LOCUS_56300 13953 13636 gene locus_tag LOCUS_56310 13953 13636 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058088.1 protein_id gnl|my_center|LOCUS_56310 15629 14394 gene locus_tag LOCUS_56320 15629 14394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56320 17384 15633 gene locus_tag LOCUS_56330 gene dnaK 17384 15633 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083187.1 protein_id gnl|my_center|LOCUS_56330 18123 17446 gene locus_tag LOCUS_56340 18123 17446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56340 18478 19665 gene locus_tag LOCUS_56350 18478 19665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56350 22535 19740 gene locus_tag LOCUS_56360 gene treY 22535 19740 CDS product malto-oligosyltrehalose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393311.1 protein_id gnl|my_center|LOCUS_56360 24454 22628 gene locus_tag LOCUS_56370 gene treZ 24454 22628 CDS product malto-oligosyltrehalose trehalohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393309.1 protein_id gnl|my_center|LOCUS_56370 26685 24559 gene locus_tag LOCUS_56380 gene glgX 26685 24559 CDS product glycogen debranching protein GlgX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224463.1 protein_id gnl|my_center|LOCUS_56380 28920 27799 gene locus_tag LOCUS_56390 gene cax 28920 27799 CDS product calcium/proton exchanger inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057620.1 protein_id gnl|my_center|LOCUS_56390 29971 30477 gene locus_tag LOCUS_56400 29971 30477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_56400 >Feature sequence101 1182 202 gene locus_tag LOCUS_56410 gene mdh 1182 202 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142537.1 protein_id gnl|my_center|LOCUS_56410 1428 1213 gene locus_tag LOCUS_56420 1428 1213 CDS product NAD(P)H-quinone oxidoreductase subunit O inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143533.1 protein_id gnl|my_center|LOCUS_56420 2670 1810 gene locus_tag LOCUS_56430 2670 1810 CDS product DNA-formamidopyrimidine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057406.1 protein_id gnl|my_center|LOCUS_56430 3016 2804 gene locus_tag LOCUS_56440 3016 2804 CDS product photosystem I reaction center subunit IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057407.1 protein_id gnl|my_center|LOCUS_56440 4014 3430 gene locus_tag LOCUS_56450 4014 3430 CDS product PAP/fibrillin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056274.1 protein_id gnl|my_center|LOCUS_56450 4242 4484 gene locus_tag LOCUS_56460 4242 4484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56460 4564 5667 gene locus_tag LOCUS_56470 gene mraY 4564 5667 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099799153.1 protein_id gnl|my_center|LOCUS_56470 6348 5845 gene locus_tag LOCUS_56480 6348 5845 CDS product MogA/MoaB family molybdenum cofactor biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000117134.1 protein_id gnl|my_center|LOCUS_56480 6805 6470 gene locus_tag LOCUS_56490 gene psb28 6805 6470 CDS product photosystem II reaction center protein Psb28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920702.1 protein_id gnl|my_center|LOCUS_56490 7392 6910 gene locus_tag LOCUS_56500 gene dtd 7392 6910 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460350.1 protein_id gnl|my_center|LOCUS_56500 8572 7436 gene locus_tag LOCUS_56510 8572 7436 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058109.1 protein_id gnl|my_center|LOCUS_56510 8839 10281 gene locus_tag LOCUS_56520 gene cysS 8839 10281 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920936.1 protein_id gnl|my_center|LOCUS_56520 10360 10599 gene locus_tag LOCUS_56530 10360 10599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_56530 10786 12228 gene locus_tag LOCUS_56540 10786 12228 CDS product TldD/PmbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056233.1 protein_id gnl|my_center|LOCUS_56540 12377 12171 gene locus_tag LOCUS_56550 12377 12171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56550 12401 13744 gene locus_tag LOCUS_56560 12401 13744 CDS product TldD/PmbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056219.1 protein_id gnl|my_center|LOCUS_56560 13966 15201 gene locus_tag LOCUS_56570 gene tnpB 13966 15201 CDS product IS200/IS605 family element RNA-guided endonuclease TnpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_054297574.1 protein_id gnl|my_center|LOCUS_56570 19663 15233 gene locus_tag LOCUS_56580 19663 15233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56580 19910 19677 gene locus_tag LOCUS_56590 19910 19677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56590 20535 20284 gene locus_tag LOCUS_56600 20535 20284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56600 21634 20939 gene locus_tag LOCUS_56610 21634 20939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56610 22101 21526 gene locus_tag LOCUS_56620 gene coaD 22101 21526 CDS product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057007.1 protein_id gnl|my_center|LOCUS_56620 22556 23428 gene locus_tag LOCUS_56630 gene lgt 22556 23428 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057991.1 protein_id gnl|my_center|LOCUS_56630 23602 24411 gene locus_tag LOCUS_56640 gene cobM 23602 24411 CDS product precorrin-4 C(11)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141377.1 protein_id gnl|my_center|LOCUS_56640 24562 24915 gene locus_tag LOCUS_56650 24562 24915 CDS product phenylpyruvate tautomerase MIF-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125356.1 protein_id gnl|my_center|LOCUS_56650 25540 26859 gene locus_tag LOCUS_56660 25540 26859 CDS product carboxylic ester hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001012297.1 protein_id gnl|my_center|LOCUS_56660 26964 28043 gene locus_tag LOCUS_56670 gene rlmN 26964 28043 CDS product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058257.1 protein_id gnl|my_center|LOCUS_56670 28974 29579 gene locus_tag LOCUS_56680 28974 29579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971331.1 protein_id gnl|my_center|LOCUS_56680 30205 29729 gene locus_tag LOCUS_56690 30205 29729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56690 >Feature sequence102 2286 730 gene locus_tag LOCUS_56700 2286 730 CDS product flavin monoamine oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368471.1 protein_id gnl|my_center|LOCUS_56700 2947 3192 gene locus_tag LOCUS_56710 gene psaC 2947 3192 CDS product photosystem I iron-sulfur center protein PsaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056855.1 protein_id gnl|my_center|LOCUS_56710 3652 5553 gene locus_tag LOCUS_56720 gene glmS 3652 5553 CDS product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921151.1 protein_id gnl|my_center|LOCUS_56720 5662 6624 gene locus_tag LOCUS_56730 5662 6624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_56730 6621 7217 gene locus_tag LOCUS_56740 6621 7217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_56740 7315 8343 gene locus_tag LOCUS_56750 7315 8343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56750 8336 8554 gene locus_tag LOCUS_56760 8336 8554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56760 8565 9911 gene locus_tag LOCUS_56770 8565 9911 CDS product restriction endonuclease subunit S inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103419.1 protein_id gnl|my_center|LOCUS_56770 9911 10942 gene locus_tag LOCUS_56780 9911 10942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56780 11157 14294 gene locus_tag LOCUS_56790 11157 14294 CDS product type I restriction endonuclease subunit R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257687.1 protein_id gnl|my_center|LOCUS_56790 15692 14718 gene locus_tag LOCUS_56800 15692 14718 CDS product N-acetylglucosamine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963507.1 protein_id gnl|my_center|LOCUS_56800 17068 15794 gene locus_tag LOCUS_56810 17068 15794 CDS product AmpG family muropeptide MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762567.1 protein_id gnl|my_center|LOCUS_56810 18358 17090 gene locus_tag LOCUS_56820 18358 17090 CDS product glutathionylspermidine synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005648054.1 protein_id gnl|my_center|LOCUS_56820 18676 18371 gene locus_tag LOCUS_56830 18676 18371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56830 18630 18854 gene locus_tag LOCUS_56840 18630 18854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56840 19223 18783 gene locus_tag LOCUS_56850 19223 18783 CDS product GxxExxY protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784536.1 protein_id gnl|my_center|LOCUS_56850 19286 22294 gene locus_tag LOCUS_56860 19286 22294 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057343.1 protein_id gnl|my_center|LOCUS_56860 22451 22894 gene locus_tag LOCUS_56870 22451 22894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56870 23978 22977 gene locus_tag LOCUS_56880 23978 22977 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475530.1 protein_id gnl|my_center|LOCUS_56880 25255 24125 gene locus_tag LOCUS_56890 25255 24125 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257553.1 protein_id gnl|my_center|LOCUS_56890 25475 26071 gene locus_tag LOCUS_56900 25475 26071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_56900 26096 27328 gene locus_tag LOCUS_56910 26096 27328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_56910 28112 29974 gene locus_tag LOCUS_56920 gene mrdA 28112 29974 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057025.1 protein_id gnl|my_center|LOCUS_56920 >Feature sequence103 312 638 gene locus_tag LOCUS_56930 312 638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56930 1040 3190 gene locus_tag LOCUS_56940 1040 3190 CDS product peptidase domain-containing ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890758.1 protein_id gnl|my_center|LOCUS_56940 3286 4680 gene locus_tag LOCUS_56950 3286 4680 CDS product HlyD family type I secretion periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073845.1 protein_id gnl|my_center|LOCUS_56950 6110 6787 gene locus_tag LOCUS_56960 6110 6787 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002937025.1 protein_id gnl|my_center|LOCUS_56960 6943 8829 gene locus_tag LOCUS_56970 6943 8829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56970 9426 9875 gene locus_tag LOCUS_56980 9426 9875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56980 12429 9982 gene locus_tag LOCUS_56990 12429 9982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56990 12954 13919 gene locus_tag LOCUS_57000 12954 13919 CDS product ribonuclease Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_224412629.1 protein_id gnl|my_center|LOCUS_57000 14911 17208 gene locus_tag LOCUS_57010 14911 17208 CDS product polysaccharide biosynthesis tyrosine autokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143774.1 protein_id gnl|my_center|LOCUS_57010 17959 17246 gene locus_tag LOCUS_57020 17959 17246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57020 19569 18121 gene locus_tag LOCUS_57030 19569 18121 CDS product HlyD family type I secretion periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268198.1 protein_id gnl|my_center|LOCUS_57030 20307 19759 gene locus_tag LOCUS_57040 20307 19759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57040 21536 20304 gene locus_tag LOCUS_57050 21536 20304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57050 21885 21520 gene locus_tag LOCUS_57060 21885 21520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57060 23349 22657 gene locus_tag LOCUS_57070 23349 22657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57070 24132 24659 gene locus_tag LOCUS_57080 24132 24659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57080 25364 25212 gene locus_tag LOCUS_57090 25364 25212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57090 25312 25707 gene locus_tag LOCUS_57100 25312 25707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57100 25849 27012 gene locus_tag LOCUS_57110 25849 27012 CDS product phosphoserine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388859.1 protein_id gnl|my_center|LOCUS_57110 27488 27033 gene locus_tag LOCUS_57120 27488 27033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57120 28661 29443 gene locus_tag LOCUS_57130 28661 29443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57130 >Feature sequence104 952 155 gene locus_tag LOCUS_57140 952 155 CDS product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057263.1 protein_id gnl|my_center|LOCUS_57140 1956 1039 gene locus_tag LOCUS_57150 1956 1039 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143217.1 protein_id gnl|my_center|LOCUS_57150 3151 2276 gene locus_tag LOCUS_57160 3151 2276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57160 3289 3840 gene locus_tag LOCUS_57170 3289 3840 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002219860.1 protein_id gnl|my_center|LOCUS_57170 4115 4654 gene locus_tag LOCUS_57180 4115 4654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57180 6294 4876 gene locus_tag LOCUS_57190 6294 4876 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099799191.1 protein_id gnl|my_center|LOCUS_57190 6390 6563 gene locus_tag LOCUS_57200 6390 6563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57200 6749 8284 gene locus_tag LOCUS_57210 gene nifK 6749 8284 CDS product nitrogenase molybdenum-iron protein subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084553.1 protein_id gnl|my_center|LOCUS_57210 8411 8734 gene locus_tag LOCUS_57220 8411 8734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57220 8858 10294 gene locus_tag LOCUS_57230 gene nifE 8858 10294 CDS product nitrogenase iron-molybdenum cofactor biosynthesis protein NifE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084554.1 protein_id gnl|my_center|LOCUS_57230 10294 11637 gene locus_tag LOCUS_57240 gene nifN 10294 11637 CDS product nitrogenase iron-molybdenum cofactor biosynthesis protein NifN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084555.1 protein_id gnl|my_center|LOCUS_57240 11763 12176 gene locus_tag LOCUS_57250 gene nifX 11763 12176 CDS product nitrogen fixation protein NifX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084556.1 protein_id gnl|my_center|LOCUS_57250 12173 12649 gene locus_tag LOCUS_57260 12173 12649 CDS product NifX-associated nitrogen fixation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084557.1 protein_id gnl|my_center|LOCUS_57260 12749 12970 gene locus_tag LOCUS_57270 12749 12970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57270 12967 13284 gene locus_tag LOCUS_57280 gene nifW 12967 13284 CDS product nitrogenase stabilizing/protective protein NifW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338296.1 protein_id gnl|my_center|LOCUS_57280 13295 14092 gene locus_tag LOCUS_57290 13295 14092 CDS product HesA/MoeB/ThiF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545472.1 protein_id gnl|my_center|LOCUS_57290 14102 14320 gene locus_tag LOCUS_57300 14102 14320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57300 14343 14714 gene locus_tag LOCUS_57310 14343 14714 CDS product iron-sulfur cluster assembly accessory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_214438544.1 protein_id gnl|my_center|LOCUS_57310 14811 15110 gene locus_tag LOCUS_57320 14811 15110 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125585.1 protein_id gnl|my_center|LOCUS_57320 15321 15599 gene locus_tag LOCUS_57330 15321 15599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57330 15596 16540 gene locus_tag LOCUS_57340 15596 16540 CDS product heme o synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920945.1 protein_id gnl|my_center|LOCUS_57340 17074 16865 gene locus_tag LOCUS_57350 17074 16865 CDS product molybdopterin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021259.1 protein_id gnl|my_center|LOCUS_57350 17404 18060 gene locus_tag LOCUS_57360 17404 18060 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946184.1 protein_id gnl|my_center|LOCUS_57360 18171 18527 gene locus_tag LOCUS_57370 18171 18527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57370 20066 20536 gene locus_tag LOCUS_57380 20066 20536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57380 20511 21797 gene locus_tag LOCUS_57390 20511 21797 CDS product SagB/ThcOx family dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056025.1 protein_id gnl|my_center|LOCUS_57390 21822 22193 gene locus_tag LOCUS_57400 21822 22193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57400 22162 22335 gene locus_tag LOCUS_57410 22162 22335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57410 22828 23190 gene locus_tag LOCUS_57420 22828 23190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57420 23439 23879 gene locus_tag LOCUS_57430 23439 23879 CDS product SufE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015159351.1 protein_id gnl|my_center|LOCUS_57430 24023 24931 gene locus_tag LOCUS_57440 24023 24931 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889319.1 protein_id gnl|my_center|LOCUS_57440 25940 24993 gene locus_tag LOCUS_57450 25940 24993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57450 26353 26625 gene locus_tag LOCUS_57460 26353 26625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57460 26965 27354 gene locus_tag LOCUS_57470 26965 27354 CDS product SCO5389 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973607.1 protein_id gnl|my_center|LOCUS_57470 27597 28595 gene locus_tag LOCUS_57480 27597 28595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57480 >Feature sequence105 1883 249 gene locus_tag LOCUS_57490 1883 249 CDS product B12-binding domain-containing radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142311.1 protein_id gnl|my_center|LOCUS_57490 3136 1913 gene locus_tag LOCUS_57500 gene hpnI 3136 1913 CDS product bacteriohopanetetrol glucosamine biosynthesis glycosyltransferase HpnI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941358.1 protein_id gnl|my_center|LOCUS_57500 3362 4990 gene locus_tag LOCUS_57510 3362 4990 CDS product cyclic peptide export ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057486.1 protein_id gnl|my_center|LOCUS_57510 5202 6155 gene locus_tag LOCUS_57520 5202 6155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57520 7839 6379 gene locus_tag LOCUS_57530 gene hpnJ 7839 6379 CDS product hopanoid biosynthesis associated radical SAM protein HpnJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196953.1 protein_id gnl|my_center|LOCUS_57530 9128 8307 gene locus_tag LOCUS_57540 9128 8307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57540 9375 9154 gene locus_tag LOCUS_57550 9375 9154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57550 10188 10478 gene locus_tag LOCUS_57560 10188 10478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57560 10779 11300 gene locus_tag LOCUS_57570 10779 11300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57570 11577 13910 gene locus_tag LOCUS_57580 11577 13910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57580 14348 14587 gene locus_tag LOCUS_57590 14348 14587 CDS product type II toxin-antitoxin system prevent-host-death family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140635.1 protein_id gnl|my_center|LOCUS_57590 14584 14991 gene locus_tag LOCUS_57600 14584 14991 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140634.1 protein_id gnl|my_center|LOCUS_57600 15286 16584 gene locus_tag LOCUS_57610 15286 16584 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011213222.1 protein_id gnl|my_center|LOCUS_57610 18615 17806 gene locus_tag LOCUS_57620 18615 17806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57620 18872 18582 gene locus_tag LOCUS_57630 18872 18582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57630 20172 19681 gene locus_tag LOCUS_57640 20172 19681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57640 22415 20262 gene locus_tag LOCUS_57650 22415 20262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57650 22813 22472 gene locus_tag LOCUS_57660 22813 22472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57660 23294 23737 gene locus_tag LOCUS_57670 23294 23737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57670 26028 23776 gene locus_tag LOCUS_57680 26028 23776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57680 29594 26232 gene locus_tag LOCUS_57690 29594 26232 CDS product PAS domain S-box protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022738.1 protein_id gnl|my_center|LOCUS_57690 >Feature sequence106 322 14 gene locus_tag LOCUS_57700 322 14 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57700 3687 367 gene locus_tag LOCUS_57710 3687 367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57710 4363 4181 gene locus_tag LOCUS_57720 4363 4181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57720 5642 4557 gene locus_tag LOCUS_57730 5642 4557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57730 6367 5720 gene locus_tag LOCUS_57740 6367 5720 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140938.1 protein_id gnl|my_center|LOCUS_57740 9315 6472 gene locus_tag LOCUS_57750 9315 6472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57750 9886 9569 gene locus_tag LOCUS_57760 9886 9569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57760 11054 10203 gene locus_tag LOCUS_57770 11054 10203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57770 12967 11312 gene locus_tag LOCUS_57780 12967 11312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57780 14758 13031 gene locus_tag LOCUS_57790 14758 13031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57790 17281 16019 gene locus_tag LOCUS_57800 gene metK 17281 16019 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056822.1 protein_id gnl|my_center|LOCUS_57800 18597 17596 gene locus_tag LOCUS_57810 18597 17596 CDS product phosphoribulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057751.1 protein_id gnl|my_center|LOCUS_57810 19256 19492 gene locus_tag LOCUS_57820 19256 19492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57820 19717 21012 gene locus_tag LOCUS_57830 19717 21012 CDS product phycobilisome linker polypeptide inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057053.1 protein_id gnl|my_center|LOCUS_57830 21179 22498 gene locus_tag LOCUS_57840 21179 22498 CDS product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921083.1 protein_id gnl|my_center|LOCUS_57840 22601 23623 gene locus_tag LOCUS_57850 22601 23623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57850 24275 23817 gene locus_tag LOCUS_57860 24275 23817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57860 25592 25137 gene locus_tag LOCUS_57870 25592 25137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57870 26875 26003 gene locus_tag LOCUS_57880 26875 26003 CDS product S-methyl-5'-thioadenosine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057121.1 protein_id gnl|my_center|LOCUS_57880 28440 26968 gene locus_tag LOCUS_57890 28440 26968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57890 29299 28874 gene locus_tag LOCUS_57900 29299 28874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57900 >Feature sequence107 3198 118 gene locus_tag LOCUS_57910 3198 118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57910 4628 3318 gene locus_tag LOCUS_57920 4628 3318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57920 8801 5049 gene locus_tag LOCUS_57930 8801 5049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57930 10440 11720 gene locus_tag LOCUS_57940 10440 11720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57940 13034 12006 gene locus_tag LOCUS_57950 gene obgE 13034 12006 CDS product GTPase ObgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058186.1 protein_id gnl|my_center|LOCUS_57950 13870 13178 gene locus_tag LOCUS_57960 13870 13178 CDS product Mo-dependent nitrogenase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920896.1 protein_id gnl|my_center|LOCUS_57960 14154 14591 gene locus_tag LOCUS_57970 14154 14591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57970 14632 15738 gene locus_tag LOCUS_57980 14632 15738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57980 16264 18327 gene locus_tag LOCUS_57990 gene ligA 16264 18327 CDS product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056701.1 protein_id gnl|my_center|LOCUS_57990 19081 18413 gene locus_tag LOCUS_58000 gene lipB 19081 18413 CDS product lipoyl(octanoyl) transferase LipB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056676.1 protein_id gnl|my_center|LOCUS_58000 19753 20409 gene locus_tag LOCUS_58010 gene raiA 19753 20409 CDS product ribosome-associated translation inhibitor RaiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056677.1 protein_id gnl|my_center|LOCUS_58010 20966 20508 gene locus_tag LOCUS_58020 20966 20508 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920697.1 protein_id gnl|my_center|LOCUS_58020 21132 22265 gene locus_tag LOCUS_58030 21132 22265 CDS product lpg1661 family Dot/Icm T4SS effector inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947388.1 protein_id gnl|my_center|LOCUS_58030 22820 22398 gene locus_tag LOCUS_58040 22820 22398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58040 24271 23222 gene locus_tag LOCUS_58050 24271 23222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58050 25704 24487 gene locus_tag LOCUS_58060 25704 24487 CDS product DUF4336 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125209.1 protein_id gnl|my_center|LOCUS_58060 27687 26161 gene locus_tag LOCUS_58070 gene bchB 27687 26161 CDS product ferredoxin:protochlorophyllide reductase (ATP-dependent) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058224.1 protein_id gnl|my_center|LOCUS_58070 28358 28077 gene locus_tag LOCUS_58080 28358 28077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58080 29201 28416 gene locus_tag LOCUS_58090 29201 28416 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021804.1 protein_id gnl|my_center|LOCUS_58090 >Feature sequence108 507 58 gene locus_tag LOCUS_58100 507 58 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58100 1172 4321 gene locus_tag LOCUS_58110 1172 4321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58110 4601 5116 gene locus_tag LOCUS_58120 4601 5116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58120 5136 6071 gene locus_tag LOCUS_58130 5136 6071 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124123.1 protein_id gnl|my_center|LOCUS_58130 6238 7050 gene locus_tag LOCUS_58140 6238 7050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58140 8245 7193 gene locus_tag LOCUS_58150 8245 7193 CDS product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000102638.1 protein_id gnl|my_center|LOCUS_58150 9197 8235 gene locus_tag LOCUS_58160 9197 8235 CDS product diguanylate cyclase regulator RdcB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000203516.1 protein_id gnl|my_center|LOCUS_58160 10356 9199 gene locus_tag LOCUS_58170 10356 9199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58170 11391 10519 gene locus_tag LOCUS_58180 11391 10519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58180 11663 11490 gene locus_tag LOCUS_58190 11663 11490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58190 12759 12334 gene locus_tag LOCUS_58200 12759 12334 CDS product PIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141572.1 protein_id gnl|my_center|LOCUS_58200 13022 12756 gene locus_tag LOCUS_58210 13022 12756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141573.1 protein_id gnl|my_center|LOCUS_58210 13477 13136 gene locus_tag LOCUS_58220 13477 13136 CDS product HigA family addiction module antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015575.1 protein_id gnl|my_center|LOCUS_58220 13650 13504 gene locus_tag LOCUS_58230 13650 13504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58230 15987 14620 gene locus_tag LOCUS_58240 15987 14620 CDS product GH1 family beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084183.1 protein_id gnl|my_center|LOCUS_58240 16130 16336 gene locus_tag LOCUS_58250 16130 16336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58250 17122 18414 gene locus_tag LOCUS_58260 17122 18414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58260 18722 20929 gene locus_tag LOCUS_58270 18722 20929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58270 21852 21376 gene locus_tag LOCUS_58280 21852 21376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58280 22169 21870 gene locus_tag LOCUS_58290 22169 21870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58290 22926 22348 gene locus_tag LOCUS_58300 22926 22348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58300 24386 23331 gene locus_tag LOCUS_58310 24386 23331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58310 24880 27396 gene locus_tag LOCUS_58320 24880 27396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58320 27673 28608 gene locus_tag LOCUS_58330 27673 28608 CDS product ATP adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125113.1 protein_id gnl|my_center|LOCUS_58330 28826 28644 gene locus_tag LOCUS_58340 28826 28644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58340 >Feature sequence109 199 612 gene locus_tag LOCUS_58350 199 612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58350 1603 617 gene locus_tag LOCUS_58360 1603 617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58360 3833 2961 gene locus_tag LOCUS_58370 3833 2961 CDS product 6-carboxytetrahydropterin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056938.1 protein_id gnl|my_center|LOCUS_58370 4666 3965 gene locus_tag LOCUS_58380 4666 3965 CDS product J domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056725.1 protein_id gnl|my_center|LOCUS_58380 5644 4682 gene locus_tag LOCUS_58390 gene cysK 5644 4682 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056355.1 protein_id gnl|my_center|LOCUS_58390 6182 5745 gene locus_tag LOCUS_58400 6182 5745 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056354.1 protein_id gnl|my_center|LOCUS_58400 8285 6456 gene locus_tag LOCUS_58410 8285 6456 CDS product iron uptake porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058157.1 protein_id gnl|my_center|LOCUS_58410 8977 8696 gene locus_tag LOCUS_58420 8977 8696 CDS product 4a-hydroxytetrahydrobiopterin dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057662.1 protein_id gnl|my_center|LOCUS_58420 11376 10570 gene locus_tag LOCUS_58430 gene psbD 11376 10570 CDS product photosystem II D2 protein (photosystem q(a) protein) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056308.1 protein_id gnl|my_center|LOCUS_58430 12011 12283 gene locus_tag LOCUS_58440 12011 12283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056647.1 protein_id gnl|my_center|LOCUS_58440 12302 12994 gene locus_tag LOCUS_58450 12302 12994 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920717.1 protein_id gnl|my_center|LOCUS_58450 13260 13811 gene locus_tag LOCUS_58460 13260 13811 CDS product NYN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142986.1 protein_id gnl|my_center|LOCUS_58460 14025 14098 gene locus_tag LOCUS_t00390 14025 14098 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 15773 14232 gene locus_tag LOCUS_58470 gene glpK 15773 14232 CDS product glycerol kinase GlpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141749.1 protein_id gnl|my_center|LOCUS_58470 15918 16502 gene locus_tag LOCUS_58480 15918 16502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58480 16984 16610 gene locus_tag LOCUS_58490 16984 16610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58490 17807 17983 gene locus_tag LOCUS_58500 17807 17983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58500 18022 18858 gene locus_tag LOCUS_58510 18022 18858 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768991.1 protein_id gnl|my_center|LOCUS_58510 19004 19630 gene locus_tag LOCUS_58520 19004 19630 CDS product MOSC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141283.1 protein_id gnl|my_center|LOCUS_58520 19735 20226 gene locus_tag LOCUS_58530 19735 20226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58530 20357 21226 gene locus_tag LOCUS_58540 20357 21226 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122363.1 protein_id gnl|my_center|LOCUS_58540 21657 22358 gene locus_tag LOCUS_58550 21657 22358 CDS product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143729.1 protein_id gnl|my_center|LOCUS_58550 22483 23871 gene locus_tag LOCUS_58560 22483 23871 CDS product mercuric reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946005.1 protein_id gnl|my_center|LOCUS_58560 24286 25035 gene locus_tag LOCUS_58570 24286 25035 CDS product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245309.1 protein_id gnl|my_center|LOCUS_58570 25394 25630 gene locus_tag LOCUS_58580 25394 25630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_58580 26076 26501 gene locus_tag LOCUS_58590 26076 26501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58590 28038 26677 gene locus_tag LOCUS_58600 28038 26677 CDS product TrpB-like pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257295.1 protein_id gnl|my_center|LOCUS_58600 >Feature sequence110 1696 248 gene locus_tag LOCUS_58610 1696 248 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584110.1 protein_id gnl|my_center|LOCUS_58610 3272 2787 gene locus_tag LOCUS_58620 3272 2787 CDS product DUF4174 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118826413.1 protein_id gnl|my_center|LOCUS_58620 3484 4704 gene locus_tag LOCUS_58630 3484 4704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58630 5606 5061 gene locus_tag LOCUS_58640 5606 5061 CDS product pentapeptide repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920767.1 protein_id gnl|my_center|LOCUS_58640 5591 6085 gene locus_tag LOCUS_58650 5591 6085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58650 6757 6368 gene locus_tag LOCUS_58660 6757 6368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056454.1 protein_id gnl|my_center|LOCUS_58660 6998 8182 gene locus_tag LOCUS_58670 gene queA 6998 8182 CDS product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056766.1 protein_id gnl|my_center|LOCUS_58670 8924 8229 gene locus_tag LOCUS_58680 8924 8229 CDS product TrkA family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056267.1 protein_id gnl|my_center|LOCUS_58680 10385 9090 gene locus_tag LOCUS_58690 10385 9090 CDS product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099799062.1 protein_id gnl|my_center|LOCUS_58690 10575 11417 gene locus_tag LOCUS_58700 10575 11417 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143083.1 protein_id gnl|my_center|LOCUS_58700 11459 12424 gene locus_tag LOCUS_58710 11459 12424 CDS product homogentisate phytyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140287.1 protein_id gnl|my_center|LOCUS_58710 13064 12714 gene locus_tag LOCUS_58720 13064 12714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58720 13465 13055 gene locus_tag LOCUS_58730 13465 13055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58730 13817 14284 gene locus_tag LOCUS_58740 13817 14284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58740 14288 15913 gene locus_tag LOCUS_58750 gene cobA 14288 15913 CDS product uroporphyrinogen-III C-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920993.1 protein_id gnl|my_center|LOCUS_58750 16111 17766 gene locus_tag LOCUS_58760 16111 17766 CDS product alpha-keto acid decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003297558.1 protein_id gnl|my_center|LOCUS_58760 18906 17959 gene locus_tag LOCUS_58770 18906 17959 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000808254.1 protein_id gnl|my_center|LOCUS_58770 19739 19930 gene locus_tag LOCUS_58780 19739 19930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58780 20116 20718 gene locus_tag LOCUS_58790 gene coaE 20116 20718 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056742.1 protein_id gnl|my_center|LOCUS_58790 22263 20914 gene locus_tag LOCUS_58800 22263 20914 CDS product ATP-grasp domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001093155.1 protein_id gnl|my_center|LOCUS_58800 23777 22578 gene locus_tag LOCUS_58810 23777 22578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58810 >Feature sequence111 1188 259 gene locus_tag LOCUS_58820 1188 259 CDS product methylenetetrahydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_126986764.1 protein_id gnl|my_center|LOCUS_58820 2260 1250 gene locus_tag LOCUS_58830 gene trpS 2260 1250 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057831.1 protein_id gnl|my_center|LOCUS_58830 2638 4221 gene locus_tag LOCUS_58840 2638 4221 CDS product B12-binding domain-containing radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193934126.1 protein_id gnl|my_center|LOCUS_58840 4449 4303 gene locus_tag LOCUS_58850 4449 4303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58850 4597 5325 gene locus_tag LOCUS_58860 4597 5325 CDS product DUF429 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057978.1 protein_id gnl|my_center|LOCUS_58860 7930 5369 gene locus_tag LOCUS_58870 7930 5369 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941039.1 protein_id gnl|my_center|LOCUS_58870 9130 8597 gene locus_tag LOCUS_58880 9130 8597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58880 9455 9799 gene locus_tag LOCUS_58890 9455 9799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58890 11916 10060 gene locus_tag LOCUS_58900 11916 10060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58900 12929 12516 gene locus_tag LOCUS_58910 gene tnpA 12929 12516 CDS product IS200/IS605 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103036865.1 protein_id gnl|my_center|LOCUS_58910 12996 14384 gene locus_tag LOCUS_58920 12996 14384 CDS product RNA-guided endonuclease TnpB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897221.1 protein_id gnl|my_center|LOCUS_58920 14401 14733 gene locus_tag LOCUS_58930 gene crcB 14401 14733 CDS product fluoride efflux transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258331.1 protein_id gnl|my_center|LOCUS_58930 15628 15080 gene locus_tag LOCUS_58940 15628 15080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58940 17428 15806 gene locus_tag LOCUS_58950 gene murJ 17428 15806 CDS product murein biosynthesis integral membrane protein MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058183.1 protein_id gnl|my_center|LOCUS_58950 17709 18011 gene locus_tag LOCUS_58960 17709 18011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58960 19849 18395 gene locus_tag LOCUS_58970 19849 18395 CDS product LCP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057595.1 protein_id gnl|my_center|LOCUS_58970 20220 21272 gene locus_tag LOCUS_58980 20220 21272 CDS product mannose-1-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479721.1 protein_id gnl|my_center|LOCUS_58980 21704 23350 gene locus_tag LOCUS_58990 21704 23350 CDS product AarF/ABC1/UbiB kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141468.1 protein_id gnl|my_center|LOCUS_58990 26901 23680 gene locus_tag LOCUS_59000 26901 23680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59000 >Feature sequence112 960 409 gene locus_tag LOCUS_59010 960 409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59010 1952 1104 gene locus_tag LOCUS_59020 1952 1104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59020 3500 2355 gene locus_tag LOCUS_59030 3500 2355 CDS product HhoA/HhoB/HtrA family serine endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058268.1 protein_id gnl|my_center|LOCUS_59030 3878 4276 gene locus_tag LOCUS_59040 3878 4276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59040 4442 5260 gene locus_tag LOCUS_59050 gene menH 4442 5260 CDS product 2-succinyl-6-hydroxy-2,4-cyclohexadiene-1-carboxylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933504.1 protein_id gnl|my_center|LOCUS_59050 5317 5841 gene locus_tag LOCUS_59060 5317 5841 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948046.1 protein_id gnl|my_center|LOCUS_59060 6919 6404 gene locus_tag LOCUS_59070 6919 6404 CDS product glycoside hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056871.1 protein_id gnl|my_center|LOCUS_59070 7880 7221 gene locus_tag LOCUS_59080 7880 7221 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920805.1 protein_id gnl|my_center|LOCUS_59080 8181 8864 gene locus_tag LOCUS_59090 8181 8864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59090 9403 8933 gene locus_tag LOCUS_59100 9403 8933 CDS product DUF4079 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057333.1 protein_id gnl|my_center|LOCUS_59100 9552 10832 gene locus_tag LOCUS_59110 9552 10832 CDS product ankyrin repeat domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016207.1 protein_id gnl|my_center|LOCUS_59110 12111 10948 gene locus_tag LOCUS_59120 12111 10948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59120 12226 12447 gene locus_tag LOCUS_59130 12226 12447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59130 12488 12952 gene locus_tag LOCUS_59140 12488 12952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59140 13243 13395 gene locus_tag LOCUS_59150 13243 13395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59150 14593 15174 gene locus_tag LOCUS_59160 14593 15174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59160 16905 15622 gene locus_tag LOCUS_59170 16905 15622 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142579.1 protein_id gnl|my_center|LOCUS_59170 18328 17075 gene locus_tag LOCUS_59180 18328 17075 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142580.1 protein_id gnl|my_center|LOCUS_59180 20004 18847 gene locus_tag LOCUS_59190 20004 18847 CDS product 5-(carboxyamino)imidazole ribonucleotide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057098.1 protein_id gnl|my_center|LOCUS_59190 20471 20319 gene locus_tag LOCUS_59200 20471 20319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59200 21546 20515 gene locus_tag LOCUS_59210 21546 20515 CDS product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000377275.1 protein_id gnl|my_center|LOCUS_59210 22018 22200 gene locus_tag LOCUS_59220 22018 22200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59220 22471 22812 gene locus_tag LOCUS_59230 22471 22812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056366.1 protein_id gnl|my_center|LOCUS_59230 24610 22835 gene locus_tag LOCUS_59240 24610 22835 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920921.1 protein_id gnl|my_center|LOCUS_59240 25639 26520 gene locus_tag LOCUS_59250 25639 26520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59250 26716 27105 gene locus_tag LOCUS_59260 26716 27105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59260 >Feature sequence113 411 635 gene locus_tag LOCUS_59270 411 635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59270 2097 709 gene locus_tag LOCUS_59280 gene argH 2097 709 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056221.1 protein_id gnl|my_center|LOCUS_59280 2807 2148 gene locus_tag LOCUS_59290 2807 2148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59290 3365 4261 gene locus_tag LOCUS_59300 3365 4261 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143217.1 protein_id gnl|my_center|LOCUS_59300 4476 5354 gene locus_tag LOCUS_59310 4476 5354 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020468.1 protein_id gnl|my_center|LOCUS_59310 6172 5399 gene locus_tag LOCUS_59320 gene larB 6172 5399 CDS product nickel pincer cofactor biosynthesis protein LarB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057031.1 protein_id gnl|my_center|LOCUS_59320 8064 6250 gene locus_tag LOCUS_59330 8064 6250 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056653.1 protein_id gnl|my_center|LOCUS_59330 9954 8161 gene locus_tag LOCUS_59340 9954 8161 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056653.1 protein_id gnl|my_center|LOCUS_59340 10328 10080 gene locus_tag LOCUS_59350 10328 10080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59350 10685 10512 gene locus_tag LOCUS_59360 10685 10512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59360 11159 10686 gene locus_tag LOCUS_59370 11159 10686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59370 11811 11332 gene locus_tag LOCUS_59380 gene ispF 11811 11332 CDS product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_168569903.1 protein_id gnl|my_center|LOCUS_59380 12560 11898 gene locus_tag LOCUS_59390 gene trmD 12560 11898 CDS product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057450.1 protein_id gnl|my_center|LOCUS_59390 13311 14174 gene locus_tag LOCUS_59400 13311 14174 CDS product cyanophycinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058003.1 protein_id gnl|my_center|LOCUS_59400 14420 17050 gene locus_tag LOCUS_59410 gene cphA 14420 17050 CDS product cyanophycin synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058004.1 protein_id gnl|my_center|LOCUS_59410 17276 17103 gene locus_tag LOCUS_59420 17276 17103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59420 17588 18280 gene locus_tag LOCUS_59430 17588 18280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59430 19770 18589 gene locus_tag LOCUS_59440 19770 18589 CDS product hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104155.1 protein_id gnl|my_center|LOCUS_59440 20296 19889 gene locus_tag LOCUS_59450 20296 19889 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021290.1 protein_id gnl|my_center|LOCUS_59450 22666 20411 gene locus_tag LOCUS_59460 22666 20411 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971984.1 protein_id gnl|my_center|LOCUS_59460 24455 22923 gene locus_tag LOCUS_59470 24455 22923 CDS product serine/threonine-protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056941.1 protein_id gnl|my_center|LOCUS_59470 24645 24403 gene locus_tag LOCUS_59480 24645 24403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59480 24680 25297 gene locus_tag LOCUS_59490 gene cbiT 24680 25297 CDS product precorrin-6Y C5,15-methyltransferase subunit CbiT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057353.1 protein_id gnl|my_center|LOCUS_59490 25412 26299 gene locus_tag LOCUS_59500 25412 26299 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057942.1 protein_id gnl|my_center|LOCUS_59500 >Feature sequence114 455 958 gene locus_tag LOCUS_59510 455 958 CDS product YbjN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099797565.1 protein_id gnl|my_center|LOCUS_59510 955 1686 gene locus_tag LOCUS_59520 955 1686 CDS product lipoate--protein ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099797618.1 protein_id gnl|my_center|LOCUS_59520 1781 2443 gene locus_tag LOCUS_59530 1781 2443 CDS product Type 1 glutamine amidotransferase-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245002.1 protein_id gnl|my_center|LOCUS_59530 3072 2464 gene locus_tag LOCUS_59540 3072 2464 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026183791.1 protein_id gnl|my_center|LOCUS_59540 4175 3177 gene locus_tag LOCUS_59550 4175 3177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59550 5765 4566 gene locus_tag LOCUS_59560 5765 4566 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920848.1 protein_id gnl|my_center|LOCUS_59560 6813 6535 gene locus_tag LOCUS_59570 6813 6535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59570 7142 7375 gene locus_tag LOCUS_59580 7142 7375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59580 7501 8133 gene locus_tag LOCUS_59590 7501 8133 CDS product phosphoribosylanthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058105.1 protein_id gnl|my_center|LOCUS_59590 8999 8253 gene locus_tag LOCUS_59600 gene folE 8999 8253 CDS product GTP cyclohydrolase I FolE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015079151.1 protein_id gnl|my_center|LOCUS_59600 9796 9074 gene locus_tag LOCUS_59610 9796 9074 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057150.1 protein_id gnl|my_center|LOCUS_59610 11197 10214 gene locus_tag LOCUS_59620 11197 10214 CDS product acetyl-CoA carboxylase carboxyltransferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057151.1 protein_id gnl|my_center|LOCUS_59620 12316 11297 gene locus_tag LOCUS_59630 12316 11297 CDS product long-chain acyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057152.1 protein_id gnl|my_center|LOCUS_59630 13183 12488 gene locus_tag LOCUS_59640 13183 12488 CDS product aldehyde oxygenase (deformylating) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057153.1 protein_id gnl|my_center|LOCUS_59640 13362 14225 gene locus_tag LOCUS_59650 13362 14225 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_198405945.1 protein_id gnl|my_center|LOCUS_59650 15526 14501 gene locus_tag LOCUS_59660 15526 14501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056254.1 protein_id gnl|my_center|LOCUS_59660 16008 15736 gene locus_tag LOCUS_59670 16008 15736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59670 16161 17150 gene locus_tag LOCUS_59680 gene moaA 16161 17150 CDS product GTP 3',8-cyclase MoaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143017.1 protein_id gnl|my_center|LOCUS_59680 17798 17190 gene locus_tag LOCUS_59690 gene rpsD 17798 17190 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056002.1 protein_id gnl|my_center|LOCUS_59690 18128 18910 gene locus_tag LOCUS_59700 18128 18910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59700 19883 18984 gene locus_tag LOCUS_59710 19883 18984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59710 23418 21478 gene locus_tag LOCUS_59720 23418 21478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59720 25284 23794 gene locus_tag LOCUS_59730 25284 23794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59730 25374 25781 gene locus_tag LOCUS_59740 gene tnpA 25374 25781 CDS product IS200/IS605 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103036865.1 protein_id gnl|my_center|LOCUS_59740 >Feature sequence115 1491 3302 gene locus_tag LOCUS_59750 1491 3302 CDS product reverse transcriptase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272172.1 protein_id gnl|my_center|LOCUS_59750 3247 3474 gene locus_tag LOCUS_59760 3247 3474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59760 3516 4805 gene locus_tag LOCUS_59770 3516 4805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59770 5508 8576 gene locus_tag LOCUS_59780 5508 8576 CDS product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140279.1 protein_id gnl|my_center|LOCUS_59780 8994 10004 gene locus_tag LOCUS_59790 8994 10004 CDS product iron ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385771.1 protein_id gnl|my_center|LOCUS_59790 10124 11773 gene locus_tag LOCUS_59800 10124 11773 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902650.1 protein_id gnl|my_center|LOCUS_59800 11814 12881 gene locus_tag LOCUS_59810 11814 12881 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099799101.1 protein_id gnl|my_center|LOCUS_59810 12942 13682 gene locus_tag LOCUS_59820 12942 13682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59820 15260 13827 gene locus_tag LOCUS_59830 15260 13827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59830 17869 15302 gene locus_tag LOCUS_59840 17869 15302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59840 19354 17969 gene locus_tag LOCUS_59850 19354 17969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59850 19648 20211 gene locus_tag LOCUS_59860 19648 20211 CDS product CAP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142359.1 protein_id gnl|my_center|LOCUS_59860 20791 20228 gene locus_tag LOCUS_59870 gene wcaF 20791 20228 CDS product colanic acid biosynthesis acetyltransferase WcaF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001153597.1 protein_id gnl|my_center|LOCUS_59870 21807 20860 gene locus_tag LOCUS_59880 21807 20860 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001239224.1 protein_id gnl|my_center|LOCUS_59880 22755 21823 gene locus_tag LOCUS_59890 22755 21823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59890 23913 23137 gene locus_tag LOCUS_59900 23913 23137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59900 24241 24789 gene locus_tag LOCUS_59910 gene cobU 24241 24789 CDS product bifunctional adenosylcobinamide kinase/adenosylcobinamide-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056947.1 protein_id gnl|my_center|LOCUS_59910 24992 25447 gene locus_tag LOCUS_59920 24992 25447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099797542.1 protein_id gnl|my_center|LOCUS_59920 >Feature sequence116 465 13 gene locus_tag LOCUS_59930 465 13 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59930 1509 1006 gene locus_tag LOCUS_59940 1509 1006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59940 3111 1597 gene locus_tag LOCUS_59950 3111 1597 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055931.1 protein_id gnl|my_center|LOCUS_59950 3757 3179 gene locus_tag LOCUS_59960 3757 3179 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142965.1 protein_id gnl|my_center|LOCUS_59960 5030 3978 gene locus_tag LOCUS_59970 5030 3978 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004538885.1 protein_id gnl|my_center|LOCUS_59970 5196 5840 gene locus_tag LOCUS_59980 5196 5840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59980 5944 6564 gene locus_tag LOCUS_59990 5944 6564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59990 7932 7423 gene locus_tag LOCUS_60000 7932 7423 CDS product DUF177 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142230.1 protein_id gnl|my_center|LOCUS_60000 8737 8204 gene locus_tag LOCUS_60010 8737 8204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142229.1 protein_id gnl|my_center|LOCUS_60010 9882 8737 gene locus_tag LOCUS_60020 gene yidC 9882 8737 CDS product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056448.1 protein_id gnl|my_center|LOCUS_60020 10499 10110 gene locus_tag LOCUS_60030 10499 10110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_60030 10905 10486 gene locus_tag LOCUS_60040 10905 10486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_60040 11709 11197 gene locus_tag LOCUS_60050 11709 11197 CDS product DUF2808 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056648.1 protein_id gnl|my_center|LOCUS_60050 12430 13593 gene locus_tag LOCUS_60060 12430 13593 CDS product Re/Si-specific NAD(P)(+) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056541.1 protein_id gnl|my_center|LOCUS_60060 13665 13958 gene locus_tag LOCUS_60070 13665 13958 CDS product NAD(P) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920741.1 protein_id gnl|my_center|LOCUS_60070 13955 15358 gene locus_tag LOCUS_60080 13955 15358 CDS product NAD(P)(+) transhydrogenase (Re/Si-specific) subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056543.1 protein_id gnl|my_center|LOCUS_60080 16747 15494 gene locus_tag LOCUS_60090 16747 15494 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461315.1 protein_id gnl|my_center|LOCUS_60090 18033 17812 gene locus_tag LOCUS_60100 18033 17812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60100 18240 18677 gene locus_tag LOCUS_60110 18240 18677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60110 18787 20184 gene locus_tag LOCUS_60120 18787 20184 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143057.1 protein_id gnl|my_center|LOCUS_60120 20196 20534 gene locus_tag LOCUS_60130 20196 20534 CDS product carbon dioxide-concentrating mechanism protein CcmK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142093.1 protein_id gnl|my_center|LOCUS_60130 20689 21861 gene locus_tag LOCUS_60140 20689 21861 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937699.1 protein_id gnl|my_center|LOCUS_60140 21972 22412 gene locus_tag LOCUS_60150 21972 22412 CDS product secondary thiamine-phosphate synthase enzyme YjbQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125638.1 protein_id gnl|my_center|LOCUS_60150 23019 24248 gene locus_tag LOCUS_60160 23019 24248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60160 24353 25291 gene locus_tag LOCUS_60170 24353 25291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60170 >Feature sequence117 312 109 gene locus_tag LOCUS_60180 312 109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60180 511 1089 gene locus_tag LOCUS_60190 511 1089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60190 1130 1315 gene locus_tag LOCUS_60200 1130 1315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60200 2603 1578 gene locus_tag LOCUS_60210 2603 1578 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057039.1 protein_id gnl|my_center|LOCUS_60210 4293 2722 gene locus_tag LOCUS_60220 4293 2722 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_036534662.1 protein_id gnl|my_center|LOCUS_60220 4837 5169 gene locus_tag LOCUS_60230 4837 5169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055877.1 protein_id gnl|my_center|LOCUS_60230 5514 7043 gene locus_tag LOCUS_60240 gene psbB 5514 7043 CDS product photosystem II chlorophyll-binding protein CP47 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057370.1 protein_id gnl|my_center|LOCUS_60240 7621 8844 gene locus_tag LOCUS_60250 7621 8844 CDS product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057881.1 protein_id gnl|my_center|LOCUS_60250 9857 9252 gene locus_tag LOCUS_60260 9857 9252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60260 10299 10523 gene locus_tag LOCUS_60270 10299 10523 CDS product ferredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057929.1 protein_id gnl|my_center|LOCUS_60270 10691 11437 gene locus_tag LOCUS_60280 10691 11437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60280 11771 12514 gene locus_tag LOCUS_60290 11771 12514 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055908.1 protein_id gnl|my_center|LOCUS_60290 12828 13604 gene locus_tag LOCUS_60300 12828 13604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60300 14593 13787 gene locus_tag LOCUS_60310 gene egtC 14593 13787 CDS product ergothioneine biosynthesis protein EgtC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144315.1 protein_id gnl|my_center|LOCUS_60310 14845 15309 gene locus_tag LOCUS_60320 14845 15309 CDS product M67 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143403.1 protein_id gnl|my_center|LOCUS_60320 15389 16561 gene locus_tag LOCUS_60330 gene moeB 15389 16561 CDS product molybdopterin-synthase adenylyltransferase MoeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058235.1 protein_id gnl|my_center|LOCUS_60330 16990 17427 gene locus_tag LOCUS_60340 16990 17427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60340 17582 18685 gene locus_tag LOCUS_60350 gene ada 17582 18685 CDS product bifunctional DNA-binding transcriptional regulator/O6-methylguanine-DNA methyltransferase Ada inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_089725526.1 protein_id gnl|my_center|LOCUS_60350 19292 18756 gene locus_tag LOCUS_60360 19292 18756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60360 19893 19384 gene locus_tag LOCUS_60370 gene yetL 19893 19384 CDS product transcriptional regulator YetL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233796.1 protein_id gnl|my_center|LOCUS_60370 19965 20630 gene locus_tag LOCUS_60380 19965 20630 CDS product DNA-3-methyladenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000653302.1 protein_id gnl|my_center|LOCUS_60380 21565 23436 gene locus_tag LOCUS_60390 21565 23436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60390 25026 24220 gene locus_tag LOCUS_60400 25026 24220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60400 >Feature sequence118 812 150 gene locus_tag LOCUS_60410 812 150 CDS product DUF2232 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057242.1 protein_id gnl|my_center|LOCUS_60410 1620 922 gene locus_tag LOCUS_60420 1620 922 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_126987297.1 protein_id gnl|my_center|LOCUS_60420 2451 6962 gene locus_tag LOCUS_60430 2451 6962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60430 7917 7255 gene locus_tag LOCUS_60440 7917 7255 CDS product heme oxygenase (biliverdin-producing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920678.1 protein_id gnl|my_center|LOCUS_60440 8500 9972 gene locus_tag LOCUS_60450 gene glmM 8500 9972 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013191710.1 protein_id gnl|my_center|LOCUS_60450 10919 11398 gene locus_tag LOCUS_60460 10919 11398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60460 11648 13357 gene locus_tag LOCUS_60470 11648 13357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60470 13364 14362 gene locus_tag LOCUS_60480 13364 14362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60480 14459 15634 gene locus_tag LOCUS_60490 14459 15634 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256879.1 protein_id gnl|my_center|LOCUS_60490 15921 17114 gene locus_tag LOCUS_60500 15921 17114 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162850918.1 protein_id gnl|my_center|LOCUS_60500 17249 17887 gene locus_tag LOCUS_60510 17249 17887 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142152.1 protein_id gnl|my_center|LOCUS_60510 18006 18590 gene locus_tag LOCUS_60520 18006 18590 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008274486.1 protein_id gnl|my_center|LOCUS_60520 18964 18599 gene locus_tag LOCUS_60530 18964 18599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60530 19040 23242 gene locus_tag LOCUS_60540 19040 23242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60540 23546 23298 gene locus_tag LOCUS_60550 23546 23298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60550 23864 24079 gene locus_tag LOCUS_60560 23864 24079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60560 24076 24504 gene locus_tag LOCUS_60570 24076 24504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60570 >Feature sequence119 1202 288 gene locus_tag LOCUS_60580 1202 288 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143466.1 protein_id gnl|my_center|LOCUS_60580 1589 1296 gene locus_tag LOCUS_60590 1589 1296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60590 3377 1707 gene locus_tag LOCUS_60600 3377 1707 CDS product DUF3352 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057437.1 protein_id gnl|my_center|LOCUS_60600 3841 6504 gene locus_tag LOCUS_60610 3841 6504 CDS product M1 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057830.1 protein_id gnl|my_center|LOCUS_60610 7092 8312 gene locus_tag LOCUS_60620 7092 8312 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142192.1 protein_id gnl|my_center|LOCUS_60620 8528 9718 gene locus_tag LOCUS_60630 8528 9718 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142191.1 protein_id gnl|my_center|LOCUS_60630 9796 11982 gene locus_tag LOCUS_60640 9796 11982 CDS product polysaccharide biosynthesis tyrosine autokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142199.1 protein_id gnl|my_center|LOCUS_60640 11985 13451 gene locus_tag LOCUS_60650 11985 13451 CDS product O-antigen ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142196.1 protein_id gnl|my_center|LOCUS_60650 13481 14542 gene locus_tag LOCUS_60660 13481 14542 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142183.1 protein_id gnl|my_center|LOCUS_60660 14593 15810 gene locus_tag LOCUS_60670 14593 15810 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141789.1 protein_id gnl|my_center|LOCUS_60670 15827 16810 gene locus_tag LOCUS_60680 15827 16810 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142186.1 protein_id gnl|my_center|LOCUS_60680 16979 17938 gene locus_tag LOCUS_60690 16979 17938 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142186.1 protein_id gnl|my_center|LOCUS_60690 18049 19434 gene locus_tag LOCUS_60700 18049 19434 CDS product oligosaccharide flippase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730933.1 protein_id gnl|my_center|LOCUS_60700 19466 19750 gene locus_tag LOCUS_60710 19466 19750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60710 20674 19832 gene locus_tag LOCUS_60720 20674 19832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60720 22067 20667 gene locus_tag LOCUS_60730 22067 20667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60730 22683 22429 gene locus_tag LOCUS_60740 22683 22429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60740 22796 23899 gene locus_tag LOCUS_60750 22796 23899 CDS product ImmA/IrrE family metallo-endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003410103.1 protein_id gnl|my_center|LOCUS_60750 23886 24401 gene locus_tag LOCUS_60760 23886 24401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60760 >Feature sequence120 223 1308 gene locus_tag LOCUS_60770 223 1308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60770 1751 2143 gene locus_tag LOCUS_60780 1751 2143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60780 2143 3429 gene locus_tag LOCUS_60790 2143 3429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60790 3608 4543 gene locus_tag LOCUS_60800 3608 4543 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057378.1 protein_id gnl|my_center|LOCUS_60800 5048 4794 gene locus_tag LOCUS_60810 5048 4794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60810 4985 5257 gene locus_tag LOCUS_60820 4985 5257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60820 5901 6419 gene locus_tag LOCUS_60830 5901 6419 CDS product phycocyanin subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057792.1 protein_id gnl|my_center|LOCUS_60830 6497 6985 gene locus_tag LOCUS_60840 gene cpcA 6497 6985 CDS product phycocyanin subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057793.1 protein_id gnl|my_center|LOCUS_60840 7146 8006 gene locus_tag LOCUS_60850 7146 8006 CDS product phycobilisome linker polypeptide inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057794.1 protein_id gnl|my_center|LOCUS_60850 8397 8672 gene locus_tag LOCUS_60860 8397 8672 CDS product phycobilisome linker polypeptide inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057795.1 protein_id gnl|my_center|LOCUS_60860 8684 9514 gene locus_tag LOCUS_60870 8684 9514 CDS product HEAT repeat domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009454959.1 protein_id gnl|my_center|LOCUS_60870 9588 10193 gene locus_tag LOCUS_60880 9588 10193 CDS product HEAT repeat domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057797.1 protein_id gnl|my_center|LOCUS_60880 10255 11094 gene locus_tag LOCUS_60890 10255 11094 CDS product phycobilisome rod-core linker polypeptide inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057798.1 protein_id gnl|my_center|LOCUS_60890 11152 11931 gene locus_tag LOCUS_60900 11152 11931 CDS product phycobilisome rod-core linker polypeptide inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057799.1 protein_id gnl|my_center|LOCUS_60900 12118 12885 gene locus_tag LOCUS_60910 12118 12885 CDS product phycobilisome rod-core linker polypeptide inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057800.1 protein_id gnl|my_center|LOCUS_60910 14768 13215 gene locus_tag LOCUS_60920 14768 13215 CDS product iron uptake porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058157.1 protein_id gnl|my_center|LOCUS_60920 14923 15075 gene locus_tag LOCUS_60930 14923 15075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60930 16345 17301 gene locus_tag LOCUS_60940 16345 17301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60940 17603 19057 gene locus_tag LOCUS_60950 17603 19057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60950 19260 20402 gene locus_tag LOCUS_60960 19260 20402 CDS product LdpA C-terminal domain-containing domain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056586.1 protein_id gnl|my_center|LOCUS_60960 20515 22257 gene locus_tag LOCUS_60970 20515 22257 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056587.1 protein_id gnl|my_center|LOCUS_60970 22747 22376 gene locus_tag LOCUS_60980 22747 22376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60980 23576 23806 gene locus_tag LOCUS_60990 23576 23806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60990 >Feature sequence121 710 453 gene locus_tag LOCUS_61000 710 453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61000 1160 1465 gene locus_tag LOCUS_61010 1160 1465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61010 2248 1715 gene locus_tag LOCUS_61020 2248 1715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61020 2610 2233 gene locus_tag LOCUS_61030 2610 2233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61030 4349 2871 gene locus_tag LOCUS_61040 4349 2871 CDS product FAD-linked oxidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143062.1 protein_id gnl|my_center|LOCUS_61040 4498 4268 gene locus_tag LOCUS_61050 4498 4268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61050 4520 4690 gene locus_tag LOCUS_61060 4520 4690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61060 5474 4677 gene locus_tag LOCUS_61070 5474 4677 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786661.1 protein_id gnl|my_center|LOCUS_61070 6601 5645 gene locus_tag LOCUS_61080 gene miaA 6601 5645 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056495.1 protein_id gnl|my_center|LOCUS_61080 6792 8729 gene locus_tag LOCUS_61090 gene gyrB 6792 8729 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056494.1 protein_id gnl|my_center|LOCUS_61090 9088 9726 gene locus_tag LOCUS_61100 9088 9726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61100 11241 12416 gene locus_tag LOCUS_61110 gene rpoD 11241 12416 CDS product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920727.1 protein_id gnl|my_center|LOCUS_61110 12884 12705 gene locus_tag LOCUS_61120 12884 12705 CDS product chlorophyll a/b-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056299.1 protein_id gnl|my_center|LOCUS_61120 13142 12963 gene locus_tag LOCUS_61130 13142 12963 CDS product chlorophyll a/b-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056299.1 protein_id gnl|my_center|LOCUS_61130 13400 13221 gene locus_tag LOCUS_61140 13400 13221 CDS product chlorophyll a/b-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056299.1 protein_id gnl|my_center|LOCUS_61140 13658 13479 gene locus_tag LOCUS_61150 13658 13479 CDS product chlorophyll a/b-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056299.1 protein_id gnl|my_center|LOCUS_61150 14076 14681 gene locus_tag LOCUS_61160 14076 14681 CDS product DUF3455 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088492.1 protein_id gnl|my_center|LOCUS_61160 15070 15303 gene locus_tag LOCUS_61170 15070 15303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61170 15938 15411 gene locus_tag LOCUS_61180 15938 15411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61180 16264 15995 gene locus_tag LOCUS_61190 16264 15995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61190 16899 16264 gene locus_tag LOCUS_61200 16899 16264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61200 19540 17051 gene locus_tag LOCUS_61210 gene gyrA 19540 17051 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142048.1 protein_id gnl|my_center|LOCUS_61210 19799 20203 gene locus_tag LOCUS_61220 19799 20203 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626534.1 protein_id gnl|my_center|LOCUS_61220 21406 20513 gene locus_tag LOCUS_61230 21406 20513 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_073550718.1 protein_id gnl|my_center|LOCUS_61230 21685 22275 gene locus_tag LOCUS_61240 21685 22275 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034350382.1 protein_id gnl|my_center|LOCUS_61240 22350 22850 gene locus_tag LOCUS_61250 22350 22850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61250 23228 23572 gene locus_tag LOCUS_61260 23228 23572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61260 >Feature sequence122 1376 186 gene locus_tag LOCUS_61270 1376 186 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058160.1 protein_id gnl|my_center|LOCUS_61270 1551 3098 gene locus_tag LOCUS_61280 1551 3098 CDS product TM0106 family RecB-like putative nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124464.1 protein_id gnl|my_center|LOCUS_61280 4140 3250 gene locus_tag LOCUS_61290 4140 3250 CDS product DUF4394 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928850.1 protein_id gnl|my_center|LOCUS_61290 4791 5972 gene locus_tag LOCUS_61300 4791 5972 CDS product esterase-like activity of phytase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929131.1 protein_id gnl|my_center|LOCUS_61300 6640 6362 gene locus_tag LOCUS_61310 6640 6362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61310 8501 6765 gene locus_tag LOCUS_61320 8501 6765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61320 8965 9237 gene locus_tag LOCUS_61330 8965 9237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61330 9797 9579 gene locus_tag LOCUS_61340 9797 9579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142104.1 protein_id gnl|my_center|LOCUS_61340 10356 11324 gene locus_tag LOCUS_61350 gene uvsE 10356 11324 CDS product UV DNA damage repair endonuclease UvsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034350019.1 protein_id gnl|my_center|LOCUS_61350 11674 11330 gene locus_tag LOCUS_61360 11674 11330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61360 11926 11684 gene locus_tag LOCUS_61370 11926 11684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61370 12165 13763 gene locus_tag LOCUS_61380 12165 13763 CDS product Hsp70 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058049.1 protein_id gnl|my_center|LOCUS_61380 14322 13810 gene locus_tag LOCUS_61390 14322 13810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61390 14422 14225 gene locus_tag LOCUS_61400 14422 14225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61400 14703 14888 gene locus_tag LOCUS_61410 14703 14888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61410 15513 14881 gene locus_tag LOCUS_61420 15513 14881 CDS product bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144255.1 protein_id gnl|my_center|LOCUS_61420 15867 16709 gene locus_tag LOCUS_61430 15867 16709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61430 16999 17922 gene locus_tag LOCUS_61440 16999 17922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61440 18151 19056 gene locus_tag LOCUS_61450 18151 19056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61450 19936 20106 gene locus_tag LOCUS_61460 19936 20106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61460 20119 21177 gene locus_tag LOCUS_61470 20119 21177 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056460.1 protein_id gnl|my_center|LOCUS_61470 21251 22024 gene locus_tag LOCUS_61480 21251 22024 CDS product TIGR03943 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172597933.1 protein_id gnl|my_center|LOCUS_61480 22190 23692 gene locus_tag LOCUS_61490 22190 23692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057099.1 protein_id gnl|my_center|LOCUS_61490 >Feature sequence123 227 1087 gene locus_tag LOCUS_61500 gene nadC 227 1087 CDS product carboxylating nicotinate-nucleotide diphosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057550.1 protein_id gnl|my_center|LOCUS_61500 1139 1864 gene locus_tag LOCUS_61510 1139 1864 CDS product DUF4336 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837011.1 protein_id gnl|my_center|LOCUS_61510 1962 3722 gene locus_tag LOCUS_61520 gene argS 1962 3722 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056669.1 protein_id gnl|my_center|LOCUS_61520 4107 4565 gene locus_tag LOCUS_61530 4107 4565 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140580.1 protein_id gnl|my_center|LOCUS_61530 4685 6163 gene locus_tag LOCUS_61540 4685 6163 CDS product CoA-acylating methylmalonate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979130.1 protein_id gnl|my_center|LOCUS_61540 6435 6154 gene locus_tag LOCUS_61550 6435 6154 CDS product DUF2087 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679502.1 protein_id gnl|my_center|LOCUS_61550 6753 7142 gene locus_tag LOCUS_61560 6753 7142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61560 7583 10006 gene locus_tag LOCUS_61570 7583 10006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61570 10793 10038 gene locus_tag LOCUS_61580 10793 10038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61580 10972 11763 gene locus_tag LOCUS_61590 10972 11763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61590 12707 11772 gene locus_tag LOCUS_61600 12707 11772 CDS product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141699.1 protein_id gnl|my_center|LOCUS_61600 13384 13118 gene locus_tag LOCUS_61610 13384 13118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61610 15670 16956 gene locus_tag LOCUS_61620 15670 16956 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000024453.1 protein_id gnl|my_center|LOCUS_61620 17519 16974 gene locus_tag LOCUS_61630 17519 16974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61630 18213 17569 gene locus_tag LOCUS_61640 18213 17569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61640 19512 18397 gene locus_tag LOCUS_61650 19512 18397 CDS product D-alanine--D-alanine ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056373.1 protein_id gnl|my_center|LOCUS_61650 20164 19682 gene locus_tag LOCUS_61660 20164 19682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61660 20434 20249 gene locus_tag LOCUS_61670 20434 20249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61670 21937 20615 gene locus_tag LOCUS_61680 gene miaB 21937 20615 CDS product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057155.1 protein_id gnl|my_center|LOCUS_61680 23618 22185 gene locus_tag LOCUS_61690 23618 22185 CDS product carotenoid oxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142768.1 protein_id gnl|my_center|LOCUS_61690 >Feature sequence124 294 1331 gene locus_tag LOCUS_61700 294 1331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61700 1328 2620 gene locus_tag LOCUS_61710 1328 2620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61710 2617 4035 gene locus_tag LOCUS_61720 2617 4035 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891943.1 protein_id gnl|my_center|LOCUS_61720 4058 4336 gene locus_tag LOCUS_61730 4058 4336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61730 4536 4763 gene locus_tag LOCUS_61740 4536 4763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61740 4811 5011 gene locus_tag LOCUS_61750 4811 5011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61750 5002 5403 gene locus_tag LOCUS_61760 5002 5403 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227971.1 protein_id gnl|my_center|LOCUS_61760 5409 7787 gene locus_tag LOCUS_61770 5409 7787 CDS product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105653.1 protein_id gnl|my_center|LOCUS_61770 8437 8937 gene locus_tag LOCUS_61780 8437 8937 CDS product DUF2231 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140739.1 protein_id gnl|my_center|LOCUS_61780 8934 9539 gene locus_tag LOCUS_61790 8934 9539 CDS product DUF2231 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140740.1 protein_id gnl|my_center|LOCUS_61790 9683 10588 gene locus_tag LOCUS_61800 gene coxB 9683 10588 CDS product cytochrome c oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928955.1 protein_id gnl|my_center|LOCUS_61800 10694 12364 gene locus_tag LOCUS_61810 gene ctaD 10694 12364 CDS product cytochrome c oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140742.1 protein_id gnl|my_center|LOCUS_61810 12712 13314 gene locus_tag LOCUS_61820 12712 13314 CDS product cytochrome c oxidase subunit 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142159.1 protein_id gnl|my_center|LOCUS_61820 13552 15117 gene locus_tag LOCUS_61830 13552 15117 CDS product GMC family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141163.1 protein_id gnl|my_center|LOCUS_61830 15905 15330 gene locus_tag LOCUS_61840 15905 15330 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014279.1 protein_id gnl|my_center|LOCUS_61840 17418 16141 gene locus_tag LOCUS_61850 17418 16141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61850 17451 17711 gene locus_tag LOCUS_61860 17451 17711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61860 18191 17778 gene locus_tag LOCUS_61870 18191 17778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61870 19371 19132 gene locus_tag LOCUS_61880 19371 19132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61880 19645 19433 gene locus_tag LOCUS_61890 19645 19433 CDS product chlorophyll a/b-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058042.1 protein_id gnl|my_center|LOCUS_61890 20184 21011 gene locus_tag LOCUS_61900 gene rsmA 20184 21011 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056506.1 protein_id gnl|my_center|LOCUS_61900 21071 22021 gene locus_tag LOCUS_61910 gene ispE 21071 22021 CDS product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056351.1 protein_id gnl|my_center|LOCUS_61910 22068 22385 gene locus_tag LOCUS_61920 22068 22385 CDS product DUF3082 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057677.1 protein_id gnl|my_center|LOCUS_61920 22467 22871 gene locus_tag LOCUS_61930 22467 22871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61930 >Feature sequence125 722 528 gene locus_tag LOCUS_61940 722 528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61940 1625 816 gene locus_tag LOCUS_61950 1625 816 CDS product glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817427.1 protein_id gnl|my_center|LOCUS_61950 2244 1663 gene locus_tag LOCUS_61960 2244 1663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61960 3599 2262 gene locus_tag LOCUS_61970 3599 2262 CDS product MurT ligase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258102.1 protein_id gnl|my_center|LOCUS_61970 3935 4420 gene locus_tag LOCUS_61980 3935 4420 CDS product thylakoid membrane photosystem I accumulation factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099798220.1 protein_id gnl|my_center|LOCUS_61980 4721 5329 gene locus_tag LOCUS_61990 4721 5329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61990 6752 5691 gene locus_tag LOCUS_62000 6752 5691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62000 8025 6796 gene locus_tag LOCUS_62010 8025 6796 CDS product VWA-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887812.1 protein_id gnl|my_center|LOCUS_62010 8293 8144 gene locus_tag LOCUS_62020 8293 8144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62020 9623 8622 gene locus_tag LOCUS_62030 9623 8622 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887814.1 protein_id gnl|my_center|LOCUS_62030 11412 10366 gene locus_tag LOCUS_62040 gene egtD 11412 10366 CDS product L-histidine N(alpha)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_088429091.1 protein_id gnl|my_center|LOCUS_62040 12884 11613 gene locus_tag LOCUS_62050 12884 11613 CDS product ergothioneine biosynthesis protein EgtB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141636.1 protein_id gnl|my_center|LOCUS_62050 13647 12859 gene locus_tag LOCUS_62060 gene egtC 13647 12859 CDS product ergothioneine biosynthesis protein EgtC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144315.1 protein_id gnl|my_center|LOCUS_62060 14528 14175 gene locus_tag LOCUS_62070 14528 14175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62070 17915 15009 gene locus_tag LOCUS_62080 17915 15009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62080 20360 17949 gene locus_tag LOCUS_62090 20360 17949 CDS product sucrose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056890.1 protein_id gnl|my_center|LOCUS_62090 22191 20821 gene locus_tag LOCUS_62100 22191 20821 CDS product RNA-guided endonuclease TnpB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897221.1 protein_id gnl|my_center|LOCUS_62100 22247 22648 gene locus_tag LOCUS_62110 gene tnpA 22247 22648 CDS product IS200/IS605 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979110.1 protein_id gnl|my_center|LOCUS_62110 22744 23028 gene locus_tag LOCUS_62120 22744 23028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62120 >Feature sequence126 496 77 gene locus_tag LOCUS_62130 496 77 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62130 706 1641 gene locus_tag LOCUS_62140 706 1641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62140 1766 2731 gene locus_tag LOCUS_62150 1766 2731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62150 2758 3720 gene locus_tag LOCUS_62160 2758 3720 CDS product phosphatidylinositol-specific phospholipase C/glycerophosphodiester phosphodiesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122695.1 protein_id gnl|my_center|LOCUS_62160 4493 4224 gene locus_tag LOCUS_62170 4493 4224 CDS product GlsB/YeaQ/YmgE family stress response membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005397239.1 protein_id gnl|my_center|LOCUS_62170 5053 4688 gene locus_tag LOCUS_62180 5053 4688 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946033.1 protein_id gnl|my_center|LOCUS_62180 8036 5418 gene locus_tag LOCUS_62190 gene clpB 8036 5418 CDS product ATP-dependent chaperone ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057229.1 protein_id gnl|my_center|LOCUS_62190 8672 10030 gene locus_tag LOCUS_62200 8672 10030 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193345476.1 protein_id gnl|my_center|LOCUS_62200 10027 10698 gene locus_tag LOCUS_62210 10027 10698 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140026.1 protein_id gnl|my_center|LOCUS_62210 11087 12664 gene locus_tag LOCUS_62220 11087 12664 CDS product SulP family inorganic anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105392.1 protein_id gnl|my_center|LOCUS_62220 12705 12863 gene locus_tag LOCUS_62230 12705 12863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62230 13091 13666 gene locus_tag LOCUS_62240 13091 13666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268600.1 protein_id gnl|my_center|LOCUS_62240 18358 13808 gene locus_tag LOCUS_62250 18358 13808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62250 18688 18365 gene locus_tag LOCUS_62260 18688 18365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62260 18834 19088 gene locus_tag LOCUS_62270 18834 19088 CDS product TIGR02450 family Trp-rich protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142102.1 protein_id gnl|my_center|LOCUS_62270 19752 20618 gene locus_tag LOCUS_62280 gene bchL 19752 20618 CDS product ferredoxin:protochlorophyllide reductase (ATP-dependent) iron-sulfur ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921031.1 protein_id gnl|my_center|LOCUS_62280 20648 21415 gene locus_tag LOCUS_62290 20648 21415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62290 21493 22893 gene locus_tag LOCUS_62300 21493 22893 CDS product ferredoxin:protochlorophyllide reductase (ATP-dependent) subunit N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058178.1 protein_id gnl|my_center|LOCUS_62300 >Feature sequence127 386 207 gene locus_tag LOCUS_62310 386 207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62310 426 1646 gene locus_tag LOCUS_62320 426 1646 CDS product RNA-guided endonuclease TnpB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000942660.1 protein_id gnl|my_center|LOCUS_62320 3563 1656 gene locus_tag LOCUS_62330 3563 1656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62330 4072 4296 gene locus_tag LOCUS_62340 4072 4296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62340 7321 5690 gene locus_tag LOCUS_62350 7321 5690 CDS product CocE/NonD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025269720.1 protein_id gnl|my_center|LOCUS_62350 7860 7405 gene locus_tag LOCUS_62360 7860 7405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62360 8747 7968 gene locus_tag LOCUS_62370 gene rutB 8747 7968 CDS product peroxyureidoacrylate/ureidoacrylate amidohydrolase RutB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001446784.1 protein_id gnl|my_center|LOCUS_62370 8831 10231 gene locus_tag LOCUS_62380 8831 10231 CDS product 8-oxoguanine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223813.1 protein_id gnl|my_center|LOCUS_62380 10780 10328 gene locus_tag LOCUS_62390 10780 10328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62390 11444 10929 gene locus_tag LOCUS_62400 11444 10929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62400 12140 13645 gene locus_tag LOCUS_62410 12140 13645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62410 15306 13777 gene locus_tag LOCUS_62420 15306 13777 CDS product SagB/ThcOx family dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143459.1 protein_id gnl|my_center|LOCUS_62420 16511 15564 gene locus_tag LOCUS_62430 16511 15564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62430 16711 17577 gene locus_tag LOCUS_62440 16711 17577 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971490.1 protein_id gnl|my_center|LOCUS_62440 18285 18866 gene locus_tag LOCUS_62450 18285 18866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62450 18963 19958 gene locus_tag LOCUS_62460 gene ilvC 18963 19958 CDS product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921008.1 protein_id gnl|my_center|LOCUS_62460 21040 20114 gene locus_tag LOCUS_62470 21040 20114 CDS product RNA-guided endonuclease TnpB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403412.1 protein_id gnl|my_center|LOCUS_62470 21485 22336 gene locus_tag LOCUS_62480 21485 22336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62480 22589 22377 gene locus_tag LOCUS_62490 22589 22377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62490 >Feature sequence128 145 717 gene locus_tag LOCUS_62500 145 717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62500 726 980 gene locus_tag LOCUS_62510 726 980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62510 977 1195 gene locus_tag LOCUS_62520 977 1195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62520 1205 2053 gene locus_tag LOCUS_62530 1205 2053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62530 2055 2636 gene locus_tag LOCUS_62540 2055 2636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62540 2654 3148 gene locus_tag LOCUS_62550 2654 3148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62550 3150 3461 gene locus_tag LOCUS_62560 3150 3461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62560 3462 4307 gene locus_tag LOCUS_62570 3462 4307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62570 4307 4945 gene locus_tag LOCUS_62580 4307 4945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62580 4971 5780 gene locus_tag LOCUS_62590 4971 5780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62590 6063 8231 gene locus_tag LOCUS_62600 6063 8231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62600 8221 8679 gene locus_tag LOCUS_62610 8221 8679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62610 8948 9427 gene locus_tag LOCUS_62620 8948 9427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62620 9506 10978 gene locus_tag LOCUS_62630 9506 10978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62630 11106 11819 gene locus_tag LOCUS_62640 11106 11819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62640 12531 13166 gene locus_tag LOCUS_62650 12531 13166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140615.1 protein_id gnl|my_center|LOCUS_62650 13913 13431 gene locus_tag LOCUS_62660 13913 13431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62660 14441 15631 gene locus_tag LOCUS_62670 14441 15631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62670 15989 17272 gene locus_tag LOCUS_62680 15989 17272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62680 17542 21081 gene locus_tag LOCUS_62690 17542 21081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62690 21247 21492 gene locus_tag LOCUS_62700 21247 21492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62700 22102 22626 gene locus_tag LOCUS_62710 22102 22626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62710 >Feature sequence129 1276 155 gene locus_tag LOCUS_62720 1276 155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62720 3120 1279 gene locus_tag LOCUS_62730 3120 1279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62730 4492 3113 gene locus_tag LOCUS_62740 4492 3113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62740 4876 5175 gene locus_tag LOCUS_62750 4876 5175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62750 5604 5822 gene locus_tag LOCUS_62760 5604 5822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62760 7056 5881 gene locus_tag LOCUS_62770 gene ribD 7056 5881 CDS product bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057986.1 protein_id gnl|my_center|LOCUS_62770 7802 7350 gene locus_tag LOCUS_62780 gene mreD 7802 7350 CDS product rod shape-determining protein MreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056784.1 protein_id gnl|my_center|LOCUS_62780 8894 8100 gene locus_tag LOCUS_62790 8894 8100 CDS product rod shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056783.1 protein_id gnl|my_center|LOCUS_62790 10019 8976 gene locus_tag LOCUS_62800 10019 8976 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056782.1 protein_id gnl|my_center|LOCUS_62800 10352 10714 gene locus_tag LOCUS_62810 10352 10714 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057330.1 protein_id gnl|my_center|LOCUS_62810 11593 10841 gene locus_tag LOCUS_62820 11593 10841 CDS product SIMPL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007353051.1 protein_id gnl|my_center|LOCUS_62820 11963 12376 gene locus_tag LOCUS_62830 11963 12376 CDS product EVE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259228.1 protein_id gnl|my_center|LOCUS_62830 12463 13890 gene locus_tag LOCUS_62840 12463 13890 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_088430287.1 protein_id gnl|my_center|LOCUS_62840 15119 17101 gene locus_tag LOCUS_62850 15119 17101 CDS product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920663.1 protein_id gnl|my_center|LOCUS_62850 18256 20265 gene locus_tag LOCUS_62860 18256 20265 CDS product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920663.1 protein_id gnl|my_center|LOCUS_62860 20527 21393 gene locus_tag LOCUS_62870 gene murI 20527 21393 CDS product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056314.1 protein_id gnl|my_center|LOCUS_62870 >Feature sequence130 785 1057 gene locus_tag LOCUS_62880 785 1057 CDS product GlsB/YeaQ/YmgE family stress response membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005397239.1 protein_id gnl|my_center|LOCUS_62880 2488 1301 gene locus_tag LOCUS_62890 2488 1301 CDS product RNA-guided endonuclease TnpB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057329.1 protein_id gnl|my_center|LOCUS_62890 3122 4570 gene locus_tag LOCUS_62900 gene atpD 3122 4570 CDS product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056375.1 protein_id gnl|my_center|LOCUS_62900 4748 5161 gene locus_tag LOCUS_62910 gene atpC 4748 5161 CDS product ATP synthase F1 subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056376.1 protein_id gnl|my_center|LOCUS_62910 6639 5212 gene locus_tag LOCUS_62920 6639 5212 CDS product lactonase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929159.1 protein_id gnl|my_center|LOCUS_62920 6931 7812 gene locus_tag LOCUS_62930 6931 7812 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142979.1 protein_id gnl|my_center|LOCUS_62930 7977 10244 gene locus_tag LOCUS_62940 7977 10244 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962866.1 protein_id gnl|my_center|LOCUS_62940 10474 12255 gene locus_tag LOCUS_62950 10474 12255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62950 12574 12275 gene locus_tag LOCUS_62960 12574 12275 CDS product 30S ribosomal protein PSRP-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056156.1 protein_id gnl|my_center|LOCUS_62960 12747 13565 gene locus_tag LOCUS_62970 12747 13565 CDS product TIGR01548 family HAD-type hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920669.1 protein_id gnl|my_center|LOCUS_62970 13656 14450 gene locus_tag LOCUS_62980 13656 14450 CDS product Tab2/Atab2 family RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057694.1 protein_id gnl|my_center|LOCUS_62980 14781 14497 gene locus_tag LOCUS_62990 14781 14497 CDS product DUF2470 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928995.1 protein_id gnl|my_center|LOCUS_62990 15191 15952 gene locus_tag LOCUS_63000 15191 15952 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058253.1 protein_id gnl|my_center|LOCUS_63000 16839 15970 gene locus_tag LOCUS_63010 16839 15970 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921020.1 protein_id gnl|my_center|LOCUS_63010 17125 17661 gene locus_tag LOCUS_63020 17125 17661 CDS product DUF4330 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920747.1 protein_id gnl|my_center|LOCUS_63020 17834 19561 gene locus_tag LOCUS_63030 17834 19561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63030 19805 20251 gene locus_tag LOCUS_63040 19805 20251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63040 20793 20584 gene locus_tag LOCUS_63050 20793 20584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63050 22477 21584 gene locus_tag LOCUS_63060 22477 21584 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141368.1 protein_id gnl|my_center|LOCUS_63060 >Feature sequence131 1410 607 gene locus_tag LOCUS_63070 1410 607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63070 2366 1443 gene locus_tag LOCUS_63080 2366 1443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63080 3017 4372 gene locus_tag LOCUS_63090 gene gntT 3017 4372 CDS product guanitoxin biosynthesis MATE family efflux transporter GntT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140501.1 protein_id gnl|my_center|LOCUS_63090 6870 5695 gene locus_tag LOCUS_63100 gene devC 6870 5695 CDS product ABC transporter permease DevC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141427.1 protein_id gnl|my_center|LOCUS_63100 8201 6867 gene locus_tag LOCUS_63110 8201 6867 CDS product ABC exporter membrane fusion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056492.1 protein_id gnl|my_center|LOCUS_63110 8377 9231 gene locus_tag LOCUS_63120 8377 9231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63120 10019 10324 gene locus_tag LOCUS_63130 10019 10324 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009927010.1 protein_id gnl|my_center|LOCUS_63130 10685 12556 gene locus_tag LOCUS_63140 10685 12556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63140 12621 13958 gene locus_tag LOCUS_63150 12621 13958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63150 14176 16287 gene locus_tag LOCUS_63160 14176 16287 CDS product TIGR00300 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056358.1 protein_id gnl|my_center|LOCUS_63160 16432 16992 gene locus_tag LOCUS_63170 16432 16992 CDS product DUF2085 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099798230.1 protein_id gnl|my_center|LOCUS_63170 19088 17127 gene locus_tag LOCUS_63180 19088 17127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63180 21662 19812 gene locus_tag LOCUS_63190 21662 19812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63190 >Feature sequence132 287 12 gene locus_tag LOCUS_63200 287 12 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63200 3080 378 gene locus_tag LOCUS_63210 3080 378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63210 3761 5044 gene locus_tag LOCUS_63220 3761 5044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63220 5192 5602 gene locus_tag LOCUS_63230 5192 5602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63230 5994 5659 gene locus_tag LOCUS_63240 5994 5659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63240 6176 5982 gene locus_tag LOCUS_63250 6176 5982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63250 6480 6226 gene locus_tag LOCUS_63260 6480 6226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63260 6851 6489 gene locus_tag LOCUS_63270 6851 6489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63270 10144 7304 gene locus_tag LOCUS_63280 10144 7304 CDS product cation-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057066.1 protein_id gnl|my_center|LOCUS_63280 10304 11419 gene locus_tag LOCUS_63290 10304 11419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63290 11930 13303 gene locus_tag LOCUS_63300 11930 13303 CDS product IS110 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_224497204.1 protein_id gnl|my_center|LOCUS_63300 13690 13283 gene locus_tag LOCUS_63310 13690 13283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63310 14112 13702 gene locus_tag LOCUS_63320 14112 13702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63320 15293 14472 gene locus_tag LOCUS_63330 15293 14472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63330 16843 15419 gene locus_tag LOCUS_63340 16843 15419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63340 17067 16864 gene locus_tag LOCUS_63350 17067 16864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63350 17495 17064 gene locus_tag LOCUS_63360 17495 17064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63360 18417 17503 gene locus_tag LOCUS_63370 18417 17503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63370 18923 18729 gene locus_tag LOCUS_63380 18923 18729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63380 19045 19632 gene locus_tag LOCUS_63390 19045 19632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63390 19733 21160 gene locus_tag LOCUS_63400 19733 21160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63400 >Feature sequence133 542 1123 gene locus_tag LOCUS_63410 542 1123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63410 1155 1778 gene locus_tag LOCUS_63420 1155 1778 CDS product ribonuclease D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056926.1 protein_id gnl|my_center|LOCUS_63420 2372 1839 gene locus_tag LOCUS_63430 2372 1839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63430 2753 3118 gene locus_tag LOCUS_63440 2753 3118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63440 3172 6279 gene locus_tag LOCUS_63450 3172 6279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63450 4305 4229 gene locus_tag LOCUS_t00400 4305 4229 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 7102 6521 gene locus_tag LOCUS_63460 7102 6521 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392284.1 protein_id gnl|my_center|LOCUS_63460 8297 7212 gene locus_tag LOCUS_63470 gene pdxA 8297 7212 CDS product 4-hydroxythreonine-4-phosphate dehydrogenase PdxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057880.1 protein_id gnl|my_center|LOCUS_63470 8936 8307 gene locus_tag LOCUS_63480 8936 8307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63480 9608 9940 gene locus_tag LOCUS_63490 9608 9940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63490 10162 13539 gene locus_tag LOCUS_63500 10162 13539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63500 13976 13665 gene locus_tag LOCUS_63510 13976 13665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63510 14688 14984 gene locus_tag LOCUS_63520 14688 14984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63520 15236 14898 gene locus_tag LOCUS_63530 15236 14898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63530 15614 16603 gene locus_tag LOCUS_63540 15614 16603 CDS product NAD(P)H-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056703.1 protein_id gnl|my_center|LOCUS_63540 16743 17660 gene locus_tag LOCUS_63550 16743 17660 CDS product NAD(+) kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056702.1 protein_id gnl|my_center|LOCUS_63550 18004 18690 gene locus_tag LOCUS_63560 18004 18690 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056116.1 protein_id gnl|my_center|LOCUS_63560 18890 19450 gene locus_tag LOCUS_63570 18890 19450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63570 19965 20156 gene locus_tag LOCUS_63580 19965 20156 CDS product DUF2949 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921037.1 protein_id gnl|my_center|LOCUS_63580 21575 20370 gene locus_tag LOCUS_63590 21575 20370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63590 >Feature sequence134 551 757 gene locus_tag LOCUS_63600 551 757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63600 1268 867 gene locus_tag LOCUS_63610 1268 867 CDS product fasciclin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142147.1 protein_id gnl|my_center|LOCUS_63610 2134 1508 gene locus_tag LOCUS_63620 2134 1508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63620 3294 2149 gene locus_tag LOCUS_63630 3294 2149 CDS product XdhC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243519.1 protein_id gnl|my_center|LOCUS_63630 5687 3378 gene locus_tag LOCUS_63640 5687 3378 CDS product xanthine dehydrogenase family protein molybdopterin-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_151611289.1 protein_id gnl|my_center|LOCUS_63640 6679 5684 gene locus_tag LOCUS_63650 6679 5684 CDS product xanthine dehydrogenase family protein subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087966.1 protein_id gnl|my_center|LOCUS_63650 7287 6694 gene locus_tag LOCUS_63660 7287 6694 CDS product 2Fe-2S iron-sulfur cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036293.1 protein_id gnl|my_center|LOCUS_63660 9674 7413 gene locus_tag LOCUS_63670 9674 7413 CDS product xanthine dehydrogenase family protein molybdopterin-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_081163175.1 protein_id gnl|my_center|LOCUS_63670 10654 9671 gene locus_tag LOCUS_63680 10654 9671 CDS product xanthine dehydrogenase family protein subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105102.1 protein_id gnl|my_center|LOCUS_63680 11330 10665 gene locus_tag LOCUS_63690 11330 10665 CDS product 2Fe-2S iron-sulfur cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_151613181.1 protein_id gnl|my_center|LOCUS_63690 12350 13174 gene locus_tag LOCUS_63700 12350 13174 CDS product SirB1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142488.1 protein_id gnl|my_center|LOCUS_63700 13760 13311 gene locus_tag LOCUS_63710 13760 13311 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140032.1 protein_id gnl|my_center|LOCUS_63710 14126 15733 gene locus_tag LOCUS_63720 14126 15733 CDS product mechanosensitive ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056580.1 protein_id gnl|my_center|LOCUS_63720 17315 16062 gene locus_tag LOCUS_63730 17315 16062 CDS product DNA-processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012602551.1 protein_id gnl|my_center|LOCUS_63730 19421 17322 gene locus_tag LOCUS_63740 19421 17322 CDS product RecQ family ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268660.1 protein_id gnl|my_center|LOCUS_63740 20984 19695 gene locus_tag LOCUS_63750 20984 19695 CDS product Glu/Leu/Phe/Val dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928696.1 protein_id gnl|my_center|LOCUS_63750 >Feature sequence135 1436 231 gene locus_tag LOCUS_63760 1436 231 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056559.1 protein_id gnl|my_center|LOCUS_63760 2560 1583 gene locus_tag LOCUS_63770 gene czcD 2560 1583 CDS product CDF family zinc transporter CzcD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100957.1 protein_id gnl|my_center|LOCUS_63770 2837 3508 gene locus_tag LOCUS_63780 2837 3508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63780 3925 4935 gene locus_tag LOCUS_63790 3925 4935 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920795.1 protein_id gnl|my_center|LOCUS_63790 5154 5954 gene locus_tag LOCUS_63800 gene rpsB 5154 5954 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057525.1 protein_id gnl|my_center|LOCUS_63800 6289 7233 gene locus_tag LOCUS_63810 gene tsf 6289 7233 CDS product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965094.1 protein_id gnl|my_center|LOCUS_63810 7528 8631 gene locus_tag LOCUS_63820 7528 8631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63820 8765 11257 gene locus_tag LOCUS_63830 gene recG 8765 11257 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056582.1 protein_id gnl|my_center|LOCUS_63830 11254 12156 gene locus_tag LOCUS_63840 11254 12156 CDS product DUF4351 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142039.1 protein_id gnl|my_center|LOCUS_63840 13283 12231 gene locus_tag LOCUS_63850 13283 12231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63850 14781 13495 gene locus_tag LOCUS_63860 14781 13495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63860 15373 17841 gene locus_tag LOCUS_63870 gene ppsA 15373 17841 CDS product phosphoenolpyruvate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056610.1 protein_id gnl|my_center|LOCUS_63870 18230 18481 gene locus_tag LOCUS_63880 18230 18481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63880 18612 20240 gene locus_tag LOCUS_63890 18612 20240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63890 20846 20385 gene locus_tag LOCUS_63900 20846 20385 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003531560.1 protein_id gnl|my_center|LOCUS_63900 >Feature sequence136 2000 183 gene locus_tag LOCUS_63910 2000 183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63910 2608 2357 gene locus_tag LOCUS_63920 2608 2357 CDS product type II toxin-antitoxin system HicA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250461.1 protein_id gnl|my_center|LOCUS_63920 2840 2601 gene locus_tag LOCUS_63930 2840 2601 CDS product type II toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022341.1 protein_id gnl|my_center|LOCUS_63930 3433 3176 gene locus_tag LOCUS_63940 3433 3176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63940 4799 3594 gene locus_tag LOCUS_63950 4799 3594 CDS product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056884.1 protein_id gnl|my_center|LOCUS_63950 5655 4885 gene locus_tag LOCUS_63960 5655 4885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63960 7189 5780 gene locus_tag LOCUS_63970 7189 5780 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197530022.1 protein_id gnl|my_center|LOCUS_63970 8691 7486 gene locus_tag LOCUS_63980 8691 7486 CDS product RNA-guided endonuclease TnpB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041233550.1 protein_id gnl|my_center|LOCUS_63980 8756 8914 gene locus_tag LOCUS_63990 8756 8914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63990 10494 9004 gene locus_tag LOCUS_64000 gene amt 10494 9004 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056043.1 protein_id gnl|my_center|LOCUS_64000 12016 11495 gene locus_tag LOCUS_64010 gene purE 12016 11495 CDS product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056434.1 protein_id gnl|my_center|LOCUS_64010 12289 13530 gene locus_tag LOCUS_64020 gene nagA 12289 13530 CDS product N-acetylglucosamine-6-phosphate deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057928.1 protein_id gnl|my_center|LOCUS_64020 13626 14309 gene locus_tag LOCUS_64030 gene bchM 13626 14309 CDS product magnesium protoporphyrin IX methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056304.1 protein_id gnl|my_center|LOCUS_64030 14769 15155 gene locus_tag LOCUS_64040 14769 15155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64040 15310 15816 gene locus_tag LOCUS_64050 15310 15816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64050 15844 16221 gene locus_tag LOCUS_64060 15844 16221 CDS product DUF423 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144314.1 protein_id gnl|my_center|LOCUS_64060 18275 16308 gene locus_tag LOCUS_64070 18275 16308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64070 18789 20780 gene locus_tag LOCUS_64080 18789 20780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64080 >Feature sequence137 123 446 gene locus_tag LOCUS_64090 123 446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64090 437 820 gene locus_tag LOCUS_64100 437 820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64100 1127 2281 gene locus_tag LOCUS_64110 1127 2281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64110 2677 4383 gene locus_tag LOCUS_64120 2677 4383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64120 4367 5665 gene locus_tag LOCUS_64130 4367 5665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64130 5667 6731 gene locus_tag LOCUS_64140 5667 6731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64140 7300 7494 gene locus_tag LOCUS_64150 7300 7494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64150 8973 7951 gene locus_tag LOCUS_64160 gene hpnH 8973 7951 CDS product adenosyl-hopene transferase HpnH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056444.1 protein_id gnl|my_center|LOCUS_64160 10092 9088 gene locus_tag LOCUS_64170 10092 9088 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141745.1 protein_id gnl|my_center|LOCUS_64170 10079 10276 gene locus_tag LOCUS_64180 10079 10276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64180 10276 10977 gene locus_tag LOCUS_64190 10276 10977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144039.1 protein_id gnl|my_center|LOCUS_64190 11052 11228 gene locus_tag LOCUS_64200 11052 11228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64200 11255 12835 gene locus_tag LOCUS_64210 11255 12835 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114382.1 protein_id gnl|my_center|LOCUS_64210 13185 12937 gene locus_tag LOCUS_64220 13185 12937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_64220 14138 15526 gene locus_tag LOCUS_64230 14138 15526 CDS product 3' terminal RNA ribose 2'-O-methyltransferase Hen1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485480.1 protein_id gnl|my_center|LOCUS_64230 15631 16452 gene locus_tag LOCUS_64240 15631 16452 CDS product HEAT repeat domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000072850.1 protein_id gnl|my_center|LOCUS_64240 16452 19094 gene locus_tag LOCUS_64250 16452 19094 CDS product polynucleotide kinase-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530161.1 protein_id gnl|my_center|LOCUS_64250 19384 19202 gene locus_tag LOCUS_64260 19384 19202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64260 19529 20437 gene locus_tag LOCUS_64270 19529 20437 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028123.1 protein_id gnl|my_center|LOCUS_64270 20541 20864 gene locus_tag LOCUS_64280 20541 20864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64280 >Feature sequence138 685 2301 gene locus_tag LOCUS_64290 685 2301 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730315.1 protein_id gnl|my_center|LOCUS_64290 2535 2326 gene locus_tag LOCUS_64300 2535 2326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64300 3215 3541 gene locus_tag LOCUS_64310 3215 3541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64310 3652 5337 gene locus_tag LOCUS_64320 3652 5337 CDS product AarF/ABC1/UbiB kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_088894694.1 protein_id gnl|my_center|LOCUS_64320 5354 6079 gene locus_tag LOCUS_64330 5354 6079 CDS product Stp1/IreP family PP2C-type Ser/Thr phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058076.1 protein_id gnl|my_center|LOCUS_64330 6728 6925 gene locus_tag LOCUS_64340 6728 6925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64340 9026 7470 gene locus_tag LOCUS_64350 9026 7470 CDS product serine/threonine-protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056298.1 protein_id gnl|my_center|LOCUS_64350 10703 9231 gene locus_tag LOCUS_64360 10703 9231 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533544.1 protein_id gnl|my_center|LOCUS_64360 10812 11051 gene locus_tag LOCUS_64370 10812 11051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64370 11073 11288 gene locus_tag LOCUS_64380 11073 11288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64380 11292 11975 gene locus_tag LOCUS_64390 11292 11975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64390 12823 12305 gene locus_tag LOCUS_64400 12823 12305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64400 13953 12967 gene locus_tag LOCUS_64410 13953 12967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64410 15409 13928 gene locus_tag LOCUS_64420 15409 13928 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922235.1 protein_id gnl|my_center|LOCUS_64420 15944 17389 gene locus_tag LOCUS_64430 15944 17389 CDS product RecQ family ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056643.1 protein_id gnl|my_center|LOCUS_64430 17498 19399 gene locus_tag LOCUS_64440 17498 19399 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140584.1 protein_id gnl|my_center|LOCUS_64440 20433 19441 gene locus_tag LOCUS_64450 gene pheS 20433 19441 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056537.1 protein_id gnl|my_center|LOCUS_64450 >Feature sequence139 135 314 gene locus_tag LOCUS_64460 135 314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64460 1487 402 gene locus_tag LOCUS_64470 1487 402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64470 2008 1511 gene locus_tag LOCUS_64480 2008 1511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64480 3186 5114 gene locus_tag LOCUS_64490 3186 5114 CDS product alpha-amylase family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928510.1 protein_id gnl|my_center|LOCUS_64490 5833 5153 gene locus_tag LOCUS_64500 5833 5153 CDS product LuxR C-terminal-related transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197530096.1 protein_id gnl|my_center|LOCUS_64500 5940 6596 gene locus_tag LOCUS_64510 5940 6596 CDS product DUF3386 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056760.1 protein_id gnl|my_center|LOCUS_64510 7160 7726 gene locus_tag LOCUS_64520 7160 7726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64520 8010 8603 gene locus_tag LOCUS_64530 8010 8603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64530 8610 9662 gene locus_tag LOCUS_64540 8610 9662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64540 11234 9747 gene locus_tag LOCUS_64550 11234 9747 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816561.1 protein_id gnl|my_center|LOCUS_64550 11531 11758 gene locus_tag LOCUS_64560 11531 11758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64560 12930 12457 gene locus_tag LOCUS_64570 12930 12457 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027654.1 protein_id gnl|my_center|LOCUS_64570 13295 12942 gene locus_tag LOCUS_64580 13295 12942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64580 14867 13380 gene locus_tag LOCUS_64590 14867 13380 CDS product CIA30 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055916.1 protein_id gnl|my_center|LOCUS_64590 16731 15427 gene locus_tag LOCUS_64600 16731 15427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64600 16934 17839 gene locus_tag LOCUS_64610 16934 17839 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056343.1 protein_id gnl|my_center|LOCUS_64610 18300 17812 gene locus_tag LOCUS_64620 18300 17812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_64620 18604 18272 gene locus_tag LOCUS_64630 18604 18272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_64630 19026 19277 gene locus_tag LOCUS_64640 19026 19277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64640 19283 19774 gene locus_tag LOCUS_64650 19283 19774 CDS product DUF3368 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140618.1 protein_id gnl|my_center|LOCUS_64650 20258 20085 gene locus_tag LOCUS_64660 20258 20085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64660 20476 20231 gene locus_tag LOCUS_64670 20476 20231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64670 >Feature sequence140 686 480 gene locus_tag LOCUS_64680 686 480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64680 1391 816 gene locus_tag LOCUS_64690 1391 816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64690 2877 1885 gene locus_tag LOCUS_64700 2877 1885 CDS product aromatic ring-hydroxylating dioxygenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979027.1 protein_id gnl|my_center|LOCUS_64700 3958 2981 gene locus_tag LOCUS_64710 gene hpxD 3958 2981 CDS product molybdenum cofactor-independent xanthine hydroxylase subunit HpxD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705426.1 protein_id gnl|my_center|LOCUS_64710 4190 4014 gene locus_tag LOCUS_64720 4190 4014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64720 4237 5700 gene locus_tag LOCUS_64730 4237 5700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64730 5727 6080 gene locus_tag LOCUS_64740 5727 6080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64740 6391 6621 gene locus_tag LOCUS_64750 6391 6621 CDS product AbrB/MazE/SpoVT family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001192482.1 protein_id gnl|my_center|LOCUS_64750 6973 6737 gene locus_tag LOCUS_64760 6973 6737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64760 7130 7375 gene locus_tag LOCUS_64770 7130 7375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64770 7642 7770 gene locus_tag LOCUS_64780 7642 7770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64780 8454 7825 gene locus_tag LOCUS_64790 8454 7825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64790 8611 11208 gene locus_tag LOCUS_64800 gene ptsP 8611 11208 CDS product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938280.1 protein_id gnl|my_center|LOCUS_64800 12539 11463 gene locus_tag LOCUS_64810 gene acsF 12539 11463 CDS product magnesium-protoporphyrin IX monomethyl ester (oxidative) cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057559.1 protein_id gnl|my_center|LOCUS_64810 13073 13786 gene locus_tag LOCUS_64820 13073 13786 CDS product heme oxygenase (biliverdin-producing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920678.1 protein_id gnl|my_center|LOCUS_64820 14123 15505 gene locus_tag LOCUS_64830 gene hemN 14123 15505 CDS product oxygen-independent coproporphyrinogen III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057557.1 protein_id gnl|my_center|LOCUS_64830 16159 17409 gene locus_tag LOCUS_64840 16159 17409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64840 17558 17358 gene locus_tag LOCUS_64850 17558 17358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64850 19957 18785 gene locus_tag LOCUS_64860 19957 18785 CDS product RNA-guided endonuclease TnpB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140589.1 protein_id gnl|my_center|LOCUS_64860 >Feature sequence141 452 99 gene locus_tag LOCUS_64870 452 99 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64870 615 544 gene locus_tag LOCUS_t00410 615 544 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 3763 671 gene locus_tag LOCUS_64880 3763 671 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_190962212.1 protein_id gnl|my_center|LOCUS_64880 5489 3954 gene locus_tag LOCUS_64890 5489 3954 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928611.1 protein_id gnl|my_center|LOCUS_64890 5967 6842 gene locus_tag LOCUS_64900 5967 6842 CDS product metal-dependent phosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028172344.1 protein_id gnl|my_center|LOCUS_64900 6933 8051 gene locus_tag LOCUS_64910 6933 8051 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056993.1 protein_id gnl|my_center|LOCUS_64910 8157 9269 gene locus_tag LOCUS_64920 8157 9269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64920 9495 9274 gene locus_tag LOCUS_64930 9495 9274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64930 10813 9920 gene locus_tag LOCUS_64940 10813 9920 CDS product DUF4231 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030354.1 protein_id gnl|my_center|LOCUS_64940 12266 10869 gene locus_tag LOCUS_64950 12266 10869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64950 12924 12343 gene locus_tag LOCUS_64960 12924 12343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64960 13442 13029 gene locus_tag LOCUS_64970 13442 13029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64970 15366 13687 gene locus_tag LOCUS_64980 15366 13687 CDS product cation acetate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228221.1 protein_id gnl|my_center|LOCUS_64980 15630 15376 gene locus_tag LOCUS_64990 15630 15376 CDS product DUF4212 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172914.1 protein_id gnl|my_center|LOCUS_64990 16287 16886 gene locus_tag LOCUS_65000 16287 16886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65000 17147 19027 gene locus_tag LOCUS_65010 17147 19027 CDS product DICT sensory domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057496.1 protein_id gnl|my_center|LOCUS_65010 >Feature sequence142 1195 1530 gene locus_tag LOCUS_65020 1195 1530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65020 1607 2125 gene locus_tag LOCUS_65030 1607 2125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65030 3271 2621 gene locus_tag LOCUS_65040 3271 2621 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928651.1 protein_id gnl|my_center|LOCUS_65040 3822 3388 gene locus_tag LOCUS_65050 3822 3388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65050 4160 4375 gene locus_tag LOCUS_65060 4160 4375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65060 4460 4627 gene locus_tag LOCUS_65070 4460 4627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65070 4933 5136 gene locus_tag LOCUS_65080 4933 5136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65080 5216 5668 gene locus_tag LOCUS_65090 5216 5668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65090 6104 5919 gene locus_tag LOCUS_65100 6104 5919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65100 6958 6236 gene locus_tag LOCUS_65110 6958 6236 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072508.1 protein_id gnl|my_center|LOCUS_65110 7835 7566 gene locus_tag LOCUS_65120 7835 7566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65120 8896 7835 gene locus_tag LOCUS_65130 8896 7835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65130 11530 9254 gene locus_tag LOCUS_65140 11530 9254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65140 12434 11586 gene locus_tag LOCUS_65150 12434 11586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65150 12729 12526 gene locus_tag LOCUS_65160 12729 12526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65160 13208 12729 gene locus_tag LOCUS_65170 13208 12729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65170 13525 13238 gene locus_tag LOCUS_65180 13525 13238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65180 13824 14024 gene locus_tag LOCUS_65190 13824 14024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65190 14540 14785 gene locus_tag LOCUS_65200 14540 14785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65200 14988 14782 gene locus_tag LOCUS_65210 14988 14782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65210 15204 15845 gene locus_tag LOCUS_65220 15204 15845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65220 15906 19472 gene locus_tag LOCUS_65230 15906 19472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65230 >Feature sequence143 455 1147 gene locus_tag LOCUS_65240 455 1147 CDS product prohibitin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461868.1 protein_id gnl|my_center|LOCUS_65240 1643 1837 gene locus_tag LOCUS_65250 1643 1837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65250 1896 3608 gene locus_tag LOCUS_65260 1896 3608 CDS product ShlB/FhaC/HecB family hemolysin secretion/activation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099799342.1 protein_id gnl|my_center|LOCUS_65260 3822 6305 gene locus_tag LOCUS_65270 3822 6305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65270 6475 7443 gene locus_tag LOCUS_65280 6475 7443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65280 7528 9879 gene locus_tag LOCUS_65290 7528 9879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65290 10417 10226 gene locus_tag LOCUS_65300 10417 10226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65300 10393 10971 gene locus_tag LOCUS_65310 10393 10971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65310 13761 10981 gene locus_tag LOCUS_65320 13761 10981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65320 15158 16303 gene locus_tag LOCUS_65330 15158 16303 CDS product SpoIID/LytB domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056246.1 protein_id gnl|my_center|LOCUS_65330 17660 16374 gene locus_tag LOCUS_65340 17660 16374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057293.1 protein_id gnl|my_center|LOCUS_65340 18208 18687 gene locus_tag LOCUS_65350 18208 18687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65350 >Feature sequence144 623 462 gene locus_tag LOCUS_65360 623 462 CDS product rubredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966063.1 protein_id gnl|my_center|LOCUS_65360 2538 754 gene locus_tag LOCUS_65370 2538 754 CDS product PDZ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143530.1 protein_id gnl|my_center|LOCUS_65370 4710 3535 gene locus_tag LOCUS_65380 4710 3535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65380 6670 5936 gene locus_tag LOCUS_65390 6670 5936 CDS product TIGR04283 family arsenosugar biosynthesis glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140670.1 protein_id gnl|my_center|LOCUS_65390 7207 6869 gene locus_tag LOCUS_65400 7207 6869 CDS product carbon dioxide-concentrating mechanism protein CcmK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142093.1 protein_id gnl|my_center|LOCUS_65400 8355 9536 gene locus_tag LOCUS_65410 8355 9536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65410 9552 11363 gene locus_tag LOCUS_65420 9552 11363 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975712.1 protein_id gnl|my_center|LOCUS_65420 11401 13032 gene locus_tag LOCUS_65430 11401 13032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65430 13029 14093 gene locus_tag LOCUS_65440 13029 14093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65440 14352 14143 gene locus_tag LOCUS_65450 14352 14143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65450 14479 16200 gene locus_tag LOCUS_65460 14479 16200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65460 16330 17136 gene locus_tag LOCUS_65470 16330 17136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_65470 17681 17370 gene locus_tag LOCUS_65480 17681 17370 CDS product carbon dioxide-concentrating mechanism protein CcmK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142093.1 protein_id gnl|my_center|LOCUS_65480 18150 17953 gene locus_tag LOCUS_65490 18150 17953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65490 18581 18240 gene locus_tag LOCUS_65500 18581 18240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65500 18706 18945 gene locus_tag LOCUS_65510 18706 18945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65510 18950 19228 gene locus_tag LOCUS_65520 18950 19228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65520 >Feature sequence145 397 107 gene locus_tag LOCUS_65530 397 107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65530 913 638 gene locus_tag LOCUS_65540 913 638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65540 2210 1284 gene locus_tag LOCUS_65550 2210 1284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65550 3502 3290 gene locus_tag LOCUS_65560 3502 3290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_65560 5467 3533 gene locus_tag LOCUS_65570 5467 3533 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021363.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_65570 6236 5598 gene locus_tag LOCUS_65580 6236 5598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65580 7429 6605 gene locus_tag LOCUS_65590 7429 6605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65590 8101 7517 gene locus_tag LOCUS_65600 8101 7517 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392328.1 protein_id gnl|my_center|LOCUS_65600 8956 8390 gene locus_tag LOCUS_65610 8956 8390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65610 9580 9188 gene locus_tag LOCUS_65620 9580 9188 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144197.1 protein_id gnl|my_center|LOCUS_65620 10008 9655 gene locus_tag LOCUS_65630 10008 9655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65630 10352 12370 gene locus_tag LOCUS_65640 10352 12370 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140636.1 protein_id gnl|my_center|LOCUS_65640 12470 12724 gene locus_tag LOCUS_65650 12470 12724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65650 13379 14722 gene locus_tag LOCUS_65660 13379 14722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65660 15044 16945 gene locus_tag LOCUS_65670 15044 16945 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144195.1 protein_id gnl|my_center|LOCUS_65670 17426 18109 gene locus_tag LOCUS_65680 17426 18109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65680 18841 18341 gene locus_tag LOCUS_65690 18841 18341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65690 19139 18939 gene locus_tag LOCUS_65700 19139 18939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65700 >Feature sequence146 282 115 gene locus_tag LOCUS_65710 282 115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65710 1455 298 gene locus_tag LOCUS_65720 1455 298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65720 1600 1971 gene locus_tag LOCUS_65730 1600 1971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65730 2077 2235 gene locus_tag LOCUS_65740 2077 2235 CDS product YqaE/Pmp3 family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390272.1 protein_id gnl|my_center|LOCUS_65740 3082 2420 gene locus_tag LOCUS_65750 3082 2420 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086982.1 protein_id gnl|my_center|LOCUS_65750 3204 4193 gene locus_tag LOCUS_65760 3204 4193 CDS product Rieske 2Fe-2S domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015156906.1 protein_id gnl|my_center|LOCUS_65760 4340 5212 gene locus_tag LOCUS_65770 4340 5212 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113539.1 protein_id gnl|my_center|LOCUS_65770 5259 6503 gene locus_tag LOCUS_65780 5259 6503 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143095.1 protein_id gnl|my_center|LOCUS_65780 10206 6550 gene locus_tag LOCUS_65790 gene nifJ 10206 6550 CDS product pyruvate:ferredoxin (flavodoxin) oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933292.1 protein_id gnl|my_center|LOCUS_65790 12331 11150 gene locus_tag LOCUS_65800 12331 11150 CDS product catalase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338580.1 protein_id gnl|my_center|LOCUS_65800 14108 12474 gene locus_tag LOCUS_65810 14108 12474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65810 15432 14413 gene locus_tag LOCUS_65820 15432 14413 CDS product DUF2235 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073502.1 protein_id gnl|my_center|LOCUS_65820 16343 15534 gene locus_tag LOCUS_65830 16343 15534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65830 >Feature sequence147 1348 1611 gene locus_tag LOCUS_65840 1348 1611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65840 1601 1933 gene locus_tag LOCUS_65850 1601 1933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65850 2480 5398 gene locus_tag LOCUS_65860 2480 5398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65860 5557 5973 gene locus_tag LOCUS_65870 5557 5973 CDS product DOPA 4,5-dioxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193180291.1 protein_id gnl|my_center|LOCUS_65870 6734 6330 gene locus_tag LOCUS_65880 6734 6330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65880 7398 6976 gene locus_tag LOCUS_65890 7398 6976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65890 7571 7792 gene locus_tag LOCUS_65900 7571 7792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65900 7805 8425 gene locus_tag LOCUS_65910 7805 8425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65910 8480 8698 gene locus_tag LOCUS_65920 8480 8698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65920 10233 9244 gene locus_tag LOCUS_65930 10233 9244 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142835.1 protein_id gnl|my_center|LOCUS_65930 11386 10352 gene locus_tag LOCUS_65940 11386 10352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087751.1 protein_id gnl|my_center|LOCUS_65940 12182 11415 gene locus_tag LOCUS_65950 12182 11415 CDS product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368402.1 protein_id gnl|my_center|LOCUS_65950 12918 13805 gene locus_tag LOCUS_65960 12918 13805 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143349.1 protein_id gnl|my_center|LOCUS_65960 15648 13984 gene locus_tag LOCUS_65970 15648 13984 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027306.1 protein_id gnl|my_center|LOCUS_65970 16066 16326 gene locus_tag LOCUS_65980 16066 16326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65980 17239 16874 gene locus_tag LOCUS_65990 17239 16874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_65990 17806 17423 gene locus_tag LOCUS_66000 17806 17423 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143848.1 protein_id gnl|my_center|LOCUS_66000 >Feature sequence148 384 127 gene locus_tag LOCUS_66010 384 127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920770.1 protein_id gnl|my_center|LOCUS_66010 866 441 gene locus_tag LOCUS_66020 866 441 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920771.1 protein_id gnl|my_center|LOCUS_66020 1305 946 gene locus_tag LOCUS_66030 1305 946 CDS product iron-sulfur cluster assembly accessory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_126986038.1 protein_id gnl|my_center|LOCUS_66030 1754 3388 gene locus_tag LOCUS_66040 1754 3388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142439.1 protein_id gnl|my_center|LOCUS_66040 5668 5841 gene locus_tag LOCUS_66050 5668 5841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66050 6007 7446 gene locus_tag LOCUS_66060 gene zds 6007 7446 CDS product 9,9'-di-cis-zeta-carotene desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056192.1 protein_id gnl|my_center|LOCUS_66060 7535 7987 gene locus_tag LOCUS_66070 7535 7987 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056191.1 protein_id gnl|my_center|LOCUS_66070 8460 8221 gene locus_tag LOCUS_66080 8460 8221 CDS product 2Fe-2S iron-sulfur cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057397.1 protein_id gnl|my_center|LOCUS_66080 9950 8472 gene locus_tag LOCUS_66090 9950 8472 CDS product cobyric acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057553.1 protein_id gnl|my_center|LOCUS_66090 10581 10177 gene locus_tag LOCUS_66100 10581 10177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057265.1 protein_id gnl|my_center|LOCUS_66100 11030 11467 gene locus_tag LOCUS_66110 11030 11467 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057040.1 protein_id gnl|my_center|LOCUS_66110 11910 11536 gene locus_tag LOCUS_66120 11910 11536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66120 12895 11999 gene locus_tag LOCUS_66130 12895 11999 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057164.1 protein_id gnl|my_center|LOCUS_66130 14040 13021 gene locus_tag LOCUS_66140 14040 13021 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920628.1 protein_id gnl|my_center|LOCUS_66140 14452 14174 gene locus_tag LOCUS_66150 14452 14174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66150 15514 14657 gene locus_tag LOCUS_66160 15514 14657 CDS product DUF4351 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144335.1 protein_id gnl|my_center|LOCUS_66160 16135 16302 gene locus_tag LOCUS_66170 16135 16302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66170 >Feature sequence149 1420 323 gene locus_tag LOCUS_66180 gene aroF 1420 323 CDS product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056213.1 protein_id gnl|my_center|LOCUS_66180 3267 2170 gene locus_tag LOCUS_66190 gene aroF 3267 2170 CDS product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056213.1 protein_id gnl|my_center|LOCUS_66190 3854 5152 gene locus_tag LOCUS_66200 3854 5152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66200 5678 7048 gene locus_tag LOCUS_66210 5678 7048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66210 8690 7110 gene locus_tag LOCUS_66220 8690 7110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66220 10177 8999 gene locus_tag LOCUS_66230 10177 8999 CDS product DUF1822 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140225.1 protein_id gnl|my_center|LOCUS_66230 11391 10192 gene locus_tag LOCUS_66240 11391 10192 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929352.1 protein_id gnl|my_center|LOCUS_66240 11856 14231 gene locus_tag LOCUS_66250 11856 14231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66250 14429 14791 gene locus_tag LOCUS_66260 14429 14791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_66260 15514 15128 gene locus_tag LOCUS_66270 15514 15128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058300.1 protein_id gnl|my_center|LOCUS_66270 15933 16799 gene locus_tag LOCUS_66280 15933 16799 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929728.1 protein_id gnl|my_center|LOCUS_66280 >Feature sequence150 3703 245 gene locus_tag LOCUS_66290 3703 245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66290 4991 4197 gene locus_tag LOCUS_66300 4991 4197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_66300 6090 6467 gene locus_tag LOCUS_66310 6090 6467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66310 6718 7830 gene locus_tag LOCUS_66320 gene wecB 6718 7830 CDS product UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057875.1 protein_id gnl|my_center|LOCUS_66320 9164 7908 gene locus_tag LOCUS_66330 9164 7908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66330 10117 9506 gene locus_tag LOCUS_66340 10117 9506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66340 11414 10479 gene locus_tag LOCUS_66350 11414 10479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66350 13089 14333 gene locus_tag LOCUS_66360 13089 14333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66360 14591 15532 gene locus_tag LOCUS_66370 14591 15532 CDS product glycosyltransferase family 8 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242748.1 protein_id gnl|my_center|LOCUS_66370 15658 15897 gene locus_tag LOCUS_66380 15658 15897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66380 16494 16751 gene locus_tag LOCUS_66390 16494 16751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66390 >Feature sequence151 785 1870 gene locus_tag LOCUS_66400 785 1870 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928886.1 protein_id gnl|my_center|LOCUS_66400 2017 3060 gene locus_tag LOCUS_66410 2017 3060 CDS product M42 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003088971.1 protein_id gnl|my_center|LOCUS_66410 3199 3666 gene locus_tag LOCUS_66420 3199 3666 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057639.1 protein_id gnl|my_center|LOCUS_66420 3771 4436 gene locus_tag LOCUS_66430 3771 4436 CDS product HEAT repeat domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921118.1 protein_id gnl|my_center|LOCUS_66430 5131 4613 gene locus_tag LOCUS_66440 5131 4613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66440 5855 5202 gene locus_tag LOCUS_66450 5855 5202 CDS product cofactor assembly of complex C subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056532.1 protein_id gnl|my_center|LOCUS_66450 6699 5971 gene locus_tag LOCUS_66460 6699 5971 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197524184.1 protein_id gnl|my_center|LOCUS_66460 6978 8426 gene locus_tag LOCUS_66470 gene radA 6978 8426 CDS product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142401.1 protein_id gnl|my_center|LOCUS_66470 8502 9086 gene locus_tag LOCUS_66480 8502 9086 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141358.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_66480 9087 9233 gene locus_tag LOCUS_66490 9087 9233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66490 10064 9414 gene locus_tag LOCUS_66500 10064 9414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66500 12505 10610 gene locus_tag LOCUS_66510 12505 10610 CDS product KAP family P-loop domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080141.1 protein_id gnl|my_center|LOCUS_66510 12691 13524 gene locus_tag LOCUS_66520 gene menB 12691 13524 CDS product 1,4-dihydroxy-2-naphthoyl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058289.1 protein_id gnl|my_center|LOCUS_66520 13834 13607 gene locus_tag LOCUS_66530 13834 13607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66530 13912 14160 gene locus_tag LOCUS_66540 13912 14160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66540 15541 16266 gene locus_tag LOCUS_66550 15541 16266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66550 >Feature sequence152 235 639 gene locus_tag LOCUS_66560 235 639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66560 1271 741 gene locus_tag LOCUS_66570 1271 741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66570 1362 1532 gene locus_tag LOCUS_66580 1362 1532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66580 1486 1860 gene locus_tag LOCUS_66590 1486 1860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66590 2262 1963 gene locus_tag LOCUS_66600 2262 1963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929043.1 protein_id gnl|my_center|LOCUS_66600 3415 2768 gene locus_tag LOCUS_66610 3415 2768 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025687389.1 protein_id gnl|my_center|LOCUS_66610 4425 3412 gene locus_tag LOCUS_66620 gene queG 4425 3412 CDS product tRNA epoxyqueuosine(34) reductase QueG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920720.1 protein_id gnl|my_center|LOCUS_66620 4576 5094 gene locus_tag LOCUS_66630 4576 5094 CDS product orange carotenoid protein N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057109.1 protein_id gnl|my_center|LOCUS_66630 5298 5720 gene locus_tag LOCUS_66640 5298 5720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66640 6253 5801 gene locus_tag LOCUS_66650 6253 5801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056629.1 protein_id gnl|my_center|LOCUS_66650 9513 6481 gene locus_tag LOCUS_66660 9513 6481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66660 9937 9761 gene locus_tag LOCUS_66670 9937 9761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66670 10794 10348 gene locus_tag LOCUS_66680 10794 10348 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056399.1 protein_id gnl|my_center|LOCUS_66680 12468 10795 gene locus_tag LOCUS_66690 12468 10795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66690 13383 12658 gene locus_tag LOCUS_66700 13383 12658 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144387.1 protein_id gnl|my_center|LOCUS_66700 13987 14754 gene locus_tag LOCUS_66710 13987 14754 CDS product WecB/TagA/CpsF family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920693.1 protein_id gnl|my_center|LOCUS_66710 15493 14891 gene locus_tag LOCUS_66720 15493 14891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66720 >Feature sequence153 659 2497 gene locus_tag LOCUS_66730 659 2497 CDS product fatty acyl-AMP ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928895.1 protein_id gnl|my_center|LOCUS_66730 2731 3585 gene locus_tag LOCUS_66740 2731 3585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66740 4163 4498 gene locus_tag LOCUS_66750 4163 4498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66750 4840 9579 gene locus_tag LOCUS_66760 4840 9579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66760 9664 10776 gene locus_tag LOCUS_66770 9664 10776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66770 10915 12126 gene locus_tag LOCUS_66780 10915 12126 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257396.1 protein_id gnl|my_center|LOCUS_66780 12442 13185 gene locus_tag LOCUS_66790 12442 13185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66790 13358 14014 gene locus_tag LOCUS_66800 13358 14014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_66800 14007 15524 gene locus_tag LOCUS_66810 14007 15524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66810 >Feature sequence154 2103 367 gene locus_tag LOCUS_66820 2103 367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66820 2798 2100 gene locus_tag LOCUS_66830 2798 2100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66830 3632 2808 gene locus_tag LOCUS_66840 3632 2808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66840 5544 4495 gene locus_tag LOCUS_66850 5544 4495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66850 6612 5569 gene locus_tag LOCUS_66860 6612 5569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66860 9703 6956 gene locus_tag LOCUS_66870 9703 6956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140619.1 protein_id gnl|my_center|LOCUS_66870 10028 9651 gene locus_tag LOCUS_66880 10028 9651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66880 10600 10043 gene locus_tag LOCUS_66890 10600 10043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66890 11134 11316 gene locus_tag LOCUS_66900 11134 11316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66900 11701 13284 gene locus_tag LOCUS_66910 11701 13284 CDS product alkaline phosphatase D family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197530132.1 protein_id gnl|my_center|LOCUS_66910 13486 15036 gene locus_tag LOCUS_66920 13486 15036 CDS product GMC oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142818.1 protein_id gnl|my_center|LOCUS_66920 >Feature sequence155 580 1041 gene locus_tag LOCUS_66930 580 1041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66930 1346 1675 gene locus_tag LOCUS_66940 1346 1675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66940 2115 3371 gene locus_tag LOCUS_66950 2115 3371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66950 3383 6628 gene locus_tag LOCUS_66960 3383 6628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66960 6632 7819 gene locus_tag LOCUS_66970 6632 7819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66970 8734 8315 gene locus_tag LOCUS_66980 8734 8315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66980 8949 9623 gene locus_tag LOCUS_66990 8949 9623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66990 9943 10593 gene locus_tag LOCUS_67000 9943 10593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67000 12137 10875 gene locus_tag LOCUS_67010 12137 10875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67010 12514 12296 gene locus_tag LOCUS_67020 12514 12296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_67020 12503 12817 gene locus_tag LOCUS_67030 12503 12817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67030 14328 13216 gene locus_tag LOCUS_67040 14328 13216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67040 14544 15071 gene locus_tag LOCUS_67050 14544 15071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67050 >Feature sequence156 135 449 gene locus_tag LOCUS_67060 135 449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67060 727 2043 gene locus_tag LOCUS_67070 727 2043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920776.1 protein_id gnl|my_center|LOCUS_67070 2844 2320 gene locus_tag LOCUS_67080 2844 2320 CDS product DUF937 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142303.1 protein_id gnl|my_center|LOCUS_67080 3272 4825 gene locus_tag LOCUS_67090 3272 4825 CDS product DUF697 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056847.1 protein_id gnl|my_center|LOCUS_67090 5359 7197 gene locus_tag LOCUS_67100 5359 7197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67100 9343 7247 gene locus_tag LOCUS_67110 9343 7247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67110 9509 10216 gene locus_tag LOCUS_67120 9509 10216 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545876.1 protein_id gnl|my_center|LOCUS_67120 10398 11075 gene locus_tag LOCUS_67130 10398 11075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67130 14350 11213 gene locus_tag LOCUS_67140 14350 11213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67140 >Feature sequence157 3824 267 gene locus_tag LOCUS_67150 gene mfd 3824 267 CDS product transcription-repair coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056796.1 protein_id gnl|my_center|LOCUS_67150 4102 5454 gene locus_tag LOCUS_67160 4102 5454 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056829.1 protein_id gnl|my_center|LOCUS_67160 6323 5583 gene locus_tag LOCUS_67170 6323 5583 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142774.1 protein_id gnl|my_center|LOCUS_67170 7193 6483 gene locus_tag LOCUS_67180 7193 6483 CDS product DevA family ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056490.1 protein_id gnl|my_center|LOCUS_67180 8432 7278 gene locus_tag LOCUS_67190 gene devC 8432 7278 CDS product ABC transporter permease DevC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141427.1 protein_id gnl|my_center|LOCUS_67190 9931 8510 gene locus_tag LOCUS_67200 9931 8510 CDS product ABC exporter membrane fusion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056492.1 protein_id gnl|my_center|LOCUS_67200 11393 10602 gene locus_tag LOCUS_67210 11393 10602 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033687802.1 protein_id gnl|my_center|LOCUS_67210 12157 11420 gene locus_tag LOCUS_67220 12157 11420 CDS product phycocyanobilin:ferredoxin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058141.1 protein_id gnl|my_center|LOCUS_67220 12370 12627 gene locus_tag LOCUS_67230 12370 12627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67230 14005 13301 gene locus_tag LOCUS_67240 14005 13301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67240 >Feature sequence158 3461 2637 gene locus_tag LOCUS_67250 3461 2637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_67250 3757 3494 gene locus_tag LOCUS_67260 3757 3494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_67260 4189 5124 gene locus_tag LOCUS_67270 4189 5124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67270 5126 5770 gene locus_tag LOCUS_67280 5126 5770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67280 5806 6252 gene locus_tag LOCUS_67290 5806 6252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67290 6249 7544 gene locus_tag LOCUS_67300 6249 7544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67300 7541 8611 gene locus_tag LOCUS_67310 7541 8611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67310 8630 9334 gene locus_tag LOCUS_67320 gene queC 8630 9334 CDS product 7-cyano-7-deazaguanine synthase QueC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190026.1 protein_id gnl|my_center|LOCUS_67320 9331 9966 gene locus_tag LOCUS_67330 gene queE 9331 9966 CDS product 7-carboxy-7-deazaguanine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920995.1 protein_id gnl|my_center|LOCUS_67330 9963 10328 gene locus_tag LOCUS_67340 9963 10328 CDS product 6-carboxytetrahydropterin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085269.1 protein_id gnl|my_center|LOCUS_67340 11231 10350 gene locus_tag LOCUS_67350 11231 10350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67350 12815 11241 gene locus_tag LOCUS_67360 12815 11241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67360 >Feature sequence159 575 766 gene locus_tag LOCUS_67370 575 766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_67370 1827 3848 gene locus_tag LOCUS_67380 1827 3848 CDS product S8 family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816805.1 protein_id gnl|my_center|LOCUS_67380 3866 4120 gene locus_tag LOCUS_67390 3866 4120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67390 4151 4516 gene locus_tag LOCUS_67400 4151 4516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67400 4981 5187 gene locus_tag LOCUS_67410 4981 5187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67410 5405 7741 gene locus_tag LOCUS_67420 5405 7741 CDS product TOMM precursor leader peptide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227744.1 protein_id gnl|my_center|LOCUS_67420 7906 8100 gene locus_tag LOCUS_67430 7906 8100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67430 8288 12853 gene locus_tag LOCUS_67440 8288 12853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67440 >Feature sequence160 384 1130 gene locus_tag LOCUS_67450 384 1130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67450 1840 4311 gene locus_tag LOCUS_67460 1840 4311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67460 4330 7098 gene locus_tag LOCUS_67470 4330 7098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67470 12806 7095 gene locus_tag LOCUS_67480 12806 7095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67480 >Feature sequence161 339 115 gene locus_tag LOCUS_67490 339 115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67490 589 425 gene locus_tag LOCUS_67500 589 425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67500 1249 1007 gene locus_tag LOCUS_67510 1249 1007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67510 2610 1285 gene locus_tag LOCUS_67520 2610 1285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67520 3811 3578 gene locus_tag LOCUS_67530 3811 3578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67530 5054 4338 gene locus_tag LOCUS_67540 5054 4338 CDS product pirin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141821.1 protein_id gnl|my_center|LOCUS_67540 6139 5555 gene locus_tag LOCUS_67550 gene dps 6139 5555 CDS product DNA starvation/stationary phase protection protein Dps inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258826.1 protein_id gnl|my_center|LOCUS_67550 8803 6497 gene locus_tag LOCUS_67560 8803 6497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67560 10501 11868 gene locus_tag LOCUS_67570 10501 11868 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329291.1 protein_id gnl|my_center|LOCUS_67570 >Feature sequence162 163 6576 gene locus_tag LOCUS_67580 163 6576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67580 6750 8327 gene locus_tag LOCUS_67590 6750 8327 CDS product PAS domain S-box protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225982.1 protein_id gnl|my_center|LOCUS_67590 8495 10831 gene locus_tag LOCUS_67600 gene pcrA 8495 10831 CDS product DNA helicase PcrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058290.1 protein_id gnl|my_center|LOCUS_67600 11316 10909 gene locus_tag LOCUS_67610 11316 10909 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144197.1 protein_id gnl|my_center|LOCUS_67610 11695 11814 gene locus_tag LOCUS_67620 11695 11814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67620 >Feature sequence163 685 485 gene locus_tag LOCUS_67630 685 485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67630 1211 1912 gene locus_tag LOCUS_67640 1211 1912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67640 1836 4577 gene locus_tag LOCUS_67650 1836 4577 CDS product type I secretion system permease/ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268199.1 protein_id gnl|my_center|LOCUS_67650 4819 5604 gene locus_tag LOCUS_67660 4819 5604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67660 6207 5632 gene locus_tag LOCUS_67670 6207 5632 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142405.1 protein_id gnl|my_center|LOCUS_67670 7659 6391 gene locus_tag LOCUS_67680 7659 6391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67680 7778 8563 gene locus_tag LOCUS_67690 gene sfsA 7778 8563 CDS product DNA/RNA nuclease SfsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141732.1 protein_id gnl|my_center|LOCUS_67690 9454 8567 gene locus_tag LOCUS_67700 9454 8567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67700 10744 10214 gene locus_tag LOCUS_67710 10744 10214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_67710 10925 10764 gene locus_tag LOCUS_67720 10925 10764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67720 11137 10943 gene locus_tag LOCUS_67730 11137 10943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67730 >Feature sequence164 150 1256 gene locus_tag LOCUS_67740 150 1256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67740 3826 1382 gene locus_tag LOCUS_67750 3826 1382 CDS product DUF839 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144413.1 protein_id gnl|my_center|LOCUS_67750 4303 5136 gene locus_tag LOCUS_67760 4303 5136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67760 5656 5222 gene locus_tag LOCUS_67770 5656 5222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67770 6157 6336 gene locus_tag LOCUS_67780 6157 6336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67780 6336 10139 gene locus_tag LOCUS_67790 6336 10139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67790 10997 10362 gene locus_tag LOCUS_67800 gene aqpZ 10997 10362 CDS product aquaporin Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140371.1 protein_id gnl|my_center|LOCUS_67800 11390 11172 gene locus_tag LOCUS_67810 11390 11172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67810 >Feature sequence165 685 497 gene locus_tag LOCUS_67820 685 497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67820 978 7712 gene locus_tag LOCUS_67830 978 7712 CDS product HAMP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014400094.1 protein_id gnl|my_center|LOCUS_67830 8725 8952 gene locus_tag LOCUS_67840 8725 8952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67840 9159 10436 gene locus_tag LOCUS_67850 9159 10436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67850 10455 10970 gene locus_tag LOCUS_67860 10455 10970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67860 >Feature sequence166 459 151 gene locus_tag LOCUS_67870 459 151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67870 1896 598 gene locus_tag LOCUS_67880 1896 598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67880 2331 6002 gene locus_tag LOCUS_67890 gene smc 2331 6002 CDS product chromosome segregation protein SMC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057762.1 protein_id gnl|my_center|LOCUS_67890 6061 7056 gene locus_tag LOCUS_67900 6061 7056 CDS product PRC-barrel domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920765.1 protein_id gnl|my_center|LOCUS_67900 7595 7275 gene locus_tag LOCUS_67910 7595 7275 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058088.1 protein_id gnl|my_center|LOCUS_67910 7860 8789 gene locus_tag LOCUS_67920 7860 8789 CDS product cobalamin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141330.1 protein_id gnl|my_center|LOCUS_67920 9188 8901 gene locus_tag LOCUS_67930 9188 8901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67930 10413 9334 gene locus_tag LOCUS_67940 10413 9334 CDS product M4 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015370332.1 protein_id gnl|my_center|LOCUS_67940 >Feature sequence167 1736 270 gene locus_tag LOCUS_67950 gene glgA 1736 270 CDS product glycogen synthase GlgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056608.1 protein_id gnl|my_center|LOCUS_67950 2979 2008 gene locus_tag LOCUS_67960 gene hemC 2979 2008 CDS product hydroxymethylbilane synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057483.1 protein_id gnl|my_center|LOCUS_67960 3464 5185 gene locus_tag LOCUS_67970 3464 5185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67970 5641 6306 gene locus_tag LOCUS_67980 5641 6306 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256556.1 protein_id gnl|my_center|LOCUS_67980 6798 8072 gene locus_tag LOCUS_67990 6798 8072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67990 8080 8883 gene locus_tag LOCUS_68000 8080 8883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68000 10375 9098 gene locus_tag LOCUS_68010 10375 9098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68010 >Feature sequence168 3144 271 gene locus_tag LOCUS_68020 gene ileS 3144 271 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921027.1 protein_id gnl|my_center|LOCUS_68020 3442 3203 gene locus_tag LOCUS_68030 3442 3203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68030 4366 3563 gene locus_tag LOCUS_68040 4366 3563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68040 4637 6217 gene locus_tag LOCUS_68050 gene gndA 4637 6217 CDS product NADP-dependent phosphogluconate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056424.1 protein_id gnl|my_center|LOCUS_68050 7737 6547 gene locus_tag LOCUS_68060 7737 6547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68060 10423 7847 gene locus_tag LOCUS_68070 10423 7847 CDS product CHAT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_044205562.1 protein_id gnl|my_center|LOCUS_68070 >Feature sequence169 335 108 gene locus_tag LOCUS_68080 335 108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68080 1468 506 gene locus_tag LOCUS_68090 1468 506 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141892.1 protein_id gnl|my_center|LOCUS_68090 2845 1643 gene locus_tag LOCUS_68100 gene coaBC 2845 1643 CDS product bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921057.1 protein_id gnl|my_center|LOCUS_68100 3058 2846 gene locus_tag LOCUS_68110 3058 2846 CDS product DUF2555 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024125484.1 protein_id gnl|my_center|LOCUS_68110 3879 3247 gene locus_tag LOCUS_68120 3879 3247 CDS product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057873.1 protein_id gnl|my_center|LOCUS_68120 5115 4519 gene locus_tag LOCUS_68130 5115 4519 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043900134.1 protein_id gnl|my_center|LOCUS_68130 5926 5195 gene locus_tag LOCUS_68140 5926 5195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68140 6581 5928 gene locus_tag LOCUS_68150 6581 5928 CDS product DNA-3-methyladenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142016.1 protein_id gnl|my_center|LOCUS_68150 8432 7515 gene locus_tag LOCUS_68160 8432 7515 CDS product Mph(B) family macrolide 2'-phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000031017.1 protein_id gnl|my_center|LOCUS_68160 8691 10259 gene locus_tag LOCUS_68170 gene purH 8691 10259 CDS product bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057387.1 protein_id gnl|my_center|LOCUS_68170 >Feature sequence170 1420 2115 gene locus_tag LOCUS_68180 1420 2115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68180 2335 3069 gene locus_tag LOCUS_68190 2335 3069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68190 3519 4586 gene locus_tag LOCUS_68200 gene mtnA 3519 4586 CDS product S-methyl-5-thioribose-1-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056904.1 protein_id gnl|my_center|LOCUS_68200 6274 5165 gene locus_tag LOCUS_68210 6274 5165 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057593.1 protein_id gnl|my_center|LOCUS_68210 7016 6303 gene locus_tag LOCUS_68220 7016 6303 CDS product GUN4 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057433.1 protein_id gnl|my_center|LOCUS_68220 7811 9232 gene locus_tag LOCUS_68230 7811 9232 CDS product NADP-dependent isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125901.1 protein_id gnl|my_center|LOCUS_68230 9691 9422 gene locus_tag LOCUS_68240 9691 9422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68240 9994 9758 gene locus_tag LOCUS_68250 9994 9758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68250 10494 10192 gene locus_tag LOCUS_68260 10494 10192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68260 >Feature sequence171 1474 1674 gene locus_tag LOCUS_68270 1474 1674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68270 1836 4577 gene locus_tag LOCUS_68280 1836 4577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68280 5353 4979 gene locus_tag LOCUS_68290 5353 4979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68290 5391 7298 gene locus_tag LOCUS_68300 5391 7298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68300 7543 7851 gene locus_tag LOCUS_68310 7543 7851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68310 7984 10410 gene locus_tag LOCUS_68320 7984 10410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68320 >Feature sequence172 233 637 gene locus_tag LOCUS_68330 233 637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68330 790 1341 gene locus_tag LOCUS_68340 790 1341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68340 1630 2007 gene locus_tag LOCUS_68350 1630 2007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68350 1994 2338 gene locus_tag LOCUS_68360 1994 2338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68360 2331 2564 gene locus_tag LOCUS_68370 2331 2564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68370 2557 2826 gene locus_tag LOCUS_68380 2557 2826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68380 2835 3050 gene locus_tag LOCUS_68390 2835 3050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68390 3084 3431 gene locus_tag LOCUS_68400 3084 3431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68400 3433 3825 gene locus_tag LOCUS_68410 3433 3825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68410 3825 4538 gene locus_tag LOCUS_68420 3825 4538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68420 4610 6652 gene locus_tag LOCUS_68430 4610 6652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68430 6883 7335 gene locus_tag LOCUS_68440 6883 7335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68440 8435 8178 gene locus_tag LOCUS_68450 8435 8178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68450 8626 8841 gene locus_tag LOCUS_68460 8626 8841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68460 8853 9308 gene locus_tag LOCUS_68470 8853 9308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68470 9420 10535 gene locus_tag LOCUS_68480 9420 10535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68480 >Feature sequence173 1065 592 gene locus_tag LOCUS_68490 1065 592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68490 2041 1184 gene locus_tag LOCUS_68500 2041 1184 CDS product PDDEXK nuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143046.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_68500 2218 2051 gene locus_tag LOCUS_68510 2218 2051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_68510 2736 2347 gene locus_tag LOCUS_68520 2736 2347 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056577.1 protein_id gnl|my_center|LOCUS_68520 3209 2778 gene locus_tag LOCUS_68530 3209 2778 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942658.1 protein_id gnl|my_center|LOCUS_68530 3541 5049 gene locus_tag LOCUS_68540 gene malQ 3541 5049 CDS product 4-alpha-glucanotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056555.1 protein_id gnl|my_center|LOCUS_68540 5916 5104 gene locus_tag LOCUS_68550 5916 5104 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057337.1 protein_id gnl|my_center|LOCUS_68550 6708 5950 gene locus_tag LOCUS_68560 6708 5950 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056503.1 protein_id gnl|my_center|LOCUS_68560 6854 7567 gene locus_tag LOCUS_68570 6854 7567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68570 8325 7777 gene locus_tag LOCUS_68580 gene dps 8325 7777 CDS product DNA starvation/stationary phase protection protein Dps inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258826.1 protein_id gnl|my_center|LOCUS_68580 9658 8750 gene locus_tag LOCUS_68590 9658 8750 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143217.1 protein_id gnl|my_center|LOCUS_68590 >Feature sequence174 910 233 gene locus_tag LOCUS_68600 910 233 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707254.1 protein_id gnl|my_center|LOCUS_68600 1069 1449 gene locus_tag LOCUS_68610 1069 1449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141253.1 protein_id gnl|my_center|LOCUS_68610 1747 2061 gene locus_tag LOCUS_68620 1747 2061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058283.1 protein_id gnl|my_center|LOCUS_68620 2273 4000 gene locus_tag LOCUS_68630 2273 4000 CDS product succinate dehydrogenase/fumarate reductase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057217.1 protein_id gnl|my_center|LOCUS_68630 4377 4997 gene locus_tag LOCUS_68640 4377 4997 CDS product TMEM165/GDT1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056234.1 protein_id gnl|my_center|LOCUS_68640 5964 5065 gene locus_tag LOCUS_68650 5964 5065 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057037.1 protein_id gnl|my_center|LOCUS_68650 6311 7300 gene locus_tag LOCUS_68660 6311 7300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920996.1 protein_id gnl|my_center|LOCUS_68660 8538 7369 gene locus_tag LOCUS_68670 8538 7369 CDS product homocysteine biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058195.1 protein_id gnl|my_center|LOCUS_68670 9357 8683 gene locus_tag LOCUS_68680 9357 8683 CDS product alpha-ketoglutarate-dependent dioxygenase AlkB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000976220.1 protein_id gnl|my_center|LOCUS_68680 10209 9385 gene locus_tag LOCUS_68690 10209 9385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68690