COMMON DATATYPE type WGS KEYWORD keyword WGS KEYWORD keyword STANDARD_DRAFT DBLINK project biosample SUBMITTER ab_name ab_name ab_name contact email phone fax institute country city street zip REFERENCE title ab_name ab_name ab_name status Unpublished year COMMENT line Annotated by DFAST v.1.2.20 (https://dfast.nig.ac.jp) ST_COMMENT tagset_id Genome-Assembly-Data Assembly Method Genome Coverage Sequencing Technology sequence01 source 1..227397 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(4539..5603) product acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000827020.1 transl_table 11 codon_start 1 locus_tag LOCUS_00010 CDS complement(5819..6421) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004114736.1 transl_table 11 codon_start 1 locus_tag LOCUS_00020 CDS complement(6958..7800) product nucleotidyl transferase AbiEii/AbiGii toxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287519.1 transl_table 11 codon_start 1 locus_tag LOCUS_00030 CDS complement(7797..8384) product type IV toxin-antitoxin system AbiEi family antitoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287520.1 transl_table 11 codon_start 1 locus_tag LOCUS_00040 CDS complement(8722..9258) product alpha-ribazole phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964694.1 transl_table 11 codon_start 1 locus_tag LOCUS_00050 gene cobC CDS complement(9376..9882) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009994781.1 transl_table 11 codon_start 1 locus_tag LOCUS_00060 CDS complement(10039..10710) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00070 CDS complement(10703..11038) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00080 CDS complement(11038..11412) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00090 CDS complement(11412..11897) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00100 CDS complement(12140..12595) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00110 CDS complement(12664..12996) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00120 CDS 13399..13608 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00130 CDS 14885..15184 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00140 CDS complement(15280..15897) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00150 CDS complement(15967..16440) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00160 CDS complement(17217..18251) product acyl-CoA thioester hydrolase/BAAT C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262593.1 transl_table 11 codon_start 1 locus_tag LOCUS_00170 CDS complement(18384..18560) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00180 CDS complement(18646..18969) product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009994766.1 transl_table 11 codon_start 1 locus_tag LOCUS_00190 CDS complement(18969..19271) product type II toxin-antitoxin system RelB/DinJ family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004133089.1 transl_table 11 codon_start 1 locus_tag LOCUS_00200 CDS complement(19380..20858) product Lsa family ABC-F type ribosomal protection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004113321.1 transl_table 11 codon_start 1 locus_tag LOCUS_00210 CDS complement(21034..21228) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00220 note possible pseudo, internal stop codon CDS 21718..22023 product type II toxin-antitoxin system RelB/DinJ family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009994780.1 transl_table 11 codon_start 1 locus_tag LOCUS_00230 CDS 22020..22346 product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004113282.1 transl_table 11 codon_start 1 locus_tag LOCUS_00240 CDS complement(22612..23244) product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009994774.1 transl_table 11 codon_start 1 locus_tag LOCUS_00250 CDS complement(23825..24010) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00260 note possible pseudo, internal stop codon CDS complement(24256..24687) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004113272.1 transl_table 11 codon_start 1 locus_tag LOCUS_00270 CDS complement(24926..25897) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00280 CDS 26997..27413 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00290 CDS 27416..27619 product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861845.1 transl_table 11 codon_start 1 locus_tag LOCUS_00300 CDS complement(27813..27989) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00310 note possible pseudo, internal stop codon, frameshifted CDS complement(27967..28131) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00320 note possible pseudo, internal stop codon, frameshifted CDS complement(28188..28772) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948624.1 transl_table 11 codon_start 1 locus_tag LOCUS_00330 CDS complement(28938..29372) product cytidine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000355907.1 transl_table 11 codon_start 1 locus_tag LOCUS_00340 CDS complement(29570..30067) product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004574859.1 transl_table 11 codon_start 1 locus_tag LOCUS_00350 CDS complement(30290..31051) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00360 note possible pseudo, frameshifted CDS complement(31030..31317) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00370 note possible pseudo, frameshifted CDS complement(31572..31730) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00380 CDS complement(32335..33423) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00390 CDS complement(34384..34701) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00400 CDS complement(34873..36216) product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546298.1 transl_table 11 codon_start 1 locus_tag LOCUS_00410 gene rlmD CDS 36572..37951 product Na+/H+ antiporter NhaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546295.1 transl_table 11 codon_start 1 locus_tag LOCUS_00420 gene nhaC CDS 38026..38739 product Bax inhibitor-1/YccA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640270.1 transl_table 11 codon_start 1 locus_tag LOCUS_00430 CDS complement(38783..39454) product L,D-transpeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548465.1 transl_table 11 codon_start 1 locus_tag LOCUS_00440 CDS complement(39543..40451) product diacylglycerol kinase family lipid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546288.1 transl_table 11 codon_start 1 locus_tag LOCUS_00450 CDS complement(40471..41901) product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254176.1 transl_table 11 codon_start 1 locus_tag LOCUS_00460 gene gatB CDS complement(41905..43344) product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546285.1 transl_table 11 codon_start 1 locus_tag LOCUS_00470 gene gatA CDS complement(43344..43646) product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546283.1 transl_table 11 codon_start 1 locus_tag LOCUS_00480 gene gatC CDS complement(43657..44787) product CamS family sex pheromone protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546280.1 transl_table 11 codon_start 1 locus_tag LOCUS_00490 CDS complement(44793..46811) product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546277.1 transl_table 11 codon_start 1 locus_tag LOCUS_00500 gene ligA CDS complement(46825..49053) product DNA helicase PcrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546275.1 transl_table 11 codon_start 1 locus_tag LOCUS_00510 gene pcrA CDS complement(49155..49766) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00520 CDS complement(49769..50380) product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254627.1 transl_table 11 codon_start 1 locus_tag LOCUS_00530 tRNA complement(50439..50524) product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00010 CDS complement(50596..51738) product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254072.1 transl_table 11 codon_start 1 locus_tag LOCUS_00540 CDS complement(51885..54548) product calcium-translocating P-type ATPase, PMCA-type inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546265.1 transl_table 11 codon_start 1 locus_tag LOCUS_00550 CDS complement(54734..55570) product ammonia-dependent NAD(+) synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546262.1 transl_table 11 codon_start 1 locus_tag LOCUS_00560 gene nadE CDS complement(55573..57051) product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254174.1 transl_table 11 codon_start 1 locus_tag LOCUS_00570 CDS complement(57093..57791) product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546270.1 transl_table 11 codon_start 1 locus_tag LOCUS_00580 CDS complement(57854..58942) product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546257.1 transl_table 11 codon_start 1 locus_tag LOCUS_00590 CDS complement(58979..59704) product WecB/TagA/CpsF family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546254.1 transl_table 11 codon_start 1 locus_tag LOCUS_00600 CDS complement(59708..61135) product oligosaccharide flippase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254175.1 transl_table 11 codon_start 1 locus_tag LOCUS_00610 CDS complement(61150..62283) product CDP-glycerol--glycerophosphate glycerophosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546266.1 transl_table 11 codon_start 1 locus_tag LOCUS_00620 CDS 62420..62809 product glycerol-3-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254173.1 transl_table 11 codon_start 1 locus_tag LOCUS_00630 gene tagD CDS complement(63702..64562) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00640 CDS 64669..65922 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775182.1 transl_table 11 codon_start 1 locus_tag LOCUS_00650 CDS complement(66022..66723) product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546250.1 transl_table 11 codon_start 1 locus_tag LOCUS_00660 tRNA complement(66854..66927) product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00020 tRNA complement(66933..67016) product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00030 CDS complement(67127..68035) product L-lactate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548290.1 transl_table 11 codon_start 1 locus_tag LOCUS_00670 tRNA complement(68148..68221) product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00040 CDS complement(68278..69441) product hydroxymethylglutaryl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546460.1 transl_table 11 codon_start 1 locus_tag LOCUS_00680 CDS complement(69441..70649) product hydroxymethylglutaryl-CoA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546459.1 transl_table 11 codon_start 1 locus_tag LOCUS_00690 CDS complement(70646..71812) product thiolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546457.1 transl_table 11 codon_start 1 locus_tag LOCUS_00700 CDS 72050..72610 product peptidoglycan-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546204.1 transl_table 11 codon_start 1 locus_tag LOCUS_00710 CDS complement(72683..72967) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00720 CDS complement(73247..74620) product branched-chain amino acid transport system II carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254324.1 transl_table 11 codon_start 1 locus_tag LOCUS_00730 gene brnQ CDS complement(75011..76165) product ArgE/DapE family deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475542.1 transl_table 11 codon_start 1 locus_tag LOCUS_00740 CDS complement(76276..77115) product MetQ/NlpA family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475539.1 transl_table 11 codon_start 1 locus_tag LOCUS_00750 CDS complement(77509..79875) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00760 CDS complement(79885..80679) product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815052.1 transl_table 11 codon_start 1 locus_tag LOCUS_00770 CDS complement(80679..81350) product metal ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001059661.1 transl_table 11 codon_start 1 locus_tag LOCUS_00780 CDS complement(81343..82254) product metal ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003728914.1 transl_table 11 codon_start 1 locus_tag LOCUS_00790 CDS complement(82416..82937) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00800 CDS complement(83047..83505) product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003550138.1 transl_table 11 codon_start 1 locus_tag LOCUS_00810 gene smpB CDS complement(83508..85784) product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003550136.1 transl_table 11 codon_start 1 locus_tag LOCUS_00820 gene rnr CDS complement(85855..86088) product preprotein translocase subunit SecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254157.1 transl_table 11 codon_start 1 locus_tag LOCUS_00830 gene secG CDS complement(86207..87505) product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003564271.1 transl_table 11 codon_start 1 locus_tag LOCUS_00840 gene eno CDS complement(87556..88311) product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546605.1 transl_table 11 codon_start 1 locus_tag LOCUS_00850 gene tpiA CDS complement(88329..89543) product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546602.1 transl_table 11 codon_start 1 locus_tag LOCUS_00860 CDS complement(89652..90668) product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546601.1 transl_table 11 codon_start 1 locus_tag LOCUS_00870 gene gap CDS complement(90725..91756) product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546600.1 transl_table 11 codon_start 1 locus_tag LOCUS_00880 tRNA 91984..92055 product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00050 CDS 92270..92854 product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546597.1 transl_table 11 codon_start 1 locus_tag LOCUS_00890 gene clpP CDS complement(92953..94221) product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809085.1 transl_table 11 codon_start 1 locus_tag LOCUS_00900 CDS complement(94237..95733) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00910 CDS complement(95726..96670) product DNA-binding protein WhiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546596.1 transl_table 11 codon_start 1 locus_tag LOCUS_00920 gene whiA CDS complement(96670..97704) product YvcK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546595.1 transl_table 11 codon_start 1 locus_tag LOCUS_00930 CDS complement(97717..98592) product RNase adapter RapZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546593.1 transl_table 11 codon_start 1 locus_tag LOCUS_00940 gene rapZ CDS complement(98640..101456) product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546588.1 transl_table 11 codon_start 1 locus_tag LOCUS_00950 gene uvrA CDS complement(101484..103481) product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546586.1 transl_table 11 codon_start 1 locus_tag LOCUS_00960 gene uvrB CDS complement(103539..105266) product phospho-sugar mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546584.1 transl_table 11 codon_start 1 locus_tag LOCUS_00970 CDS complement(105283..106209) product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254223.1 transl_table 11 codon_start 1 locus_tag LOCUS_00980 gene trxB CDS complement(106229..107248) product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546563.1 transl_table 11 codon_start 1 locus_tag LOCUS_00990 CDS complement(107285..107986) product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015613330.1 transl_table 11 codon_start 1 locus_tag LOCUS_01000 gene lgt CDS complement(108134..109072) product HPr(Ser) kinase/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546560.1 transl_table 11 codon_start 1 locus_tag LOCUS_01010 gene hprK CDS complement(109076..109372) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01020 CDS complement(109389..110387) product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_095522727.1 transl_table 11 codon_start 1 locus_tag LOCUS_01030 gene prfB CDS complement(110547..112946) product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254222.1 transl_table 11 codon_start 1 locus_tag LOCUS_01040 gene secA CDS complement(113109..113666) product ribosome-associated translation inhibitor RaiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254221.1 transl_table 11 codon_start 1 locus_tag LOCUS_01050 gene raiA CDS complement(113747..114430) product ComF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254220.1 transl_table 11 codon_start 1 locus_tag LOCUS_01060 CDS complement(114408..115697) product helicase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546538.1 transl_table 11 codon_start 1 locus_tag LOCUS_01070 CDS 115739..116404 product YigZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546537.1 transl_table 11 codon_start 1 locus_tag LOCUS_01080 CDS complement(116451..117587) product MraY family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546535.1 transl_table 11 codon_start 1 locus_tag LOCUS_01090 CDS complement(117683..119314) product ribonuclease Y inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254219.1 transl_table 11 codon_start 1 locus_tag LOCUS_01100 gene rny CDS complement(119398..120435) product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546531.1 transl_table 11 codon_start 1 locus_tag LOCUS_01110 gene recA CDS complement(120558..121136) product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546529.1 transl_table 11 codon_start 1 locus_tag LOCUS_01120 gene pgsA CDS complement(121139..122215) product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546527.1 transl_table 11 codon_start 1 locus_tag LOCUS_01130 CDS complement(122324..123547) product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546521.1 transl_table 11 codon_start 1 locus_tag LOCUS_01140 CDS complement(123544..124758) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01150 CDS complement(124763..127027) product DNA translocase FtsK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546517.1 transl_table 11 codon_start 1 locus_tag LOCUS_01160 CDS complement(127043..127450) product DUF1149 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546515.1 transl_table 11 codon_start 1 locus_tag LOCUS_01170 CDS complement(127461..127973) product tRNA (cytidine(34)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546513.1 transl_table 11 codon_start 1 locus_tag LOCUS_01180 CDS complement(128074..129216) product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546511.1 transl_table 11 codon_start 1 locus_tag LOCUS_01190 CDS complement(129226..129606) product PTS glucitol/sorbitol transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101685.1 transl_table 11 codon_start 1 locus_tag LOCUS_01200 CDS 129742..130761 product lactonase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546505.1 transl_table 11 codon_start 1 locus_tag LOCUS_01210 CDS 130770..131603 product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003564150.1 transl_table 11 codon_start 1 locus_tag LOCUS_01220 CDS complement(131643..132545) product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546500.1 transl_table 11 codon_start 1 locus_tag LOCUS_01230 CDS complement(132538..133347) product NAD kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254215.1 transl_table 11 codon_start 1 locus_tag LOCUS_01240 CDS complement(133344..133970) product GTP pyrophosphokinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546495.1 transl_table 11 codon_start 1 locus_tag LOCUS_01250 CDS 134048..134662 product CYTH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546493.1 transl_table 11 codon_start 1 locus_tag LOCUS_01260 CDS 134727..135344 product DsbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546492.1 transl_table 11 codon_start 1 locus_tag LOCUS_01270 CDS complement(135337..136206) product competence protein CoiA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254214.1 transl_table 11 codon_start 1 locus_tag LOCUS_01280 CDS complement(136284..137060) product adaptor protein MecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546487.1 transl_table 11 codon_start 1 locus_tag LOCUS_01290 CDS complement(137151..137549) product transcriptional regulator SpxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254213.1 transl_table 11 codon_start 1 locus_tag LOCUS_01300 gene spxA CDS 137766..138260 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01310 CDS 138322..138747 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01320 CDS complement(138784..139644) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01330 CDS complement(139779..141776) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01340 CDS complement(141959..143260) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01350 CDS 143564..144226 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01360 CDS complement(144468..145568) product GH25 family lysozyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254618.1 transl_table 11 codon_start 1 locus_tag LOCUS_01370 CDS complement(145580..146884) product beta-N-acetylglucosaminidase AcmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548795.1 transl_table 11 codon_start 1 locus_tag LOCUS_01380 gene acmB CDS complement(147077..147343) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01390 CDS complement(147380..147592) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01400 CDS 147791..148225 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548785.1 transl_table 11 codon_start 1 locus_tag LOCUS_01410 CDS 148338..150410 product KUP/HAK/KT family potassium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254197.1 transl_table 11 codon_start 1 locus_tag LOCUS_01420 CDS 150524..151708 product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011675074.1 transl_table 11 codon_start 1 locus_tag LOCUS_01430 CDS complement(151767..152558) product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015613417.1 transl_table 11 codon_start 1 locus_tag LOCUS_01440 CDS complement(152562..153215) product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254570.1 transl_table 11 codon_start 1 locus_tag LOCUS_01450 CDS complement(153238..154026) product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367542.1 transl_table 11 codon_start 1 locus_tag LOCUS_01460 CDS complement(154168..155364) product bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254293.1 transl_table 11 codon_start 1 locus_tag LOCUS_01470 gene coaBC CDS complement(155487..159152) product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254109.1 transl_table 11 codon_start 1 locus_tag LOCUS_01480 gene rpoC CDS complement(159171..162845) product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254108.1 transl_table 11 codon_start 1 locus_tag LOCUS_01490 CDS complement(163057..165480) product ATP-dependent Clp protease ATP-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549016.1 transl_table 11 codon_start 1 locus_tag LOCUS_01500 CDS complement(165563..166741) product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475674.1 transl_table 11 codon_start 1 locus_tag LOCUS_01510 CDS complement(166859..167368) product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700992.1 transl_table 11 codon_start 1 locus_tag LOCUS_01520 CDS complement(167358..168212) product pyridoxamine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262821.1 transl_table 11 codon_start 1 locus_tag LOCUS_01530 tRNA complement(168226..168301) product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00060 tRNA complement(168340..168411) product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00070 CDS complement(168465..169976) product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254107.1 transl_table 11 codon_start 1 locus_tag LOCUS_01540 gene lysS CDS complement(169994..170929) product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254106.1 transl_table 11 codon_start 1 locus_tag LOCUS_01550 gene dusB CDS complement(171069..173114) product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254105.1 transl_table 11 codon_start 1 locus_tag LOCUS_01560 gene ftsH CDS complement(173198..174490) product tRNA lysidine(34) synthetase TilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549010.1 transl_table 11 codon_start 1 locus_tag LOCUS_01570 gene tilS CDS complement(174521..174859) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01580 CDS complement(174859..175233) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01590 CDS complement(175316..175558) product RNA-binding S4 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254102.1 transl_table 11 codon_start 1 locus_tag LOCUS_01600 CDS complement(175572..178904) product transcription-repair coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254101.1 transl_table 11 codon_start 1 locus_tag LOCUS_01610 gene mfd CDS complement(178926..179483) product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549001.1 transl_table 11 codon_start 1 locus_tag LOCUS_01620 gene pth CDS 179622..180593 product L-lactate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549000.1 transl_table 11 codon_start 1 locus_tag LOCUS_01630 CDS 180734..181417 product cyclic di-AMP binding protein CbpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254100.1 transl_table 11 codon_start 1 locus_tag LOCUS_01640 gene cbpA CDS complement(181493..182620) product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548996.1 transl_table 11 codon_start 1 locus_tag LOCUS_01650 gene alr CDS complement(182624..182980) product holo-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254099.1 transl_table 11 codon_start 1 locus_tag LOCUS_01660 gene acpS CDS complement(183103..184566) product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548992.1 transl_table 11 codon_start 1 locus_tag LOCUS_01670 CDS complement(184582..185949) product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548990.1 transl_table 11 codon_start 1 locus_tag LOCUS_01680 CDS complement(186088..186339) product type B 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548978.1 transl_table 11 codon_start 1 locus_tag LOCUS_01690 CDS 186653..187981 product SLC45 family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644357.1 transl_table 11 codon_start 1 locus_tag LOCUS_01700 CDS 188131..188901 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01710 CDS complement(188903..189913) product DNA cytosine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010951379.1 transl_table 11 codon_start 1 locus_tag LOCUS_01720 CDS 190411..190716 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01730 CDS 190884..191087 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01740 CDS 191044..191319 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01750 note possible pseudo, internal stop codon CDS complement(191670..193766) product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001245433.1 transl_table 11 codon_start 1 locus_tag LOCUS_01760 CDS complement(193786..194235) product CopY/TcrY family copper transport repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000103844.1 transl_table 11 codon_start 1 locus_tag LOCUS_01770 CDS complement(194985..195281) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01780 CDS complement(195247..195435) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01790 note possible pseudo, frameshifted CDS complement(195838..198132) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01800 CDS complement(198699..198884) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01810 CDS complement(198889..199191) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01820 CDS 199244..199498 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01830 CDS 199663..199914 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01840 CDS complement(199904..203494) product Eco57I restriction-modification methylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766276.1 transl_table 11 codon_start 1 locus_tag LOCUS_01850 CDS complement(203522..204274) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01860 CDS complement(204476..206029) product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548925.1 transl_table 11 codon_start 1 locus_tag LOCUS_01870 gene guaA CDS 206368..206946 product xanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476270.1 transl_table 11 codon_start 1 locus_tag LOCUS_01880 CDS 206946..208229 product nucleobase:cation symporter-2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548915.1 transl_table 11 codon_start 1 locus_tag LOCUS_01890 CDS complement(208308..208670) product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254128.1 transl_table 11 codon_start 1 locus_tag LOCUS_01900 gene rplL CDS complement(208715..209215) product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549105.1 transl_table 11 codon_start 1 locus_tag LOCUS_01910 gene rplJ CDS complement(209458..210150) product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549096.1 transl_table 11 codon_start 1 locus_tag LOCUS_01920 gene rplA CDS complement(210247..210672) product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549095.1 transl_table 11 codon_start 1 locus_tag LOCUS_01930 gene rplK CDS complement(210814..211365) product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549094.1 transl_table 11 codon_start 1 locus_tag LOCUS_01940 gene nusG CDS complement(211443..211610) product preprotein translocase subunit SecE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549093.1 transl_table 11 codon_start 1 locus_tag LOCUS_01950 gene secE CDS complement(211616..211765) product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549092.1 transl_table 11 codon_start 1 locus_tag LOCUS_01960 gene rpmG CDS 211949..213169 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813994.1 transl_table 11 codon_start 1 locus_tag LOCUS_01970 CDS complement(213283..213828) product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287436.1 transl_table 11 codon_start 1 locus_tag LOCUS_01980 CDS complement(213941..214717) product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254123.1 transl_table 11 codon_start 1 locus_tag LOCUS_01990 gene rlmB CDS complement(214698..215141) product Mini-ribonuclease 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549083.1 transl_table 11 codon_start 1 locus_tag LOCUS_02000 CDS complement(215128..216540) product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549082.1 transl_table 11 codon_start 1 locus_tag LOCUS_02010 gene cysS CDS complement(216661..218160) product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254122.1 transl_table 11 codon_start 1 locus_tag LOCUS_02020 gene gltX CDS complement(218240..219619) product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549080.1 transl_table 11 codon_start 1 locus_tag LOCUS_02030 gene radA CDS complement(219619..220170) product dUTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254121.1 transl_table 11 codon_start 1 locus_tag LOCUS_02040 CDS 220318..221664 product aminopeptidase C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549077.1 transl_table 11 codon_start 1 locus_tag LOCUS_02050 gene pepC CDS complement(221705..222640) product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549076.1 transl_table 11 codon_start 1 locus_tag LOCUS_02060 CDS complement(222704..223381) product 2,3-bisphosphoglycerate-dependent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021721658.1 transl_table 11 codon_start 1 locus_tag LOCUS_02070 CDS complement(223383..223583) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02080 CDS complement(223586..223822) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02090 CDS complement(223847..224734) product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549073.1 transl_table 11 codon_start 1 locus_tag LOCUS_02100 CDS complement(224749..225438) product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549072.1 transl_table 11 codon_start 1 locus_tag LOCUS_02110 CDS 225582..226160 product DJ-1/PfpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549069.1 transl_table 11 codon_start 1 locus_tag LOCUS_02120 CDS complement(226175..226498) product multidrug efflux SMR transporter subunit EbrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245163.1 transl_table 11 codon_start 1 locus_tag LOCUS_02130 gene ebrB misc_feature complement(226536..>227397) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002367673.1:pheromone response LPXTG-anchored adhesin PrgC locus_tag LOCUS_02140 sequence02 source 1..116748 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(142..891) product YibE/F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548732.1 transl_table 11 codon_start 1 locus_tag LOCUS_02150 CDS complement(903..1988) product YibE/F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548730.1 transl_table 11 codon_start 1 locus_tag LOCUS_02160 CDS complement(2008..2676) product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254052.1 transl_table 11 codon_start 1 locus_tag LOCUS_02170 CDS complement(2701..3783) product D-alanine--D-alanine ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548727.1 transl_table 11 codon_start 1 locus_tag LOCUS_02180 CDS 4017..5456 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02190 CDS 5894..6289 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02200 CDS 6291..6902 product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476045.1 transl_table 11 codon_start 1 locus_tag LOCUS_02210 CDS 7232..7435 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02220 note possible pseudo, internal stop codon, frameshifted CDS 7438..7782 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02230 note possible pseudo, frameshifted CDS complement(8023..8421) product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870381.1 transl_table 11 codon_start 1 locus_tag LOCUS_02240 CDS complement(8549..9376) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02250 CDS complement(9384..10049) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254049.1 transl_table 11 codon_start 1 locus_tag LOCUS_02260 CDS complement(10206..11195) product ribose-phosphate diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548712.1 transl_table 11 codon_start 1 locus_tag LOCUS_02270 CDS complement(11284..11940) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254047.1 transl_table 11 codon_start 1 locus_tag LOCUS_02280 CDS complement(11970..12776) product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254046.1 transl_table 11 codon_start 1 locus_tag LOCUS_02290 CDS 12911..13876 product DUF1002 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548693.1 transl_table 11 codon_start 1 locus_tag LOCUS_02300 CDS complement(13915..14565) product ribonuclease H family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003702912.1 transl_table 11 codon_start 1 locus_tag LOCUS_02310 CDS 14646..16091 product cardiolipin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548687.1 transl_table 11 codon_start 1 locus_tag LOCUS_02320 gene cls CDS 16228..16359 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02330 CDS 16475..18082 product ABC transporter substrate-binding protein/permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254042.1 transl_table 11 codon_start 1 locus_tag LOCUS_02340 CDS 18075..18830 product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548674.1 transl_table 11 codon_start 1 locus_tag LOCUS_02350 CDS complement(18890..20593) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012914013.1 transl_table 11 codon_start 1 locus_tag LOCUS_02360 CDS complement(20771..21691) product HNH endonuclease signature motif containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254041.1 transl_table 11 codon_start 1 locus_tag LOCUS_02370 CDS complement(21692..22339) product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254040.1 transl_table 11 codon_start 1 locus_tag LOCUS_02380 CDS complement(22453..22587) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548644.1 transl_table 11 codon_start 1 locus_tag LOCUS_02390 CDS complement(22644..23015) product iron-sulfur cluster biosynthesis family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548621.1 transl_table 11 codon_start 1 locus_tag LOCUS_02400 CDS 23223..24329 product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254034.1 transl_table 11 codon_start 1 locus_tag LOCUS_02410 CDS 24345..24896 product LemA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254033.1 transl_table 11 codon_start 1 locus_tag LOCUS_02420 CDS 25028..25792 product zinc metalloprotease HtpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254032.1 transl_table 11 codon_start 1 locus_tag LOCUS_02430 gene htpX CDS 25997..26545 product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643692.1 transl_table 11 codon_start 1 locus_tag LOCUS_02440 CDS 26520..27893 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548609.1 transl_table 11 codon_start 1 locus_tag LOCUS_02450 CDS 27907..28563 product energy-coupling factor transporter transmembrane component T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548607.1 transl_table 11 codon_start 1 locus_tag LOCUS_02460 CDS complement(28566..29081) product 23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548590.1 transl_table 11 codon_start 1 locus_tag LOCUS_02470 gene rlmH CDS complement(29597..30769) product trypsin-like peptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015613276.1 transl_table 11 codon_start 1 locus_tag LOCUS_02480 CDS complement(30805..31602) product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254029.1 transl_table 11 codon_start 1 locus_tag LOCUS_02490 CDS complement(31627..32463) product two-component system regulatory protein YycI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548584.1 transl_table 11 codon_start 1 locus_tag LOCUS_02500 CDS complement(32453..33787) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548582.1 transl_table 11 codon_start 1 locus_tag LOCUS_02510 CDS complement(33777..35615) product cell wall metabolism sensor histidine kinase WalK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254027.1 transl_table 11 codon_start 1 locus_tag LOCUS_02520 gene walK CDS complement(35657..36361) product response regulator YycF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548578.1 transl_table 11 codon_start 1 locus_tag LOCUS_02530 gene yycF tRNA 36566..36640 product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00080 CDS complement(36690..38027) product nucleobase:cation symporter-2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356719.1 transl_table 11 codon_start 1 locus_tag LOCUS_02540 CDS complement(38051..39400) product guanine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002379675.1 transl_table 11 codon_start 1 locus_tag LOCUS_02550 gene guaD CDS 39634..39921 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02560 CDS complement(40132..40392) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02570 CDS complement(40665..41576) product prolyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003550037.1 transl_table 11 codon_start 1 locus_tag LOCUS_02580 CDS complement(41626..42978) product branched-chain amino acid transport system II carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476479.1 transl_table 11 codon_start 1 locus_tag LOCUS_02590 gene brnQ CDS complement(43070..44521) product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549250.1 transl_table 11 codon_start 1 locus_tag LOCUS_02600 CDS complement(44639..45466) product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549252.1 transl_table 11 codon_start 1 locus_tag LOCUS_02610 CDS complement(45486..46178) product YjjG family noncanonical pyrimidine nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025079808.1 transl_table 11 codon_start 1 locus_tag LOCUS_02620 CDS complement(46184..46705) product DUF1836 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476576.1 transl_table 11 codon_start 1 locus_tag LOCUS_02630 CDS 46828..47664 product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476577.1 transl_table 11 codon_start 1 locus_tag LOCUS_02640 CDS 47917..48930 product class 1b ribonucleoside-diphosphate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001192437.1 transl_table 11 codon_start 1 locus_tag LOCUS_02650 gene nrdF CDS 48932..49357 product class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011167010.1 transl_table 11 codon_start 1 locus_tag LOCUS_02660 gene nrdI CDS 49347..51524 product class 1b ribonucleoside-diphosphate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000194382.1 transl_table 11 codon_start 1 locus_tag LOCUS_02670 gene nrdE CDS complement(51613..53505) product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549419.1 transl_table 11 codon_start 1 locus_tag LOCUS_02680 gene mnmG CDS complement(53517..54902) product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549418.1 transl_table 11 codon_start 1 locus_tag LOCUS_02690 gene mnmE CDS complement(55002..55877) product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254638.1 transl_table 11 codon_start 1 locus_tag LOCUS_02700 CDS complement(55879..56250) product ribonuclease P protein component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549413.1 transl_table 11 codon_start 1 locus_tag LOCUS_02710 gene rnpA CDS complement(56300..56440) product 50S ribosomal protein L34 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549412.1 transl_table 11 codon_start 1 locus_tag LOCUS_02720 gene rpmH CDS 56919..58280 product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011253999.1 transl_table 11 codon_start 1 locus_tag LOCUS_02730 gene dnaA CDS 58452..59582 product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549381.1 transl_table 11 codon_start 1 locus_tag LOCUS_02740 gene dnaN CDS 59785..60030 product S4 domain-containing protein YaaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254000.1 transl_table 11 codon_start 1 locus_tag LOCUS_02750 gene yaaA CDS 60034..61155 product DNA replication/repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549377.1 transl_table 11 codon_start 1 locus_tag LOCUS_02760 gene recF CDS 61156..63117 product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549374.1 transl_table 11 codon_start 1 locus_tag LOCUS_02770 gene gyrB CDS 63127..65574 product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549372.1 transl_table 11 codon_start 1 locus_tag LOCUS_02780 gene gyrA CDS 65752..66048 product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549370.1 transl_table 11 codon_start 1 locus_tag LOCUS_02790 gene rpsF CDS 66084..66539 product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254001.1 transl_table 11 codon_start 1 locus_tag LOCUS_02800 gene ssb CDS 66568..66804 product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003701427.1 transl_table 11 codon_start 1 locus_tag LOCUS_02810 gene rpsR CDS 66972..68987 product DHH family phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549345.1 transl_table 11 codon_start 1 locus_tag LOCUS_02820 CDS 69003..69458 product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549343.1 transl_table 11 codon_start 1 locus_tag LOCUS_02830 gene rplI CDS 69464..70837 product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549341.1 transl_table 11 codon_start 1 locus_tag LOCUS_02840 gene dnaB CDS 72876..73025 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02850 CDS 73066..73419 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02860 CDS 73394..73930 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02870 CDS 74007..74315 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02880 CDS 74390..76237 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02890 CDS complement(77368..77550) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02900 CDS complement(77513..77782) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02910 CDS complement(78379..79545) product DUF2974 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254005.1 transl_table 11 codon_start 1 locus_tag LOCUS_02920 CDS complement(79552..80238) product MgtC/SapB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966920.1 transl_table 11 codon_start 1 locus_tag LOCUS_02930 tRNA 80386..80458 product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00090 CDS 80709..81089 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02940 CDS 81111..82337 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254348.1 transl_table 11 codon_start 1 locus_tag LOCUS_02950 CDS 82455..82820 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02960 note possible pseudo, internal stop codon, frameshifted CDS 83009..83260 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02970 note possible pseudo, internal stop codon, frameshifted CDS 83526..84914 product NADP-dependent phosphogluconate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254636.1 transl_table 11 codon_start 1 locus_tag LOCUS_02980 gene gndA CDS 84982..86532 product ClC family H(+)/Cl(-) exchange transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549425.1 transl_table 11 codon_start 1 locus_tag LOCUS_02990 CDS complement(86684..88003) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101374.1 transl_table 11 codon_start 1 locus_tag LOCUS_03000 CDS complement(88015..89325) product NCS2 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025014283.1 transl_table 11 codon_start 1 locus_tag LOCUS_03010 CDS 89667..90764 product BMP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549489.1 transl_table 11 codon_start 1 locus_tag LOCUS_03020 CDS 90900..91988 product BMP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549489.1 transl_table 11 codon_start 1 locus_tag LOCUS_03030 CDS 92038..93576 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549479.1 transl_table 11 codon_start 1 locus_tag LOCUS_03040 CDS 93585..94697 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549477.1 transl_table 11 codon_start 1 locus_tag LOCUS_03050 CDS 94697..95653 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549473.1 transl_table 11 codon_start 1 locus_tag LOCUS_03060 CDS complement(95682..96638) product ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101341.1 transl_table 11 codon_start 1 locus_tag LOCUS_03070 gene hemH CDS complement(96811..98304) product peptide MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254595.1 transl_table 11 codon_start 1 locus_tag LOCUS_03080 CDS 98494..99198 product glucosamine-6-phosphate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549469.1 transl_table 11 codon_start 1 locus_tag LOCUS_03090 gene nagB CDS 99318..99962 product deoxynucleoside kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549467.1 transl_table 11 codon_start 1 locus_tag LOCUS_03100 CDS 99975..100640 product deoxynucleoside kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549464.1 transl_table 11 codon_start 1 locus_tag LOCUS_03110 CDS 100662..101972 product NCS2 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549459.1 transl_table 11 codon_start 1 locus_tag LOCUS_03120 CDS 101990..102637 product type II CAAX endopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549496.1 transl_table 11 codon_start 1 locus_tag LOCUS_03130 CDS complement(102685..103845) product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549506.1 transl_table 11 codon_start 1 locus_tag LOCUS_03140 CDS complement(104031..104522) product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549510.1 transl_table 11 codon_start 1 locus_tag LOCUS_03150 CDS 104671..105819 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549513.1 transl_table 11 codon_start 1 locus_tag LOCUS_03160 CDS 105836..106132 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03170 CDS 106195..106350 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03180 CDS 106369..107886 product D-alanine--poly(phosphoribitol) ligase subunit DltA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549519.1 transl_table 11 codon_start 1 locus_tag LOCUS_03190 gene dltA CDS 107883..109100 product D-alanyl-lipoteichoic acid biosynthesis protein DltB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254621.1 transl_table 11 codon_start 1 locus_tag LOCUS_03200 gene dltB CDS 109146..109385 product D-alanine--poly(phosphoribitol) ligase subunit DltC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549523.1 transl_table 11 codon_start 1 locus_tag LOCUS_03210 gene dltC CDS 109378..111663 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03220 CDS complement(111715..114156) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015613435.1 transl_table 11 codon_start 1 locus_tag LOCUS_03230 CDS complement(114166..114867) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549550.1 transl_table 11 codon_start 1 locus_tag LOCUS_03240 CDS 115064..116479 product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003701275.1 transl_table 11 codon_start 1 locus_tag LOCUS_03250 sequence03 source 1..97958 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 249..1238 product mannose/fructose/sorbose PTS transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003702191.1 transl_table 11 codon_start 1 locus_tag LOCUS_03260 CDS 1266..2060 product PTS mannose/fructose/sorbose transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003702189.1 transl_table 11 codon_start 1 locus_tag LOCUS_03270 CDS 2085..3014 product PTS system mannose/fructose/sorbose family transporter subunit IID inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700025.1 transl_table 11 codon_start 1 locus_tag LOCUS_03280 CDS 3016..3375 product DUF956 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003568234.1 transl_table 11 codon_start 1 locus_tag LOCUS_03290 CDS 3603..4976 product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549564.1 transl_table 11 codon_start 1 locus_tag LOCUS_03300 CDS complement(5062..6072) product aspartate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549578.1 transl_table 11 codon_start 1 locus_tag LOCUS_03310 gene asnA CDS 6535..7446 product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549600.1 transl_table 11 codon_start 1 locus_tag LOCUS_03320 CDS 7629..10343 product YhgE/Pip domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_087118395.1 transl_table 11 codon_start 1 locus_tag LOCUS_03330 CDS complement(10498..11433) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03340 CDS 11528..11680 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03350 CDS complement(11636..13021) product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015613351.1 transl_table 11 codon_start 1 locus_tag LOCUS_03360 CDS complement(13011..13682) product cobyric acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549605.1 transl_table 11 codon_start 1 locus_tag LOCUS_03370 CDS 13850..14626 product tyrosine-protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549621.1 transl_table 11 codon_start 1 locus_tag LOCUS_03380 CDS 14720..15673 product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003564289.1 transl_table 11 codon_start 1 locus_tag LOCUS_03390 CDS 15840..17501 product alpha-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254601.1 transl_table 11 codon_start 1 locus_tag LOCUS_03400 CDS 17516..19264 product glycoside hydrolase family 13 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549626.1 transl_table 11 codon_start 1 locus_tag LOCUS_03410 CDS 19239..19388 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03420 CDS 19372..21645 product glycoside hydrolase family 65 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549627.1 transl_table 11 codon_start 1 locus_tag LOCUS_03430 CDS 21630..22292 product beta-phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549628.1 transl_table 11 codon_start 1 locus_tag LOCUS_03440 gene pgmB CDS 22312..23415 product sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546234.1 transl_table 11 codon_start 1 locus_tag LOCUS_03450 gene ugpC CDS 23520..24734 product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549630.1 transl_table 11 codon_start 1 locus_tag LOCUS_03460 CDS 24797..26146 product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549632.1 transl_table 11 codon_start 1 locus_tag LOCUS_03470 CDS 26152..27021 product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549634.1 transl_table 11 codon_start 1 locus_tag LOCUS_03480 CDS complement(27100..28479) product flavocytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546997.1 transl_table 11 codon_start 1 locus_tag LOCUS_03490 CDS complement(28503..29915) product C69 family dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549685.1 transl_table 11 codon_start 1 locus_tag LOCUS_03500 CDS 30013..30234 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007126009.1 transl_table 11 codon_start 1 locus_tag LOCUS_03510 CDS 30247..30804 product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549688.1 transl_table 11 codon_start 1 locus_tag LOCUS_03520 CDS 30798..31358 product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549689.1 transl_table 11 codon_start 1 locus_tag LOCUS_03530 CDS 31376..32161 product tyrosine-protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549690.1 transl_table 11 codon_start 1 locus_tag LOCUS_03540 CDS 32266..32421 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03550 CDS 32889..33608 product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549696.1 transl_table 11 codon_start 1 locus_tag LOCUS_03560 gene rsmG CDS 33629..34474 product nucleoid occlusion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254588.1 transl_table 11 codon_start 1 locus_tag LOCUS_03570 gene noc CDS 34477..35250 product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254587.1 transl_table 11 codon_start 1 locus_tag LOCUS_03580 CDS 35234..36112 product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549701.1 transl_table 11 codon_start 1 locus_tag LOCUS_03590 CDS 36127..36378 product DUF951 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549703.1 transl_table 11 codon_start 1 locus_tag LOCUS_03600 CDS 36391..37491 product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549709.1 transl_table 11 codon_start 1 locus_tag LOCUS_03610 gene ychF CDS 37503..38279 product DUF1129 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002363563.1 transl_table 11 codon_start 1 locus_tag LOCUS_03620 CDS complement(38332..38883) product cysteine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254459.1 transl_table 11 codon_start 1 locus_tag LOCUS_03630 CDS 38966..39601 product pyroglutamyl-peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548812.1 transl_table 11 codon_start 1 locus_tag LOCUS_03640 gene pcp CDS 39637..40725 product LCP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548816.1 transl_table 11 codon_start 1 locus_tag LOCUS_03650 CDS 40731..41345 product glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548818.1 transl_table 11 codon_start 1 locus_tag LOCUS_03660 CDS 41586..42839 product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548823.1 transl_table 11 codon_start 1 locus_tag LOCUS_03670 gene tyrS tRNA 42898..42970 product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00100 CDS 43056..43874 product 1-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003731860.1 transl_table 11 codon_start 1 locus_tag LOCUS_03680 gene pfkB CDS complement(43911..44711) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03690 CDS complement(44779..45222) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03700 CDS 45411..46103 product 2,3-diphosphoglycerate-dependent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548802.1 transl_table 11 codon_start 1 locus_tag LOCUS_03710 CDS complement(46132..47508) product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548899.1 transl_table 11 codon_start 1 locus_tag LOCUS_03720 CDS 47648..48079 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03730 CDS 48099..48644 product DNA-directed RNA polymerase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548904.1 transl_table 11 codon_start 1 locus_tag LOCUS_03740 gene rpoE CDS 48752..50374 product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254085.1 transl_table 11 codon_start 1 locus_tag LOCUS_03750 CDS 50506..51771 product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254086.1 transl_table 11 codon_start 1 locus_tag LOCUS_03760 CDS 51830..52549 product MIP/aquaporin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548130.1 transl_table 11 codon_start 1 locus_tag LOCUS_03770 CDS complement(53020..54591) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254025.1 transl_table 11 codon_start 1 locus_tag LOCUS_03780 CDS complement(54612..56183) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547498.1 transl_table 11 codon_start 1 locus_tag LOCUS_03790 CDS complement(56232..56402) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03800 CDS complement(56740..56913) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03810 CDS complement(57021..57308) product DUF2187 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549842.1 transl_table 11 codon_start 1 locus_tag LOCUS_03820 CDS 57401..57958 product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041814911.1 transl_table 11 codon_start 1 locus_tag LOCUS_03830 CDS 58101..58802 product C40 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549854.1 transl_table 11 codon_start 1 locus_tag LOCUS_03840 CDS 58958..60139 product L,D-transpeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549671.1 transl_table 11 codon_start 1 locus_tag LOCUS_03850 CDS 60154..60870 product TIGR02206 family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029714299.1 transl_table 11 codon_start 1 locus_tag LOCUS_03860 CDS 61541..61948 product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549020.1 transl_table 11 codon_start 1 locus_tag LOCUS_03870 gene rpsL CDS 61964..62434 product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549021.1 transl_table 11 codon_start 1 locus_tag LOCUS_03880 gene rpsG CDS 62467..64557 product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549022.1 transl_table 11 codon_start 1 locus_tag LOCUS_03890 gene fusA CDS 64740..67031 product RNA polymerase recycling motor HelD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003627819.1 transl_table 11 codon_start 1 locus_tag LOCUS_03900 gene helD CDS 67119..67961 product type I pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003550009.1 transl_table 11 codon_start 1 locus_tag LOCUS_03910 gene coaA CDS 67974..68534 product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003550017.1 transl_table 11 codon_start 1 locus_tag LOCUS_03920 gene efp CDS 68691..69971 product peptidase T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548288.1 transl_table 11 codon_start 1 locus_tag LOCUS_03930 gene pepT CDS 69991..70902 product DNA/RNA non-specific endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003550055.1 transl_table 11 codon_start 1 locus_tag LOCUS_03940 CDS complement(70966..71883) product BadF/BadG/BcrA/BcrD ATPase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548278.1 transl_table 11 codon_start 1 locus_tag LOCUS_03950 CDS 72056..72964 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03960 CDS 72986..73828 product zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003550081.1 transl_table 11 codon_start 1 locus_tag LOCUS_03970 CDS complement(73878..74657) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254520.1 transl_table 11 codon_start 1 locus_tag LOCUS_03980 CDS 74803..75402 product TVP38/TMEM64 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003550094.1 transl_table 11 codon_start 1 locus_tag LOCUS_03990 CDS 75406..75903 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003550097.1 transl_table 11 codon_start 1 locus_tag LOCUS_04000 CDS 76150..77460 product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254519.1 transl_table 11 codon_start 1 locus_tag LOCUS_04010 gene serS CDS complement(77514..80681) product type I restriction endonuclease subunit R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968692.1 transl_table 11 codon_start 1 locus_tag LOCUS_04020 CDS complement(80699..81409) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04030 CDS complement(81412..82578) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04040 CDS complement(82575..84395) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04050 CDS complement(84392..84607) product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000885335.1 transl_table 11 codon_start 1 locus_tag LOCUS_04060 CDS 85064..86407 product maltose-6'-phosphate glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549970.1 transl_table 11 codon_start 1 locus_tag LOCUS_04070 CDS 86491..88113 product alpha-glucoside-specific PTS transporter subunit IIBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546418.1 transl_table 11 codon_start 1 locus_tag LOCUS_04080 CDS 88445..89251 product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254203.1 transl_table 11 codon_start 1 locus_tag LOCUS_04090 CDS 89229..89738 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04100 CDS 89743..90228 product PTS glucose transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546424.1 transl_table 11 codon_start 1 locus_tag LOCUS_04110 CDS 90371..90895 product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254592.1 transl_table 11 codon_start 1 locus_tag LOCUS_04120 CDS 90899..91954 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254591.1 transl_table 11 codon_start 1 locus_tag LOCUS_04130 CDS 91977..92654 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254590.1 transl_table 11 codon_start 1 locus_tag LOCUS_04140 CDS complement(92657..93373) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04150 CDS 93520..94389 product phosphate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003701554.1 transl_table 11 codon_start 1 locus_tag LOCUS_04160 CDS 94392..95306 product phosphate ABC transporter permease subunit PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674325.1 transl_table 11 codon_start 1 locus_tag LOCUS_04170 gene pstC CDS 95309..96202 product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549099.1 transl_table 11 codon_start 1 locus_tag LOCUS_04180 gene pstA CDS 96202..96969 product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003702915.1 transl_table 11 codon_start 1 locus_tag LOCUS_04190 gene pstB CDS 96981..97733 product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549101.1 transl_table 11 codon_start 1 locus_tag LOCUS_04200 gene pstB sequence04 source 1..87610 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 525..686 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04210 CDS 740..3448 product type 2 lanthipeptide synthetase LanM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000875575.1 transl_table 11 codon_start 1 locus_tag LOCUS_04220 gene lanM CDS 3504..5600 product peptidase domain-containing ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000701298.1 transl_table 11 codon_start 1 locus_tag LOCUS_04230 CDS 5593..6498 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262197.1 transl_table 11 codon_start 1 locus_tag LOCUS_04240 CDS 6505..7245 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003703143.1 transl_table 11 codon_start 1 locus_tag LOCUS_04250 CDS 7238..7984 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476317.1 transl_table 11 codon_start 1 locus_tag LOCUS_04260 CDS 8298..9161 product Rgg/GadR/MutR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263840.1 transl_table 11 codon_start 1 locus_tag LOCUS_04270 CDS 10287..10553 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04280 CDS 10621..10881 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04290 CDS 10941..11060 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04300 CDS complement(11291..12178) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04310 note possible pseudo, frameshifted CDS complement(12109..12672) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04320 CDS complement(12764..15718) product glycoside hydrolase family 31 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548741.1 transl_table 11 codon_start 1 locus_tag LOCUS_04330 CDS 15806..16966 product N-acetylglucosamine-6-phosphate deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254054.1 transl_table 11 codon_start 1 locus_tag LOCUS_04340 gene nagA CDS 17059..17457 product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194089.1 transl_table 11 codon_start 1 locus_tag LOCUS_04350 CDS 17706..19283 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254534.1 transl_table 11 codon_start 1 locus_tag LOCUS_04360 CDS complement(19463..20236) product ABC-2 family transporter protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861932.1 transl_table 11 codon_start 1 locus_tag LOCUS_04370 CDS complement(20233..20847) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04380 CDS complement(20982..21902) product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016723.1 transl_table 11 codon_start 1 locus_tag LOCUS_04390 CDS complement(22090..22890) product tyrosine-protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548752.1 transl_table 11 codon_start 1 locus_tag LOCUS_04400 CDS 23039..23515 product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548753.1 transl_table 11 codon_start 1 locus_tag LOCUS_04410 CDS 23601..24083 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548767.1 transl_table 11 codon_start 1 locus_tag LOCUS_04420 CDS 24136..25527 product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254060.1 transl_table 11 codon_start 1 locus_tag LOCUS_04430 CDS 25593..27542 product asparagine synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548773.1 transl_table 11 codon_start 1 locus_tag LOCUS_04440 gene asnB CDS 27560..28819 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548775.1 transl_table 11 codon_start 1 locus_tag LOCUS_04450 CDS 29019..30335 product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011922251.1 transl_table 11 codon_start 1 locus_tag LOCUS_04460 CDS 30329..31744 product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002905175.1 transl_table 11 codon_start 1 locus_tag LOCUS_04470 CDS 31872..33392 product glycerol kinase GlpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775048.1 transl_table 11 codon_start 1 locus_tag LOCUS_04480 gene glpK CDS 33395..35230 product type 1 glycerol-3-phosphate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837394.1 transl_table 11 codon_start 1 locus_tag LOCUS_04490 gene glpO CDS 35249..35962 product MIP/aquaporin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641945.1 transl_table 11 codon_start 1 locus_tag LOCUS_04500 CDS 36142..36459 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04510 CDS 36682..38871 product anaerobic ribonucleoside-triphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254061.1 transl_table 11 codon_start 1 locus_tag LOCUS_04520 gene nrdD CDS 38896..39609 product anaerobic ribonucleoside-triphosphate reductase activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548777.1 transl_table 11 codon_start 1 locus_tag LOCUS_04530 gene nrdG CDS 39712..40932 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548780.1 transl_table 11 codon_start 1 locus_tag LOCUS_04540 CDS 41047..42996 product peptidase M13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548782.1 transl_table 11 codon_start 1 locus_tag LOCUS_04550 CDS complement(43142..44452) product C1 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254075.1 transl_table 11 codon_start 1 locus_tag LOCUS_04560 CDS complement(44523..45950) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04570 CDS complement(45931..46404) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04580 CDS 46567..47028 product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548866.1 transl_table 11 codon_start 1 locus_tag LOCUS_04590 gene greA CDS complement(47121..47921) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04600 CDS complement(47922..48623) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04610 CDS complement(49169..49483) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04620 CDS 49606..50268 product CPBP family intramembrane metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254077.1 transl_table 11 codon_start 1 locus_tag LOCUS_04630 tRNA complement(50299..50371) product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00110 CDS 50522..51541 product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548870.1 transl_table 11 codon_start 1 locus_tag LOCUS_04640 gene trpS CDS 51563..52036 product ComE operon protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548871.1 transl_table 11 codon_start 1 locus_tag LOCUS_04650 CDS 52033..52602 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04660 CDS 52934..55621 product magnesium-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548873.1 transl_table 11 codon_start 1 locus_tag LOCUS_04670 gene mgtA CDS 55736..57715 product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254078.1 transl_table 11 codon_start 1 locus_tag LOCUS_04680 gene metG CDS 57715..58488 product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548876.1 transl_table 11 codon_start 1 locus_tag LOCUS_04690 CDS 58472..59035 product ribonuclease M5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548877.1 transl_table 11 codon_start 1 locus_tag LOCUS_04700 gene rnmV CDS 59025..59912 product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548878.1 transl_table 11 codon_start 1 locus_tag LOCUS_04710 gene rsmA CDS 59990..60232 product Veg family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548879.1 transl_table 11 codon_start 1 locus_tag LOCUS_04720 CDS 60370..61206 product pur operon repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548880.1 transl_table 11 codon_start 1 locus_tag LOCUS_04730 gene purR CDS 61240..62625 product bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548882.1 transl_table 11 codon_start 1 locus_tag LOCUS_04740 gene glmU CDS 62719..63684 product ribose-phosphate diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254080.1 transl_table 11 codon_start 1 locus_tag LOCUS_04750 CDS 63930..64238 product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549023.1 transl_table 11 codon_start 1 locus_tag LOCUS_04760 gene rpsJ CDS 64266..64895 product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549024.1 transl_table 11 codon_start 1 locus_tag LOCUS_04770 gene rplC CDS 64910..65524 product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549025.1 transl_table 11 codon_start 1 locus_tag LOCUS_04780 gene rplD CDS 65524..65826 product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549026.1 transl_table 11 codon_start 1 locus_tag LOCUS_04790 gene rplW CDS 65842..66678 product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254111.1 transl_table 11 codon_start 1 locus_tag LOCUS_04800 gene rplB CDS 66701..66985 product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003567557.1 transl_table 11 codon_start 1 locus_tag LOCUS_04810 gene rpsS CDS 67004..67357 product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549029.1 transl_table 11 codon_start 1 locus_tag LOCUS_04820 gene rplV CDS 67372..68046 product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254113.1 transl_table 11 codon_start 1 locus_tag LOCUS_04830 gene rpsC CDS 68049..68486 product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549031.1 transl_table 11 codon_start 1 locus_tag LOCUS_04840 gene rplP CDS 68476..68661 product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549032.1 transl_table 11 codon_start 1 locus_tag LOCUS_04850 gene rpmC CDS 68684..68950 product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254114.1 transl_table 11 codon_start 1 locus_tag LOCUS_04860 gene rpsQ CDS 68979..69347 product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549034.1 transl_table 11 codon_start 1 locus_tag LOCUS_04870 gene rplN CDS 69368..69610 product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549035.1 transl_table 11 codon_start 1 locus_tag LOCUS_04880 CDS 69625..70167 product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549036.1 transl_table 11 codon_start 1 locus_tag LOCUS_04890 gene rplE CDS 70183..70368 product type Z 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549037.1 transl_table 11 codon_start 1 locus_tag LOCUS_04900 CDS 70395..70793 product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549038.1 transl_table 11 codon_start 1 locus_tag LOCUS_04910 gene rpsH CDS 70818..71348 product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549039.1 transl_table 11 codon_start 1 locus_tag LOCUS_04920 gene rplF CDS 71375..71734 product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549040.1 transl_table 11 codon_start 1 locus_tag LOCUS_04930 gene rplR CDS 71752..72264 product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549041.1 transl_table 11 codon_start 1 locus_tag LOCUS_04940 gene rpsE CDS 72277..72462 product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549042.1 transl_table 11 codon_start 1 locus_tag LOCUS_04950 gene rpmD CDS 72493..72933 product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549043.1 transl_table 11 codon_start 1 locus_tag LOCUS_04960 gene rplO CDS 72933..74237 product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549044.1 transl_table 11 codon_start 1 locus_tag LOCUS_04970 gene secY CDS 74247..74897 product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549045.1 transl_table 11 codon_start 1 locus_tag LOCUS_04980 CDS 74973..75194 product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002878178.1 transl_table 11 codon_start 1 locus_tag LOCUS_04990 gene infA CDS 75358..75708 product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549046.1 transl_table 11 codon_start 1 locus_tag LOCUS_05000 gene rpsM CDS 75729..76118 product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015613292.1 transl_table 11 codon_start 1 locus_tag LOCUS_05010 gene rpsK CDS 76164..77102 product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549048.1 transl_table 11 codon_start 1 locus_tag LOCUS_05020 CDS 77127..77510 product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549049.1 transl_table 11 codon_start 1 locus_tag LOCUS_05030 gene rplQ CDS 77695..78543 product energy-coupling factor transporter ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549050.1 transl_table 11 codon_start 1 locus_tag LOCUS_05040 CDS 78519..79370 product energy-coupling factor transporter ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549051.1 transl_table 11 codon_start 1 locus_tag LOCUS_05050 CDS 79371..80168 product energy-coupling factor transporter transmembrane protein EcfT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288724.1 transl_table 11 codon_start 1 locus_tag LOCUS_05060 CDS 80169..80951 product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549053.1 transl_table 11 codon_start 1 locus_tag LOCUS_05070 gene truA CDS 81053..81496 product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549054.1 transl_table 11 codon_start 1 locus_tag LOCUS_05080 gene rplM CDS 81510..81905 product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549055.1 transl_table 11 codon_start 1 locus_tag LOCUS_05090 gene rpsI sequence05 source 1..81321 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 65..1054 product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546749.1 transl_table 11 codon_start 1 locus_tag LOCUS_05100 CDS 1102..1416 product membrane protein insertion efficiency factor YidD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003564982.1 transl_table 11 codon_start 1 locus_tag LOCUS_05110 gene yidD CDS 1430..1657 product DUF2969 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546751.1 transl_table 11 codon_start 1 locus_tag LOCUS_05120 CDS 1674..2867 product FtsW/RodA/SpoVE family cell cycle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546752.1 transl_table 11 codon_start 1 locus_tag LOCUS_05130 CDS 3269..3583 product YdcP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000420682.1 transl_table 11 codon_start 1 locus_tag LOCUS_05140 CDS 3599..3985 product YdcP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000985015.1 transl_table 11 codon_start 1 locus_tag LOCUS_05150 CDS 4014..5399 product FtsK/SpoIIIE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000813488.1 transl_table 11 codon_start 1 locus_tag LOCUS_05160 CDS 5577..6035 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05170 note possible pseudo, internal stop codon CDS 6057..6782 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05180 note possible pseudo, internal stop codon CDS 6825..7046 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001009056.1 transl_table 11 codon_start 1 locus_tag LOCUS_05190 CDS 7163..7660 product antirestriction protein ArdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000342539.1 transl_table 11 codon_start 1 locus_tag LOCUS_05200 CDS 7749..8141 product conjugal transfer protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000506270.1 transl_table 11 codon_start 1 locus_tag LOCUS_05210 CDS 8125..10572 product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000331160.1 transl_table 11 codon_start 1 locus_tag LOCUS_05220 CDS 10575..12752 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000804748.1 transl_table 11 codon_start 1 locus_tag LOCUS_05230 CDS 12749..13750 product bifunctional lysozyme/C40 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000769868.1 transl_table 11 codon_start 1 locus_tag LOCUS_05240 CDS 13747..14682 product conjugal transfer protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001224318.1 transl_table 11 codon_start 1 locus_tag LOCUS_05250 CDS 15059..16978 product tetracycline resistance ribosomal protection protein Tet(M) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000691727.1 transl_table 11 codon_start 1 locus_tag LOCUS_05260 gene tet(M) CDS complement(17324..17677) product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001227347.1 transl_table 11 codon_start 1 locus_tag LOCUS_05270 CDS 18182..18604 product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000804885.1 transl_table 11 codon_start 1 locus_tag LOCUS_05280 CDS 18601..18831 product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000857133.1 transl_table 11 codon_start 1 locus_tag LOCUS_05290 CDS 19292..19495 product excisionase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000814511.1 transl_table 11 codon_start 1 locus_tag LOCUS_05300 CDS 19577..20794 product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001291561.1 transl_table 11 codon_start 1 locus_tag LOCUS_05310 CDS complement(20979..21452) product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546753.1 transl_table 11 codon_start 1 locus_tag LOCUS_05320 CDS complement(21510..21794) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05330 CDS complement(22049..23356) product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546755.1 transl_table 11 codon_start 1 locus_tag LOCUS_05340 CDS complement(23430..24041) product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254249.1 transl_table 11 codon_start 1 locus_tag LOCUS_05350 gene rpsD CDS 24324..26027 product septation ring formation regulator EzrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546759.1 transl_table 11 codon_start 1 locus_tag LOCUS_05360 gene ezrA CDS 26128..27282 product cysteine desulfurase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546760.1 transl_table 11 codon_start 1 locus_tag LOCUS_05370 CDS 27293..28510 product tRNA 4-thiouridine(8) synthase ThiI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546762.1 transl_table 11 codon_start 1 locus_tag LOCUS_05380 gene thiI CDS 28802..31441 product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254252.1 transl_table 11 codon_start 1 locus_tag LOCUS_05390 CDS 31445..32710 product folylpolyglutamate synthase/dihydrofolate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254253.1 transl_table 11 codon_start 1 locus_tag LOCUS_05400 CDS 32691..33368 product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546772.1 transl_table 11 codon_start 1 locus_tag LOCUS_05410 CDS 33401..34018 product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546774.1 transl_table 11 codon_start 1 locus_tag LOCUS_05420 gene radC CDS 34114..35112 product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546776.1 transl_table 11 codon_start 1 locus_tag LOCUS_05430 CDS 35162..36010 product rod shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546779.1 transl_table 11 codon_start 1 locus_tag LOCUS_05440 gene mreC CDS 36010..36537 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05450 CDS 37328..37759 product division/cell wall cluster transcriptional repressor MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700457.1 transl_table 11 codon_start 1 locus_tag LOCUS_05460 gene mraZ CDS 37756..38709 product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546789.1 transl_table 11 codon_start 1 locus_tag LOCUS_05470 gene rsmH CDS 38737..39102 product cell division protein FtsL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254255.1 transl_table 11 codon_start 1 locus_tag LOCUS_05480 gene ftsL CDS 39099..41252 product penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546793.1 transl_table 11 codon_start 1 locus_tag LOCUS_05490 CDS 41261..42220 product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546795.1 transl_table 11 codon_start 1 locus_tag LOCUS_05500 gene mraY CDS 42234..43616 product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546797.1 transl_table 11 codon_start 1 locus_tag LOCUS_05510 gene murD CDS 43619..44731 product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254256.1 transl_table 11 codon_start 1 locus_tag LOCUS_05520 gene murG CDS 44760..45596 product FtsQ-type POTRA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546801.1 transl_table 11 codon_start 1 locus_tag LOCUS_05530 CDS 45661..47028 product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254257.1 transl_table 11 codon_start 1 locus_tag LOCUS_05540 gene ftsA CDS 47047..48309 product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546805.1 transl_table 11 codon_start 1 locus_tag LOCUS_05550 gene ftsZ CDS 48332..48754 product cell division protein SepF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254258.1 transl_table 11 codon_start 1 locus_tag LOCUS_05560 gene sepF CDS 48757..49047 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05570 CDS 49188..49802 product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547929.1 transl_table 11 codon_start 1 locus_tag LOCUS_05580 gene gmk CDS 49804..50022 product DNA-directed RNA polymerase subunit omega inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547927.1 transl_table 11 codon_start 1 locus_tag LOCUS_05590 gene rpoZ CDS 50080..52470 product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547921.1 transl_table 11 codon_start 1 locus_tag LOCUS_05600 gene priA CDS 52493..53437 product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547919.1 transl_table 11 codon_start 1 locus_tag LOCUS_05610 gene fmt CDS 53427..54740 product 16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254418.1 transl_table 11 codon_start 1 locus_tag LOCUS_05620 gene rsmB CDS 54746..55495 product Stp1/IreP family PP2C-type Ser/Thr phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254417.1 transl_table 11 codon_start 1 locus_tag LOCUS_05630 CDS 55498..57417 product Stk1 family PASTA domain-containing Ser/Thr kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_056938256.1 transl_table 11 codon_start 1 locus_tag LOCUS_05640 gene pknB CDS 57417..58310 product ribosome small subunit-dependent GTPase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547915.1 transl_table 11 codon_start 1 locus_tag LOCUS_05650 gene rsgA CDS 58318..58968 product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547914.1 transl_table 11 codon_start 1 locus_tag LOCUS_05660 gene rpe CDS 58953..59666 product thiamine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254415.1 transl_table 11 codon_start 1 locus_tag LOCUS_05670 CDS complement(59686..60321) product uridine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546365.1 transl_table 11 codon_start 1 locus_tag LOCUS_05680 gene udk CDS 60484..61962 product ABC transporter substrate-binding protein/permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548719.1 transl_table 11 codon_start 1 locus_tag LOCUS_05690 CDS 61955..62695 product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254050.1 transl_table 11 codon_start 1 locus_tag LOCUS_05700 CDS 62816..63868 product inorganic phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052107.1 transl_table 11 codon_start 1 locus_tag LOCUS_05710 CDS 63878..64501 product DUF47 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068188.1 transl_table 11 codon_start 1 locus_tag LOCUS_05720 CDS 64562..65353 product Fe-S cluster assembly ATPase SufC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004894681.1 transl_table 11 codon_start 1 locus_tag LOCUS_05730 gene sufC CDS 65366..66664 product Fe-S cluster assembly protein SufD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101418.1 transl_table 11 codon_start 1 locus_tag LOCUS_05740 gene sufD CDS 66630..67868 product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101419.1 transl_table 11 codon_start 1 locus_tag LOCUS_05750 CDS 67858..68307 product SUF system NifU family Fe-S cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640266.1 transl_table 11 codon_start 1 locus_tag LOCUS_05760 CDS 68309..69712 product Fe-S cluster assembly protein SufB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014567504.1 transl_table 11 codon_start 1 locus_tag LOCUS_05770 gene sufB CDS 69790..70257 product Dps family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002354782.1 transl_table 11 codon_start 1 locus_tag LOCUS_05780 CDS 70815..71903 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05790 CDS complement(72053..73396) product PFL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475560.1 transl_table 11 codon_start 1 locus_tag LOCUS_05800 CDS complement(73414..73680) product ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003703119.1 transl_table 11 codon_start 1 locus_tag LOCUS_05810 CDS 73834..74772 product ribokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003563212.1 transl_table 11 codon_start 1 locus_tag LOCUS_05820 gene rbsK CDS 74759..75454 product ribose-5-phosphate isomerase RpiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254196.1 transl_table 11 codon_start 1 locus_tag LOCUS_05830 gene rpiA CDS 75558..76490 product nucleoside hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546379.1 transl_table 11 codon_start 1 locus_tag LOCUS_05840 CDS 76490..77215 product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546381.1 transl_table 11 codon_start 1 locus_tag LOCUS_05850 CDS 77363..79759 product phosphoketolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254199.1 transl_table 11 codon_start 1 locus_tag LOCUS_05860 CDS 79868..81214 product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905313.1 transl_table 11 codon_start 1 locus_tag LOCUS_05870 sequence06 source 1..71467 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(223..675) product threonine/serine exporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549820.1 transl_table 11 codon_start 1 locus_tag LOCUS_05880 CDS complement(677..1459) product threonine/serine exporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549818.1 transl_table 11 codon_start 1 locus_tag LOCUS_05890 CDS complement(1452..1841) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549816.1 transl_table 11 codon_start 1 locus_tag LOCUS_05900 CDS 2026..2610 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05910 CDS complement(2642..3748) product LCP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549814.1 transl_table 11 codon_start 1 locus_tag LOCUS_05920 CDS 3886..5685 product oligoendopeptidase F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549813.1 transl_table 11 codon_start 1 locus_tag LOCUS_05930 gene pepF CDS 5818..6813 product dihydroxyacetone kinase subunit DhaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548125.1 transl_table 11 codon_start 1 locus_tag LOCUS_05940 gene dhaK CDS 6826..7410 product dihydroxyacetone kinase subunit DhaL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548127.1 transl_table 11 codon_start 1 locus_tag LOCUS_05950 gene dhaL CDS 7407..7775 product dihydroxyacetone kinase phosphoryl donor subunit DhaM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003704317.1 transl_table 11 codon_start 1 locus_tag LOCUS_05960 gene dhaM CDS complement(7934..8614) product DUF3800 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012028388.1 transl_table 11 codon_start 1 locus_tag LOCUS_05970 CDS complement(8669..11308) product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034260979.1 transl_table 11 codon_start 1 locus_tag LOCUS_05980 CDS complement(11311..13353) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05990 CDS complement(13353..15269) product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034528504.1 transl_table 11 codon_start 1 locus_tag LOCUS_06000 CDS complement(15428..16987) product cholesterol-dependent cytolysin vaginolysin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_180947087.1 transl_table 11 codon_start 1 locus_tag LOCUS_06010 gene vly CDS 17189..17665 product nucleoside 2-deoxyribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015613286.1 transl_table 11 codon_start 1 locus_tag LOCUS_06020 CDS complement(17794..19530) product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254212.1 transl_table 11 codon_start 1 locus_tag LOCUS_06030 gene ptsP CDS complement(19530..19796) product phosphocarrier protein HPr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546482.1 transl_table 11 codon_start 1 locus_tag LOCUS_06040 CDS complement(19924..20097) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06050 CDS 20228..22369 product ATP-dependent Clp protease ATP-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254211.1 transl_table 11 codon_start 1 locus_tag LOCUS_06060 CDS 22424..22702 product DUF1827 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546474.1 transl_table 11 codon_start 1 locus_tag LOCUS_06070 CDS complement(22885..23766) product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548384.1 transl_table 11 codon_start 1 locus_tag LOCUS_06080 CDS complement(23916..24725) product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948543.1 transl_table 11 codon_start 1 locus_tag LOCUS_06090 CDS complement(24718..25629) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000074567.1 transl_table 11 codon_start 1 locus_tag LOCUS_06100 CDS complement(25712..25948) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06110 CDS complement(25969..31044) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06120 CDS complement(31166..32488) product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548413.1 transl_table 11 codon_start 1 locus_tag LOCUS_06130 gene murC CDS complement(32523..33176) product DUF4479 and tRNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548415.1 transl_table 11 codon_start 1 locus_tag LOCUS_06140 CDS complement(33192..33512) product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254504.1 transl_table 11 codon_start 1 locus_tag LOCUS_06150 CDS complement(33531..34181) product tRNA (guanosine(46)-N7)-methyltransferase TrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548419.1 transl_table 11 codon_start 1 locus_tag LOCUS_06160 gene trmB CDS complement(34193..35389) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015613400.1 transl_table 11 codon_start 1 locus_tag LOCUS_06170 CDS complement(35373..36122) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548423.1 transl_table 11 codon_start 1 locus_tag LOCUS_06180 CDS 36213..36650 product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548425.1 transl_table 11 codon_start 1 locus_tag LOCUS_06190 CDS 36662..36973 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06200 CDS 37064..37957 product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254505.1 transl_table 11 codon_start 1 locus_tag LOCUS_06210 CDS complement(38084..39061) product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254506.1 transl_table 11 codon_start 1 locus_tag LOCUS_06220 CDS complement(39063..41459) product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254507.1 transl_table 11 codon_start 1 locus_tag LOCUS_06230 CDS complement(41443..42666) product DNA repair exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548436.1 transl_table 11 codon_start 1 locus_tag LOCUS_06240 CDS complement(42676..43026) product YlbF family regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548438.1 transl_table 11 codon_start 1 locus_tag LOCUS_06250 CDS complement(43045..45123) product PBP1A family penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548440.1 transl_table 11 codon_start 1 locus_tag LOCUS_06260 CDS 45184..46062 product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548442.1 transl_table 11 codon_start 1 locus_tag LOCUS_06270 CDS complement(46148..47062) product class II fructose-1,6-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254510.1 transl_table 11 codon_start 1 locus_tag LOCUS_06280 gene fba CDS complement(47158..48834) product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548463.1 transl_table 11 codon_start 1 locus_tag LOCUS_06290 gene argS CDS complement(49096..50373) product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254512.1 transl_table 11 codon_start 1 locus_tag LOCUS_06300 CDS complement(50357..52642) product glycoside hydrolase family 31 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254583.1 transl_table 11 codon_start 1 locus_tag LOCUS_06310 CDS complement(52646..53515) product NAD(P)H-hydrate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254511.1 transl_table 11 codon_start 1 locus_tag LOCUS_06320 tRNA 53596..53679 product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00120 CDS complement(53891..54172) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06330 CDS complement(54345..54761) product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000381519.1 transl_table 11 codon_start 1 locus_tag LOCUS_06340 CDS complement(54745..54939) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06350 CDS complement(54956..55156) product CPCC family cysteine-rich protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001044017.1 transl_table 11 codon_start 1 locus_tag LOCUS_06360 CDS complement(55125..55580) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06370 CDS complement(55595..55963) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06380 CDS complement(56112..56291) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06390 CDS complement(56798..56977) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06400 CDS complement(57137..57286) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06410 CDS complement(57412..57588) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06420 CDS 57756..58424 product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922054.1 transl_table 11 codon_start 1 locus_tag LOCUS_06430 CDS complement(58807..59511) product class II aldolase/adducin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102245.1 transl_table 11 codon_start 1 locus_tag LOCUS_06440 CDS complement(59583..59771) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06450 CDS complement(59788..61353) product PTS galactitol transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102243.1 transl_table 11 codon_start 1 locus_tag LOCUS_06460 CDS complement(61372..61680) product PTS sugar transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102242.1 transl_table 11 codon_start 1 locus_tag LOCUS_06470 CDS complement(61698..62168) product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102241.1 transl_table 11 codon_start 1 locus_tag LOCUS_06480 CDS 62331..63095 product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102240.1 transl_table 11 codon_start 1 locus_tag LOCUS_06490 CDS complement(63240..63806) product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546208.1 transl_table 11 codon_start 1 locus_tag LOCUS_06500 CDS complement(63830..65458) product polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548498.1 transl_table 11 codon_start 1 locus_tag LOCUS_06510 CDS complement(65480..67894) product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548508.1 transl_table 11 codon_start 1 locus_tag LOCUS_06520 gene leuS CDS complement(68181..69647) product MDR family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548513.1 transl_table 11 codon_start 1 locus_tag LOCUS_06530 CDS complement(69640..70845) product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548514.1 transl_table 11 codon_start 1 locus_tag LOCUS_06540 gene metK CDS complement(70802..70951) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06550 tRNA complement(70965..71039) product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00130 tRNA complement(71042..71115) product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00140 tRNA complement(71213..71304) product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00150 sequence07 source 1..68629 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(367..558) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06560 CDS 735..905 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06570 note possible pseudo, frameshifted CDS complement(1176..2345) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06580 note possible pseudo, internal stop codon CDS complement(2484..2906) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06590 note possible pseudo, internal stop codon CDS complement(3301..4293) product GMP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254608.1 transl_table 11 codon_start 1 locus_tag LOCUS_06600 CDS 4485..5774 product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549585.1 transl_table 11 codon_start 1 locus_tag LOCUS_06610 CDS 5778..7073 product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254607.1 transl_table 11 codon_start 1 locus_tag LOCUS_06620 gene purB CDS 7187..7846 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002984437.1 transl_table 11 codon_start 1 locus_tag LOCUS_06630 CDS 7843..8598 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06640 CDS complement(8716..9999) product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549861.1 transl_table 11 codon_start 1 locus_tag LOCUS_06650 gene hflX CDS complement(10033..10683) product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549989.1 transl_table 11 codon_start 1 locus_tag LOCUS_06660 CDS complement(10777..11412) product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548040.1 transl_table 11 codon_start 1 locus_tag LOCUS_06670 gene pyrE CDS complement(11414..12121) product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548039.1 transl_table 11 codon_start 1 locus_tag LOCUS_06680 gene pyrF CDS 12369..13610 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288985.1 transl_table 11 codon_start 1 locus_tag LOCUS_06690 CDS 13616..14536 product dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254443.1 transl_table 11 codon_start 1 locus_tag LOCUS_06700 CDS 14582..15124 product bifunctional pyr operon transcriptional regulator/uracil phosphoribosyltransferase PyrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548034.1 transl_table 11 codon_start 1 locus_tag LOCUS_06710 gene pyrR CDS 15263..16204 product aspartate carbamoyltransferase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548032.1 transl_table 11 codon_start 1 locus_tag LOCUS_06720 CDS 16204..17481 product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254442.1 transl_table 11 codon_start 1 locus_tag LOCUS_06730 CDS 17481..18563 product glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548026.1 transl_table 11 codon_start 1 locus_tag LOCUS_06740 gene carA CDS 18556..21723 product carbamoyl-phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254441.1 transl_table 11 codon_start 1 locus_tag LOCUS_06750 gene carB CDS complement(21846..22007) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06760 CDS 22092..22970 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06770 CDS 22963..23616 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06780 CDS 23603..24139 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06790 CDS complement(24195..26108) product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549141.1 transl_table 11 codon_start 1 locus_tag LOCUS_06800 CDS 26295..26924 product redox-sensing transcriptional repressor Rex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549143.1 transl_table 11 codon_start 1 locus_tag LOCUS_06810 CDS 27050..27334 product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549156.1 transl_table 11 codon_start 1 locus_tag LOCUS_06820 gene groES CDS 27360..28994 product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549158.1 transl_table 11 codon_start 1 locus_tag LOCUS_06830 gene groL CDS 29137..31701 product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254144.1 transl_table 11 codon_start 1 locus_tag LOCUS_06840 gene mutS CDS 31707..33584 product DNA mismatch repair endonuclease MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549162.1 transl_table 11 codon_start 1 locus_tag LOCUS_06850 gene mutL CDS 33606..34190 product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549165.1 transl_table 11 codon_start 1 locus_tag LOCUS_06860 gene ruvA CDS 34207..35211 product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549167.1 transl_table 11 codon_start 1 locus_tag LOCUS_06870 gene ruvB CDS 35272..35628 product preprotein translocase subunit YajC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015613305.1 transl_table 11 codon_start 1 locus_tag LOCUS_06880 gene yajC CDS 35733..37181 product glucose-6-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549170.1 transl_table 11 codon_start 1 locus_tag LOCUS_06890 gene zwf CDS 37182..38291 product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549172.1 transl_table 11 codon_start 1 locus_tag LOCUS_06900 gene dinB CDS 38348..39304 product bifunctional oligoribonuclease/PAP phosphatase NrnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254146.1 transl_table 11 codon_start 1 locus_tag LOCUS_06910 CDS 39291..40673 product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549176.1 transl_table 11 codon_start 1 locus_tag LOCUS_06920 CDS 40895..43528 product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549179.1 transl_table 11 codon_start 1 locus_tag LOCUS_06930 gene alaS CDS 43608..43865 product IreB family regulatory phosphoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549189.1 transl_table 11 codon_start 1 locus_tag LOCUS_06940 CDS 43865..44296 product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549192.1 transl_table 11 codon_start 1 locus_tag LOCUS_06950 gene ruvX CDS 44303..44614 product DUF1292 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549194.1 transl_table 11 codon_start 1 locus_tag LOCUS_06960 CDS 44722..47082 product endonuclease MutS2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549197.1 transl_table 11 codon_start 1 locus_tag LOCUS_06970 CDS 47179..47490 product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254147.1 transl_table 11 codon_start 1 locus_tag LOCUS_06980 gene trxA CDS complement(47617..48015) product YslB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549202.1 transl_table 11 codon_start 1 locus_tag LOCUS_06990 CDS 48111..48896 product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549203.1 transl_table 11 codon_start 1 locus_tag LOCUS_07000 gene murI CDS 48914..49534 product XTP/dITP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549206.1 transl_table 11 codon_start 1 locus_tag LOCUS_07010 CDS complement(49560..50405) product mechanosensitive ion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674287.1 transl_table 11 codon_start 1 locus_tag LOCUS_07020 CDS 50530..50967 product DUF948 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003129531.1 transl_table 11 codon_start 1 locus_tag LOCUS_07030 CDS 50982..51311 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07040 CDS complement(51363..52469) product Xaa-Pro peptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549213.1 transl_table 11 codon_start 1 locus_tag LOCUS_07050 CDS 52618..53619 product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549214.1 transl_table 11 codon_start 1 locus_tag LOCUS_07060 CDS complement(53699..55096) product dipeptidase PepV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547162.1 transl_table 11 codon_start 1 locus_tag LOCUS_07070 gene pepV CDS complement(55111..56478) product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549215.1 transl_table 11 codon_start 1 locus_tag LOCUS_07080 CDS 56586..56918 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015613308.1 transl_table 11 codon_start 1 locus_tag LOCUS_07090 CDS 56922..57464 product YutD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549221.1 transl_table 11 codon_start 1 locus_tag LOCUS_07100 CDS 57467..58246 product TIGR01457 family HAD-type hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549224.1 transl_table 11 codon_start 1 locus_tag LOCUS_07110 CDS 58246..58854 product TIGR01906 family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254154.1 transl_table 11 codon_start 1 locus_tag LOCUS_07120 CDS 58974..61727 product CRISPR-associated helicase Cas3' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_116440412.1 transl_table 11 codon_start 1 locus_tag LOCUS_07130 gene cas3 CDS 61714..63375 product type I-E CRISPR-associated protein Cse1/CasA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009994024.1 transl_table 11 codon_start 1 locus_tag LOCUS_07140 CDS 63385..63972 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07150 CDS 63975..65051 product type I-E CRISPR-associated protein Cas7/Cse4/CasC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004138505.1 transl_table 11 codon_start 1 locus_tag LOCUS_07160 gene cas7e CDS 65068..65805 product type I-E CRISPR-associated protein Cas5/CasD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009994022.1 transl_table 11 codon_start 1 locus_tag LOCUS_07170 gene cas5e CDS 65814..66473 product type I-E CRISPR-associated protein Cas6/Cse3/CasE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004112674.1 transl_table 11 codon_start 1 locus_tag LOCUS_07180 gene cas6e CDS 66470..67408 product type I-E CRISPR-associated endonuclease Cas1e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_116440418.1 transl_table 11 codon_start 1 locus_tag LOCUS_07190 gene cas1e CDS 67409..68308 product type I-E CRISPR-associated endoribonuclease Cas2e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674076.1 transl_table 11 codon_start 1 locus_tag LOCUS_07200 gene cas2e repeat_region 68363..>68629 inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtatttcccgcacatgcgggggtgatcct sequence08 source 1..53824 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 2622..5273 product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548351.1 transl_table 11 codon_start 1 locus_tag LOCUS_07210 gene polA CDS 5286..6116 product bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548349.1 transl_table 11 codon_start 1 locus_tag LOCUS_07220 gene mutM CDS 6113..6706 product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548347.1 transl_table 11 codon_start 1 locus_tag LOCUS_07230 gene coaE CDS 6710..7177 product transcriptional regulator NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548345.1 transl_table 11 codon_start 1 locus_tag LOCUS_07240 gene nrdR CDS 7181..8527 product DnaD domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548343.1 transl_table 11 codon_start 1 locus_tag LOCUS_07250 CDS 8544..9443 product primosomal protein DnaI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254494.1 transl_table 11 codon_start 1 locus_tag LOCUS_07260 gene dnaI CDS 9712..11643 product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548338.1 transl_table 11 codon_start 1 locus_tag LOCUS_07270 gene thrS CDS 11944..12348 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07280 CDS 12370..12570 product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548328.1 transl_table 11 codon_start 1 locus_tag LOCUS_07290 gene rpmI CDS 12607..12963 product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548326.1 transl_table 11 codon_start 1 locus_tag LOCUS_07300 gene rplT CDS 13107..13859 product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549794.1 transl_table 11 codon_start 1 locus_tag LOCUS_07310 CDS 13859..14773 product 1-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549796.1 transl_table 11 codon_start 1 locus_tag LOCUS_07320 gene pfkB CDS 14801..16693 product fructose-specific PTS transporter subunit EIIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549797.1 transl_table 11 codon_start 1 locus_tag LOCUS_07330 CDS 16812..17330 product YqeG family HAD IIIA-type phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254490.1 transl_table 11 codon_start 1 locus_tag LOCUS_07340 CDS 17330..18442 product ribosome biogenesis GTPase YqeH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548317.1 transl_table 11 codon_start 1 locus_tag LOCUS_07350 gene yqeH CDS 18442..19071 product nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548315.1 transl_table 11 codon_start 1 locus_tag LOCUS_07360 CDS 19064..19672 product bis(5'-nucleosyl)-tetraphosphatase (symmetrical) YqeK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548313.1 transl_table 11 codon_start 1 locus_tag LOCUS_07370 gene yqeK CDS 19684..20028 product ribosome silencing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548311.1 transl_table 11 codon_start 1 locus_tag LOCUS_07380 gene rsfS CDS 20038..21198 product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548309.1 transl_table 11 codon_start 1 locus_tag LOCUS_07390 CDS 21199..21726 product YceD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548307.1 transl_table 11 codon_start 1 locus_tag LOCUS_07400 CDS 21842..22567 product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548305.1 transl_table 11 codon_start 1 locus_tag LOCUS_07410 CDS 22545..24086 product HAMP domain-containing histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254489.1 transl_table 11 codon_start 1 locus_tag LOCUS_07420 CDS complement(24127..25086) product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254488.1 transl_table 11 codon_start 1 locus_tag LOCUS_07430 gene yidC CDS 25235..25996 product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548298.1 transl_table 11 codon_start 1 locus_tag LOCUS_07440 CDS 26069..26416 product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254487.1 transl_table 11 codon_start 1 locus_tag LOCUS_07450 CDS 26707..27756 product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548296.1 transl_table 11 codon_start 1 locus_tag LOCUS_07460 gene pheS CDS 27756..30170 product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548294.1 transl_table 11 codon_start 1 locus_tag LOCUS_07470 gene pheT CDS 30194..31294 product endolytic transglycosylase MltG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475970.1 transl_table 11 codon_start 1 locus_tag LOCUS_07480 gene mltG CDS 31367..31852 product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548292.1 transl_table 11 codon_start 1 locus_tag LOCUS_07490 gene greA CDS 31907..34009 product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254485.1 transl_table 11 codon_start 1 locus_tag LOCUS_07500 CDS 34016..36598 product sigma 54-interacting transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002304269.1 transl_table 11 codon_start 1 locus_tag LOCUS_07510 CDS 36731..37138 product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002989935.1 transl_table 11 codon_start 1 locus_tag LOCUS_07520 CDS 37156..37647 product PTS sugar transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000632643.1 transl_table 11 codon_start 1 locus_tag LOCUS_07530 CDS 37664..38488 product PTS mannose/fructose/sorbose/N-acetylgalactosamine transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002365419.1 transl_table 11 codon_start 1 locus_tag LOCUS_07540 CDS 38485..39312 product PTS system mannose/fructose/sorbose family transporter subunit IID inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002354796.1 transl_table 11 codon_start 1 locus_tag LOCUS_07550 CDS 39313..40017 product MgtC/SapB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355354.1 transl_table 11 codon_start 1 locus_tag LOCUS_07560 CDS 40031..41311 product RNA polymerase factor sigma-54 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242595.1 transl_table 11 codon_start 1 locus_tag LOCUS_07570 gene rpoN CDS complement(41385..43769) product Xaa-Pro dipeptidyl-peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548011.1 transl_table 11 codon_start 1 locus_tag LOCUS_07580 CDS 43920..46460 product M1 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101213.1 transl_table 11 codon_start 1 locus_tag LOCUS_07590 tRNA 46538..46611 product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00160 CDS 46785..46934 product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548272.1 transl_table 11 codon_start 1 locus_tag LOCUS_07600 gene rpmG CDS 46991..47542 product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475812.1 transl_table 11 codon_start 1 locus_tag LOCUS_07610 CDS 47556..48254 product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254484.1 transl_table 11 codon_start 1 locus_tag LOCUS_07620 CDS 48254..48472 product YqgQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475814.1 transl_table 11 codon_start 1 locus_tag LOCUS_07630 CDS 48507..48908 product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548248.1 transl_table 11 codon_start 1 locus_tag LOCUS_07640 CDS complement(48963..49142) product DUF3042 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003564621.1 transl_table 11 codon_start 1 locus_tag LOCUS_07650 CDS 49217..50152 product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548247.1 transl_table 11 codon_start 1 locus_tag LOCUS_07660 gene miaA CDS 50257..51594 product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003627067.1 transl_table 11 codon_start 1 locus_tag LOCUS_07670 gene glnA CDS 51697..52872 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548117.1 transl_table 11 codon_start 1 locus_tag LOCUS_07680 sequence09 source 1..48794 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(626..1195) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07690 note possible pseudo, frameshifted CDS 1290..1433 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07700 CDS 1889..2077 product type II toxin-antitoxin system HicA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229010.1 transl_table 11 codon_start 1 locus_tag LOCUS_07710 CDS 2139..2522 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07720 CDS 2627..3094 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07730 CDS 3084..4313 product PBSX family phage terminase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674653.1 transl_table 11 codon_start 1 locus_tag LOCUS_07740 CDS 4327..5757 product phage portal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674652.1 transl_table 11 codon_start 1 locus_tag LOCUS_07750 CDS 5750..7342 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07760 CDS 7347..7631 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07770 CDS 7752..8009 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07780 CDS 8124..8729 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07790 CDS 8743..9615 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07800 CDS 9632..10036 product phage head-tail connector protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674645.1 transl_table 11 codon_start 1 locus_tag LOCUS_07810 CDS 10020..10388 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07820 CDS 10388..10768 product DUF3168 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003566400.1 transl_table 11 codon_start 1 locus_tag LOCUS_07830 CDS 10785..11231 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07840 CDS 12016..12249 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07850 CDS 12264..12461 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07860 CDS 12639..12797 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07870 CDS 12920..13528 product MptD family putative ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000368971.1 transl_table 11 codon_start 1 locus_tag LOCUS_07880 CDS 13528..14217 product energy-coupling factor transporter transmembrane component T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001141952.1 transl_table 11 codon_start 1 locus_tag LOCUS_07890 CDS 14211..15587 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000229353.1 transl_table 11 codon_start 1 locus_tag LOCUS_07900 CDS 15645..17264 product alpha-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254098.1 transl_table 11 codon_start 1 locus_tag LOCUS_07910 CDS complement(17303..18520) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07920 CDS 18915..19910 product tryptophan ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674603.1 transl_table 11 codon_start 1 locus_tag LOCUS_07930 gene trpX CDS 19910..20809 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642727.1 transl_table 11 codon_start 1 locus_tag LOCUS_07940 CDS 20802..21563 product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000245086.1 transl_table 11 codon_start 1 locus_tag LOCUS_07950 CDS 21673..23121 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254182.1 transl_table 11 codon_start 1 locus_tag LOCUS_07960 CDS 23364..24293 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000524830.1 transl_table 11 codon_start 1 locus_tag LOCUS_07970 CDS 24280..25080 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146599.1 transl_table 11 codon_start 1 locus_tag LOCUS_07980 CDS complement(25133..26446) product solute carrier family 23 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546343.1 transl_table 11 codon_start 1 locus_tag LOCUS_07990 CDS complement(26644..27843) product multidrug efflux MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254190.1 transl_table 11 codon_start 1 locus_tag LOCUS_08000 CDS 28010..29098 product M42 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546357.1 transl_table 11 codon_start 1 locus_tag LOCUS_08010 CDS 29271..30011 product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546366.1 transl_table 11 codon_start 1 locus_tag LOCUS_08020 CDS 30020..30841 product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546367.1 transl_table 11 codon_start 1 locus_tag LOCUS_08030 CDS 30838..31476 product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003701287.1 transl_table 11 codon_start 1 locus_tag LOCUS_08040 CDS 31486..32145 product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546369.1 transl_table 11 codon_start 1 locus_tag LOCUS_08050 CDS complement(32322..32507) product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547911.1 transl_table 11 codon_start 1 locus_tag LOCUS_08060 gene rpmB CDS 32683..33042 product Asp23/Gls24 family envelope stress response protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547910.1 transl_table 11 codon_start 1 locus_tag LOCUS_08070 CDS 33066..34730 product DAK2 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547907.1 transl_table 11 codon_start 1 locus_tag LOCUS_08080 CDS 34732..36753 product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254414.1 transl_table 11 codon_start 1 locus_tag LOCUS_08090 gene recG CDS 36774..37775 product phosphate acyltransferase PlsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547901.1 transl_table 11 codon_start 1 locus_tag LOCUS_08100 gene plsX CDS 37825..38067 product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003699980.1 transl_table 11 codon_start 1 locus_tag LOCUS_08110 gene acpP CDS 38215..39219 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547898.1 transl_table 11 codon_start 1 locus_tag LOCUS_08120 CDS 39229..40197 product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547895.1 transl_table 11 codon_start 1 locus_tag LOCUS_08130 CDS 40199..41161 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547894.1 transl_table 11 codon_start 1 locus_tag LOCUS_08140 CDS 41176..42105 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547893.1 transl_table 11 codon_start 1 locus_tag LOCUS_08150 CDS 42560..44311 product oligopeptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254413.1 transl_table 11 codon_start 1 locus_tag LOCUS_08160 CDS 44446..45123 product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547887.1 transl_table 11 codon_start 1 locus_tag LOCUS_08170 gene rnc CDS 45146..48703 product chromosome segregation protein SMC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254411.1 transl_table 11 codon_start 1 locus_tag LOCUS_08180 gene smc sequence10 source 1..45248 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(343..1716) product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546123.1 transl_table 11 codon_start 1 locus_tag LOCUS_08190 CDS 2046..4640 product bifunctional acetaldehyde-CoA/alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546132.1 transl_table 11 codon_start 1 locus_tag LOCUS_08200 gene adhE CDS 4806..6005 product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548234.1 transl_table 11 codon_start 1 locus_tag LOCUS_08210 CDS complement(6061..7050) product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548187.1 transl_table 11 codon_start 1 locus_tag LOCUS_08220 gene galE CDS 7213..8307 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254531.1 transl_table 11 codon_start 1 locus_tag LOCUS_08230 CDS 8307..9170 product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003550063.1 transl_table 11 codon_start 1 locus_tag LOCUS_08240 CDS 9172..9990 product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254529.1 transl_table 11 codon_start 1 locus_tag LOCUS_08250 CDS 9974..11263 product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003550067.1 transl_table 11 codon_start 1 locus_tag LOCUS_08260 CDS 11302..12591 product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003550069.1 transl_table 11 codon_start 1 locus_tag LOCUS_08270 CDS 13085..13321 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08280 CDS complement(13328..13843) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08290 CDS complement(13843..14706) product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546611.1 transl_table 11 codon_start 1 locus_tag LOCUS_08300 CDS 14776..15489 product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546612.1 transl_table 11 codon_start 1 locus_tag LOCUS_08310 CDS 15546..16526 product phosphate acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641060.1 transl_table 11 codon_start 1 locus_tag LOCUS_08320 gene pta CDS 16523..16999 product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546616.1 transl_table 11 codon_start 1 locus_tag LOCUS_08330 gene tsaE CDS complement(17077..17610) product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546623.1 transl_table 11 codon_start 1 locus_tag LOCUS_08340 CDS 17724..18638 product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546624.1 transl_table 11 codon_start 1 locus_tag LOCUS_08350 gene murB CDS 18693..19799 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546625.1 transl_table 11 codon_start 1 locus_tag LOCUS_08360 CDS 19786..20598 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546626.1 transl_table 11 codon_start 1 locus_tag LOCUS_08370 CDS 20595..21395 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254228.1 transl_table 11 codon_start 1 locus_tag LOCUS_08380 CDS 21392..22465 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546630.1 transl_table 11 codon_start 1 locus_tag LOCUS_08390 CDS 22504..23346 product diadenylate cyclase CdaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254229.1 transl_table 11 codon_start 1 locus_tag LOCUS_08400 gene cdaA CDS 23343..24311 product CdaR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546633.1 transl_table 11 codon_start 1 locus_tag LOCUS_08410 CDS 24335..25687 product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546635.1 transl_table 11 codon_start 1 locus_tag LOCUS_08420 gene glmM CDS 25879..27690 product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546133.1 transl_table 11 codon_start 1 locus_tag LOCUS_08430 gene glmS CDS 27797..29320 product O-antigen ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549839.1 transl_table 11 codon_start 1 locus_tag LOCUS_08440 CDS 29336..29734 product CrcB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254309.1 transl_table 11 codon_start 1 locus_tag LOCUS_08450 CDS 29734..30084 product fluoride efflux transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547161.1 transl_table 11 codon_start 1 locus_tag LOCUS_08460 gene crcB CDS complement(30136..31008) product zinc ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254571.1 transl_table 11 codon_start 1 locus_tag LOCUS_08470 CDS 31278..31574 product MazG-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003565490.1 transl_table 11 codon_start 1 locus_tag LOCUS_08480 CDS 31792..32064 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08490 CDS 32057..32197 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08500 CDS 32178..32969 product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002905004.1 transl_table 11 codon_start 1 locus_tag LOCUS_08510 CDS 33152..33883 product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546668.1 transl_table 11 codon_start 1 locus_tag LOCUS_08520 CDS complement(33953..35188) product cytosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_117530778.1 transl_table 11 codon_start 1 locus_tag LOCUS_08530 gene codA CDS complement(35200..36459) product cytosine permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986589.1 transl_table 11 codon_start 1 locus_tag LOCUS_08540 gene codB CDS complement(36643..37089) product DUF3021 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000793164.1 transl_table 11 codon_start 1 locus_tag LOCUS_08550 CDS complement(37086..37517) product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700966.1 transl_table 11 codon_start 1 locus_tag LOCUS_08560 CDS 37668..38159 product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002905642.1 transl_table 11 codon_start 1 locus_tag LOCUS_08570 sequence11 source 1..41289 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1122 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011109597.1:Ig-like domain-containing protein locus_tag LOCUS_08580 CDS 1556..8476 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08590 CDS 8671..11430 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08600 tRNA 11569..11643 product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00170 CDS 11841..13133 product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003550069.1 transl_table 11 codon_start 1 locus_tag LOCUS_08610 CDS 13233..13901 product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012027525.1 transl_table 11 codon_start 1 locus_tag LOCUS_08620 CDS 14104..14823 product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002456718.1 transl_table 11 codon_start 1 locus_tag LOCUS_08630 CDS 14923..15678 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681851.1 transl_table 11 codon_start 1 locus_tag LOCUS_08640 CDS 15678..17645 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000489378.1 transl_table 11 codon_start 1 locus_tag LOCUS_08650 CDS 17778..19169 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08660 CDS 19197..20165 product mannose-6-phosphate isomerase, class I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546690.1 transl_table 11 codon_start 1 locus_tag LOCUS_08670 gene manA CDS 20177..20566 product SdpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003584155.1 transl_table 11 codon_start 1 locus_tag LOCUS_08680 CDS 20568..21281 product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254236.1 transl_table 11 codon_start 1 locus_tag LOCUS_08690 CDS complement(21397..23577) product LTA synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546703.1 transl_table 11 codon_start 1 locus_tag LOCUS_08700 CDS 23799..25139 product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546706.1 transl_table 11 codon_start 1 locus_tag LOCUS_08710 CDS 25231..26124 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549788.1 transl_table 11 codon_start 1 locus_tag LOCUS_08720 CDS 26121..27350 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549790.1 transl_table 11 codon_start 1 locus_tag LOCUS_08730 tRNA complement(27413..27485) product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00180 tRNA complement(27489..27562) product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00190 CDS 27688..28701 product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546711.1 transl_table 11 codon_start 1 locus_tag LOCUS_08740 CDS complement(28704..30056) product Mur ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546733.1 transl_table 11 codon_start 1 locus_tag LOCUS_08750 CDS 30186..30779 product thymidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015613340.1 transl_table 11 codon_start 1 locus_tag LOCUS_08760 CDS 30812..31900 product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546735.1 transl_table 11 codon_start 1 locus_tag LOCUS_08770 gene prfA CDS 31893..32732 product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546736.1 transl_table 11 codon_start 1 locus_tag LOCUS_08780 gene prmC CDS 32668..33732 product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546737.1 transl_table 11 codon_start 1 locus_tag LOCUS_08790 CDS 33826..34455 product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546738.1 transl_table 11 codon_start 1 locus_tag LOCUS_08800 gene upp CDS 34550..35266 product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546739.1 transl_table 11 codon_start 1 locus_tag LOCUS_08810 gene atpB CDS 35285..35497 product F0F1 ATP synthase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029779745.1 transl_table 11 codon_start 1 locus_tag LOCUS_08820 gene atpE CDS 35542..36042 product F0F1 ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546741.1 transl_table 11 codon_start 1 locus_tag LOCUS_08830 gene atpF CDS 36042..36611 product F0F1 ATP synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546742.1 transl_table 11 codon_start 1 locus_tag LOCUS_08840 CDS 36601..38112 product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254246.1 transl_table 11 codon_start 1 locus_tag LOCUS_08850 gene atpA CDS 38130..39083 product F0F1 ATP synthase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546744.1 transl_table 11 codon_start 1 locus_tag LOCUS_08860 CDS 39107..40549 product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254247.1 transl_table 11 codon_start 1 locus_tag LOCUS_08870 gene atpD CDS 40561..40995 product F0F1 ATP synthase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546746.1 transl_table 11 codon_start 1 locus_tag LOCUS_08880 CDS 41045..41278 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08890 sequence12 source 1..40744 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(252..1181) product riboflavin biosynthesis protein RibF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547803.1 transl_table 11 codon_start 1 locus_tag LOCUS_08900 gene ribF CDS complement(1199..2092) product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547805.1 transl_table 11 codon_start 1 locus_tag LOCUS_08910 gene truB CDS complement(2153..2509) product ribosome-binding factor A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547807.1 transl_table 11 codon_start 1 locus_tag LOCUS_08920 CDS complement(2543..5179) product translation initiation factor IF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254396.1 transl_table 11 codon_start 1 locus_tag LOCUS_08930 gene infB CDS complement(5184..5489) product ribosomal L7Ae/L30e/S12e/Gadd45 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547810.1 transl_table 11 codon_start 1 locus_tag LOCUS_08940 CDS complement(5491..5787) product YlxR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547812.1 transl_table 11 codon_start 1 locus_tag LOCUS_08950 CDS complement(5812..6900) product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254397.1 transl_table 11 codon_start 1 locus_tag LOCUS_08960 gene nusA CDS complement(6920..7396) product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254398.1 transl_table 11 codon_start 1 locus_tag LOCUS_08970 gene rimP CDS complement(7518..11792) product PolC-type DNA polymerase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547817.1 transl_table 11 codon_start 1 locus_tag LOCUS_08980 CDS complement(11797..13497) product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547819.1 transl_table 11 codon_start 1 locus_tag LOCUS_08990 CDS complement(13514..14770) product RIP metalloprotease RseP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547820.1 transl_table 11 codon_start 1 locus_tag LOCUS_09000 gene rseP CDS complement(14780..15577) product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547823.1 transl_table 11 codon_start 1 locus_tag LOCUS_09010 CDS complement(15595..16314) product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547825.1 transl_table 11 codon_start 1 locus_tag LOCUS_09020 CDS complement(16330..16887) product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_095341972.1 transl_table 11 codon_start 1 locus_tag LOCUS_09030 gene frr CDS complement(16887..17612) product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254400.1 transl_table 11 codon_start 1 locus_tag LOCUS_09040 gene pyrH CDS complement(17768..18643) product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003565808.1 transl_table 11 codon_start 1 locus_tag LOCUS_09050 gene tsf CDS complement(18676..19449) product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547837.1 transl_table 11 codon_start 1 locus_tag LOCUS_09060 gene rpsB CDS complement(19596..20624) product GIY-YIG nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547839.1 transl_table 11 codon_start 1 locus_tag LOCUS_09070 CDS 20684..21298 product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547840.1 transl_table 11 codon_start 1 locus_tag LOCUS_09080 CDS complement(21346..23142) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015613381.1 transl_table 11 codon_start 1 locus_tag LOCUS_09090 CDS complement(23132..24898) product ABC transporter transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254403.1 transl_table 11 codon_start 1 locus_tag LOCUS_09100 CDS complement(24972..25187) product YneF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547849.1 transl_table 11 codon_start 1 locus_tag LOCUS_09110 CDS complement(25253..25498) product DUF896 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547851.1 transl_table 11 codon_start 1 locus_tag LOCUS_09120 CDS 25622..26206 product transcriptional repressor LexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254404.1 transl_table 11 codon_start 1 locus_tag LOCUS_09130 gene lexA CDS complement(26251..27033) product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644407.1 transl_table 11 codon_start 1 locus_tag LOCUS_09140 CDS complement(27177..27527) product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003629071.1 transl_table 11 codon_start 1 locus_tag LOCUS_09150 gene rplS CDS complement(27646..28362) product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254407.1 transl_table 11 codon_start 1 locus_tag LOCUS_09160 gene trmD CDS complement(28352..28873) product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254408.1 transl_table 11 codon_start 1 locus_tag LOCUS_09170 gene rimM CDS complement(28929..29201) product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547870.1 transl_table 11 codon_start 1 locus_tag LOCUS_09180 gene rpsP CDS complement(29292..30719) product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547873.1 transl_table 11 codon_start 1 locus_tag LOCUS_09190 gene ffh CDS complement(30721..31062) product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547875.1 transl_table 11 codon_start 1 locus_tag LOCUS_09200 CDS complement(31167..32846) product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547931.1 transl_table 11 codon_start 1 locus_tag LOCUS_09210 gene recN CDS complement(32859..33671) product TlyA family rRNA (cytidine-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547933.1 transl_table 11 codon_start 1 locus_tag LOCUS_09220 CDS complement(33671..34537) product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547935.1 transl_table 11 codon_start 1 locus_tag LOCUS_09230 CDS complement(34540..34782) product exodeoxyribonuclease VII small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547938.1 transl_table 11 codon_start 1 locus_tag LOCUS_09240 CDS complement(34775..36133) product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547941.1 transl_table 11 codon_start 1 locus_tag LOCUS_09250 gene xseA CDS complement(36123..36977) product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547942.1 transl_table 11 codon_start 1 locus_tag LOCUS_09260 CDS complement(37029..37430) product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547945.1 transl_table 11 codon_start 1 locus_tag LOCUS_09270 gene nusB CDS complement(37430..37843) product Asp23/Gls24 family envelope stress response protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547946.1 transl_table 11 codon_start 1 locus_tag LOCUS_09280 CDS complement(37876..38436) product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547948.1 transl_table 11 codon_start 1 locus_tag LOCUS_09290 gene efp CDS complement(38520..39629) product aminopeptidase P family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547949.1 transl_table 11 codon_start 1 locus_tag LOCUS_09300 CDS complement(39696..39995) product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254420.1 transl_table 11 codon_start 1 locus_tag LOCUS_09310 gene rpmA CDS complement(40012..40323) product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547952.1 transl_table 11 codon_start 1 locus_tag LOCUS_09320 gene rplU sequence13 source 1..33015 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(866..1747) product S1-like domain-containing RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254300.1 transl_table 11 codon_start 1 locus_tag LOCUS_09330 CDS complement(1862..3631) product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547072.1 transl_table 11 codon_start 1 locus_tag LOCUS_09340 gene pyk CDS complement(3669..4628) product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547070.1 transl_table 11 codon_start 1 locus_tag LOCUS_09350 gene pfkA CDS complement(4767..7889) product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547069.1 transl_table 11 codon_start 1 locus_tag LOCUS_09360 CDS 8093..8299 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09370 CDS complement(8404..8595) product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547064.1 transl_table 11 codon_start 1 locus_tag LOCUS_09380 gene rpmF CDS complement(8719..9513) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547056.1 transl_table 11 codon_start 1 locus_tag LOCUS_09390 CDS complement(9518..10444) product ribonuclease Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547055.1 transl_table 11 codon_start 1 locus_tag LOCUS_09400 gene rnz CDS complement(10451..12373) product acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025015105.1 transl_table 11 codon_start 1 locus_tag LOCUS_09410 CDS complement(12390..13673) product GTPase ObgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254297.1 transl_table 11 codon_start 1 locus_tag LOCUS_09420 gene obgE CDS complement(13761..15578) product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547051.1 transl_table 11 codon_start 1 locus_tag LOCUS_09430 gene uvrC CDS 15699..16634 product nucleoside hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254272.1 transl_table 11 codon_start 1 locus_tag LOCUS_09440 CDS complement(16822..17199) product DUF1828 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547028.1 transl_table 11 codon_start 1 locus_tag LOCUS_09450 CDS complement(17236..17550) product metal-sulfur cluster assembly factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003703477.1 transl_table 11 codon_start 1 locus_tag LOCUS_09460 CDS complement(17552..18433) product L-serine ammonia-lyase, iron-sulfur-dependent, subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548060.1 transl_table 11 codon_start 1 locus_tag LOCUS_09470 gene sdaAA CDS complement(18455..19117) product serine dehydratase beta chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254449.1 transl_table 11 codon_start 1 locus_tag LOCUS_09480 CDS complement(19198..19716) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546897.1 transl_table 11 codon_start 1 locus_tag LOCUS_09490 CDS complement(19788..20375) product ribosome biogenesis GTP-binding protein YihA/YsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546867.1 transl_table 11 codon_start 1 locus_tag LOCUS_09500 gene yihA CDS complement(20365..21654) product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546864.1 transl_table 11 codon_start 1 locus_tag LOCUS_09510 gene clpX CDS complement(21762..23090) product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546863.1 transl_table 11 codon_start 1 locus_tag LOCUS_09520 gene tig CDS complement(23217..24407) product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546862.1 transl_table 11 codon_start 1 locus_tag LOCUS_09530 gene tuf CDS complement(24577..25446) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254267.1 transl_table 11 codon_start 1 locus_tag LOCUS_09540 CDS complement(25415..27304) product ribonuclease J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546860.1 transl_table 11 codon_start 1 locus_tag LOCUS_09550 CDS complement(27491..27760) product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546859.1 transl_table 11 codon_start 1 locus_tag LOCUS_09560 gene rpsO CDS 27953..28207 product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546858.1 transl_table 11 codon_start 1 locus_tag LOCUS_09570 gene rpsT CDS complement(28256..29242) product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546856.1 transl_table 11 codon_start 1 locus_tag LOCUS_09580 gene holA CDS complement(29239..31518) product DNA internalization-related competence protein ComEC/Rec2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546854.1 transl_table 11 codon_start 1 locus_tag LOCUS_09590 CDS complement(31487..32119) product helix-hairpin-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546852.1 transl_table 11 codon_start 1 locus_tag LOCUS_09600 misc_feature complement(32162..>33015) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003546849.1:SepM family pheromone-processing serine protease locus_tag LOCUS_09610 sequence14 source 1..32219 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1578 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003547519.1:NFACT RNA binding domain-containing protein locus_tag LOCUS_09620 CDS complement(1646..4813) product carbamoyl phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254355.1 transl_table 11 codon_start 1 locus_tag LOCUS_09630 CDS complement(4820..5881) product carbamoyl phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547524.1 transl_table 11 codon_start 1 locus_tag LOCUS_09640 CDS complement(5886..6821) product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254356.1 transl_table 11 codon_start 1 locus_tag LOCUS_09650 CDS complement(6829..7305) product signal peptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015613370.1 transl_table 11 codon_start 1 locus_tag LOCUS_09660 gene lspA CDS complement(7306..8982) product formate--tetrahydrofolate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254358.1 transl_table 11 codon_start 1 locus_tag LOCUS_09670 CDS complement(8982..9329) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09680 CDS complement(9422..10546) product class I SAM-dependent RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547533.1 transl_table 11 codon_start 1 locus_tag LOCUS_09690 CDS complement(11019..11360) product cell division regulator GpsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547534.1 transl_table 11 codon_start 1 locus_tag LOCUS_09700 CDS complement(11436..11975) product DUF1273 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547535.1 transl_table 11 codon_start 1 locus_tag LOCUS_09710 CDS 12048..12638 product Holliday junction resolvase RecU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254360.1 transl_table 11 codon_start 1 locus_tag LOCUS_09720 gene recU CDS 12643..14949 product PBP1A family penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254361.1 transl_table 11 codon_start 1 locus_tag LOCUS_09730 CDS complement(15001..15627) product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254362.1 transl_table 11 codon_start 1 locus_tag LOCUS_09740 gene nth CDS complement(15653..16288) product DnaD domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547543.1 transl_table 11 codon_start 1 locus_tag LOCUS_09750 CDS complement(16349..17650) product asparagine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547544.1 transl_table 11 codon_start 1 locus_tag LOCUS_09760 gene asnS CDS complement(17721..18230) product DUF5590 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475866.1 transl_table 11 codon_start 1 locus_tag LOCUS_09770 CDS complement(18227..21028) product helicase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254365.1 transl_table 11 codon_start 1 locus_tag LOCUS_09780 CDS complement(21052..24672) product helicase-exonuclease AddAB subunit AddA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254366.1 transl_table 11 codon_start 1 locus_tag LOCUS_09790 gene addA CDS complement(24665..28138) product PD-(D/E)XK nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254367.1 transl_table 11 codon_start 1 locus_tag LOCUS_09800 CDS 28207..29127 product mevalonate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547572.1 transl_table 11 codon_start 1 locus_tag LOCUS_09810 gene mvk CDS 29142..30119 product diphosphomevalonate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547574.1 transl_table 11 codon_start 1 locus_tag LOCUS_09820 gene mvaD CDS 30131..31204 product phosphomevalonate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254368.1 transl_table 11 codon_start 1 locus_tag LOCUS_09830 sequence15 source 1..30104 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 27..1544 product ABC transporter permease/substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262245.1 transl_table 11 codon_start 1 locus_tag LOCUS_09840 CDS 1662..3599 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09850 CDS complement(3605..5863) product plasma-membrane proton-efflux P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254392.1 transl_table 11 codon_start 1 locus_tag LOCUS_09860 tRNA 5986..6072 product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00200 CDS 6231..6722 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09870 CDS 6867..8153 product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546959.1 transl_table 11 codon_start 1 locus_tag LOCUS_09880 gene eno CDS 8289..10160 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09890 CDS 10178..11800 product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546358.1 transl_table 11 codon_start 1 locus_tag LOCUS_09900 CDS 12181..13230 product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475540.1 transl_table 11 codon_start 1 locus_tag LOCUS_09910 CDS 13223..13924 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475541.1 transl_table 11 codon_start 1 locus_tag LOCUS_09920 CDS 14047..15426 product threonine/serine exporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547031.1 transl_table 11 codon_start 1 locus_tag LOCUS_09930 CDS complement(15481..15987) product Cys-tRNA(Pro) deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254291.1 transl_table 11 codon_start 1 locus_tag LOCUS_09940 gene ybaK CDS 16049..16981 product 50S ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547033.1 transl_table 11 codon_start 1 locus_tag LOCUS_09950 gene prmA CDS 17408..19660 product bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254292.1 transl_table 11 codon_start 1 locus_tag LOCUS_09960 CDS 19660..20097 product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547036.1 transl_table 11 codon_start 1 locus_tag LOCUS_09970 gene dtd CDS 20344..21630 product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547037.1 transl_table 11 codon_start 1 locus_tag LOCUS_09980 gene hisS CDS 21633..23471 product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547039.1 transl_table 11 codon_start 1 locus_tag LOCUS_09990 gene aspS CDS 23552..24124 product NADPH-dependent FMN reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003704526.1 transl_table 11 codon_start 1 locus_tag LOCUS_10000 CDS 24250..25128 product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547719.1 transl_table 11 codon_start 1 locus_tag LOCUS_10010 CDS complement(25180..26013) product pyruvate, water dikinase regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547712.1 transl_table 11 codon_start 1 locus_tag LOCUS_10020 CDS 26215..26391 product 30S ribosomal protein S21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002880182.1 transl_table 11 codon_start 1 locus_tag LOCUS_10030 gene rpsU CDS 26488..26931 product GatB/YqeY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547630.1 transl_table 11 codon_start 1 locus_tag LOCUS_10040 CDS 26951..27913 product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254379.1 transl_table 11 codon_start 1 locus_tag LOCUS_10050 CDS 27910..28437 product rRNA maturation RNase YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547628.1 transl_table 11 codon_start 1 locus_tag LOCUS_10060 gene ybeY CDS 28453..29355 product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254378.1 transl_table 11 codon_start 1 locus_tag LOCUS_10070 gene era sequence16 source 1..25740 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(174..671) product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546847.1 transl_table 11 codon_start 1 locus_tag LOCUS_10080 gene coaD CDS complement(658..1206) product 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546846.1 transl_table 11 codon_start 1 locus_tag LOCUS_10090 gene rsmD CDS complement(1209..1541) product YlbG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546844.1 transl_table 11 codon_start 1 locus_tag LOCUS_10100 CDS complement(1519..2721) product putative peptidoglycan glycosyltransferase FtsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254265.1 transl_table 11 codon_start 1 locus_tag LOCUS_10110 CDS complement(2865..4700) product translational GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254264.1 transl_table 11 codon_start 1 locus_tag LOCUS_10120 gene typA CDS 4950..5504 product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546838.1 transl_table 11 codon_start 1 locus_tag LOCUS_10130 gene def CDS 5641..5865 product DNA-dependent RNA polymerase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546835.1 transl_table 11 codon_start 1 locus_tag LOCUS_10140 CDS 5874..7553 product ribonuclease J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546834.1 transl_table 11 codon_start 1 locus_tag LOCUS_10150 CDS complement(7592..9934) product ATP-dependent RecD-like DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546830.1 transl_table 11 codon_start 1 locus_tag LOCUS_10160 CDS complement(9962..10594) product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546828.1 transl_table 11 codon_start 1 locus_tag LOCUS_10170 CDS complement(10594..11250) product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546826.1 transl_table 11 codon_start 1 locus_tag LOCUS_10180 CDS complement(11279..12406) product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546824.1 transl_table 11 codon_start 1 locus_tag LOCUS_10190 gene mnmA CDS complement(12417..12752) product DUF1831 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546822.1 transl_table 11 codon_start 1 locus_tag LOCUS_10200 CDS complement(12783..13283) product dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546982.1 transl_table 11 codon_start 1 locus_tag LOCUS_10210 CDS complement(13305..14261) product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546979.1 transl_table 11 codon_start 1 locus_tag LOCUS_10220 CDS complement(14325..14852) product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547784.1 transl_table 11 codon_start 1 locus_tag LOCUS_10230 CDS complement(14948..17233) product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547786.1 transl_table 11 codon_start 1 locus_tag LOCUS_10240 gene recJ CDS complement(17230..17916) product class A sortase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547788.1 transl_table 11 codon_start 1 locus_tag LOCUS_10250 CDS complement(17918..19756) product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254395.1 transl_table 11 codon_start 1 locus_tag LOCUS_10260 gene lepA CDS complement(19946..21085) product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547790.1 transl_table 11 codon_start 1 locus_tag LOCUS_10270 gene dnaJ CDS complement(21154..23001) product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547791.1 transl_table 11 codon_start 1 locus_tag LOCUS_10280 gene dnaK CDS complement(23018..23566) product nucleotide exchange factor GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547792.1 transl_table 11 codon_start 1 locus_tag LOCUS_10290 gene grpE CDS complement(23578..24636) product heat-inducible transcriptional repressor HrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547794.1 transl_table 11 codon_start 1 locus_tag LOCUS_10300 gene hrcA CDS complement(24895..25638) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10310 sequence17 source 1..18167 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(915..2858) product DNA topoisomerase IV subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547476.1 transl_table 11 codon_start 1 locus_tag LOCUS_10320 gene parE CDS 2906..3598 product glycerol-3-phosphate 1-O-acyltransferase PlsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547474.1 transl_table 11 codon_start 1 locus_tag LOCUS_10330 gene plsY CDS complement(3631..4521) product aldose 1-epimerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547149.1 transl_table 11 codon_start 1 locus_tag LOCUS_10340 CDS complement(4538..5935) product ATP-dependent protease ATPase subunit HslU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254308.1 transl_table 11 codon_start 1 locus_tag LOCUS_10350 gene hslU CDS complement(5946..6470) product HslU--HslV peptidase proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254307.1 transl_table 11 codon_start 1 locus_tag LOCUS_10360 gene hslV CDS complement(6474..7397) product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547143.1 transl_table 11 codon_start 1 locus_tag LOCUS_10370 CDS complement(7400..8713) product methylenetetrahydrofolate--tRNA-(uracil(54)-C(5))-methyltransferase (FADH(2)-oxidizing) TrmFO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547141.1 transl_table 11 codon_start 1 locus_tag LOCUS_10380 gene trmFO CDS complement(8763..10850) product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547140.1 transl_table 11 codon_start 1 locus_tag LOCUS_10390 gene topA CDS complement(10920..11765) product DNA-processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547135.1 transl_table 11 codon_start 1 locus_tag LOCUS_10400 gene dprA CDS complement(11814..12566) product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254306.1 transl_table 11 codon_start 1 locus_tag LOCUS_10410 CDS complement(12563..13402) product ribosome biogenesis GTPase YlqF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547131.1 transl_table 11 codon_start 1 locus_tag LOCUS_10420 gene ylqF CDS complement(13616..14998) product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101574.1 transl_table 11 codon_start 1 locus_tag LOCUS_10430 CDS complement(15003..15230) product YozE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547128.1 transl_table 11 codon_start 1 locus_tag LOCUS_10440 CDS complement(15239..16090) product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254305.1 transl_table 11 codon_start 1 locus_tag LOCUS_10450 CDS 16217..16882 product hemolysin III family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254304.1 transl_table 11 codon_start 1 locus_tag LOCUS_10460 misc_feature complement(16980..>18167) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003547116.1:CCA tRNA nucleotidyltransferase locus_tag LOCUS_10470 sequence18 source 1..16320 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 85..546 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254564.1 transl_table 11 codon_start 1 locus_tag LOCUS_10480 CDS 569..1198 product LVIS_2131 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549837.1 transl_table 11 codon_start 1 locus_tag LOCUS_10490 CDS 1244..1858 product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254130.1 transl_table 11 codon_start 1 locus_tag LOCUS_10500 CDS 1877..2353 product tRNA adenosine(34) deaminase TadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254132.1 transl_table 11 codon_start 1 locus_tag LOCUS_10510 gene tadA CDS 2536..4287 product DNA polymerase III subunit gamma/tau inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549111.1 transl_table 11 codon_start 1 locus_tag LOCUS_10520 gene dnaX CDS 4333..4662 product YbaB/EbfC family nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549112.1 transl_table 11 codon_start 1 locus_tag LOCUS_10530 CDS 4662..5261 product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549113.1 transl_table 11 codon_start 1 locus_tag LOCUS_10540 gene recR CDS 5258..5491 product YaaL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549114.1 transl_table 11 codon_start 1 locus_tag LOCUS_10550 CDS 5551..6192 product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254134.1 transl_table 11 codon_start 1 locus_tag LOCUS_10560 gene tmk CDS 6209..7066 product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549117.1 transl_table 11 codon_start 1 locus_tag LOCUS_10570 CDS 7082..7435 product DNA replication initiation control protein YabA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254135.1 transl_table 11 codon_start 1 locus_tag LOCUS_10580 gene yabA CDS 7438..8292 product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549119.1 transl_table 11 codon_start 1 locus_tag LOCUS_10590 gene rsmI CDS 8302..9021 product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254136.1 transl_table 11 codon_start 1 locus_tag LOCUS_10600 CDS 9035..9772 product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549123.1 transl_table 11 codon_start 1 locus_tag LOCUS_10610 gene tsaB CDS 9801..10283 product ribosomal protein S18-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549125.1 transl_table 11 codon_start 1 locus_tag LOCUS_10620 gene rimI CDS 10303..11349 product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549127.1 transl_table 11 codon_start 1 locus_tag LOCUS_10630 gene tsaD CDS 11381..12070 product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549720.1 transl_table 11 codon_start 1 locus_tag LOCUS_10640 CDS 12060..13241 product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549721.1 transl_table 11 codon_start 1 locus_tag LOCUS_10650 CDS 13276..14835 product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254584.1 transl_table 11 codon_start 1 locus_tag LOCUS_10660 CDS 14859..15605 product amino acid racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549723.1 transl_table 11 codon_start 1 locus_tag LOCUS_10670 misc_feature complement(15688..>16320) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011254070.1:hydrolase locus_tag LOCUS_10680 sequence19 source 1..15765 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 208..9222 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10690 CDS 9362..9586 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10700 CDS 9590..10288 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10710 CDS 10334..11677 product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546431.1 transl_table 11 codon_start 1 locus_tag LOCUS_10720 CDS 11770..12336 product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254205.1 transl_table 11 codon_start 1 locus_tag LOCUS_10730 gene hpt CDS 12410..13627 product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546440.1 transl_table 11 codon_start 1 locus_tag LOCUS_10740 tRNA complement(13646..13718) product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00210 CDS complement(13770..13949) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10750 CDS 14062..15204 product UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254552.1 transl_table 11 codon_start 1 locus_tag LOCUS_10760 gene wecB CDS complement(15271..15717) product flavodoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546448.1 transl_table 11 codon_start 1 locus_tag LOCUS_10770 sequence20 source 1..14043 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 43..1353 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10780 CDS 1365..2513 product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254377.1 transl_table 11 codon_start 1 locus_tag LOCUS_10790 gene rpoD CDS 2574..3257 product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547613.1 transl_table 11 codon_start 1 locus_tag LOCUS_10800 CDS 3244..4041 product Nif3-like dinuclear metal center hexameric protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547612.1 transl_table 11 codon_start 1 locus_tag LOCUS_10810 CDS 4061..5305 product peptidase T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547606.1 transl_table 11 codon_start 1 locus_tag LOCUS_10820 gene pepT CDS 5616..5990 product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547604.1 transl_table 11 codon_start 1 locus_tag LOCUS_10830 CDS 5983..6672 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642672.1 transl_table 11 codon_start 1 locus_tag LOCUS_10840 CDS 6690..7412 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10850 CDS 7518..8408 product GIY-YIG nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962520.1 transl_table 11 codon_start 1 locus_tag LOCUS_10860 CDS complement(8665..8946) product type II toxin-antitoxin system RelB/DinJ family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002665927.1 transl_table 11 codon_start 1 locus_tag LOCUS_10870 CDS 9215..9928 product SprT family zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681373.1 transl_table 11 codon_start 1 locus_tag LOCUS_10880 CDS complement(9989..10174) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10890 CDS complement(10190..10792) product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547598.1 transl_table 11 codon_start 1 locus_tag LOCUS_10900 gene lepB CDS 10880..11626 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254372.1 transl_table 11 codon_start 1 locus_tag LOCUS_10910 CDS 11613..12599 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10920 CDS 12592..14001 product RsmF rRNA methyltransferase first C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254371.1 transl_table 11 codon_start 1 locus_tag LOCUS_10930 sequence21 source 1..13569 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..916 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003547883.1:signal recognition particle-docking protein FtsY locus_tag LOCUS_10940 CDS 943..2367 product C69 family dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254410.1 transl_table 11 codon_start 1 locus_tag LOCUS_10950 CDS 2479..3300 product DivIVA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254259.1 transl_table 11 codon_start 1 locus_tag LOCUS_10960 CDS 3514..6300 product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254260.1 transl_table 11 codon_start 1 locus_tag LOCUS_10970 gene ileS CDS 6300..6518 product cold shock domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546816.1 transl_table 11 codon_start 1 locus_tag LOCUS_10980 CDS 6524..7087 product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254261.1 transl_table 11 codon_start 1 locus_tag LOCUS_10990 CDS 7080..7331 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11000 CDS 7343..8032 product 5'-methylthioadenosine/adenosylhomocysteine nucleosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254262.1 transl_table 11 codon_start 1 locus_tag LOCUS_11010 CDS 8054..9199 product cysteine desulfurase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101678.1 transl_table 11 codon_start 1 locus_tag LOCUS_11020 CDS 9341..9676 product dihydroneopterin aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643485.1 transl_table 11 codon_start 1 locus_tag LOCUS_11030 gene folB CDS 9673..10188 product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642516.1 transl_table 11 codon_start 1 locus_tag LOCUS_11040 gene folK CDS 10169..10729 product GTP cyclohydrolase I FolE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642515.1 transl_table 11 codon_start 1 locus_tag LOCUS_11050 gene folE CDS 10735..11997 product Mur ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643484.1 transl_table 11 codon_start 1 locus_tag LOCUS_11060 CDS 11990..12589 product RdgB/HAM1 family non-canonical purine NTP pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932022.1 transl_table 11 codon_start 1 locus_tag LOCUS_11070 gene rdgB sequence22 source 1..11787 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 354..1085 product segregation/condensation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547078.1 transl_table 11 codon_start 1 locus_tag LOCUS_11080 CDS 1078..1653 product SMC-Scp complex subunit ScpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547080.1 transl_table 11 codon_start 1 locus_tag LOCUS_11090 gene scpB CDS 1672..2391 product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547082.1 transl_table 11 codon_start 1 locus_tag LOCUS_11100 CDS 2458..3237 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11110 CDS 3507..4100 product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296977.1 transl_table 11 codon_start 1 locus_tag LOCUS_11120 CDS 4188..4856 product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254302.1 transl_table 11 codon_start 1 locus_tag LOCUS_11130 gene cmk CDS 4915..6102 product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547091.1 transl_table 11 codon_start 1 locus_tag LOCUS_11140 gene rpsA CDS 6171..7478 product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254303.1 transl_table 11 codon_start 1 locus_tag LOCUS_11150 gene der CDS 7624..7899 product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547110.1 transl_table 11 codon_start 1 locus_tag LOCUS_11160 CDS 7989..9239 product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547113.1 transl_table 11 codon_start 1 locus_tag LOCUS_11170 CDS 9283..10773 product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011921882.1 transl_table 11 codon_start 1 locus_tag LOCUS_11180 CDS complement(10844..11785) product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547115.1 transl_table 11 codon_start 1 locus_tag LOCUS_11190 sequence23 source 1..10782 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 162..983 product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254208.1 transl_table 11 codon_start 1 locus_tag LOCUS_11200 gene map CDS 987..1907 product YihY/virulence factor BrkB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546451.1 transl_table 11 codon_start 1 locus_tag LOCUS_11210 CDS 1947..2834 product UTP--glucose-1-phosphate uridylyltransferase GalU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546456.1 transl_table 11 codon_start 1 locus_tag LOCUS_11220 gene galU CDS complement(2873..3166) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11230 CDS 3254..4207 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254232.1 transl_table 11 codon_start 1 locus_tag LOCUS_11240 CDS complement(4448..5821) product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546467.1 transl_table 11 codon_start 1 locus_tag LOCUS_11250 gene rlmD CDS 5929..6744 product recombination regulator RecX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546469.1 transl_table 11 codon_start 1 locus_tag LOCUS_11260 gene recX CDS 6764..7255 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254210.1 transl_table 11 codon_start 1 locus_tag LOCUS_11270 CDS complement(7259..7705) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11280 CDS 7812..8687 product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546472.1 transl_table 11 codon_start 1 locus_tag LOCUS_11290 CDS 8687..10258 product peptide chain release factor 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546473.1 transl_table 11 codon_start 1 locus_tag LOCUS_11300 sequence24 source 1..10695 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(764..1060) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11310 CDS complement(1427..3037) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001108415.1 transl_table 11 codon_start 1 locus_tag LOCUS_11320 CDS complement(3069..3839) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002485509.1 transl_table 11 codon_start 1 locus_tag LOCUS_11330 CDS complement(3857..4615) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003645053.1 transl_table 11 codon_start 1 locus_tag LOCUS_11340 CDS complement(4605..5495) product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287087.1 transl_table 11 codon_start 1 locus_tag LOCUS_11350 CDS complement(5497..8166) product class III lanthionine synthetase LanKC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_127742798.1 transl_table 11 codon_start 1 locus_tag LOCUS_11360 gene lanKC CDS complement(8272..8400) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11370 CDS 8858..9622 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11380 CDS complement(9859..10374) product O-acetyl-ADP-ribose deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549649.1 transl_table 11 codon_start 1 locus_tag LOCUS_11390 sequence25 source 1..8674 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 393..1514 product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_087235334.1 transl_table 11 codon_start 1 locus_tag LOCUS_11400 tmRNA complement(1664..2028) product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_tm00010 CDS complement(2066..3277) product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548234.1 transl_table 11 codon_start 1 locus_tag LOCUS_11410 CDS complement(3288..4289) product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546680.1 transl_table 11 codon_start 1 locus_tag LOCUS_11420 CDS complement(4380..4553) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11430 CDS complement(4537..5028) product ComGF family competence protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546679.1 transl_table 11 codon_start 1 locus_tag LOCUS_11440 CDS complement(5015..5233) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11450 CDS complement(5223..5654) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11460 CDS complement(5638..5964) product competence type IV pilus major pilin ComGC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546673.1 transl_table 11 codon_start 1 locus_tag LOCUS_11470 gene comGC CDS complement(5979..6977) product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021721297.1 transl_table 11 codon_start 1 locus_tag LOCUS_11480 CDS complement(6946..7920) product competence type IV pilus ATPase ComGA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546670.1 transl_table 11 codon_start 1 locus_tag LOCUS_11490 gene comGA sequence26 source 1..7121 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ tRNA 254..325 product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00220 tRNA 362..453 product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00230 tRNA 485..560 product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00240 tRNA 569..644 product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00250 tRNA 678..753 product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00260 tRNA 755..830 product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00270 tRNA 836..910 product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00280 tRNA 917..1000 product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00290 tRNA 1003..1075 product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00300 tRNA 1089..1162 product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00310 tRNA 1168..1241 product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00320 tRNA 1264..1334 product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00330 tRNA 1367..1452 product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00340 CDS 1565..2719 product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003550126.1 transl_table 11 codon_start 1 locus_tag LOCUS_11500 CDS 2721..3764 product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003550128.1 transl_table 11 codon_start 1 locus_tag LOCUS_11510 CDS 3764..4774 product lysylphosphatidylglycerol synthase transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003550130.1 transl_table 11 codon_start 1 locus_tag LOCUS_11520 CDS 4833..6902 product LTA synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254156.1 transl_table 11 codon_start 1 locus_tag LOCUS_11530 sequence27 source 1..6619 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(462..611) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11540 CDS complement(608..937) product DUF771 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475911.1 transl_table 11 codon_start 1 locus_tag LOCUS_11550 CDS complement(940..1161) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11560 CDS complement(1171..1347) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11570 CDS complement(1344..2114) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11580 CDS complement(2145..2336) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11590 CDS 2488..2799 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11600 CDS 2832..3251 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11610 CDS 3913..4086 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11620 CDS complement(4104..4247) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11630 CDS 4309..5460 product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475894.1 transl_table 11 codon_start 1 locus_tag LOCUS_11640 CDS complement(5731..5970) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11650 CDS complement(6054..6587) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11660 sequence28 source 1..5246 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1..153 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11670 CDS 168..455 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11680 CDS 463..657 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11690 CDS 1033..1317 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11700 note possible pseudo, internal stop codon CDS 1372..1590 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11710 CDS 1592..2539 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11720 CDS 2541..3410 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000411125.1 transl_table 11 codon_start 1 locus_tag LOCUS_11730 CDS 3394..4137 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000646283.1 transl_table 11 codon_start 1 locus_tag LOCUS_11740 CDS 4146..4661 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11750 CDS 4661..5053 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11760 sequence29 source 1..3704 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(465..2534) product glycine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547620.1 transl_table 11 codon_start 1 locus_tag LOCUS_11770 gene glyS CDS complement(2536..3441) product glycine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547621.1 transl_table 11 codon_start 1 locus_tag LOCUS_11780 gene glyQ sequence30 source 1..3555 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 208..1362 product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705504.1 transl_table 11 codon_start 1 locus_tag LOCUS_11790 CDS 2036..3424 product DHA2 family efflux MFS transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101592.1 transl_table 11 codon_start 1 locus_tag LOCUS_11800 sequence31 source 1..3396 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1617 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003547478.1:DNA topoisomerase IV subunit A locus_tag LOCUS_11810 CDS 1696..2631 product manganese-dependent inorganic pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547481.1 transl_table 11 codon_start 1 locus_tag LOCUS_11820 CDS 2752..3348 product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547484.1 transl_table 11 codon_start 1 locus_tag LOCUS_11830 sequence32 source 1..2919 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 131..1309 product IS256-like element ISEf1 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000997695.1 transl_table 11 codon_start 1 locus_tag LOCUS_11840 CDS 1398..1592 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11850 CDS 1593..1796 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11860 CDS 1833..2567 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11870 CDS 2582..2755 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11880