>Feature sequence01 5603 4539 gene locus_tag LOCUS_00010 5603 4539 CDS product acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000827020.1 protein_id gnl|my_center|LOCUS_00010 6421 5819 gene locus_tag LOCUS_00020 6421 5819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004114736.1 protein_id gnl|my_center|LOCUS_00020 7800 6958 gene locus_tag LOCUS_00030 7800 6958 CDS product nucleotidyl transferase AbiEii/AbiGii toxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287519.1 protein_id gnl|my_center|LOCUS_00030 8384 7797 gene locus_tag LOCUS_00040 8384 7797 CDS product type IV toxin-antitoxin system AbiEi family antitoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287520.1 protein_id gnl|my_center|LOCUS_00040 9258 8722 gene locus_tag LOCUS_00050 gene cobC 9258 8722 CDS product alpha-ribazole phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964694.1 protein_id gnl|my_center|LOCUS_00050 9882 9376 gene locus_tag LOCUS_00060 9882 9376 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009994781.1 protein_id gnl|my_center|LOCUS_00060 10710 10039 gene locus_tag LOCUS_00070 10710 10039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00070 11038 10703 gene locus_tag LOCUS_00080 11038 10703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00080 11412 11038 gene locus_tag LOCUS_00090 11412 11038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00090 11897 11412 gene locus_tag LOCUS_00100 11897 11412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00100 12595 12140 gene locus_tag LOCUS_00110 12595 12140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00110 12996 12664 gene locus_tag LOCUS_00120 12996 12664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00120 13399 13608 gene locus_tag LOCUS_00130 13399 13608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00130 14885 15184 gene locus_tag LOCUS_00140 14885 15184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00140 15897 15280 gene locus_tag LOCUS_00150 15897 15280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00150 16440 15967 gene locus_tag LOCUS_00160 16440 15967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00160 18251 17217 gene locus_tag LOCUS_00170 18251 17217 CDS product acyl-CoA thioester hydrolase/BAAT C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262593.1 protein_id gnl|my_center|LOCUS_00170 18560 18384 gene locus_tag LOCUS_00180 18560 18384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00180 18969 18646 gene locus_tag LOCUS_00190 18969 18646 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009994766.1 protein_id gnl|my_center|LOCUS_00190 19271 18969 gene locus_tag LOCUS_00200 19271 18969 CDS product type II toxin-antitoxin system RelB/DinJ family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004133089.1 protein_id gnl|my_center|LOCUS_00200 20858 19380 gene locus_tag LOCUS_00210 20858 19380 CDS product Lsa family ABC-F type ribosomal protection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004113321.1 protein_id gnl|my_center|LOCUS_00210 21228 21034 gene locus_tag LOCUS_00220 21228 21034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_00220 21718 22023 gene locus_tag LOCUS_00230 21718 22023 CDS product type II toxin-antitoxin system RelB/DinJ family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009994780.1 protein_id gnl|my_center|LOCUS_00230 22020 22346 gene locus_tag LOCUS_00240 22020 22346 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004113282.1 protein_id gnl|my_center|LOCUS_00240 23244 22612 gene locus_tag LOCUS_00250 23244 22612 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009994774.1 protein_id gnl|my_center|LOCUS_00250 24010 23825 gene locus_tag LOCUS_00260 24010 23825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_00260 24687 24256 gene locus_tag LOCUS_00270 24687 24256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004113272.1 protein_id gnl|my_center|LOCUS_00270 25897 24926 gene locus_tag LOCUS_00280 25897 24926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00280 26997 27413 gene locus_tag LOCUS_00290 26997 27413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00290 27416 27619 gene locus_tag LOCUS_00300 27416 27619 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861845.1 protein_id gnl|my_center|LOCUS_00300 27989 27813 gene locus_tag LOCUS_00310 27989 27813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_00310 28131 27967 gene locus_tag LOCUS_00320 28131 27967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_00320 28772 28188 gene locus_tag LOCUS_00330 28772 28188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948624.1 protein_id gnl|my_center|LOCUS_00330 29372 28938 gene locus_tag LOCUS_00340 29372 28938 CDS product cytidine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000355907.1 protein_id gnl|my_center|LOCUS_00340 30067 29570 gene locus_tag LOCUS_00350 30067 29570 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004574859.1 protein_id gnl|my_center|LOCUS_00350 31051 30290 gene locus_tag LOCUS_00360 31051 30290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00360 31317 31030 gene locus_tag LOCUS_00370 31317 31030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00370 31730 31572 gene locus_tag LOCUS_00380 31730 31572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00380 33423 32335 gene locus_tag LOCUS_00390 33423 32335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00390 34701 34384 gene locus_tag LOCUS_00400 34701 34384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00400 36216 34873 gene locus_tag LOCUS_00410 gene rlmD 36216 34873 CDS product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546298.1 protein_id gnl|my_center|LOCUS_00410 36572 37951 gene locus_tag LOCUS_00420 gene nhaC 36572 37951 CDS product Na+/H+ antiporter NhaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546295.1 protein_id gnl|my_center|LOCUS_00420 38026 38739 gene locus_tag LOCUS_00430 38026 38739 CDS product Bax inhibitor-1/YccA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640270.1 protein_id gnl|my_center|LOCUS_00430 39454 38783 gene locus_tag LOCUS_00440 39454 38783 CDS product L,D-transpeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548465.1 protein_id gnl|my_center|LOCUS_00440 40451 39543 gene locus_tag LOCUS_00450 40451 39543 CDS product diacylglycerol kinase family lipid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546288.1 protein_id gnl|my_center|LOCUS_00450 41901 40471 gene locus_tag LOCUS_00460 gene gatB 41901 40471 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254176.1 protein_id gnl|my_center|LOCUS_00460 43344 41905 gene locus_tag LOCUS_00470 gene gatA 43344 41905 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546285.1 protein_id gnl|my_center|LOCUS_00470 43646 43344 gene locus_tag LOCUS_00480 gene gatC 43646 43344 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546283.1 protein_id gnl|my_center|LOCUS_00480 44787 43657 gene locus_tag LOCUS_00490 44787 43657 CDS product CamS family sex pheromone protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546280.1 protein_id gnl|my_center|LOCUS_00490 46811 44793 gene locus_tag LOCUS_00500 gene ligA 46811 44793 CDS product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546277.1 protein_id gnl|my_center|LOCUS_00500 49053 46825 gene locus_tag LOCUS_00510 gene pcrA 49053 46825 CDS product DNA helicase PcrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546275.1 protein_id gnl|my_center|LOCUS_00510 49766 49155 gene locus_tag LOCUS_00520 49766 49155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00520 50380 49769 gene locus_tag LOCUS_00530 50380 49769 CDS product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254627.1 protein_id gnl|my_center|LOCUS_00530 50524 50439 gene locus_tag LOCUS_t00010 50524 50439 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 51738 50596 gene locus_tag LOCUS_00540 51738 50596 CDS product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254072.1 protein_id gnl|my_center|LOCUS_00540 54548 51885 gene locus_tag LOCUS_00550 54548 51885 CDS product calcium-translocating P-type ATPase, PMCA-type inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546265.1 protein_id gnl|my_center|LOCUS_00550 55570 54734 gene locus_tag LOCUS_00560 gene nadE 55570 54734 CDS product ammonia-dependent NAD(+) synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546262.1 protein_id gnl|my_center|LOCUS_00560 57051 55573 gene locus_tag LOCUS_00570 57051 55573 CDS product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254174.1 protein_id gnl|my_center|LOCUS_00570 57791 57093 gene locus_tag LOCUS_00580 57791 57093 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546270.1 protein_id gnl|my_center|LOCUS_00580 58942 57854 gene locus_tag LOCUS_00590 58942 57854 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546257.1 protein_id gnl|my_center|LOCUS_00590 59704 58979 gene locus_tag LOCUS_00600 59704 58979 CDS product WecB/TagA/CpsF family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546254.1 protein_id gnl|my_center|LOCUS_00600 61135 59708 gene locus_tag LOCUS_00610 61135 59708 CDS product oligosaccharide flippase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254175.1 protein_id gnl|my_center|LOCUS_00610 62283 61150 gene locus_tag LOCUS_00620 62283 61150 CDS product CDP-glycerol--glycerophosphate glycerophosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546266.1 protein_id gnl|my_center|LOCUS_00620 62420 62809 gene locus_tag LOCUS_00630 gene tagD 62420 62809 CDS product glycerol-3-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254173.1 protein_id gnl|my_center|LOCUS_00630 64562 63702 gene locus_tag LOCUS_00640 64562 63702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00640 64669 65922 gene locus_tag LOCUS_00650 64669 65922 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775182.1 protein_id gnl|my_center|LOCUS_00650 66723 66022 gene locus_tag LOCUS_00660 66723 66022 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546250.1 protein_id gnl|my_center|LOCUS_00660 66927 66854 gene locus_tag LOCUS_t00020 66927 66854 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 67016 66933 gene locus_tag LOCUS_t00030 67016 66933 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 68035 67127 gene locus_tag LOCUS_00670 68035 67127 CDS product L-lactate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548290.1 protein_id gnl|my_center|LOCUS_00670 68221 68148 gene locus_tag LOCUS_t00040 68221 68148 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 69441 68278 gene locus_tag LOCUS_00680 69441 68278 CDS product hydroxymethylglutaryl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546460.1 protein_id gnl|my_center|LOCUS_00680 70649 69441 gene locus_tag LOCUS_00690 70649 69441 CDS product hydroxymethylglutaryl-CoA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546459.1 protein_id gnl|my_center|LOCUS_00690 71812 70646 gene locus_tag LOCUS_00700 71812 70646 CDS product thiolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546457.1 protein_id gnl|my_center|LOCUS_00700 72050 72610 gene locus_tag LOCUS_00710 72050 72610 CDS product peptidoglycan-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546204.1 protein_id gnl|my_center|LOCUS_00710 72967 72683 gene locus_tag LOCUS_00720 72967 72683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00720 74620 73247 gene locus_tag LOCUS_00730 gene brnQ 74620 73247 CDS product branched-chain amino acid transport system II carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254324.1 protein_id gnl|my_center|LOCUS_00730 76165 75011 gene locus_tag LOCUS_00740 76165 75011 CDS product ArgE/DapE family deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475542.1 protein_id gnl|my_center|LOCUS_00740 77115 76276 gene locus_tag LOCUS_00750 77115 76276 CDS product MetQ/NlpA family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475539.1 protein_id gnl|my_center|LOCUS_00750 79875 77509 gene locus_tag LOCUS_00760 79875 77509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00760 80679 79885 gene locus_tag LOCUS_00770 80679 79885 CDS product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815052.1 protein_id gnl|my_center|LOCUS_00770 81350 80679 gene locus_tag LOCUS_00780 81350 80679 CDS product metal ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001059661.1 protein_id gnl|my_center|LOCUS_00780 82254 81343 gene locus_tag LOCUS_00790 82254 81343 CDS product metal ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003728914.1 protein_id gnl|my_center|LOCUS_00790 82937 82416 gene locus_tag LOCUS_00800 82937 82416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00800 83505 83047 gene locus_tag LOCUS_00810 gene smpB 83505 83047 CDS product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003550138.1 protein_id gnl|my_center|LOCUS_00810 85784 83508 gene locus_tag LOCUS_00820 gene rnr 85784 83508 CDS product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003550136.1 protein_id gnl|my_center|LOCUS_00820 86088 85855 gene locus_tag LOCUS_00830 gene secG 86088 85855 CDS product preprotein translocase subunit SecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254157.1 protein_id gnl|my_center|LOCUS_00830 87505 86207 gene locus_tag LOCUS_00840 gene eno 87505 86207 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003564271.1 protein_id gnl|my_center|LOCUS_00840 88311 87556 gene locus_tag LOCUS_00850 gene tpiA 88311 87556 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546605.1 protein_id gnl|my_center|LOCUS_00850 89543 88329 gene locus_tag LOCUS_00860 89543 88329 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546602.1 protein_id gnl|my_center|LOCUS_00860 90668 89652 gene locus_tag LOCUS_00870 gene gap 90668 89652 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546601.1 protein_id gnl|my_center|LOCUS_00870 91756 90725 gene locus_tag LOCUS_00880 91756 90725 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546600.1 protein_id gnl|my_center|LOCUS_00880 91984 92055 gene locus_tag LOCUS_t00050 91984 92055 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 92270 92854 gene locus_tag LOCUS_00890 gene clpP 92270 92854 CDS product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546597.1 protein_id gnl|my_center|LOCUS_00890 94221 92953 gene locus_tag LOCUS_00900 94221 92953 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809085.1 protein_id gnl|my_center|LOCUS_00900 95733 94237 gene locus_tag LOCUS_00910 95733 94237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00910 96670 95726 gene locus_tag LOCUS_00920 gene whiA 96670 95726 CDS product DNA-binding protein WhiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546596.1 protein_id gnl|my_center|LOCUS_00920 97704 96670 gene locus_tag LOCUS_00930 97704 96670 CDS product YvcK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546595.1 protein_id gnl|my_center|LOCUS_00930 98592 97717 gene locus_tag LOCUS_00940 gene rapZ 98592 97717 CDS product RNase adapter RapZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546593.1 protein_id gnl|my_center|LOCUS_00940 101456 98640 gene locus_tag LOCUS_00950 gene uvrA 101456 98640 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546588.1 protein_id gnl|my_center|LOCUS_00950 103481 101484 gene locus_tag LOCUS_00960 gene uvrB 103481 101484 CDS product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546586.1 protein_id gnl|my_center|LOCUS_00960 105266 103539 gene locus_tag LOCUS_00970 105266 103539 CDS product phospho-sugar mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546584.1 protein_id gnl|my_center|LOCUS_00970 106209 105283 gene locus_tag LOCUS_00980 gene trxB 106209 105283 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254223.1 protein_id gnl|my_center|LOCUS_00980 107248 106229 gene locus_tag LOCUS_00990 107248 106229 CDS product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546563.1 protein_id gnl|my_center|LOCUS_00990 107986 107285 gene locus_tag LOCUS_01000 gene lgt 107986 107285 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015613330.1 protein_id gnl|my_center|LOCUS_01000 109072 108134 gene locus_tag LOCUS_01010 gene hprK 109072 108134 CDS product HPr(Ser) kinase/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546560.1 protein_id gnl|my_center|LOCUS_01010 109372 109076 gene locus_tag LOCUS_01020 109372 109076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01020 110387 109389 gene locus_tag LOCUS_01030 gene prfB 110387 109389 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_095522727.1 protein_id gnl|my_center|LOCUS_01030 112946 110547 gene locus_tag LOCUS_01040 gene secA 112946 110547 CDS product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254222.1 protein_id gnl|my_center|LOCUS_01040 113666 113109 gene locus_tag LOCUS_01050 gene raiA 113666 113109 CDS product ribosome-associated translation inhibitor RaiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254221.1 protein_id gnl|my_center|LOCUS_01050 114430 113747 gene locus_tag LOCUS_01060 114430 113747 CDS product ComF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254220.1 protein_id gnl|my_center|LOCUS_01060 115697 114408 gene locus_tag LOCUS_01070 115697 114408 CDS product helicase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546538.1 protein_id gnl|my_center|LOCUS_01070 115739 116404 gene locus_tag LOCUS_01080 115739 116404 CDS product YigZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546537.1 protein_id gnl|my_center|LOCUS_01080 117587 116451 gene locus_tag LOCUS_01090 117587 116451 CDS product MraY family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546535.1 protein_id gnl|my_center|LOCUS_01090 119314 117683 gene locus_tag LOCUS_01100 gene rny 119314 117683 CDS product ribonuclease Y inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254219.1 protein_id gnl|my_center|LOCUS_01100 120435 119398 gene locus_tag LOCUS_01110 gene recA 120435 119398 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546531.1 protein_id gnl|my_center|LOCUS_01110 121136 120558 gene locus_tag LOCUS_01120 gene pgsA 121136 120558 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546529.1 protein_id gnl|my_center|LOCUS_01120 122215 121139 gene locus_tag LOCUS_01130 122215 121139 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546527.1 protein_id gnl|my_center|LOCUS_01130 123547 122324 gene locus_tag LOCUS_01140 123547 122324 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546521.1 protein_id gnl|my_center|LOCUS_01140 124758 123544 gene locus_tag LOCUS_01150 124758 123544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01150 127027 124763 gene locus_tag LOCUS_01160 127027 124763 CDS product DNA translocase FtsK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546517.1 protein_id gnl|my_center|LOCUS_01160 127450 127043 gene locus_tag LOCUS_01170 127450 127043 CDS product DUF1149 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546515.1 protein_id gnl|my_center|LOCUS_01170 127973 127461 gene locus_tag LOCUS_01180 127973 127461 CDS product tRNA (cytidine(34)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546513.1 protein_id gnl|my_center|LOCUS_01180 129216 128074 gene locus_tag LOCUS_01190 129216 128074 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546511.1 protein_id gnl|my_center|LOCUS_01190 129606 129226 gene locus_tag LOCUS_01200 129606 129226 CDS product PTS glucitol/sorbitol transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101685.1 protein_id gnl|my_center|LOCUS_01200 129742 130761 gene locus_tag LOCUS_01210 129742 130761 CDS product lactonase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546505.1 protein_id gnl|my_center|LOCUS_01210 130770 131603 gene locus_tag LOCUS_01220 130770 131603 CDS product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003564150.1 protein_id gnl|my_center|LOCUS_01220 132545 131643 gene locus_tag LOCUS_01230 132545 131643 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546500.1 protein_id gnl|my_center|LOCUS_01230 133347 132538 gene locus_tag LOCUS_01240 133347 132538 CDS product NAD kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254215.1 protein_id gnl|my_center|LOCUS_01240 133970 133344 gene locus_tag LOCUS_01250 133970 133344 CDS product GTP pyrophosphokinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546495.1 protein_id gnl|my_center|LOCUS_01250 134048 134662 gene locus_tag LOCUS_01260 134048 134662 CDS product CYTH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546493.1 protein_id gnl|my_center|LOCUS_01260 134727 135344 gene locus_tag LOCUS_01270 134727 135344 CDS product DsbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546492.1 protein_id gnl|my_center|LOCUS_01270 136206 135337 gene locus_tag LOCUS_01280 136206 135337 CDS product competence protein CoiA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254214.1 protein_id gnl|my_center|LOCUS_01280 137060 136284 gene locus_tag LOCUS_01290 137060 136284 CDS product adaptor protein MecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546487.1 protein_id gnl|my_center|LOCUS_01290 137549 137151 gene locus_tag LOCUS_01300 gene spxA 137549 137151 CDS product transcriptional regulator SpxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254213.1 protein_id gnl|my_center|LOCUS_01300 137766 138260 gene locus_tag LOCUS_01310 137766 138260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01310 138322 138747 gene locus_tag LOCUS_01320 138322 138747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01320 139644 138784 gene locus_tag LOCUS_01330 139644 138784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01330 141776 139779 gene locus_tag LOCUS_01340 141776 139779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01340 143260 141959 gene locus_tag LOCUS_01350 143260 141959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01350 143564 144226 gene locus_tag LOCUS_01360 143564 144226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01360 145568 144468 gene locus_tag LOCUS_01370 145568 144468 CDS product GH25 family lysozyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254618.1 protein_id gnl|my_center|LOCUS_01370 146884 145580 gene locus_tag LOCUS_01380 gene acmB 146884 145580 CDS product beta-N-acetylglucosaminidase AcmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548795.1 protein_id gnl|my_center|LOCUS_01380 147343 147077 gene locus_tag LOCUS_01390 147343 147077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01390 147592 147380 gene locus_tag LOCUS_01400 147592 147380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01400 147791 148225 gene locus_tag LOCUS_01410 147791 148225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548785.1 protein_id gnl|my_center|LOCUS_01410 148338 150410 gene locus_tag LOCUS_01420 148338 150410 CDS product KUP/HAK/KT family potassium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254197.1 protein_id gnl|my_center|LOCUS_01420 150524 151708 gene locus_tag LOCUS_01430 150524 151708 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011675074.1 protein_id gnl|my_center|LOCUS_01430 152558 151767 gene locus_tag LOCUS_01440 152558 151767 CDS product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015613417.1 protein_id gnl|my_center|LOCUS_01440 153215 152562 gene locus_tag LOCUS_01450 153215 152562 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254570.1 protein_id gnl|my_center|LOCUS_01450 154026 153238 gene locus_tag LOCUS_01460 154026 153238 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367542.1 protein_id gnl|my_center|LOCUS_01460 155364 154168 gene locus_tag LOCUS_01470 gene coaBC 155364 154168 CDS product bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254293.1 protein_id gnl|my_center|LOCUS_01470 159152 155487 gene locus_tag LOCUS_01480 gene rpoC 159152 155487 CDS product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254109.1 protein_id gnl|my_center|LOCUS_01480 162845 159171 gene locus_tag LOCUS_01490 162845 159171 CDS product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254108.1 protein_id gnl|my_center|LOCUS_01490 165480 163057 gene locus_tag LOCUS_01500 165480 163057 CDS product ATP-dependent Clp protease ATP-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549016.1 protein_id gnl|my_center|LOCUS_01500 166741 165563 gene locus_tag LOCUS_01510 166741 165563 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475674.1 protein_id gnl|my_center|LOCUS_01510 167368 166859 gene locus_tag LOCUS_01520 167368 166859 CDS product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700992.1 protein_id gnl|my_center|LOCUS_01520 168212 167358 gene locus_tag LOCUS_01530 168212 167358 CDS product pyridoxamine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262821.1 protein_id gnl|my_center|LOCUS_01530 168301 168226 gene locus_tag LOCUS_t00060 168301 168226 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 168411 168340 gene locus_tag LOCUS_t00070 168411 168340 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 169976 168465 gene locus_tag LOCUS_01540 gene lysS 169976 168465 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254107.1 protein_id gnl|my_center|LOCUS_01540 170929 169994 gene locus_tag LOCUS_01550 gene dusB 170929 169994 CDS product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254106.1 protein_id gnl|my_center|LOCUS_01550 173114 171069 gene locus_tag LOCUS_01560 gene ftsH 173114 171069 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254105.1 protein_id gnl|my_center|LOCUS_01560 174490 173198 gene locus_tag LOCUS_01570 gene tilS 174490 173198 CDS product tRNA lysidine(34) synthetase TilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549010.1 protein_id gnl|my_center|LOCUS_01570 174859 174521 gene locus_tag LOCUS_01580 174859 174521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01580 175233 174859 gene locus_tag LOCUS_01590 175233 174859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01590 175558 175316 gene locus_tag LOCUS_01600 175558 175316 CDS product RNA-binding S4 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254102.1 protein_id gnl|my_center|LOCUS_01600 178904 175572 gene locus_tag LOCUS_01610 gene mfd 178904 175572 CDS product transcription-repair coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254101.1 protein_id gnl|my_center|LOCUS_01610 179483 178926 gene locus_tag LOCUS_01620 gene pth 179483 178926 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549001.1 protein_id gnl|my_center|LOCUS_01620 179622 180593 gene locus_tag LOCUS_01630 179622 180593 CDS product L-lactate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549000.1 protein_id gnl|my_center|LOCUS_01630 180734 181417 gene locus_tag LOCUS_01640 gene cbpA 180734 181417 CDS product cyclic di-AMP binding protein CbpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254100.1 protein_id gnl|my_center|LOCUS_01640 182620 181493 gene locus_tag LOCUS_01650 gene alr 182620 181493 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548996.1 protein_id gnl|my_center|LOCUS_01650 182980 182624 gene locus_tag LOCUS_01660 gene acpS 182980 182624 CDS product holo-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254099.1 protein_id gnl|my_center|LOCUS_01660 184566 183103 gene locus_tag LOCUS_01670 184566 183103 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548992.1 protein_id gnl|my_center|LOCUS_01670 185949 184582 gene locus_tag LOCUS_01680 185949 184582 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548990.1 protein_id gnl|my_center|LOCUS_01680 186339 186088 gene locus_tag LOCUS_01690 186339 186088 CDS product type B 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548978.1 protein_id gnl|my_center|LOCUS_01690 186653 187981 gene locus_tag LOCUS_01700 186653 187981 CDS product SLC45 family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644357.1 protein_id gnl|my_center|LOCUS_01700 188131 188901 gene locus_tag LOCUS_01710 188131 188901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01710 189913 188903 gene locus_tag LOCUS_01720 189913 188903 CDS product DNA cytosine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010951379.1 protein_id gnl|my_center|LOCUS_01720 190411 190716 gene locus_tag LOCUS_01730 190411 190716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01730 190884 191087 gene locus_tag LOCUS_01740 190884 191087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01740 191044 191319 gene locus_tag LOCUS_01750 191044 191319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_01750 193766 191670 gene locus_tag LOCUS_01760 193766 191670 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001245433.1 protein_id gnl|my_center|LOCUS_01760 194235 193786 gene locus_tag LOCUS_01770 194235 193786 CDS product CopY/TcrY family copper transport repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000103844.1 protein_id gnl|my_center|LOCUS_01770 195281 194985 gene locus_tag LOCUS_01780 195281 194985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01780 195435 195247 gene locus_tag LOCUS_01790 195435 195247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01790 198132 195838 gene locus_tag LOCUS_01800 198132 195838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01800 198884 198699 gene locus_tag LOCUS_01810 198884 198699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01810 199191 198889 gene locus_tag LOCUS_01820 199191 198889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01820 199244 199498 gene locus_tag LOCUS_01830 199244 199498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01830 199663 199914 gene locus_tag LOCUS_01840 199663 199914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01840 203494 199904 gene locus_tag LOCUS_01850 203494 199904 CDS product Eco57I restriction-modification methylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766276.1 protein_id gnl|my_center|LOCUS_01850 204274 203522 gene locus_tag LOCUS_01860 204274 203522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01860 206029 204476 gene locus_tag LOCUS_01870 gene guaA 206029 204476 CDS product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548925.1 protein_id gnl|my_center|LOCUS_01870 206368 206946 gene locus_tag LOCUS_01880 206368 206946 CDS product xanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476270.1 protein_id gnl|my_center|LOCUS_01880 206946 208229 gene locus_tag LOCUS_01890 206946 208229 CDS product nucleobase:cation symporter-2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548915.1 protein_id gnl|my_center|LOCUS_01890 208670 208308 gene locus_tag LOCUS_01900 gene rplL 208670 208308 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254128.1 protein_id gnl|my_center|LOCUS_01900 209215 208715 gene locus_tag LOCUS_01910 gene rplJ 209215 208715 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549105.1 protein_id gnl|my_center|LOCUS_01910 210150 209458 gene locus_tag LOCUS_01920 gene rplA 210150 209458 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549096.1 protein_id gnl|my_center|LOCUS_01920 210672 210247 gene locus_tag LOCUS_01930 gene rplK 210672 210247 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549095.1 protein_id gnl|my_center|LOCUS_01930 211365 210814 gene locus_tag LOCUS_01940 gene nusG 211365 210814 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549094.1 protein_id gnl|my_center|LOCUS_01940 211610 211443 gene locus_tag LOCUS_01950 gene secE 211610 211443 CDS product preprotein translocase subunit SecE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549093.1 protein_id gnl|my_center|LOCUS_01950 211765 211616 gene locus_tag LOCUS_01960 gene rpmG 211765 211616 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549092.1 protein_id gnl|my_center|LOCUS_01960 211949 213169 gene locus_tag LOCUS_01970 211949 213169 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813994.1 protein_id gnl|my_center|LOCUS_01970 213828 213283 gene locus_tag LOCUS_01980 213828 213283 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287436.1 protein_id gnl|my_center|LOCUS_01980 214717 213941 gene locus_tag LOCUS_01990 gene rlmB 214717 213941 CDS product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254123.1 protein_id gnl|my_center|LOCUS_01990 215141 214698 gene locus_tag LOCUS_02000 215141 214698 CDS product Mini-ribonuclease 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549083.1 protein_id gnl|my_center|LOCUS_02000 216540 215128 gene locus_tag LOCUS_02010 gene cysS 216540 215128 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549082.1 protein_id gnl|my_center|LOCUS_02010 218160 216661 gene locus_tag LOCUS_02020 gene gltX 218160 216661 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254122.1 protein_id gnl|my_center|LOCUS_02020 219619 218240 gene locus_tag LOCUS_02030 gene radA 219619 218240 CDS product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549080.1 protein_id gnl|my_center|LOCUS_02030 220170 219619 gene locus_tag LOCUS_02040 220170 219619 CDS product dUTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254121.1 protein_id gnl|my_center|LOCUS_02040 220318 221664 gene locus_tag LOCUS_02050 gene pepC 220318 221664 CDS product aminopeptidase C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549077.1 protein_id gnl|my_center|LOCUS_02050 222640 221705 gene locus_tag LOCUS_02060 222640 221705 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549076.1 protein_id gnl|my_center|LOCUS_02060 223381 222704 gene locus_tag LOCUS_02070 223381 222704 CDS product 2,3-bisphosphoglycerate-dependent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021721658.1 protein_id gnl|my_center|LOCUS_02070 223583 223383 gene locus_tag LOCUS_02080 223583 223383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02080 223822 223586 gene locus_tag LOCUS_02090 223822 223586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02090 224734 223847 gene locus_tag LOCUS_02100 224734 223847 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549073.1 protein_id gnl|my_center|LOCUS_02100 225438 224749 gene locus_tag LOCUS_02110 225438 224749 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549072.1 protein_id gnl|my_center|LOCUS_02110 225582 226160 gene locus_tag LOCUS_02120 225582 226160 CDS product DJ-1/PfpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549069.1 protein_id gnl|my_center|LOCUS_02120 226498 226175 gene locus_tag LOCUS_02130 gene ebrB 226498 226175 CDS product multidrug efflux SMR transporter subunit EbrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245163.1 protein_id gnl|my_center|LOCUS_02130 <227397 226536 gene locus_tag LOCUS_02140 <227397 226536 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002367673.1:pheromone response LPXTG-anchored adhesin PrgC >Feature sequence02 891 142 gene locus_tag LOCUS_02150 891 142 CDS product YibE/F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548732.1 protein_id gnl|my_center|LOCUS_02150 1988 903 gene locus_tag LOCUS_02160 1988 903 CDS product YibE/F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548730.1 protein_id gnl|my_center|LOCUS_02160 2676 2008 gene locus_tag LOCUS_02170 2676 2008 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254052.1 protein_id gnl|my_center|LOCUS_02170 3783 2701 gene locus_tag LOCUS_02180 3783 2701 CDS product D-alanine--D-alanine ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548727.1 protein_id gnl|my_center|LOCUS_02180 4017 5456 gene locus_tag LOCUS_02190 4017 5456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02190 5894 6289 gene locus_tag LOCUS_02200 5894 6289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02200 6291 6902 gene locus_tag LOCUS_02210 6291 6902 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476045.1 protein_id gnl|my_center|LOCUS_02210 7232 7435 gene locus_tag LOCUS_02220 7232 7435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_02220 7438 7782 gene locus_tag LOCUS_02230 7438 7782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02230 8421 8023 gene locus_tag LOCUS_02240 8421 8023 CDS product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870381.1 protein_id gnl|my_center|LOCUS_02240 9376 8549 gene locus_tag LOCUS_02250 9376 8549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02250 10049 9384 gene locus_tag LOCUS_02260 10049 9384 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254049.1 protein_id gnl|my_center|LOCUS_02260 11195 10206 gene locus_tag LOCUS_02270 11195 10206 CDS product ribose-phosphate diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548712.1 protein_id gnl|my_center|LOCUS_02270 11940 11284 gene locus_tag LOCUS_02280 11940 11284 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254047.1 protein_id gnl|my_center|LOCUS_02280 12776 11970 gene locus_tag LOCUS_02290 12776 11970 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254046.1 protein_id gnl|my_center|LOCUS_02290 12911 13876 gene locus_tag LOCUS_02300 12911 13876 CDS product DUF1002 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548693.1 protein_id gnl|my_center|LOCUS_02300 14565 13915 gene locus_tag LOCUS_02310 14565 13915 CDS product ribonuclease H family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003702912.1 protein_id gnl|my_center|LOCUS_02310 14646 16091 gene locus_tag LOCUS_02320 gene cls 14646 16091 CDS product cardiolipin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548687.1 protein_id gnl|my_center|LOCUS_02320 16228 16359 gene locus_tag LOCUS_02330 16228 16359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02330 16475 18082 gene locus_tag LOCUS_02340 16475 18082 CDS product ABC transporter substrate-binding protein/permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254042.1 protein_id gnl|my_center|LOCUS_02340 18075 18830 gene locus_tag LOCUS_02350 18075 18830 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548674.1 protein_id gnl|my_center|LOCUS_02350 20593 18890 gene locus_tag LOCUS_02360 20593 18890 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012914013.1 protein_id gnl|my_center|LOCUS_02360 21691 20771 gene locus_tag LOCUS_02370 21691 20771 CDS product HNH endonuclease signature motif containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254041.1 protein_id gnl|my_center|LOCUS_02370 22339 21692 gene locus_tag LOCUS_02380 22339 21692 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254040.1 protein_id gnl|my_center|LOCUS_02380 22587 22453 gene locus_tag LOCUS_02390 22587 22453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548644.1 protein_id gnl|my_center|LOCUS_02390 23015 22644 gene locus_tag LOCUS_02400 23015 22644 CDS product iron-sulfur cluster biosynthesis family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548621.1 protein_id gnl|my_center|LOCUS_02400 23223 24329 gene locus_tag LOCUS_02410 23223 24329 CDS product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254034.1 protein_id gnl|my_center|LOCUS_02410 24345 24896 gene locus_tag LOCUS_02420 24345 24896 CDS product LemA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254033.1 protein_id gnl|my_center|LOCUS_02420 25028 25792 gene locus_tag LOCUS_02430 gene htpX 25028 25792 CDS product zinc metalloprotease HtpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254032.1 protein_id gnl|my_center|LOCUS_02430 25997 26545 gene locus_tag LOCUS_02440 25997 26545 CDS product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643692.1 protein_id gnl|my_center|LOCUS_02440 26520 27893 gene locus_tag LOCUS_02450 26520 27893 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548609.1 protein_id gnl|my_center|LOCUS_02450 27907 28563 gene locus_tag LOCUS_02460 27907 28563 CDS product energy-coupling factor transporter transmembrane component T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548607.1 protein_id gnl|my_center|LOCUS_02460 29081 28566 gene locus_tag LOCUS_02470 gene rlmH 29081 28566 CDS product 23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548590.1 protein_id gnl|my_center|LOCUS_02470 30769 29597 gene locus_tag LOCUS_02480 30769 29597 CDS product trypsin-like peptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015613276.1 protein_id gnl|my_center|LOCUS_02480 31602 30805 gene locus_tag LOCUS_02490 31602 30805 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254029.1 protein_id gnl|my_center|LOCUS_02490 32463 31627 gene locus_tag LOCUS_02500 32463 31627 CDS product two-component system regulatory protein YycI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548584.1 protein_id gnl|my_center|LOCUS_02500 33787 32453 gene locus_tag LOCUS_02510 33787 32453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548582.1 protein_id gnl|my_center|LOCUS_02510 35615 33777 gene locus_tag LOCUS_02520 gene walK 35615 33777 CDS product cell wall metabolism sensor histidine kinase WalK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254027.1 protein_id gnl|my_center|LOCUS_02520 36361 35657 gene locus_tag LOCUS_02530 gene yycF 36361 35657 CDS product response regulator YycF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548578.1 protein_id gnl|my_center|LOCUS_02530 36566 36640 gene locus_tag LOCUS_t00080 36566 36640 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 38027 36690 gene locus_tag LOCUS_02540 38027 36690 CDS product nucleobase:cation symporter-2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356719.1 protein_id gnl|my_center|LOCUS_02540 39400 38051 gene locus_tag LOCUS_02550 gene guaD 39400 38051 CDS product guanine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002379675.1 protein_id gnl|my_center|LOCUS_02550 39634 39921 gene locus_tag LOCUS_02560 39634 39921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02560 40392 40132 gene locus_tag LOCUS_02570 40392 40132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02570 41576 40665 gene locus_tag LOCUS_02580 41576 40665 CDS product prolyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003550037.1 protein_id gnl|my_center|LOCUS_02580 42978 41626 gene locus_tag LOCUS_02590 gene brnQ 42978 41626 CDS product branched-chain amino acid transport system II carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476479.1 protein_id gnl|my_center|LOCUS_02590 44521 43070 gene locus_tag LOCUS_02600 44521 43070 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549250.1 protein_id gnl|my_center|LOCUS_02600 45466 44639 gene locus_tag LOCUS_02610 45466 44639 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549252.1 protein_id gnl|my_center|LOCUS_02610 46178 45486 gene locus_tag LOCUS_02620 46178 45486 CDS product YjjG family noncanonical pyrimidine nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025079808.1 protein_id gnl|my_center|LOCUS_02620 46705 46184 gene locus_tag LOCUS_02630 46705 46184 CDS product DUF1836 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476576.1 protein_id gnl|my_center|LOCUS_02630 46828 47664 gene locus_tag LOCUS_02640 46828 47664 CDS product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476577.1 protein_id gnl|my_center|LOCUS_02640 47917 48930 gene locus_tag LOCUS_02650 gene nrdF 47917 48930 CDS product class 1b ribonucleoside-diphosphate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001192437.1 protein_id gnl|my_center|LOCUS_02650 48932 49357 gene locus_tag LOCUS_02660 gene nrdI 48932 49357 CDS product class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011167010.1 protein_id gnl|my_center|LOCUS_02660 49347 51524 gene locus_tag LOCUS_02670 gene nrdE 49347 51524 CDS product class 1b ribonucleoside-diphosphate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000194382.1 protein_id gnl|my_center|LOCUS_02670 53505 51613 gene locus_tag LOCUS_02680 gene mnmG 53505 51613 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549419.1 protein_id gnl|my_center|LOCUS_02680 54902 53517 gene locus_tag LOCUS_02690 gene mnmE 54902 53517 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549418.1 protein_id gnl|my_center|LOCUS_02690 55877 55002 gene locus_tag LOCUS_02700 55877 55002 CDS product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254638.1 protein_id gnl|my_center|LOCUS_02700 56250 55879 gene locus_tag LOCUS_02710 gene rnpA 56250 55879 CDS product ribonuclease P protein component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549413.1 protein_id gnl|my_center|LOCUS_02710 56440 56300 gene locus_tag LOCUS_02720 gene rpmH 56440 56300 CDS product 50S ribosomal protein L34 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549412.1 protein_id gnl|my_center|LOCUS_02720 56919 58280 gene locus_tag LOCUS_02730 gene dnaA 56919 58280 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011253999.1 protein_id gnl|my_center|LOCUS_02730 58452 59582 gene locus_tag LOCUS_02740 gene dnaN 58452 59582 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549381.1 protein_id gnl|my_center|LOCUS_02740 59785 60030 gene locus_tag LOCUS_02750 gene yaaA 59785 60030 CDS product S4 domain-containing protein YaaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254000.1 protein_id gnl|my_center|LOCUS_02750 60034 61155 gene locus_tag LOCUS_02760 gene recF 60034 61155 CDS product DNA replication/repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549377.1 protein_id gnl|my_center|LOCUS_02760 61156 63117 gene locus_tag LOCUS_02770 gene gyrB 61156 63117 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549374.1 protein_id gnl|my_center|LOCUS_02770 63127 65574 gene locus_tag LOCUS_02780 gene gyrA 63127 65574 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549372.1 protein_id gnl|my_center|LOCUS_02780 65752 66048 gene locus_tag LOCUS_02790 gene rpsF 65752 66048 CDS product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549370.1 protein_id gnl|my_center|LOCUS_02790 66084 66539 gene locus_tag LOCUS_02800 gene ssb 66084 66539 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254001.1 protein_id gnl|my_center|LOCUS_02800 66568 66804 gene locus_tag LOCUS_02810 gene rpsR 66568 66804 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003701427.1 protein_id gnl|my_center|LOCUS_02810 66972 68987 gene locus_tag LOCUS_02820 66972 68987 CDS product DHH family phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549345.1 protein_id gnl|my_center|LOCUS_02820 69003 69458 gene locus_tag LOCUS_02830 gene rplI 69003 69458 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549343.1 protein_id gnl|my_center|LOCUS_02830 69464 70837 gene locus_tag LOCUS_02840 gene dnaB 69464 70837 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549341.1 protein_id gnl|my_center|LOCUS_02840 72876 73025 gene locus_tag LOCUS_02850 72876 73025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02850 73066 73419 gene locus_tag LOCUS_02860 73066 73419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02860 73394 73930 gene locus_tag LOCUS_02870 73394 73930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02870 74007 74315 gene locus_tag LOCUS_02880 74007 74315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02880 74390 76237 gene locus_tag LOCUS_02890 74390 76237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02890 77550 77368 gene locus_tag LOCUS_02900 77550 77368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02900 77782 77513 gene locus_tag LOCUS_02910 77782 77513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02910 79545 78379 gene locus_tag LOCUS_02920 79545 78379 CDS product DUF2974 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254005.1 protein_id gnl|my_center|LOCUS_02920 80238 79552 gene locus_tag LOCUS_02930 80238 79552 CDS product MgtC/SapB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966920.1 protein_id gnl|my_center|LOCUS_02930 80386 80458 gene locus_tag LOCUS_t00090 80386 80458 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 80709 81089 gene locus_tag LOCUS_02940 80709 81089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02940 81111 82337 gene locus_tag LOCUS_02950 81111 82337 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254348.1 protein_id gnl|my_center|LOCUS_02950 82455 82820 gene locus_tag LOCUS_02960 82455 82820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_02960 83009 83260 gene locus_tag LOCUS_02970 83009 83260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_02970 83526 84914 gene locus_tag LOCUS_02980 gene gndA 83526 84914 CDS product NADP-dependent phosphogluconate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254636.1 protein_id gnl|my_center|LOCUS_02980 84982 86532 gene locus_tag LOCUS_02990 84982 86532 CDS product ClC family H(+)/Cl(-) exchange transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549425.1 protein_id gnl|my_center|LOCUS_02990 88003 86684 gene locus_tag LOCUS_03000 88003 86684 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101374.1 protein_id gnl|my_center|LOCUS_03000 89325 88015 gene locus_tag LOCUS_03010 89325 88015 CDS product NCS2 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025014283.1 protein_id gnl|my_center|LOCUS_03010 89667 90764 gene locus_tag LOCUS_03020 89667 90764 CDS product BMP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549489.1 protein_id gnl|my_center|LOCUS_03020 90900 91988 gene locus_tag LOCUS_03030 90900 91988 CDS product BMP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549489.1 protein_id gnl|my_center|LOCUS_03030 92038 93576 gene locus_tag LOCUS_03040 92038 93576 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549479.1 protein_id gnl|my_center|LOCUS_03040 93585 94697 gene locus_tag LOCUS_03050 93585 94697 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549477.1 protein_id gnl|my_center|LOCUS_03050 94697 95653 gene locus_tag LOCUS_03060 94697 95653 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549473.1 protein_id gnl|my_center|LOCUS_03060 96638 95682 gene locus_tag LOCUS_03070 gene hemH 96638 95682 CDS product ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101341.1 protein_id gnl|my_center|LOCUS_03070 98304 96811 gene locus_tag LOCUS_03080 98304 96811 CDS product peptide MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254595.1 protein_id gnl|my_center|LOCUS_03080 98494 99198 gene locus_tag LOCUS_03090 gene nagB 98494 99198 CDS product glucosamine-6-phosphate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549469.1 protein_id gnl|my_center|LOCUS_03090 99318 99962 gene locus_tag LOCUS_03100 99318 99962 CDS product deoxynucleoside kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549467.1 protein_id gnl|my_center|LOCUS_03100 99975 100640 gene locus_tag LOCUS_03110 99975 100640 CDS product deoxynucleoside kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549464.1 protein_id gnl|my_center|LOCUS_03110 100662 101972 gene locus_tag LOCUS_03120 100662 101972 CDS product NCS2 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549459.1 protein_id gnl|my_center|LOCUS_03120 101990 102637 gene locus_tag LOCUS_03130 101990 102637 CDS product type II CAAX endopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549496.1 protein_id gnl|my_center|LOCUS_03130 103845 102685 gene locus_tag LOCUS_03140 103845 102685 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549506.1 protein_id gnl|my_center|LOCUS_03140 104522 104031 gene locus_tag LOCUS_03150 104522 104031 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549510.1 protein_id gnl|my_center|LOCUS_03150 104671 105819 gene locus_tag LOCUS_03160 104671 105819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549513.1 protein_id gnl|my_center|LOCUS_03160 105836 106132 gene locus_tag LOCUS_03170 105836 106132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03170 106195 106350 gene locus_tag LOCUS_03180 106195 106350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03180 106369 107886 gene locus_tag LOCUS_03190 gene dltA 106369 107886 CDS product D-alanine--poly(phosphoribitol) ligase subunit DltA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549519.1 protein_id gnl|my_center|LOCUS_03190 107883 109100 gene locus_tag LOCUS_03200 gene dltB 107883 109100 CDS product D-alanyl-lipoteichoic acid biosynthesis protein DltB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254621.1 protein_id gnl|my_center|LOCUS_03200 109146 109385 gene locus_tag LOCUS_03210 gene dltC 109146 109385 CDS product D-alanine--poly(phosphoribitol) ligase subunit DltC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549523.1 protein_id gnl|my_center|LOCUS_03210 109378 111663 gene locus_tag LOCUS_03220 109378 111663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03220 114156 111715 gene locus_tag LOCUS_03230 114156 111715 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015613435.1 protein_id gnl|my_center|LOCUS_03230 114867 114166 gene locus_tag LOCUS_03240 114867 114166 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549550.1 protein_id gnl|my_center|LOCUS_03240 115064 116479 gene locus_tag LOCUS_03250 115064 116479 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003701275.1 protein_id gnl|my_center|LOCUS_03250 >Feature sequence03 249 1238 gene locus_tag LOCUS_03260 249 1238 CDS product mannose/fructose/sorbose PTS transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003702191.1 protein_id gnl|my_center|LOCUS_03260 1266 2060 gene locus_tag LOCUS_03270 1266 2060 CDS product PTS mannose/fructose/sorbose transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003702189.1 protein_id gnl|my_center|LOCUS_03270 2085 3014 gene locus_tag LOCUS_03280 2085 3014 CDS product PTS system mannose/fructose/sorbose family transporter subunit IID inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700025.1 protein_id gnl|my_center|LOCUS_03280 3016 3375 gene locus_tag LOCUS_03290 3016 3375 CDS product DUF956 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003568234.1 protein_id gnl|my_center|LOCUS_03290 3603 4976 gene locus_tag LOCUS_03300 3603 4976 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549564.1 protein_id gnl|my_center|LOCUS_03300 6072 5062 gene locus_tag LOCUS_03310 gene asnA 6072 5062 CDS product aspartate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549578.1 protein_id gnl|my_center|LOCUS_03310 6535 7446 gene locus_tag LOCUS_03320 6535 7446 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549600.1 protein_id gnl|my_center|LOCUS_03320 7629 10343 gene locus_tag LOCUS_03330 7629 10343 CDS product YhgE/Pip domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_087118395.1 protein_id gnl|my_center|LOCUS_03330 11433 10498 gene locus_tag LOCUS_03340 11433 10498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03340 11528 11680 gene locus_tag LOCUS_03350 11528 11680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03350 13021 11636 gene locus_tag LOCUS_03360 13021 11636 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015613351.1 protein_id gnl|my_center|LOCUS_03360 13682 13011 gene locus_tag LOCUS_03370 13682 13011 CDS product cobyric acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549605.1 protein_id gnl|my_center|LOCUS_03370 13850 14626 gene locus_tag LOCUS_03380 13850 14626 CDS product tyrosine-protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549621.1 protein_id gnl|my_center|LOCUS_03380 14720 15673 gene locus_tag LOCUS_03390 14720 15673 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003564289.1 protein_id gnl|my_center|LOCUS_03390 15840 17501 gene locus_tag LOCUS_03400 15840 17501 CDS product alpha-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254601.1 protein_id gnl|my_center|LOCUS_03400 17516 19264 gene locus_tag LOCUS_03410 17516 19264 CDS product glycoside hydrolase family 13 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549626.1 protein_id gnl|my_center|LOCUS_03410 19239 19388 gene locus_tag LOCUS_03420 19239 19388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03420 19372 21645 gene locus_tag LOCUS_03430 19372 21645 CDS product glycoside hydrolase family 65 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549627.1 protein_id gnl|my_center|LOCUS_03430 21630 22292 gene locus_tag LOCUS_03440 gene pgmB 21630 22292 CDS product beta-phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549628.1 protein_id gnl|my_center|LOCUS_03440 22312 23415 gene locus_tag LOCUS_03450 gene ugpC 22312 23415 CDS product sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546234.1 protein_id gnl|my_center|LOCUS_03450 23520 24734 gene locus_tag LOCUS_03460 23520 24734 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549630.1 protein_id gnl|my_center|LOCUS_03460 24797 26146 gene locus_tag LOCUS_03470 24797 26146 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549632.1 protein_id gnl|my_center|LOCUS_03470 26152 27021 gene locus_tag LOCUS_03480 26152 27021 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549634.1 protein_id gnl|my_center|LOCUS_03480 28479 27100 gene locus_tag LOCUS_03490 28479 27100 CDS product flavocytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546997.1 protein_id gnl|my_center|LOCUS_03490 29915 28503 gene locus_tag LOCUS_03500 29915 28503 CDS product C69 family dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549685.1 protein_id gnl|my_center|LOCUS_03500 30013 30234 gene locus_tag LOCUS_03510 30013 30234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007126009.1 protein_id gnl|my_center|LOCUS_03510 30247 30804 gene locus_tag LOCUS_03520 30247 30804 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549688.1 protein_id gnl|my_center|LOCUS_03520 30798 31358 gene locus_tag LOCUS_03530 30798 31358 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549689.1 protein_id gnl|my_center|LOCUS_03530 31376 32161 gene locus_tag LOCUS_03540 31376 32161 CDS product tyrosine-protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549690.1 protein_id gnl|my_center|LOCUS_03540 32266 32421 gene locus_tag LOCUS_03550 32266 32421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03550 32889 33608 gene locus_tag LOCUS_03560 gene rsmG 32889 33608 CDS product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549696.1 protein_id gnl|my_center|LOCUS_03560 33629 34474 gene locus_tag LOCUS_03570 gene noc 33629 34474 CDS product nucleoid occlusion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254588.1 protein_id gnl|my_center|LOCUS_03570 34477 35250 gene locus_tag LOCUS_03580 34477 35250 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254587.1 protein_id gnl|my_center|LOCUS_03580 35234 36112 gene locus_tag LOCUS_03590 35234 36112 CDS product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549701.1 protein_id gnl|my_center|LOCUS_03590 36127 36378 gene locus_tag LOCUS_03600 36127 36378 CDS product DUF951 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549703.1 protein_id gnl|my_center|LOCUS_03600 36391 37491 gene locus_tag LOCUS_03610 gene ychF 36391 37491 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549709.1 protein_id gnl|my_center|LOCUS_03610 37503 38279 gene locus_tag LOCUS_03620 37503 38279 CDS product DUF1129 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002363563.1 protein_id gnl|my_center|LOCUS_03620 38883 38332 gene locus_tag LOCUS_03630 38883 38332 CDS product cysteine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254459.1 protein_id gnl|my_center|LOCUS_03630 38966 39601 gene locus_tag LOCUS_03640 gene pcp 38966 39601 CDS product pyroglutamyl-peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548812.1 protein_id gnl|my_center|LOCUS_03640 39637 40725 gene locus_tag LOCUS_03650 39637 40725 CDS product LCP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548816.1 protein_id gnl|my_center|LOCUS_03650 40731 41345 gene locus_tag LOCUS_03660 40731 41345 CDS product glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548818.1 protein_id gnl|my_center|LOCUS_03660 41586 42839 gene locus_tag LOCUS_03670 gene tyrS 41586 42839 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548823.1 protein_id gnl|my_center|LOCUS_03670 42898 42970 gene locus_tag LOCUS_t00100 42898 42970 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 43056 43874 gene locus_tag LOCUS_03680 gene pfkB 43056 43874 CDS product 1-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003731860.1 protein_id gnl|my_center|LOCUS_03680 44711 43911 gene locus_tag LOCUS_03690 44711 43911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03690 45222 44779 gene locus_tag LOCUS_03700 45222 44779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03700 45411 46103 gene locus_tag LOCUS_03710 45411 46103 CDS product 2,3-diphosphoglycerate-dependent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548802.1 protein_id gnl|my_center|LOCUS_03710 47508 46132 gene locus_tag LOCUS_03720 47508 46132 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548899.1 protein_id gnl|my_center|LOCUS_03720 47648 48079 gene locus_tag LOCUS_03730 47648 48079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03730 48099 48644 gene locus_tag LOCUS_03740 gene rpoE 48099 48644 CDS product DNA-directed RNA polymerase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548904.1 protein_id gnl|my_center|LOCUS_03740 48752 50374 gene locus_tag LOCUS_03750 48752 50374 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254085.1 protein_id gnl|my_center|LOCUS_03750 50506 51771 gene locus_tag LOCUS_03760 50506 51771 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254086.1 protein_id gnl|my_center|LOCUS_03760 51830 52549 gene locus_tag LOCUS_03770 51830 52549 CDS product MIP/aquaporin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548130.1 protein_id gnl|my_center|LOCUS_03770 54591 53020 gene locus_tag LOCUS_03780 54591 53020 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254025.1 protein_id gnl|my_center|LOCUS_03780 56183 54612 gene locus_tag LOCUS_03790 56183 54612 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547498.1 protein_id gnl|my_center|LOCUS_03790 56402 56232 gene locus_tag LOCUS_03800 56402 56232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03800 56913 56740 gene locus_tag LOCUS_03810 56913 56740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03810 57308 57021 gene locus_tag LOCUS_03820 57308 57021 CDS product DUF2187 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549842.1 protein_id gnl|my_center|LOCUS_03820 57401 57958 gene locus_tag LOCUS_03830 57401 57958 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041814911.1 protein_id gnl|my_center|LOCUS_03830 58101 58802 gene locus_tag LOCUS_03840 58101 58802 CDS product C40 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549854.1 protein_id gnl|my_center|LOCUS_03840 58958 60139 gene locus_tag LOCUS_03850 58958 60139 CDS product L,D-transpeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549671.1 protein_id gnl|my_center|LOCUS_03850 60154 60870 gene locus_tag LOCUS_03860 60154 60870 CDS product TIGR02206 family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029714299.1 protein_id gnl|my_center|LOCUS_03860 61541 61948 gene locus_tag LOCUS_03870 gene rpsL 61541 61948 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549020.1 protein_id gnl|my_center|LOCUS_03870 61964 62434 gene locus_tag LOCUS_03880 gene rpsG 61964 62434 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549021.1 protein_id gnl|my_center|LOCUS_03880 62467 64557 gene locus_tag LOCUS_03890 gene fusA 62467 64557 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549022.1 protein_id gnl|my_center|LOCUS_03890 64740 67031 gene locus_tag LOCUS_03900 gene helD 64740 67031 CDS product RNA polymerase recycling motor HelD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003627819.1 protein_id gnl|my_center|LOCUS_03900 67119 67961 gene locus_tag LOCUS_03910 gene coaA 67119 67961 CDS product type I pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003550009.1 protein_id gnl|my_center|LOCUS_03910 67974 68534 gene locus_tag LOCUS_03920 gene efp 67974 68534 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003550017.1 protein_id gnl|my_center|LOCUS_03920 68691 69971 gene locus_tag LOCUS_03930 gene pepT 68691 69971 CDS product peptidase T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548288.1 protein_id gnl|my_center|LOCUS_03930 69991 70902 gene locus_tag LOCUS_03940 69991 70902 CDS product DNA/RNA non-specific endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003550055.1 protein_id gnl|my_center|LOCUS_03940 71883 70966 gene locus_tag LOCUS_03950 71883 70966 CDS product BadF/BadG/BcrA/BcrD ATPase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548278.1 protein_id gnl|my_center|LOCUS_03950 72056 72964 gene locus_tag LOCUS_03960 72056 72964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03960 72986 73828 gene locus_tag LOCUS_03970 72986 73828 CDS product zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003550081.1 protein_id gnl|my_center|LOCUS_03970 74657 73878 gene locus_tag LOCUS_03980 74657 73878 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254520.1 protein_id gnl|my_center|LOCUS_03980 74803 75402 gene locus_tag LOCUS_03990 74803 75402 CDS product TVP38/TMEM64 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003550094.1 protein_id gnl|my_center|LOCUS_03990 75406 75903 gene locus_tag LOCUS_04000 75406 75903 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003550097.1 protein_id gnl|my_center|LOCUS_04000 76150 77460 gene locus_tag LOCUS_04010 gene serS 76150 77460 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254519.1 protein_id gnl|my_center|LOCUS_04010 80681 77514 gene locus_tag LOCUS_04020 80681 77514 CDS product type I restriction endonuclease subunit R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968692.1 protein_id gnl|my_center|LOCUS_04020 81409 80699 gene locus_tag LOCUS_04030 81409 80699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04030 82578 81412 gene locus_tag LOCUS_04040 82578 81412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04040 84395 82575 gene locus_tag LOCUS_04050 84395 82575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04050 84607 84392 gene locus_tag LOCUS_04060 84607 84392 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000885335.1 protein_id gnl|my_center|LOCUS_04060 85064 86407 gene locus_tag LOCUS_04070 85064 86407 CDS product maltose-6'-phosphate glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549970.1 protein_id gnl|my_center|LOCUS_04070 86491 88113 gene locus_tag LOCUS_04080 86491 88113 CDS product alpha-glucoside-specific PTS transporter subunit IIBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546418.1 protein_id gnl|my_center|LOCUS_04080 88445 89251 gene locus_tag LOCUS_04090 88445 89251 CDS product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254203.1 protein_id gnl|my_center|LOCUS_04090 89229 89738 gene locus_tag LOCUS_04100 89229 89738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04100 89743 90228 gene locus_tag LOCUS_04110 89743 90228 CDS product PTS glucose transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546424.1 protein_id gnl|my_center|LOCUS_04110 90371 90895 gene locus_tag LOCUS_04120 90371 90895 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254592.1 protein_id gnl|my_center|LOCUS_04120 90899 91954 gene locus_tag LOCUS_04130 90899 91954 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254591.1 protein_id gnl|my_center|LOCUS_04130 91977 92654 gene locus_tag LOCUS_04140 91977 92654 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254590.1 protein_id gnl|my_center|LOCUS_04140 93373 92657 gene locus_tag LOCUS_04150 93373 92657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04150 93520 94389 gene locus_tag LOCUS_04160 93520 94389 CDS product phosphate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003701554.1 protein_id gnl|my_center|LOCUS_04160 94392 95306 gene locus_tag LOCUS_04170 gene pstC 94392 95306 CDS product phosphate ABC transporter permease subunit PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674325.1 protein_id gnl|my_center|LOCUS_04170 95309 96202 gene locus_tag LOCUS_04180 gene pstA 95309 96202 CDS product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549099.1 protein_id gnl|my_center|LOCUS_04180 96202 96969 gene locus_tag LOCUS_04190 gene pstB 96202 96969 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003702915.1 protein_id gnl|my_center|LOCUS_04190 96981 97733 gene locus_tag LOCUS_04200 gene pstB 96981 97733 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549101.1 protein_id gnl|my_center|LOCUS_04200 >Feature sequence04 525 686 gene locus_tag LOCUS_04210 525 686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04210 740 3448 gene locus_tag LOCUS_04220 gene lanM 740 3448 CDS product type 2 lanthipeptide synthetase LanM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000875575.1 protein_id gnl|my_center|LOCUS_04220 3504 5600 gene locus_tag LOCUS_04230 3504 5600 CDS product peptidase domain-containing ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000701298.1 protein_id gnl|my_center|LOCUS_04230 5593 6498 gene locus_tag LOCUS_04240 5593 6498 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262197.1 protein_id gnl|my_center|LOCUS_04240 6505 7245 gene locus_tag LOCUS_04250 6505 7245 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003703143.1 protein_id gnl|my_center|LOCUS_04250 7238 7984 gene locus_tag LOCUS_04260 7238 7984 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476317.1 protein_id gnl|my_center|LOCUS_04260 8298 9161 gene locus_tag LOCUS_04270 8298 9161 CDS product Rgg/GadR/MutR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263840.1 protein_id gnl|my_center|LOCUS_04270 10287 10553 gene locus_tag LOCUS_04280 10287 10553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04280 10621 10881 gene locus_tag LOCUS_04290 10621 10881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04290 10941 11060 gene locus_tag LOCUS_04300 10941 11060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04300 12178 11291 gene locus_tag LOCUS_04310 12178 11291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04310 12672 12109 gene locus_tag LOCUS_04320 12672 12109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04320 15718 12764 gene locus_tag LOCUS_04330 15718 12764 CDS product glycoside hydrolase family 31 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548741.1 protein_id gnl|my_center|LOCUS_04330 15806 16966 gene locus_tag LOCUS_04340 gene nagA 15806 16966 CDS product N-acetylglucosamine-6-phosphate deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254054.1 protein_id gnl|my_center|LOCUS_04340 17059 17457 gene locus_tag LOCUS_04350 17059 17457 CDS product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194089.1 protein_id gnl|my_center|LOCUS_04350 17706 19283 gene locus_tag LOCUS_04360 17706 19283 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254534.1 protein_id gnl|my_center|LOCUS_04360 20236 19463 gene locus_tag LOCUS_04370 20236 19463 CDS product ABC-2 family transporter protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861932.1 protein_id gnl|my_center|LOCUS_04370 20847 20233 gene locus_tag LOCUS_04380 20847 20233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04380 21902 20982 gene locus_tag LOCUS_04390 21902 20982 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016723.1 protein_id gnl|my_center|LOCUS_04390 22890 22090 gene locus_tag LOCUS_04400 22890 22090 CDS product tyrosine-protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548752.1 protein_id gnl|my_center|LOCUS_04400 23039 23515 gene locus_tag LOCUS_04410 23039 23515 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548753.1 protein_id gnl|my_center|LOCUS_04410 23601 24083 gene locus_tag LOCUS_04420 23601 24083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548767.1 protein_id gnl|my_center|LOCUS_04420 24136 25527 gene locus_tag LOCUS_04430 24136 25527 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254060.1 protein_id gnl|my_center|LOCUS_04430 25593 27542 gene locus_tag LOCUS_04440 gene asnB 25593 27542 CDS product asparagine synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548773.1 protein_id gnl|my_center|LOCUS_04440 27560 28819 gene locus_tag LOCUS_04450 27560 28819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548775.1 protein_id gnl|my_center|LOCUS_04450 29019 30335 gene locus_tag LOCUS_04460 29019 30335 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011922251.1 protein_id gnl|my_center|LOCUS_04460 30329 31744 gene locus_tag LOCUS_04470 30329 31744 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002905175.1 protein_id gnl|my_center|LOCUS_04470 31872 33392 gene locus_tag LOCUS_04480 gene glpK 31872 33392 CDS product glycerol kinase GlpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775048.1 protein_id gnl|my_center|LOCUS_04480 33395 35230 gene locus_tag LOCUS_04490 gene glpO 33395 35230 CDS product type 1 glycerol-3-phosphate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837394.1 protein_id gnl|my_center|LOCUS_04490 35249 35962 gene locus_tag LOCUS_04500 35249 35962 CDS product MIP/aquaporin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641945.1 protein_id gnl|my_center|LOCUS_04500 36142 36459 gene locus_tag LOCUS_04510 36142 36459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04510 36682 38871 gene locus_tag LOCUS_04520 gene nrdD 36682 38871 CDS product anaerobic ribonucleoside-triphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254061.1 protein_id gnl|my_center|LOCUS_04520 38896 39609 gene locus_tag LOCUS_04530 gene nrdG 38896 39609 CDS product anaerobic ribonucleoside-triphosphate reductase activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548777.1 protein_id gnl|my_center|LOCUS_04530 39712 40932 gene locus_tag LOCUS_04540 39712 40932 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548780.1 protein_id gnl|my_center|LOCUS_04540 41047 42996 gene locus_tag LOCUS_04550 41047 42996 CDS product peptidase M13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548782.1 protein_id gnl|my_center|LOCUS_04550 44452 43142 gene locus_tag LOCUS_04560 44452 43142 CDS product C1 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254075.1 protein_id gnl|my_center|LOCUS_04560 45950 44523 gene locus_tag LOCUS_04570 45950 44523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04570 46404 45931 gene locus_tag LOCUS_04580 46404 45931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04580 46567 47028 gene locus_tag LOCUS_04590 gene greA 46567 47028 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548866.1 protein_id gnl|my_center|LOCUS_04590 47921 47121 gene locus_tag LOCUS_04600 47921 47121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04600 48623 47922 gene locus_tag LOCUS_04610 48623 47922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04610 49483 49169 gene locus_tag LOCUS_04620 49483 49169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04620 49606 50268 gene locus_tag LOCUS_04630 49606 50268 CDS product CPBP family intramembrane metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254077.1 protein_id gnl|my_center|LOCUS_04630 50371 50299 gene locus_tag LOCUS_t00110 50371 50299 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 50522 51541 gene locus_tag LOCUS_04640 gene trpS 50522 51541 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548870.1 protein_id gnl|my_center|LOCUS_04640 51563 52036 gene locus_tag LOCUS_04650 51563 52036 CDS product ComE operon protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548871.1 protein_id gnl|my_center|LOCUS_04650 52033 52602 gene locus_tag LOCUS_04660 52033 52602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04660 52934 55621 gene locus_tag LOCUS_04670 gene mgtA 52934 55621 CDS product magnesium-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548873.1 protein_id gnl|my_center|LOCUS_04670 55736 57715 gene locus_tag LOCUS_04680 gene metG 55736 57715 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254078.1 protein_id gnl|my_center|LOCUS_04680 57715 58488 gene locus_tag LOCUS_04690 57715 58488 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548876.1 protein_id gnl|my_center|LOCUS_04690 58472 59035 gene locus_tag LOCUS_04700 gene rnmV 58472 59035 CDS product ribonuclease M5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548877.1 protein_id gnl|my_center|LOCUS_04700 59025 59912 gene locus_tag LOCUS_04710 gene rsmA 59025 59912 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548878.1 protein_id gnl|my_center|LOCUS_04710 59990 60232 gene locus_tag LOCUS_04720 59990 60232 CDS product Veg family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548879.1 protein_id gnl|my_center|LOCUS_04720 60370 61206 gene locus_tag LOCUS_04730 gene purR 60370 61206 CDS product pur operon repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548880.1 protein_id gnl|my_center|LOCUS_04730 61240 62625 gene locus_tag LOCUS_04740 gene glmU 61240 62625 CDS product bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548882.1 protein_id gnl|my_center|LOCUS_04740 62719 63684 gene locus_tag LOCUS_04750 62719 63684 CDS product ribose-phosphate diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254080.1 protein_id gnl|my_center|LOCUS_04750 63930 64238 gene locus_tag LOCUS_04760 gene rpsJ 63930 64238 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549023.1 protein_id gnl|my_center|LOCUS_04760 64266 64895 gene locus_tag LOCUS_04770 gene rplC 64266 64895 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549024.1 protein_id gnl|my_center|LOCUS_04770 64910 65524 gene locus_tag LOCUS_04780 gene rplD 64910 65524 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549025.1 protein_id gnl|my_center|LOCUS_04780 65524 65826 gene locus_tag LOCUS_04790 gene rplW 65524 65826 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549026.1 protein_id gnl|my_center|LOCUS_04790 65842 66678 gene locus_tag LOCUS_04800 gene rplB 65842 66678 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254111.1 protein_id gnl|my_center|LOCUS_04800 66701 66985 gene locus_tag LOCUS_04810 gene rpsS 66701 66985 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003567557.1 protein_id gnl|my_center|LOCUS_04810 67004 67357 gene locus_tag LOCUS_04820 gene rplV 67004 67357 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549029.1 protein_id gnl|my_center|LOCUS_04820 67372 68046 gene locus_tag LOCUS_04830 gene rpsC 67372 68046 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254113.1 protein_id gnl|my_center|LOCUS_04830 68049 68486 gene locus_tag LOCUS_04840 gene rplP 68049 68486 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549031.1 protein_id gnl|my_center|LOCUS_04840 68476 68661 gene locus_tag LOCUS_04850 gene rpmC 68476 68661 CDS product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549032.1 protein_id gnl|my_center|LOCUS_04850 68684 68950 gene locus_tag LOCUS_04860 gene rpsQ 68684 68950 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254114.1 protein_id gnl|my_center|LOCUS_04860 68979 69347 gene locus_tag LOCUS_04870 gene rplN 68979 69347 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549034.1 protein_id gnl|my_center|LOCUS_04870 69368 69610 gene locus_tag LOCUS_04880 69368 69610 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549035.1 protein_id gnl|my_center|LOCUS_04880 69625 70167 gene locus_tag LOCUS_04890 gene rplE 69625 70167 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549036.1 protein_id gnl|my_center|LOCUS_04890 70183 70368 gene locus_tag LOCUS_04900 70183 70368 CDS product type Z 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549037.1 protein_id gnl|my_center|LOCUS_04900 70395 70793 gene locus_tag LOCUS_04910 gene rpsH 70395 70793 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549038.1 protein_id gnl|my_center|LOCUS_04910 70818 71348 gene locus_tag LOCUS_04920 gene rplF 70818 71348 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549039.1 protein_id gnl|my_center|LOCUS_04920 71375 71734 gene locus_tag LOCUS_04930 gene rplR 71375 71734 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549040.1 protein_id gnl|my_center|LOCUS_04930 71752 72264 gene locus_tag LOCUS_04940 gene rpsE 71752 72264 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549041.1 protein_id gnl|my_center|LOCUS_04940 72277 72462 gene locus_tag LOCUS_04950 gene rpmD 72277 72462 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549042.1 protein_id gnl|my_center|LOCUS_04950 72493 72933 gene locus_tag LOCUS_04960 gene rplO 72493 72933 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549043.1 protein_id gnl|my_center|LOCUS_04960 72933 74237 gene locus_tag LOCUS_04970 gene secY 72933 74237 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549044.1 protein_id gnl|my_center|LOCUS_04970 74247 74897 gene locus_tag LOCUS_04980 74247 74897 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549045.1 protein_id gnl|my_center|LOCUS_04980 74973 75194 gene locus_tag LOCUS_04990 gene infA 74973 75194 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002878178.1 protein_id gnl|my_center|LOCUS_04990 75358 75708 gene locus_tag LOCUS_05000 gene rpsM 75358 75708 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549046.1 protein_id gnl|my_center|LOCUS_05000 75729 76118 gene locus_tag LOCUS_05010 gene rpsK 75729 76118 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015613292.1 protein_id gnl|my_center|LOCUS_05010 76164 77102 gene locus_tag LOCUS_05020 76164 77102 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549048.1 protein_id gnl|my_center|LOCUS_05020 77127 77510 gene locus_tag LOCUS_05030 gene rplQ 77127 77510 CDS product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549049.1 protein_id gnl|my_center|LOCUS_05030 77695 78543 gene locus_tag LOCUS_05040 77695 78543 CDS product energy-coupling factor transporter ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549050.1 protein_id gnl|my_center|LOCUS_05040 78519 79370 gene locus_tag LOCUS_05050 78519 79370 CDS product energy-coupling factor transporter ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549051.1 protein_id gnl|my_center|LOCUS_05050 79371 80168 gene locus_tag LOCUS_05060 79371 80168 CDS product energy-coupling factor transporter transmembrane protein EcfT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288724.1 protein_id gnl|my_center|LOCUS_05060 80169 80951 gene locus_tag LOCUS_05070 gene truA 80169 80951 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549053.1 protein_id gnl|my_center|LOCUS_05070 81053 81496 gene locus_tag LOCUS_05080 gene rplM 81053 81496 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549054.1 protein_id gnl|my_center|LOCUS_05080 81510 81905 gene locus_tag LOCUS_05090 gene rpsI 81510 81905 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549055.1 protein_id gnl|my_center|LOCUS_05090 >Feature sequence05 65 1054 gene locus_tag LOCUS_05100 65 1054 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546749.1 protein_id gnl|my_center|LOCUS_05100 1102 1416 gene locus_tag LOCUS_05110 gene yidD 1102 1416 CDS product membrane protein insertion efficiency factor YidD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003564982.1 protein_id gnl|my_center|LOCUS_05110 1430 1657 gene locus_tag LOCUS_05120 1430 1657 CDS product DUF2969 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546751.1 protein_id gnl|my_center|LOCUS_05120 1674 2867 gene locus_tag LOCUS_05130 1674 2867 CDS product FtsW/RodA/SpoVE family cell cycle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546752.1 protein_id gnl|my_center|LOCUS_05130 3269 3583 gene locus_tag LOCUS_05140 3269 3583 CDS product YdcP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000420682.1 protein_id gnl|my_center|LOCUS_05140 3599 3985 gene locus_tag LOCUS_05150 3599 3985 CDS product YdcP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000985015.1 protein_id gnl|my_center|LOCUS_05150 4014 5399 gene locus_tag LOCUS_05160 4014 5399 CDS product FtsK/SpoIIIE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000813488.1 protein_id gnl|my_center|LOCUS_05160 5577 6035 gene locus_tag LOCUS_05170 5577 6035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_05170 6057 6782 gene locus_tag LOCUS_05180 6057 6782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_05180 6825 7046 gene locus_tag LOCUS_05190 6825 7046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001009056.1 protein_id gnl|my_center|LOCUS_05190 7163 7660 gene locus_tag LOCUS_05200 7163 7660 CDS product antirestriction protein ArdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000342539.1 protein_id gnl|my_center|LOCUS_05200 7749 8141 gene locus_tag LOCUS_05210 7749 8141 CDS product conjugal transfer protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000506270.1 protein_id gnl|my_center|LOCUS_05210 8125 10572 gene locus_tag LOCUS_05220 8125 10572 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000331160.1 protein_id gnl|my_center|LOCUS_05220 10575 12752 gene locus_tag LOCUS_05230 10575 12752 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000804748.1 protein_id gnl|my_center|LOCUS_05230 12749 13750 gene locus_tag LOCUS_05240 12749 13750 CDS product bifunctional lysozyme/C40 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000769868.1 protein_id gnl|my_center|LOCUS_05240 13747 14682 gene locus_tag LOCUS_05250 13747 14682 CDS product conjugal transfer protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001224318.1 protein_id gnl|my_center|LOCUS_05250 15059 16978 gene locus_tag LOCUS_05260 gene tet(M) 15059 16978 CDS product tetracycline resistance ribosomal protection protein Tet(M) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000691727.1 protein_id gnl|my_center|LOCUS_05260 17677 17324 gene locus_tag LOCUS_05270 17677 17324 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001227347.1 protein_id gnl|my_center|LOCUS_05270 18182 18604 gene locus_tag LOCUS_05280 18182 18604 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000804885.1 protein_id gnl|my_center|LOCUS_05280 18601 18831 gene locus_tag LOCUS_05290 18601 18831 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000857133.1 protein_id gnl|my_center|LOCUS_05290 19292 19495 gene locus_tag LOCUS_05300 19292 19495 CDS product excisionase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000814511.1 protein_id gnl|my_center|LOCUS_05300 19577 20794 gene locus_tag LOCUS_05310 19577 20794 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001291561.1 protein_id gnl|my_center|LOCUS_05310 21452 20979 gene locus_tag LOCUS_05320 21452 20979 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546753.1 protein_id gnl|my_center|LOCUS_05320 21794 21510 gene locus_tag LOCUS_05330 21794 21510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05330 23356 22049 gene locus_tag LOCUS_05340 23356 22049 CDS product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546755.1 protein_id gnl|my_center|LOCUS_05340 24041 23430 gene locus_tag LOCUS_05350 gene rpsD 24041 23430 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254249.1 protein_id gnl|my_center|LOCUS_05350 24324 26027 gene locus_tag LOCUS_05360 gene ezrA 24324 26027 CDS product septation ring formation regulator EzrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546759.1 protein_id gnl|my_center|LOCUS_05360 26128 27282 gene locus_tag LOCUS_05370 26128 27282 CDS product cysteine desulfurase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546760.1 protein_id gnl|my_center|LOCUS_05370 27293 28510 gene locus_tag LOCUS_05380 gene thiI 27293 28510 CDS product tRNA 4-thiouridine(8) synthase ThiI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546762.1 protein_id gnl|my_center|LOCUS_05380 28802 31441 gene locus_tag LOCUS_05390 28802 31441 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254252.1 protein_id gnl|my_center|LOCUS_05390 31445 32710 gene locus_tag LOCUS_05400 31445 32710 CDS product folylpolyglutamate synthase/dihydrofolate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254253.1 protein_id gnl|my_center|LOCUS_05400 32691 33368 gene locus_tag LOCUS_05410 32691 33368 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546772.1 protein_id gnl|my_center|LOCUS_05410 33401 34018 gene locus_tag LOCUS_05420 gene radC 33401 34018 CDS product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546774.1 protein_id gnl|my_center|LOCUS_05420 34114 35112 gene locus_tag LOCUS_05430 34114 35112 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546776.1 protein_id gnl|my_center|LOCUS_05430 35162 36010 gene locus_tag LOCUS_05440 gene mreC 35162 36010 CDS product rod shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546779.1 protein_id gnl|my_center|LOCUS_05440 36010 36537 gene locus_tag LOCUS_05450 36010 36537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05450 37328 37759 gene locus_tag LOCUS_05460 gene mraZ 37328 37759 CDS product division/cell wall cluster transcriptional repressor MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700457.1 protein_id gnl|my_center|LOCUS_05460 37756 38709 gene locus_tag LOCUS_05470 gene rsmH 37756 38709 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546789.1 protein_id gnl|my_center|LOCUS_05470 38737 39102 gene locus_tag LOCUS_05480 gene ftsL 38737 39102 CDS product cell division protein FtsL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254255.1 protein_id gnl|my_center|LOCUS_05480 39099 41252 gene locus_tag LOCUS_05490 39099 41252 CDS product penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546793.1 protein_id gnl|my_center|LOCUS_05490 41261 42220 gene locus_tag LOCUS_05500 gene mraY 41261 42220 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546795.1 protein_id gnl|my_center|LOCUS_05500 42234 43616 gene locus_tag LOCUS_05510 gene murD 42234 43616 CDS product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546797.1 protein_id gnl|my_center|LOCUS_05510 43619 44731 gene locus_tag LOCUS_05520 gene murG 43619 44731 CDS product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254256.1 protein_id gnl|my_center|LOCUS_05520 44760 45596 gene locus_tag LOCUS_05530 44760 45596 CDS product FtsQ-type POTRA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546801.1 protein_id gnl|my_center|LOCUS_05530 45661 47028 gene locus_tag LOCUS_05540 gene ftsA 45661 47028 CDS product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254257.1 protein_id gnl|my_center|LOCUS_05540 47047 48309 gene locus_tag LOCUS_05550 gene ftsZ 47047 48309 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546805.1 protein_id gnl|my_center|LOCUS_05550 48332 48754 gene locus_tag LOCUS_05560 gene sepF 48332 48754 CDS product cell division protein SepF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254258.1 protein_id gnl|my_center|LOCUS_05560 48757 49047 gene locus_tag LOCUS_05570 48757 49047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05570 49188 49802 gene locus_tag LOCUS_05580 gene gmk 49188 49802 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547929.1 protein_id gnl|my_center|LOCUS_05580 49804 50022 gene locus_tag LOCUS_05590 gene rpoZ 49804 50022 CDS product DNA-directed RNA polymerase subunit omega inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547927.1 protein_id gnl|my_center|LOCUS_05590 50080 52470 gene locus_tag LOCUS_05600 gene priA 50080 52470 CDS product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547921.1 protein_id gnl|my_center|LOCUS_05600 52493 53437 gene locus_tag LOCUS_05610 gene fmt 52493 53437 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547919.1 protein_id gnl|my_center|LOCUS_05610 53427 54740 gene locus_tag LOCUS_05620 gene rsmB 53427 54740 CDS product 16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254418.1 protein_id gnl|my_center|LOCUS_05620 54746 55495 gene locus_tag LOCUS_05630 54746 55495 CDS product Stp1/IreP family PP2C-type Ser/Thr phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254417.1 protein_id gnl|my_center|LOCUS_05630 55498 57417 gene locus_tag LOCUS_05640 gene pknB 55498 57417 CDS product Stk1 family PASTA domain-containing Ser/Thr kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_056938256.1 protein_id gnl|my_center|LOCUS_05640 57417 58310 gene locus_tag LOCUS_05650 gene rsgA 57417 58310 CDS product ribosome small subunit-dependent GTPase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547915.1 protein_id gnl|my_center|LOCUS_05650 58318 58968 gene locus_tag LOCUS_05660 gene rpe 58318 58968 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547914.1 protein_id gnl|my_center|LOCUS_05660 58953 59666 gene locus_tag LOCUS_05670 58953 59666 CDS product thiamine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254415.1 protein_id gnl|my_center|LOCUS_05670 60321 59686 gene locus_tag LOCUS_05680 gene udk 60321 59686 CDS product uridine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546365.1 protein_id gnl|my_center|LOCUS_05680 60484 61962 gene locus_tag LOCUS_05690 60484 61962 CDS product ABC transporter substrate-binding protein/permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548719.1 protein_id gnl|my_center|LOCUS_05690 61955 62695 gene locus_tag LOCUS_05700 61955 62695 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254050.1 protein_id gnl|my_center|LOCUS_05700 62816 63868 gene locus_tag LOCUS_05710 62816 63868 CDS product inorganic phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052107.1 protein_id gnl|my_center|LOCUS_05710 63878 64501 gene locus_tag LOCUS_05720 63878 64501 CDS product DUF47 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068188.1 protein_id gnl|my_center|LOCUS_05720 64562 65353 gene locus_tag LOCUS_05730 gene sufC 64562 65353 CDS product Fe-S cluster assembly ATPase SufC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004894681.1 protein_id gnl|my_center|LOCUS_05730 65366 66664 gene locus_tag LOCUS_05740 gene sufD 65366 66664 CDS product Fe-S cluster assembly protein SufD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101418.1 protein_id gnl|my_center|LOCUS_05740 66630 67868 gene locus_tag LOCUS_05750 66630 67868 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101419.1 protein_id gnl|my_center|LOCUS_05750 67858 68307 gene locus_tag LOCUS_05760 67858 68307 CDS product SUF system NifU family Fe-S cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640266.1 protein_id gnl|my_center|LOCUS_05760 68309 69712 gene locus_tag LOCUS_05770 gene sufB 68309 69712 CDS product Fe-S cluster assembly protein SufB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014567504.1 protein_id gnl|my_center|LOCUS_05770 69790 70257 gene locus_tag LOCUS_05780 69790 70257 CDS product Dps family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002354782.1 protein_id gnl|my_center|LOCUS_05780 70815 71903 gene locus_tag LOCUS_05790 70815 71903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05790 73396 72053 gene locus_tag LOCUS_05800 73396 72053 CDS product PFL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475560.1 protein_id gnl|my_center|LOCUS_05800 73680 73414 gene locus_tag LOCUS_05810 73680 73414 CDS product ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003703119.1 protein_id gnl|my_center|LOCUS_05810 73834 74772 gene locus_tag LOCUS_05820 gene rbsK 73834 74772 CDS product ribokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003563212.1 protein_id gnl|my_center|LOCUS_05820 74759 75454 gene locus_tag LOCUS_05830 gene rpiA 74759 75454 CDS product ribose-5-phosphate isomerase RpiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254196.1 protein_id gnl|my_center|LOCUS_05830 75558 76490 gene locus_tag LOCUS_05840 75558 76490 CDS product nucleoside hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546379.1 protein_id gnl|my_center|LOCUS_05840 76490 77215 gene locus_tag LOCUS_05850 76490 77215 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546381.1 protein_id gnl|my_center|LOCUS_05850 77363 79759 gene locus_tag LOCUS_05860 77363 79759 CDS product phosphoketolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254199.1 protein_id gnl|my_center|LOCUS_05860 79868 81214 gene locus_tag LOCUS_05870 79868 81214 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905313.1 protein_id gnl|my_center|LOCUS_05870 >Feature sequence06 675 223 gene locus_tag LOCUS_05880 675 223 CDS product threonine/serine exporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549820.1 protein_id gnl|my_center|LOCUS_05880 1459 677 gene locus_tag LOCUS_05890 1459 677 CDS product threonine/serine exporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549818.1 protein_id gnl|my_center|LOCUS_05890 1841 1452 gene locus_tag LOCUS_05900 1841 1452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549816.1 protein_id gnl|my_center|LOCUS_05900 2026 2610 gene locus_tag LOCUS_05910 2026 2610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05910 3748 2642 gene locus_tag LOCUS_05920 3748 2642 CDS product LCP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549814.1 protein_id gnl|my_center|LOCUS_05920 3886 5685 gene locus_tag LOCUS_05930 gene pepF 3886 5685 CDS product oligoendopeptidase F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549813.1 protein_id gnl|my_center|LOCUS_05930 5818 6813 gene locus_tag LOCUS_05940 gene dhaK 5818 6813 CDS product dihydroxyacetone kinase subunit DhaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548125.1 protein_id gnl|my_center|LOCUS_05940 6826 7410 gene locus_tag LOCUS_05950 gene dhaL 6826 7410 CDS product dihydroxyacetone kinase subunit DhaL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548127.1 protein_id gnl|my_center|LOCUS_05950 7407 7775 gene locus_tag LOCUS_05960 gene dhaM 7407 7775 CDS product dihydroxyacetone kinase phosphoryl donor subunit DhaM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003704317.1 protein_id gnl|my_center|LOCUS_05960 8614 7934 gene locus_tag LOCUS_05970 8614 7934 CDS product DUF3800 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012028388.1 protein_id gnl|my_center|LOCUS_05970 11308 8669 gene locus_tag LOCUS_05980 11308 8669 CDS product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034260979.1 protein_id gnl|my_center|LOCUS_05980 13353 11311 gene locus_tag LOCUS_05990 13353 11311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05990 15269 13353 gene locus_tag LOCUS_06000 15269 13353 CDS product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034528504.1 protein_id gnl|my_center|LOCUS_06000 16987 15428 gene locus_tag LOCUS_06010 gene vly 16987 15428 CDS product cholesterol-dependent cytolysin vaginolysin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_180947087.1 protein_id gnl|my_center|LOCUS_06010 17189 17665 gene locus_tag LOCUS_06020 17189 17665 CDS product nucleoside 2-deoxyribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015613286.1 protein_id gnl|my_center|LOCUS_06020 19530 17794 gene locus_tag LOCUS_06030 gene ptsP 19530 17794 CDS product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254212.1 protein_id gnl|my_center|LOCUS_06030 19796 19530 gene locus_tag LOCUS_06040 19796 19530 CDS product phosphocarrier protein HPr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546482.1 protein_id gnl|my_center|LOCUS_06040 20097 19924 gene locus_tag LOCUS_06050 20097 19924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06050 20228 22369 gene locus_tag LOCUS_06060 20228 22369 CDS product ATP-dependent Clp protease ATP-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254211.1 protein_id gnl|my_center|LOCUS_06060 22424 22702 gene locus_tag LOCUS_06070 22424 22702 CDS product DUF1827 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546474.1 protein_id gnl|my_center|LOCUS_06070 23766 22885 gene locus_tag LOCUS_06080 23766 22885 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548384.1 protein_id gnl|my_center|LOCUS_06080 24725 23916 gene locus_tag LOCUS_06090 24725 23916 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948543.1 protein_id gnl|my_center|LOCUS_06090 25629 24718 gene locus_tag LOCUS_06100 25629 24718 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000074567.1 protein_id gnl|my_center|LOCUS_06100 25948 25712 gene locus_tag LOCUS_06110 25948 25712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06110 31044 25969 gene locus_tag LOCUS_06120 31044 25969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06120 32488 31166 gene locus_tag LOCUS_06130 gene murC 32488 31166 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548413.1 protein_id gnl|my_center|LOCUS_06130 33176 32523 gene locus_tag LOCUS_06140 33176 32523 CDS product DUF4479 and tRNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548415.1 protein_id gnl|my_center|LOCUS_06140 33512 33192 gene locus_tag LOCUS_06150 33512 33192 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254504.1 protein_id gnl|my_center|LOCUS_06150 34181 33531 gene locus_tag LOCUS_06160 gene trmB 34181 33531 CDS product tRNA (guanosine(46)-N7)-methyltransferase TrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548419.1 protein_id gnl|my_center|LOCUS_06160 35389 34193 gene locus_tag LOCUS_06170 35389 34193 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015613400.1 protein_id gnl|my_center|LOCUS_06170 36122 35373 gene locus_tag LOCUS_06180 36122 35373 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548423.1 protein_id gnl|my_center|LOCUS_06180 36213 36650 gene locus_tag LOCUS_06190 36213 36650 CDS product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548425.1 protein_id gnl|my_center|LOCUS_06190 36662 36973 gene locus_tag LOCUS_06200 36662 36973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06200 37064 37957 gene locus_tag LOCUS_06210 37064 37957 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254505.1 protein_id gnl|my_center|LOCUS_06210 39061 38084 gene locus_tag LOCUS_06220 39061 38084 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254506.1 protein_id gnl|my_center|LOCUS_06220 41459 39063 gene locus_tag LOCUS_06230 41459 39063 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254507.1 protein_id gnl|my_center|LOCUS_06230 42666 41443 gene locus_tag LOCUS_06240 42666 41443 CDS product DNA repair exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548436.1 protein_id gnl|my_center|LOCUS_06240 43026 42676 gene locus_tag LOCUS_06250 43026 42676 CDS product YlbF family regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548438.1 protein_id gnl|my_center|LOCUS_06250 45123 43045 gene locus_tag LOCUS_06260 45123 43045 CDS product PBP1A family penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548440.1 protein_id gnl|my_center|LOCUS_06260 45184 46062 gene locus_tag LOCUS_06270 45184 46062 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548442.1 protein_id gnl|my_center|LOCUS_06270 47062 46148 gene locus_tag LOCUS_06280 gene fba 47062 46148 CDS product class II fructose-1,6-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254510.1 protein_id gnl|my_center|LOCUS_06280 48834 47158 gene locus_tag LOCUS_06290 gene argS 48834 47158 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548463.1 protein_id gnl|my_center|LOCUS_06290 50373 49096 gene locus_tag LOCUS_06300 50373 49096 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254512.1 protein_id gnl|my_center|LOCUS_06300 52642 50357 gene locus_tag LOCUS_06310 52642 50357 CDS product glycoside hydrolase family 31 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254583.1 protein_id gnl|my_center|LOCUS_06310 53515 52646 gene locus_tag LOCUS_06320 53515 52646 CDS product NAD(P)H-hydrate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254511.1 protein_id gnl|my_center|LOCUS_06320 53596 53679 gene locus_tag LOCUS_t00120 53596 53679 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 54172 53891 gene locus_tag LOCUS_06330 54172 53891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06330 54761 54345 gene locus_tag LOCUS_06340 54761 54345 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000381519.1 protein_id gnl|my_center|LOCUS_06340 54939 54745 gene locus_tag LOCUS_06350 54939 54745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06350 55156 54956 gene locus_tag LOCUS_06360 55156 54956 CDS product CPCC family cysteine-rich protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001044017.1 protein_id gnl|my_center|LOCUS_06360 55580 55125 gene locus_tag LOCUS_06370 55580 55125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06370 55963 55595 gene locus_tag LOCUS_06380 55963 55595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06380 56291 56112 gene locus_tag LOCUS_06390 56291 56112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06390 56977 56798 gene locus_tag LOCUS_06400 56977 56798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06400 57286 57137 gene locus_tag LOCUS_06410 57286 57137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06410 57588 57412 gene locus_tag LOCUS_06420 57588 57412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06420 57756 58424 gene locus_tag LOCUS_06430 57756 58424 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922054.1 protein_id gnl|my_center|LOCUS_06430 59511 58807 gene locus_tag LOCUS_06440 59511 58807 CDS product class II aldolase/adducin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102245.1 protein_id gnl|my_center|LOCUS_06440 59771 59583 gene locus_tag LOCUS_06450 59771 59583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06450 61353 59788 gene locus_tag LOCUS_06460 61353 59788 CDS product PTS galactitol transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102243.1 protein_id gnl|my_center|LOCUS_06460 61680 61372 gene locus_tag LOCUS_06470 61680 61372 CDS product PTS sugar transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102242.1 protein_id gnl|my_center|LOCUS_06470 62168 61698 gene locus_tag LOCUS_06480 62168 61698 CDS product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102241.1 protein_id gnl|my_center|LOCUS_06480 62331 63095 gene locus_tag LOCUS_06490 62331 63095 CDS product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102240.1 protein_id gnl|my_center|LOCUS_06490 63806 63240 gene locus_tag LOCUS_06500 63806 63240 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546208.1 protein_id gnl|my_center|LOCUS_06500 65458 63830 gene locus_tag LOCUS_06510 65458 63830 CDS product polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548498.1 protein_id gnl|my_center|LOCUS_06510 67894 65480 gene locus_tag LOCUS_06520 gene leuS 67894 65480 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548508.1 protein_id gnl|my_center|LOCUS_06520 69647 68181 gene locus_tag LOCUS_06530 69647 68181 CDS product MDR family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548513.1 protein_id gnl|my_center|LOCUS_06530 70845 69640 gene locus_tag LOCUS_06540 gene metK 70845 69640 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548514.1 protein_id gnl|my_center|LOCUS_06540 70951 70802 gene locus_tag LOCUS_06550 70951 70802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06550 71039 70965 gene locus_tag LOCUS_t00130 71039 70965 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 71115 71042 gene locus_tag LOCUS_t00140 71115 71042 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 71304 71213 gene locus_tag LOCUS_t00150 71304 71213 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence07 558 367 gene locus_tag LOCUS_06560 558 367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06560 735 905 gene locus_tag LOCUS_06570 735 905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06570 2345 1176 gene locus_tag LOCUS_06580 2345 1176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_06580 2906 2484 gene locus_tag LOCUS_06590 2906 2484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_06590 4293 3301 gene locus_tag LOCUS_06600 4293 3301 CDS product GMP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254608.1 protein_id gnl|my_center|LOCUS_06600 4485 5774 gene locus_tag LOCUS_06610 4485 5774 CDS product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549585.1 protein_id gnl|my_center|LOCUS_06610 5778 7073 gene locus_tag LOCUS_06620 gene purB 5778 7073 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254607.1 protein_id gnl|my_center|LOCUS_06620 7187 7846 gene locus_tag LOCUS_06630 7187 7846 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002984437.1 protein_id gnl|my_center|LOCUS_06630 7843 8598 gene locus_tag LOCUS_06640 7843 8598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06640 9999 8716 gene locus_tag LOCUS_06650 gene hflX 9999 8716 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549861.1 protein_id gnl|my_center|LOCUS_06650 10683 10033 gene locus_tag LOCUS_06660 10683 10033 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549989.1 protein_id gnl|my_center|LOCUS_06660 11412 10777 gene locus_tag LOCUS_06670 gene pyrE 11412 10777 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548040.1 protein_id gnl|my_center|LOCUS_06670 12121 11414 gene locus_tag LOCUS_06680 gene pyrF 12121 11414 CDS product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548039.1 protein_id gnl|my_center|LOCUS_06680 12369 13610 gene locus_tag LOCUS_06690 12369 13610 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288985.1 protein_id gnl|my_center|LOCUS_06690 13616 14536 gene locus_tag LOCUS_06700 13616 14536 CDS product dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254443.1 protein_id gnl|my_center|LOCUS_06700 14582 15124 gene locus_tag LOCUS_06710 gene pyrR 14582 15124 CDS product bifunctional pyr operon transcriptional regulator/uracil phosphoribosyltransferase PyrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548034.1 protein_id gnl|my_center|LOCUS_06710 15263 16204 gene locus_tag LOCUS_06720 15263 16204 CDS product aspartate carbamoyltransferase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548032.1 protein_id gnl|my_center|LOCUS_06720 16204 17481 gene locus_tag LOCUS_06730 16204 17481 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254442.1 protein_id gnl|my_center|LOCUS_06730 17481 18563 gene locus_tag LOCUS_06740 gene carA 17481 18563 CDS product glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548026.1 protein_id gnl|my_center|LOCUS_06740 18556 21723 gene locus_tag LOCUS_06750 gene carB 18556 21723 CDS product carbamoyl-phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254441.1 protein_id gnl|my_center|LOCUS_06750 22007 21846 gene locus_tag LOCUS_06760 22007 21846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06760 22092 22970 gene locus_tag LOCUS_06770 22092 22970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06770 22963 23616 gene locus_tag LOCUS_06780 22963 23616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06780 23603 24139 gene locus_tag LOCUS_06790 23603 24139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06790 26108 24195 gene locus_tag LOCUS_06800 26108 24195 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549141.1 protein_id gnl|my_center|LOCUS_06800 26295 26924 gene locus_tag LOCUS_06810 26295 26924 CDS product redox-sensing transcriptional repressor Rex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549143.1 protein_id gnl|my_center|LOCUS_06810 27050 27334 gene locus_tag LOCUS_06820 gene groES 27050 27334 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549156.1 protein_id gnl|my_center|LOCUS_06820 27360 28994 gene locus_tag LOCUS_06830 gene groL 27360 28994 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549158.1 protein_id gnl|my_center|LOCUS_06830 29137 31701 gene locus_tag LOCUS_06840 gene mutS 29137 31701 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254144.1 protein_id gnl|my_center|LOCUS_06840 31707 33584 gene locus_tag LOCUS_06850 gene mutL 31707 33584 CDS product DNA mismatch repair endonuclease MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549162.1 protein_id gnl|my_center|LOCUS_06850 33606 34190 gene locus_tag LOCUS_06860 gene ruvA 33606 34190 CDS product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549165.1 protein_id gnl|my_center|LOCUS_06860 34207 35211 gene locus_tag LOCUS_06870 gene ruvB 34207 35211 CDS product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549167.1 protein_id gnl|my_center|LOCUS_06870 35272 35628 gene locus_tag LOCUS_06880 gene yajC 35272 35628 CDS product preprotein translocase subunit YajC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015613305.1 protein_id gnl|my_center|LOCUS_06880 35733 37181 gene locus_tag LOCUS_06890 gene zwf 35733 37181 CDS product glucose-6-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549170.1 protein_id gnl|my_center|LOCUS_06890 37182 38291 gene locus_tag LOCUS_06900 gene dinB 37182 38291 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549172.1 protein_id gnl|my_center|LOCUS_06900 38348 39304 gene locus_tag LOCUS_06910 38348 39304 CDS product bifunctional oligoribonuclease/PAP phosphatase NrnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254146.1 protein_id gnl|my_center|LOCUS_06910 39291 40673 gene locus_tag LOCUS_06920 39291 40673 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549176.1 protein_id gnl|my_center|LOCUS_06920 40895 43528 gene locus_tag LOCUS_06930 gene alaS 40895 43528 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549179.1 protein_id gnl|my_center|LOCUS_06930 43608 43865 gene locus_tag LOCUS_06940 43608 43865 CDS product IreB family regulatory phosphoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549189.1 protein_id gnl|my_center|LOCUS_06940 43865 44296 gene locus_tag LOCUS_06950 gene ruvX 43865 44296 CDS product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549192.1 protein_id gnl|my_center|LOCUS_06950 44303 44614 gene locus_tag LOCUS_06960 44303 44614 CDS product DUF1292 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549194.1 protein_id gnl|my_center|LOCUS_06960 44722 47082 gene locus_tag LOCUS_06970 44722 47082 CDS product endonuclease MutS2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549197.1 protein_id gnl|my_center|LOCUS_06970 47179 47490 gene locus_tag LOCUS_06980 gene trxA 47179 47490 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254147.1 protein_id gnl|my_center|LOCUS_06980 48015 47617 gene locus_tag LOCUS_06990 48015 47617 CDS product YslB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549202.1 protein_id gnl|my_center|LOCUS_06990 48111 48896 gene locus_tag LOCUS_07000 gene murI 48111 48896 CDS product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549203.1 protein_id gnl|my_center|LOCUS_07000 48914 49534 gene locus_tag LOCUS_07010 48914 49534 CDS product XTP/dITP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549206.1 protein_id gnl|my_center|LOCUS_07010 50405 49560 gene locus_tag LOCUS_07020 50405 49560 CDS product mechanosensitive ion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674287.1 protein_id gnl|my_center|LOCUS_07020 50530 50967 gene locus_tag LOCUS_07030 50530 50967 CDS product DUF948 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003129531.1 protein_id gnl|my_center|LOCUS_07030 50982 51311 gene locus_tag LOCUS_07040 50982 51311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07040 52469 51363 gene locus_tag LOCUS_07050 52469 51363 CDS product Xaa-Pro peptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549213.1 protein_id gnl|my_center|LOCUS_07050 52618 53619 gene locus_tag LOCUS_07060 52618 53619 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549214.1 protein_id gnl|my_center|LOCUS_07060 55096 53699 gene locus_tag LOCUS_07070 gene pepV 55096 53699 CDS product dipeptidase PepV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547162.1 protein_id gnl|my_center|LOCUS_07070 56478 55111 gene locus_tag LOCUS_07080 56478 55111 CDS product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549215.1 protein_id gnl|my_center|LOCUS_07080 56586 56918 gene locus_tag LOCUS_07090 56586 56918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015613308.1 protein_id gnl|my_center|LOCUS_07090 56922 57464 gene locus_tag LOCUS_07100 56922 57464 CDS product YutD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549221.1 protein_id gnl|my_center|LOCUS_07100 57467 58246 gene locus_tag LOCUS_07110 57467 58246 CDS product TIGR01457 family HAD-type hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549224.1 protein_id gnl|my_center|LOCUS_07110 58246 58854 gene locus_tag LOCUS_07120 58246 58854 CDS product TIGR01906 family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254154.1 protein_id gnl|my_center|LOCUS_07120 58974 61727 gene locus_tag LOCUS_07130 gene cas3 58974 61727 CDS product CRISPR-associated helicase Cas3' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_116440412.1 protein_id gnl|my_center|LOCUS_07130 61714 63375 gene locus_tag LOCUS_07140 61714 63375 CDS product type I-E CRISPR-associated protein Cse1/CasA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009994024.1 protein_id gnl|my_center|LOCUS_07140 63385 63972 gene locus_tag LOCUS_07150 63385 63972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07150 63975 65051 gene locus_tag LOCUS_07160 gene cas7e 63975 65051 CDS product type I-E CRISPR-associated protein Cas7/Cse4/CasC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004138505.1 protein_id gnl|my_center|LOCUS_07160 65068 65805 gene locus_tag LOCUS_07170 gene cas5e 65068 65805 CDS product type I-E CRISPR-associated protein Cas5/CasD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009994022.1 protein_id gnl|my_center|LOCUS_07170 65814 66473 gene locus_tag LOCUS_07180 gene cas6e 65814 66473 CDS product type I-E CRISPR-associated protein Cas6/Cse3/CasE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004112674.1 protein_id gnl|my_center|LOCUS_07180 66470 67408 gene locus_tag LOCUS_07190 gene cas1e 66470 67408 CDS product type I-E CRISPR-associated endonuclease Cas1e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_116440418.1 protein_id gnl|my_center|LOCUS_07190 67409 68308 gene locus_tag LOCUS_07200 gene cas2e 67409 68308 CDS product type I-E CRISPR-associated endoribonuclease Cas2e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674076.1 protein_id gnl|my_center|LOCUS_07200 68363 >68629 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtatttcccgcacatgcgggggtgatcct >Feature sequence08 2622 5273 gene locus_tag LOCUS_07210 gene polA 2622 5273 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548351.1 protein_id gnl|my_center|LOCUS_07210 5286 6116 gene locus_tag LOCUS_07220 gene mutM 5286 6116 CDS product bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548349.1 protein_id gnl|my_center|LOCUS_07220 6113 6706 gene locus_tag LOCUS_07230 gene coaE 6113 6706 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548347.1 protein_id gnl|my_center|LOCUS_07230 6710 7177 gene locus_tag LOCUS_07240 gene nrdR 6710 7177 CDS product transcriptional regulator NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548345.1 protein_id gnl|my_center|LOCUS_07240 7181 8527 gene locus_tag LOCUS_07250 7181 8527 CDS product DnaD domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548343.1 protein_id gnl|my_center|LOCUS_07250 8544 9443 gene locus_tag LOCUS_07260 gene dnaI 8544 9443 CDS product primosomal protein DnaI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254494.1 protein_id gnl|my_center|LOCUS_07260 9712 11643 gene locus_tag LOCUS_07270 gene thrS 9712 11643 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548338.1 protein_id gnl|my_center|LOCUS_07270 11944 12348 gene locus_tag LOCUS_07280 11944 12348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07280 12370 12570 gene locus_tag LOCUS_07290 gene rpmI 12370 12570 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548328.1 protein_id gnl|my_center|LOCUS_07290 12607 12963 gene locus_tag LOCUS_07300 gene rplT 12607 12963 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548326.1 protein_id gnl|my_center|LOCUS_07300 13107 13859 gene locus_tag LOCUS_07310 13107 13859 CDS product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549794.1 protein_id gnl|my_center|LOCUS_07310 13859 14773 gene locus_tag LOCUS_07320 gene pfkB 13859 14773 CDS product 1-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549796.1 protein_id gnl|my_center|LOCUS_07320 14801 16693 gene locus_tag LOCUS_07330 14801 16693 CDS product fructose-specific PTS transporter subunit EIIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549797.1 protein_id gnl|my_center|LOCUS_07330 16812 17330 gene locus_tag LOCUS_07340 16812 17330 CDS product YqeG family HAD IIIA-type phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254490.1 protein_id gnl|my_center|LOCUS_07340 17330 18442 gene locus_tag LOCUS_07350 gene yqeH 17330 18442 CDS product ribosome biogenesis GTPase YqeH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548317.1 protein_id gnl|my_center|LOCUS_07350 18442 19071 gene locus_tag LOCUS_07360 18442 19071 CDS product nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548315.1 protein_id gnl|my_center|LOCUS_07360 19064 19672 gene locus_tag LOCUS_07370 gene yqeK 19064 19672 CDS product bis(5'-nucleosyl)-tetraphosphatase (symmetrical) YqeK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548313.1 protein_id gnl|my_center|LOCUS_07370 19684 20028 gene locus_tag LOCUS_07380 gene rsfS 19684 20028 CDS product ribosome silencing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548311.1 protein_id gnl|my_center|LOCUS_07380 20038 21198 gene locus_tag LOCUS_07390 20038 21198 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548309.1 protein_id gnl|my_center|LOCUS_07390 21199 21726 gene locus_tag LOCUS_07400 21199 21726 CDS product YceD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548307.1 protein_id gnl|my_center|LOCUS_07400 21842 22567 gene locus_tag LOCUS_07410 21842 22567 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548305.1 protein_id gnl|my_center|LOCUS_07410 22545 24086 gene locus_tag LOCUS_07420 22545 24086 CDS product HAMP domain-containing histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254489.1 protein_id gnl|my_center|LOCUS_07420 25086 24127 gene locus_tag LOCUS_07430 gene yidC 25086 24127 CDS product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254488.1 protein_id gnl|my_center|LOCUS_07430 25235 25996 gene locus_tag LOCUS_07440 25235 25996 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548298.1 protein_id gnl|my_center|LOCUS_07440 26069 26416 gene locus_tag LOCUS_07450 26069 26416 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254487.1 protein_id gnl|my_center|LOCUS_07450 26707 27756 gene locus_tag LOCUS_07460 gene pheS 26707 27756 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548296.1 protein_id gnl|my_center|LOCUS_07460 27756 30170 gene locus_tag LOCUS_07470 gene pheT 27756 30170 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548294.1 protein_id gnl|my_center|LOCUS_07470 30194 31294 gene locus_tag LOCUS_07480 gene mltG 30194 31294 CDS product endolytic transglycosylase MltG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475970.1 protein_id gnl|my_center|LOCUS_07480 31367 31852 gene locus_tag LOCUS_07490 gene greA 31367 31852 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548292.1 protein_id gnl|my_center|LOCUS_07490 31907 34009 gene locus_tag LOCUS_07500 31907 34009 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254485.1 protein_id gnl|my_center|LOCUS_07500 34016 36598 gene locus_tag LOCUS_07510 34016 36598 CDS product sigma 54-interacting transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002304269.1 protein_id gnl|my_center|LOCUS_07510 36731 37138 gene locus_tag LOCUS_07520 36731 37138 CDS product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002989935.1 protein_id gnl|my_center|LOCUS_07520 37156 37647 gene locus_tag LOCUS_07530 37156 37647 CDS product PTS sugar transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000632643.1 protein_id gnl|my_center|LOCUS_07530 37664 38488 gene locus_tag LOCUS_07540 37664 38488 CDS product PTS mannose/fructose/sorbose/N-acetylgalactosamine transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002365419.1 protein_id gnl|my_center|LOCUS_07540 38485 39312 gene locus_tag LOCUS_07550 38485 39312 CDS product PTS system mannose/fructose/sorbose family transporter subunit IID inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002354796.1 protein_id gnl|my_center|LOCUS_07550 39313 40017 gene locus_tag LOCUS_07560 39313 40017 CDS product MgtC/SapB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355354.1 protein_id gnl|my_center|LOCUS_07560 40031 41311 gene locus_tag LOCUS_07570 gene rpoN 40031 41311 CDS product RNA polymerase factor sigma-54 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242595.1 protein_id gnl|my_center|LOCUS_07570 43769 41385 gene locus_tag LOCUS_07580 43769 41385 CDS product Xaa-Pro dipeptidyl-peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548011.1 protein_id gnl|my_center|LOCUS_07580 43920 46460 gene locus_tag LOCUS_07590 43920 46460 CDS product M1 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101213.1 protein_id gnl|my_center|LOCUS_07590 46538 46611 gene locus_tag LOCUS_t00160 46538 46611 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 46785 46934 gene locus_tag LOCUS_07600 gene rpmG 46785 46934 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548272.1 protein_id gnl|my_center|LOCUS_07600 46991 47542 gene locus_tag LOCUS_07610 46991 47542 CDS product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475812.1 protein_id gnl|my_center|LOCUS_07610 47556 48254 gene locus_tag LOCUS_07620 47556 48254 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254484.1 protein_id gnl|my_center|LOCUS_07620 48254 48472 gene locus_tag LOCUS_07630 48254 48472 CDS product YqgQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475814.1 protein_id gnl|my_center|LOCUS_07630 48507 48908 gene locus_tag LOCUS_07640 48507 48908 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548248.1 protein_id gnl|my_center|LOCUS_07640 49142 48963 gene locus_tag LOCUS_07650 49142 48963 CDS product DUF3042 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003564621.1 protein_id gnl|my_center|LOCUS_07650 49217 50152 gene locus_tag LOCUS_07660 gene miaA 49217 50152 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548247.1 protein_id gnl|my_center|LOCUS_07660 50257 51594 gene locus_tag LOCUS_07670 gene glnA 50257 51594 CDS product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003627067.1 protein_id gnl|my_center|LOCUS_07670 51697 52872 gene locus_tag LOCUS_07680 51697 52872 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548117.1 protein_id gnl|my_center|LOCUS_07680 >Feature sequence09 1195 626 gene locus_tag LOCUS_07690 1195 626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07690 1290 1433 gene locus_tag LOCUS_07700 1290 1433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07700 1889 2077 gene locus_tag LOCUS_07710 1889 2077 CDS product type II toxin-antitoxin system HicA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229010.1 protein_id gnl|my_center|LOCUS_07710 2139 2522 gene locus_tag LOCUS_07720 2139 2522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07720 2627 3094 gene locus_tag LOCUS_07730 2627 3094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07730 3084 4313 gene locus_tag LOCUS_07740 3084 4313 CDS product PBSX family phage terminase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674653.1 protein_id gnl|my_center|LOCUS_07740 4327 5757 gene locus_tag LOCUS_07750 4327 5757 CDS product phage portal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674652.1 protein_id gnl|my_center|LOCUS_07750 5750 7342 gene locus_tag LOCUS_07760 5750 7342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07760 7347 7631 gene locus_tag LOCUS_07770 7347 7631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07770 7752 8009 gene locus_tag LOCUS_07780 7752 8009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07780 8124 8729 gene locus_tag LOCUS_07790 8124 8729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07790 8743 9615 gene locus_tag LOCUS_07800 8743 9615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07800 9632 10036 gene locus_tag LOCUS_07810 9632 10036 CDS product phage head-tail connector protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674645.1 protein_id gnl|my_center|LOCUS_07810 10020 10388 gene locus_tag LOCUS_07820 10020 10388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07820 10388 10768 gene locus_tag LOCUS_07830 10388 10768 CDS product DUF3168 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003566400.1 protein_id gnl|my_center|LOCUS_07830 10785 11231 gene locus_tag LOCUS_07840 10785 11231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07840 12016 12249 gene locus_tag LOCUS_07850 12016 12249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07850 12264 12461 gene locus_tag LOCUS_07860 12264 12461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07860 12639 12797 gene locus_tag LOCUS_07870 12639 12797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07870 12920 13528 gene locus_tag LOCUS_07880 12920 13528 CDS product MptD family putative ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000368971.1 protein_id gnl|my_center|LOCUS_07880 13528 14217 gene locus_tag LOCUS_07890 13528 14217 CDS product energy-coupling factor transporter transmembrane component T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001141952.1 protein_id gnl|my_center|LOCUS_07890 14211 15587 gene locus_tag LOCUS_07900 14211 15587 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000229353.1 protein_id gnl|my_center|LOCUS_07900 15645 17264 gene locus_tag LOCUS_07910 15645 17264 CDS product alpha-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254098.1 protein_id gnl|my_center|LOCUS_07910 18520 17303 gene locus_tag LOCUS_07920 18520 17303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07920 18915 19910 gene locus_tag LOCUS_07930 gene trpX 18915 19910 CDS product tryptophan ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674603.1 protein_id gnl|my_center|LOCUS_07930 19910 20809 gene locus_tag LOCUS_07940 19910 20809 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642727.1 protein_id gnl|my_center|LOCUS_07940 20802 21563 gene locus_tag LOCUS_07950 20802 21563 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000245086.1 protein_id gnl|my_center|LOCUS_07950 21673 23121 gene locus_tag LOCUS_07960 21673 23121 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254182.1 protein_id gnl|my_center|LOCUS_07960 23364 24293 gene locus_tag LOCUS_07970 23364 24293 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000524830.1 protein_id gnl|my_center|LOCUS_07970 24280 25080 gene locus_tag LOCUS_07980 24280 25080 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146599.1 protein_id gnl|my_center|LOCUS_07980 26446 25133 gene locus_tag LOCUS_07990 26446 25133 CDS product solute carrier family 23 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546343.1 protein_id gnl|my_center|LOCUS_07990 27843 26644 gene locus_tag LOCUS_08000 27843 26644 CDS product multidrug efflux MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254190.1 protein_id gnl|my_center|LOCUS_08000 28010 29098 gene locus_tag LOCUS_08010 28010 29098 CDS product M42 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546357.1 protein_id gnl|my_center|LOCUS_08010 29271 30011 gene locus_tag LOCUS_08020 29271 30011 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546366.1 protein_id gnl|my_center|LOCUS_08020 30020 30841 gene locus_tag LOCUS_08030 30020 30841 CDS product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546367.1 protein_id gnl|my_center|LOCUS_08030 30838 31476 gene locus_tag LOCUS_08040 30838 31476 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003701287.1 protein_id gnl|my_center|LOCUS_08040 31486 32145 gene locus_tag LOCUS_08050 31486 32145 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546369.1 protein_id gnl|my_center|LOCUS_08050 32507 32322 gene locus_tag LOCUS_08060 gene rpmB 32507 32322 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547911.1 protein_id gnl|my_center|LOCUS_08060 32683 33042 gene locus_tag LOCUS_08070 32683 33042 CDS product Asp23/Gls24 family envelope stress response protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547910.1 protein_id gnl|my_center|LOCUS_08070 33066 34730 gene locus_tag LOCUS_08080 33066 34730 CDS product DAK2 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547907.1 protein_id gnl|my_center|LOCUS_08080 34732 36753 gene locus_tag LOCUS_08090 gene recG 34732 36753 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254414.1 protein_id gnl|my_center|LOCUS_08090 36774 37775 gene locus_tag LOCUS_08100 gene plsX 36774 37775 CDS product phosphate acyltransferase PlsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547901.1 protein_id gnl|my_center|LOCUS_08100 37825 38067 gene locus_tag LOCUS_08110 gene acpP 37825 38067 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003699980.1 protein_id gnl|my_center|LOCUS_08110 38215 39219 gene locus_tag LOCUS_08120 38215 39219 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547898.1 protein_id gnl|my_center|LOCUS_08120 39229 40197 gene locus_tag LOCUS_08130 39229 40197 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547895.1 protein_id gnl|my_center|LOCUS_08130 40199 41161 gene locus_tag LOCUS_08140 40199 41161 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547894.1 protein_id gnl|my_center|LOCUS_08140 41176 42105 gene locus_tag LOCUS_08150 41176 42105 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547893.1 protein_id gnl|my_center|LOCUS_08150 42560 44311 gene locus_tag LOCUS_08160 42560 44311 CDS product oligopeptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254413.1 protein_id gnl|my_center|LOCUS_08160 44446 45123 gene locus_tag LOCUS_08170 gene rnc 44446 45123 CDS product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547887.1 protein_id gnl|my_center|LOCUS_08170 45146 48703 gene locus_tag LOCUS_08180 gene smc 45146 48703 CDS product chromosome segregation protein SMC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254411.1 protein_id gnl|my_center|LOCUS_08180 >Feature sequence10 1716 343 gene locus_tag LOCUS_08190 1716 343 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546123.1 protein_id gnl|my_center|LOCUS_08190 2046 4640 gene locus_tag LOCUS_08200 gene adhE 2046 4640 CDS product bifunctional acetaldehyde-CoA/alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546132.1 protein_id gnl|my_center|LOCUS_08200 4806 6005 gene locus_tag LOCUS_08210 4806 6005 CDS product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548234.1 protein_id gnl|my_center|LOCUS_08210 7050 6061 gene locus_tag LOCUS_08220 gene galE 7050 6061 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548187.1 protein_id gnl|my_center|LOCUS_08220 7213 8307 gene locus_tag LOCUS_08230 7213 8307 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254531.1 protein_id gnl|my_center|LOCUS_08230 8307 9170 gene locus_tag LOCUS_08240 8307 9170 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003550063.1 protein_id gnl|my_center|LOCUS_08240 9172 9990 gene locus_tag LOCUS_08250 9172 9990 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254529.1 protein_id gnl|my_center|LOCUS_08250 9974 11263 gene locus_tag LOCUS_08260 9974 11263 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003550067.1 protein_id gnl|my_center|LOCUS_08260 11302 12591 gene locus_tag LOCUS_08270 11302 12591 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003550069.1 protein_id gnl|my_center|LOCUS_08270 13085 13321 gene locus_tag LOCUS_08280 13085 13321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08280 13843 13328 gene locus_tag LOCUS_08290 13843 13328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08290 14706 13843 gene locus_tag LOCUS_08300 14706 13843 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546611.1 protein_id gnl|my_center|LOCUS_08300 14776 15489 gene locus_tag LOCUS_08310 14776 15489 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546612.1 protein_id gnl|my_center|LOCUS_08310 15546 16526 gene locus_tag LOCUS_08320 gene pta 15546 16526 CDS product phosphate acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641060.1 protein_id gnl|my_center|LOCUS_08320 16523 16999 gene locus_tag LOCUS_08330 gene tsaE 16523 16999 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546616.1 protein_id gnl|my_center|LOCUS_08330 17610 17077 gene locus_tag LOCUS_08340 17610 17077 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546623.1 protein_id gnl|my_center|LOCUS_08340 17724 18638 gene locus_tag LOCUS_08350 gene murB 17724 18638 CDS product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546624.1 protein_id gnl|my_center|LOCUS_08350 18693 19799 gene locus_tag LOCUS_08360 18693 19799 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546625.1 protein_id gnl|my_center|LOCUS_08360 19786 20598 gene locus_tag LOCUS_08370 19786 20598 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546626.1 protein_id gnl|my_center|LOCUS_08370 20595 21395 gene locus_tag LOCUS_08380 20595 21395 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254228.1 protein_id gnl|my_center|LOCUS_08380 21392 22465 gene locus_tag LOCUS_08390 21392 22465 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546630.1 protein_id gnl|my_center|LOCUS_08390 22504 23346 gene locus_tag LOCUS_08400 gene cdaA 22504 23346 CDS product diadenylate cyclase CdaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254229.1 protein_id gnl|my_center|LOCUS_08400 23343 24311 gene locus_tag LOCUS_08410 23343 24311 CDS product CdaR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546633.1 protein_id gnl|my_center|LOCUS_08410 24335 25687 gene locus_tag LOCUS_08420 gene glmM 24335 25687 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546635.1 protein_id gnl|my_center|LOCUS_08420 25879 27690 gene locus_tag LOCUS_08430 gene glmS 25879 27690 CDS product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546133.1 protein_id gnl|my_center|LOCUS_08430 27797 29320 gene locus_tag LOCUS_08440 27797 29320 CDS product O-antigen ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549839.1 protein_id gnl|my_center|LOCUS_08440 29336 29734 gene locus_tag LOCUS_08450 29336 29734 CDS product CrcB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254309.1 protein_id gnl|my_center|LOCUS_08450 29734 30084 gene locus_tag LOCUS_08460 gene crcB 29734 30084 CDS product fluoride efflux transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547161.1 protein_id gnl|my_center|LOCUS_08460 31008 30136 gene locus_tag LOCUS_08470 31008 30136 CDS product zinc ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254571.1 protein_id gnl|my_center|LOCUS_08470 31278 31574 gene locus_tag LOCUS_08480 31278 31574 CDS product MazG-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003565490.1 protein_id gnl|my_center|LOCUS_08480 31792 32064 gene locus_tag LOCUS_08490 31792 32064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08490 32057 32197 gene locus_tag LOCUS_08500 32057 32197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08500 32178 32969 gene locus_tag LOCUS_08510 32178 32969 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002905004.1 protein_id gnl|my_center|LOCUS_08510 33152 33883 gene locus_tag LOCUS_08520 33152 33883 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546668.1 protein_id gnl|my_center|LOCUS_08520 35188 33953 gene locus_tag LOCUS_08530 gene codA 35188 33953 CDS product cytosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_117530778.1 protein_id gnl|my_center|LOCUS_08530 36459 35200 gene locus_tag LOCUS_08540 gene codB 36459 35200 CDS product cytosine permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986589.1 protein_id gnl|my_center|LOCUS_08540 37089 36643 gene locus_tag LOCUS_08550 37089 36643 CDS product DUF3021 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000793164.1 protein_id gnl|my_center|LOCUS_08550 37517 37086 gene locus_tag LOCUS_08560 37517 37086 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700966.1 protein_id gnl|my_center|LOCUS_08560 37668 38159 gene locus_tag LOCUS_08570 37668 38159 CDS product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002905642.1 protein_id gnl|my_center|LOCUS_08570 >Feature sequence11 <1 1122 gene locus_tag LOCUS_08580 <1 1122 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011109597.1:Ig-like domain-containing protein 1556 8476 gene locus_tag LOCUS_08590 1556 8476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08590 8671 11430 gene locus_tag LOCUS_08600 8671 11430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08600 11569 11643 gene locus_tag LOCUS_t00170 11569 11643 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 11841 13133 gene locus_tag LOCUS_08610 11841 13133 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003550069.1 protein_id gnl|my_center|LOCUS_08610 13233 13901 gene locus_tag LOCUS_08620 13233 13901 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012027525.1 protein_id gnl|my_center|LOCUS_08620 14104 14823 gene locus_tag LOCUS_08630 14104 14823 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002456718.1 protein_id gnl|my_center|LOCUS_08630 14923 15678 gene locus_tag LOCUS_08640 14923 15678 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681851.1 protein_id gnl|my_center|LOCUS_08640 15678 17645 gene locus_tag LOCUS_08650 15678 17645 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000489378.1 protein_id gnl|my_center|LOCUS_08650 17778 19169 gene locus_tag LOCUS_08660 17778 19169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08660 19197 20165 gene locus_tag LOCUS_08670 gene manA 19197 20165 CDS product mannose-6-phosphate isomerase, class I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546690.1 protein_id gnl|my_center|LOCUS_08670 20177 20566 gene locus_tag LOCUS_08680 20177 20566 CDS product SdpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003584155.1 protein_id gnl|my_center|LOCUS_08680 20568 21281 gene locus_tag LOCUS_08690 20568 21281 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254236.1 protein_id gnl|my_center|LOCUS_08690 23577 21397 gene locus_tag LOCUS_08700 23577 21397 CDS product LTA synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546703.1 protein_id gnl|my_center|LOCUS_08700 23799 25139 gene locus_tag LOCUS_08710 23799 25139 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546706.1 protein_id gnl|my_center|LOCUS_08710 25231 26124 gene locus_tag LOCUS_08720 25231 26124 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549788.1 protein_id gnl|my_center|LOCUS_08720 26121 27350 gene locus_tag LOCUS_08730 26121 27350 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549790.1 protein_id gnl|my_center|LOCUS_08730 27485 27413 gene locus_tag LOCUS_t00180 27485 27413 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 27562 27489 gene locus_tag LOCUS_t00190 27562 27489 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 27688 28701 gene locus_tag LOCUS_08740 27688 28701 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546711.1 protein_id gnl|my_center|LOCUS_08740 30056 28704 gene locus_tag LOCUS_08750 30056 28704 CDS product Mur ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546733.1 protein_id gnl|my_center|LOCUS_08750 30186 30779 gene locus_tag LOCUS_08760 30186 30779 CDS product thymidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015613340.1 protein_id gnl|my_center|LOCUS_08760 30812 31900 gene locus_tag LOCUS_08770 gene prfA 30812 31900 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546735.1 protein_id gnl|my_center|LOCUS_08770 31893 32732 gene locus_tag LOCUS_08780 gene prmC 31893 32732 CDS product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546736.1 protein_id gnl|my_center|LOCUS_08780 32668 33732 gene locus_tag LOCUS_08790 32668 33732 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546737.1 protein_id gnl|my_center|LOCUS_08790 33826 34455 gene locus_tag LOCUS_08800 gene upp 33826 34455 CDS product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546738.1 protein_id gnl|my_center|LOCUS_08800 34550 35266 gene locus_tag LOCUS_08810 gene atpB 34550 35266 CDS product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546739.1 protein_id gnl|my_center|LOCUS_08810 35285 35497 gene locus_tag LOCUS_08820 gene atpE 35285 35497 CDS product F0F1 ATP synthase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029779745.1 protein_id gnl|my_center|LOCUS_08820 35542 36042 gene locus_tag LOCUS_08830 gene atpF 35542 36042 CDS product F0F1 ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546741.1 protein_id gnl|my_center|LOCUS_08830 36042 36611 gene locus_tag LOCUS_08840 36042 36611 CDS product F0F1 ATP synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546742.1 protein_id gnl|my_center|LOCUS_08840 36601 38112 gene locus_tag LOCUS_08850 gene atpA 36601 38112 CDS product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254246.1 protein_id gnl|my_center|LOCUS_08850 38130 39083 gene locus_tag LOCUS_08860 38130 39083 CDS product F0F1 ATP synthase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546744.1 protein_id gnl|my_center|LOCUS_08860 39107 40549 gene locus_tag LOCUS_08870 gene atpD 39107 40549 CDS product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254247.1 protein_id gnl|my_center|LOCUS_08870 40561 40995 gene locus_tag LOCUS_08880 40561 40995 CDS product F0F1 ATP synthase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546746.1 protein_id gnl|my_center|LOCUS_08880 41045 41278 gene locus_tag LOCUS_08890 41045 41278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08890 >Feature sequence12 1181 252 gene locus_tag LOCUS_08900 gene ribF 1181 252 CDS product riboflavin biosynthesis protein RibF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547803.1 protein_id gnl|my_center|LOCUS_08900 2092 1199 gene locus_tag LOCUS_08910 gene truB 2092 1199 CDS product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547805.1 protein_id gnl|my_center|LOCUS_08910 2509 2153 gene locus_tag LOCUS_08920 2509 2153 CDS product ribosome-binding factor A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547807.1 protein_id gnl|my_center|LOCUS_08920 5179 2543 gene locus_tag LOCUS_08930 gene infB 5179 2543 CDS product translation initiation factor IF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254396.1 protein_id gnl|my_center|LOCUS_08930 5489 5184 gene locus_tag LOCUS_08940 5489 5184 CDS product ribosomal L7Ae/L30e/S12e/Gadd45 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547810.1 protein_id gnl|my_center|LOCUS_08940 5787 5491 gene locus_tag LOCUS_08950 5787 5491 CDS product YlxR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547812.1 protein_id gnl|my_center|LOCUS_08950 6900 5812 gene locus_tag LOCUS_08960 gene nusA 6900 5812 CDS product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254397.1 protein_id gnl|my_center|LOCUS_08960 7396 6920 gene locus_tag LOCUS_08970 gene rimP 7396 6920 CDS product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254398.1 protein_id gnl|my_center|LOCUS_08970 11792 7518 gene locus_tag LOCUS_08980 11792 7518 CDS product PolC-type DNA polymerase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547817.1 protein_id gnl|my_center|LOCUS_08980 13497 11797 gene locus_tag LOCUS_08990 13497 11797 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547819.1 protein_id gnl|my_center|LOCUS_08990 14770 13514 gene locus_tag LOCUS_09000 gene rseP 14770 13514 CDS product RIP metalloprotease RseP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547820.1 protein_id gnl|my_center|LOCUS_09000 15577 14780 gene locus_tag LOCUS_09010 15577 14780 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547823.1 protein_id gnl|my_center|LOCUS_09010 16314 15595 gene locus_tag LOCUS_09020 16314 15595 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547825.1 protein_id gnl|my_center|LOCUS_09020 16887 16330 gene locus_tag LOCUS_09030 gene frr 16887 16330 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_095341972.1 protein_id gnl|my_center|LOCUS_09030 17612 16887 gene locus_tag LOCUS_09040 gene pyrH 17612 16887 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254400.1 protein_id gnl|my_center|LOCUS_09040 18643 17768 gene locus_tag LOCUS_09050 gene tsf 18643 17768 CDS product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003565808.1 protein_id gnl|my_center|LOCUS_09050 19449 18676 gene locus_tag LOCUS_09060 gene rpsB 19449 18676 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547837.1 protein_id gnl|my_center|LOCUS_09060 20624 19596 gene locus_tag LOCUS_09070 20624 19596 CDS product GIY-YIG nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547839.1 protein_id gnl|my_center|LOCUS_09070 20684 21298 gene locus_tag LOCUS_09080 20684 21298 CDS product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547840.1 protein_id gnl|my_center|LOCUS_09080 23142 21346 gene locus_tag LOCUS_09090 23142 21346 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015613381.1 protein_id gnl|my_center|LOCUS_09090 24898 23132 gene locus_tag LOCUS_09100 24898 23132 CDS product ABC transporter transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254403.1 protein_id gnl|my_center|LOCUS_09100 25187 24972 gene locus_tag LOCUS_09110 25187 24972 CDS product YneF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547849.1 protein_id gnl|my_center|LOCUS_09110 25498 25253 gene locus_tag LOCUS_09120 25498 25253 CDS product DUF896 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547851.1 protein_id gnl|my_center|LOCUS_09120 25622 26206 gene locus_tag LOCUS_09130 gene lexA 25622 26206 CDS product transcriptional repressor LexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254404.1 protein_id gnl|my_center|LOCUS_09130 27033 26251 gene locus_tag LOCUS_09140 27033 26251 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644407.1 protein_id gnl|my_center|LOCUS_09140 27527 27177 gene locus_tag LOCUS_09150 gene rplS 27527 27177 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003629071.1 protein_id gnl|my_center|LOCUS_09150 28362 27646 gene locus_tag LOCUS_09160 gene trmD 28362 27646 CDS product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254407.1 protein_id gnl|my_center|LOCUS_09160 28873 28352 gene locus_tag LOCUS_09170 gene rimM 28873 28352 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254408.1 protein_id gnl|my_center|LOCUS_09170 29201 28929 gene locus_tag LOCUS_09180 gene rpsP 29201 28929 CDS product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547870.1 protein_id gnl|my_center|LOCUS_09180 30719 29292 gene locus_tag LOCUS_09190 gene ffh 30719 29292 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547873.1 protein_id gnl|my_center|LOCUS_09190 31062 30721 gene locus_tag LOCUS_09200 31062 30721 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547875.1 protein_id gnl|my_center|LOCUS_09200 32846 31167 gene locus_tag LOCUS_09210 gene recN 32846 31167 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547931.1 protein_id gnl|my_center|LOCUS_09210 33671 32859 gene locus_tag LOCUS_09220 33671 32859 CDS product TlyA family rRNA (cytidine-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547933.1 protein_id gnl|my_center|LOCUS_09220 34537 33671 gene locus_tag LOCUS_09230 34537 33671 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547935.1 protein_id gnl|my_center|LOCUS_09230 34782 34540 gene locus_tag LOCUS_09240 34782 34540 CDS product exodeoxyribonuclease VII small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547938.1 protein_id gnl|my_center|LOCUS_09240 36133 34775 gene locus_tag LOCUS_09250 gene xseA 36133 34775 CDS product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547941.1 protein_id gnl|my_center|LOCUS_09250 36977 36123 gene locus_tag LOCUS_09260 36977 36123 CDS product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547942.1 protein_id gnl|my_center|LOCUS_09260 37430 37029 gene locus_tag LOCUS_09270 gene nusB 37430 37029 CDS product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547945.1 protein_id gnl|my_center|LOCUS_09270 37843 37430 gene locus_tag LOCUS_09280 37843 37430 CDS product Asp23/Gls24 family envelope stress response protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547946.1 protein_id gnl|my_center|LOCUS_09280 38436 37876 gene locus_tag LOCUS_09290 gene efp 38436 37876 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547948.1 protein_id gnl|my_center|LOCUS_09290 39629 38520 gene locus_tag LOCUS_09300 39629 38520 CDS product aminopeptidase P family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547949.1 protein_id gnl|my_center|LOCUS_09300 39995 39696 gene locus_tag LOCUS_09310 gene rpmA 39995 39696 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254420.1 protein_id gnl|my_center|LOCUS_09310 40323 40012 gene locus_tag LOCUS_09320 gene rplU 40323 40012 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547952.1 protein_id gnl|my_center|LOCUS_09320 >Feature sequence13 1747 866 gene locus_tag LOCUS_09330 1747 866 CDS product S1-like domain-containing RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254300.1 protein_id gnl|my_center|LOCUS_09330 3631 1862 gene locus_tag LOCUS_09340 gene pyk 3631 1862 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547072.1 protein_id gnl|my_center|LOCUS_09340 4628 3669 gene locus_tag LOCUS_09350 gene pfkA 4628 3669 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547070.1 protein_id gnl|my_center|LOCUS_09350 7889 4767 gene locus_tag LOCUS_09360 7889 4767 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547069.1 protein_id gnl|my_center|LOCUS_09360 8093 8299 gene locus_tag LOCUS_09370 8093 8299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09370 8595 8404 gene locus_tag LOCUS_09380 gene rpmF 8595 8404 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547064.1 protein_id gnl|my_center|LOCUS_09380 9513 8719 gene locus_tag LOCUS_09390 9513 8719 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547056.1 protein_id gnl|my_center|LOCUS_09390 10444 9518 gene locus_tag LOCUS_09400 gene rnz 10444 9518 CDS product ribonuclease Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547055.1 protein_id gnl|my_center|LOCUS_09400 12373 10451 gene locus_tag LOCUS_09410 12373 10451 CDS product acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025015105.1 protein_id gnl|my_center|LOCUS_09410 13673 12390 gene locus_tag LOCUS_09420 gene obgE 13673 12390 CDS product GTPase ObgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254297.1 protein_id gnl|my_center|LOCUS_09420 15578 13761 gene locus_tag LOCUS_09430 gene uvrC 15578 13761 CDS product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547051.1 protein_id gnl|my_center|LOCUS_09430 15699 16634 gene locus_tag LOCUS_09440 15699 16634 CDS product nucleoside hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254272.1 protein_id gnl|my_center|LOCUS_09440 17199 16822 gene locus_tag LOCUS_09450 17199 16822 CDS product DUF1828 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547028.1 protein_id gnl|my_center|LOCUS_09450 17550 17236 gene locus_tag LOCUS_09460 17550 17236 CDS product metal-sulfur cluster assembly factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003703477.1 protein_id gnl|my_center|LOCUS_09460 18433 17552 gene locus_tag LOCUS_09470 gene sdaAA 18433 17552 CDS product L-serine ammonia-lyase, iron-sulfur-dependent, subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548060.1 protein_id gnl|my_center|LOCUS_09470 19117 18455 gene locus_tag LOCUS_09480 19117 18455 CDS product serine dehydratase beta chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254449.1 protein_id gnl|my_center|LOCUS_09480 19716 19198 gene locus_tag LOCUS_09490 19716 19198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546897.1 protein_id gnl|my_center|LOCUS_09490 20375 19788 gene locus_tag LOCUS_09500 gene yihA 20375 19788 CDS product ribosome biogenesis GTP-binding protein YihA/YsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546867.1 protein_id gnl|my_center|LOCUS_09500 21654 20365 gene locus_tag LOCUS_09510 gene clpX 21654 20365 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546864.1 protein_id gnl|my_center|LOCUS_09510 23090 21762 gene locus_tag LOCUS_09520 gene tig 23090 21762 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546863.1 protein_id gnl|my_center|LOCUS_09520 24407 23217 gene locus_tag LOCUS_09530 gene tuf 24407 23217 CDS product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546862.1 protein_id gnl|my_center|LOCUS_09530 25446 24577 gene locus_tag LOCUS_09540 25446 24577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254267.1 protein_id gnl|my_center|LOCUS_09540 27304 25415 gene locus_tag LOCUS_09550 27304 25415 CDS product ribonuclease J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546860.1 protein_id gnl|my_center|LOCUS_09550 27760 27491 gene locus_tag LOCUS_09560 gene rpsO 27760 27491 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546859.1 protein_id gnl|my_center|LOCUS_09560 27953 28207 gene locus_tag LOCUS_09570 gene rpsT 27953 28207 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546858.1 protein_id gnl|my_center|LOCUS_09570 29242 28256 gene locus_tag LOCUS_09580 gene holA 29242 28256 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546856.1 protein_id gnl|my_center|LOCUS_09580 31518 29239 gene locus_tag LOCUS_09590 31518 29239 CDS product DNA internalization-related competence protein ComEC/Rec2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546854.1 protein_id gnl|my_center|LOCUS_09590 32119 31487 gene locus_tag LOCUS_09600 32119 31487 CDS product helix-hairpin-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546852.1 protein_id gnl|my_center|LOCUS_09600 <33015 32162 gene locus_tag LOCUS_09610 <33015 32162 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003546849.1:SepM family pheromone-processing serine protease >Feature sequence14 <1 1578 gene locus_tag LOCUS_09620 <1 1578 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003547519.1:NFACT RNA binding domain-containing protein 4813 1646 gene locus_tag LOCUS_09630 4813 1646 CDS product carbamoyl phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254355.1 protein_id gnl|my_center|LOCUS_09630 5881 4820 gene locus_tag LOCUS_09640 5881 4820 CDS product carbamoyl phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547524.1 protein_id gnl|my_center|LOCUS_09640 6821 5886 gene locus_tag LOCUS_09650 6821 5886 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254356.1 protein_id gnl|my_center|LOCUS_09650 7305 6829 gene locus_tag LOCUS_09660 gene lspA 7305 6829 CDS product signal peptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015613370.1 protein_id gnl|my_center|LOCUS_09660 8982 7306 gene locus_tag LOCUS_09670 8982 7306 CDS product formate--tetrahydrofolate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254358.1 protein_id gnl|my_center|LOCUS_09670 9329 8982 gene locus_tag LOCUS_09680 9329 8982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09680 10546 9422 gene locus_tag LOCUS_09690 10546 9422 CDS product class I SAM-dependent RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547533.1 protein_id gnl|my_center|LOCUS_09690 11360 11019 gene locus_tag LOCUS_09700 11360 11019 CDS product cell division regulator GpsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547534.1 protein_id gnl|my_center|LOCUS_09700 11975 11436 gene locus_tag LOCUS_09710 11975 11436 CDS product DUF1273 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547535.1 protein_id gnl|my_center|LOCUS_09710 12048 12638 gene locus_tag LOCUS_09720 gene recU 12048 12638 CDS product Holliday junction resolvase RecU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254360.1 protein_id gnl|my_center|LOCUS_09720 12643 14949 gene locus_tag LOCUS_09730 12643 14949 CDS product PBP1A family penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254361.1 protein_id gnl|my_center|LOCUS_09730 15627 15001 gene locus_tag LOCUS_09740 gene nth 15627 15001 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254362.1 protein_id gnl|my_center|LOCUS_09740 16288 15653 gene locus_tag LOCUS_09750 16288 15653 CDS product DnaD domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547543.1 protein_id gnl|my_center|LOCUS_09750 17650 16349 gene locus_tag LOCUS_09760 gene asnS 17650 16349 CDS product asparagine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547544.1 protein_id gnl|my_center|LOCUS_09760 18230 17721 gene locus_tag LOCUS_09770 18230 17721 CDS product DUF5590 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475866.1 protein_id gnl|my_center|LOCUS_09770 21028 18227 gene locus_tag LOCUS_09780 21028 18227 CDS product helicase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254365.1 protein_id gnl|my_center|LOCUS_09780 24672 21052 gene locus_tag LOCUS_09790 gene addA 24672 21052 CDS product helicase-exonuclease AddAB subunit AddA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254366.1 protein_id gnl|my_center|LOCUS_09790 28138 24665 gene locus_tag LOCUS_09800 28138 24665 CDS product PD-(D/E)XK nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254367.1 protein_id gnl|my_center|LOCUS_09800 28207 29127 gene locus_tag LOCUS_09810 gene mvk 28207 29127 CDS product mevalonate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547572.1 protein_id gnl|my_center|LOCUS_09810 29142 30119 gene locus_tag LOCUS_09820 gene mvaD 29142 30119 CDS product diphosphomevalonate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547574.1 protein_id gnl|my_center|LOCUS_09820 30131 31204 gene locus_tag LOCUS_09830 30131 31204 CDS product phosphomevalonate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254368.1 protein_id gnl|my_center|LOCUS_09830 >Feature sequence15 27 1544 gene locus_tag LOCUS_09840 27 1544 CDS product ABC transporter permease/substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262245.1 protein_id gnl|my_center|LOCUS_09840 1662 3599 gene locus_tag LOCUS_09850 1662 3599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09850 5863 3605 gene locus_tag LOCUS_09860 5863 3605 CDS product plasma-membrane proton-efflux P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254392.1 protein_id gnl|my_center|LOCUS_09860 5986 6072 gene locus_tag LOCUS_t00200 5986 6072 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 6231 6722 gene locus_tag LOCUS_09870 6231 6722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09870 6867 8153 gene locus_tag LOCUS_09880 gene eno 6867 8153 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546959.1 protein_id gnl|my_center|LOCUS_09880 8289 10160 gene locus_tag LOCUS_09890 8289 10160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09890 10178 11800 gene locus_tag LOCUS_09900 10178 11800 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546358.1 protein_id gnl|my_center|LOCUS_09900 12181 13230 gene locus_tag LOCUS_09910 12181 13230 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475540.1 protein_id gnl|my_center|LOCUS_09910 13223 13924 gene locus_tag LOCUS_09920 13223 13924 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475541.1 protein_id gnl|my_center|LOCUS_09920 14047 15426 gene locus_tag LOCUS_09930 14047 15426 CDS product threonine/serine exporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547031.1 protein_id gnl|my_center|LOCUS_09930 15987 15481 gene locus_tag LOCUS_09940 gene ybaK 15987 15481 CDS product Cys-tRNA(Pro) deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254291.1 protein_id gnl|my_center|LOCUS_09940 16049 16981 gene locus_tag LOCUS_09950 gene prmA 16049 16981 CDS product 50S ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547033.1 protein_id gnl|my_center|LOCUS_09950 17408 19660 gene locus_tag LOCUS_09960 17408 19660 CDS product bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254292.1 protein_id gnl|my_center|LOCUS_09960 19660 20097 gene locus_tag LOCUS_09970 gene dtd 19660 20097 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547036.1 protein_id gnl|my_center|LOCUS_09970 20344 21630 gene locus_tag LOCUS_09980 gene hisS 20344 21630 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547037.1 protein_id gnl|my_center|LOCUS_09980 21633 23471 gene locus_tag LOCUS_09990 gene aspS 21633 23471 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547039.1 protein_id gnl|my_center|LOCUS_09990 23552 24124 gene locus_tag LOCUS_10000 23552 24124 CDS product NADPH-dependent FMN reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003704526.1 protein_id gnl|my_center|LOCUS_10000 24250 25128 gene locus_tag LOCUS_10010 24250 25128 CDS product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547719.1 protein_id gnl|my_center|LOCUS_10010 26013 25180 gene locus_tag LOCUS_10020 26013 25180 CDS product pyruvate, water dikinase regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547712.1 protein_id gnl|my_center|LOCUS_10020 26215 26391 gene locus_tag LOCUS_10030 gene rpsU 26215 26391 CDS product 30S ribosomal protein S21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002880182.1 protein_id gnl|my_center|LOCUS_10030 26488 26931 gene locus_tag LOCUS_10040 26488 26931 CDS product GatB/YqeY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547630.1 protein_id gnl|my_center|LOCUS_10040 26951 27913 gene locus_tag LOCUS_10050 26951 27913 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254379.1 protein_id gnl|my_center|LOCUS_10050 27910 28437 gene locus_tag LOCUS_10060 gene ybeY 27910 28437 CDS product rRNA maturation RNase YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547628.1 protein_id gnl|my_center|LOCUS_10060 28453 29355 gene locus_tag LOCUS_10070 gene era 28453 29355 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254378.1 protein_id gnl|my_center|LOCUS_10070 >Feature sequence16 671 174 gene locus_tag LOCUS_10080 gene coaD 671 174 CDS product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546847.1 protein_id gnl|my_center|LOCUS_10080 1206 658 gene locus_tag LOCUS_10090 gene rsmD 1206 658 CDS product 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546846.1 protein_id gnl|my_center|LOCUS_10090 1541 1209 gene locus_tag LOCUS_10100 1541 1209 CDS product YlbG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546844.1 protein_id gnl|my_center|LOCUS_10100 2721 1519 gene locus_tag LOCUS_10110 2721 1519 CDS product putative peptidoglycan glycosyltransferase FtsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254265.1 protein_id gnl|my_center|LOCUS_10110 4700 2865 gene locus_tag LOCUS_10120 gene typA 4700 2865 CDS product translational GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254264.1 protein_id gnl|my_center|LOCUS_10120 4950 5504 gene locus_tag LOCUS_10130 gene def 4950 5504 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546838.1 protein_id gnl|my_center|LOCUS_10130 5641 5865 gene locus_tag LOCUS_10140 5641 5865 CDS product DNA-dependent RNA polymerase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546835.1 protein_id gnl|my_center|LOCUS_10140 5874 7553 gene locus_tag LOCUS_10150 5874 7553 CDS product ribonuclease J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546834.1 protein_id gnl|my_center|LOCUS_10150 9934 7592 gene locus_tag LOCUS_10160 9934 7592 CDS product ATP-dependent RecD-like DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546830.1 protein_id gnl|my_center|LOCUS_10160 10594 9962 gene locus_tag LOCUS_10170 10594 9962 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546828.1 protein_id gnl|my_center|LOCUS_10170 11250 10594 gene locus_tag LOCUS_10180 11250 10594 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546826.1 protein_id gnl|my_center|LOCUS_10180 12406 11279 gene locus_tag LOCUS_10190 gene mnmA 12406 11279 CDS product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546824.1 protein_id gnl|my_center|LOCUS_10190 12752 12417 gene locus_tag LOCUS_10200 12752 12417 CDS product DUF1831 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546822.1 protein_id gnl|my_center|LOCUS_10200 13283 12783 gene locus_tag LOCUS_10210 13283 12783 CDS product dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546982.1 protein_id gnl|my_center|LOCUS_10210 14261 13305 gene locus_tag LOCUS_10220 14261 13305 CDS product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546979.1 protein_id gnl|my_center|LOCUS_10220 14852 14325 gene locus_tag LOCUS_10230 14852 14325 CDS product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547784.1 protein_id gnl|my_center|LOCUS_10230 17233 14948 gene locus_tag LOCUS_10240 gene recJ 17233 14948 CDS product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547786.1 protein_id gnl|my_center|LOCUS_10240 17916 17230 gene locus_tag LOCUS_10250 17916 17230 CDS product class A sortase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547788.1 protein_id gnl|my_center|LOCUS_10250 19756 17918 gene locus_tag LOCUS_10260 gene lepA 19756 17918 CDS product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254395.1 protein_id gnl|my_center|LOCUS_10260 21085 19946 gene locus_tag LOCUS_10270 gene dnaJ 21085 19946 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547790.1 protein_id gnl|my_center|LOCUS_10270 23001 21154 gene locus_tag LOCUS_10280 gene dnaK 23001 21154 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547791.1 protein_id gnl|my_center|LOCUS_10280 23566 23018 gene locus_tag LOCUS_10290 gene grpE 23566 23018 CDS product nucleotide exchange factor GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547792.1 protein_id gnl|my_center|LOCUS_10290 24636 23578 gene locus_tag LOCUS_10300 gene hrcA 24636 23578 CDS product heat-inducible transcriptional repressor HrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547794.1 protein_id gnl|my_center|LOCUS_10300 25638 24895 gene locus_tag LOCUS_10310 25638 24895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10310 >Feature sequence17 2858 915 gene locus_tag LOCUS_10320 gene parE 2858 915 CDS product DNA topoisomerase IV subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547476.1 protein_id gnl|my_center|LOCUS_10320 2906 3598 gene locus_tag LOCUS_10330 gene plsY 2906 3598 CDS product glycerol-3-phosphate 1-O-acyltransferase PlsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547474.1 protein_id gnl|my_center|LOCUS_10330 4521 3631 gene locus_tag LOCUS_10340 4521 3631 CDS product aldose 1-epimerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547149.1 protein_id gnl|my_center|LOCUS_10340 5935 4538 gene locus_tag LOCUS_10350 gene hslU 5935 4538 CDS product ATP-dependent protease ATPase subunit HslU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254308.1 protein_id gnl|my_center|LOCUS_10350 6470 5946 gene locus_tag LOCUS_10360 gene hslV 6470 5946 CDS product HslU--HslV peptidase proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254307.1 protein_id gnl|my_center|LOCUS_10360 7397 6474 gene locus_tag LOCUS_10370 7397 6474 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547143.1 protein_id gnl|my_center|LOCUS_10370 8713 7400 gene locus_tag LOCUS_10380 gene trmFO 8713 7400 CDS product methylenetetrahydrofolate--tRNA-(uracil(54)-C(5))-methyltransferase (FADH(2)-oxidizing) TrmFO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547141.1 protein_id gnl|my_center|LOCUS_10380 10850 8763 gene locus_tag LOCUS_10390 gene topA 10850 8763 CDS product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547140.1 protein_id gnl|my_center|LOCUS_10390 11765 10920 gene locus_tag LOCUS_10400 gene dprA 11765 10920 CDS product DNA-processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547135.1 protein_id gnl|my_center|LOCUS_10400 12566 11814 gene locus_tag LOCUS_10410 12566 11814 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254306.1 protein_id gnl|my_center|LOCUS_10410 13402 12563 gene locus_tag LOCUS_10420 gene ylqF 13402 12563 CDS product ribosome biogenesis GTPase YlqF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547131.1 protein_id gnl|my_center|LOCUS_10420 14998 13616 gene locus_tag LOCUS_10430 14998 13616 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101574.1 protein_id gnl|my_center|LOCUS_10430 15230 15003 gene locus_tag LOCUS_10440 15230 15003 CDS product YozE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547128.1 protein_id gnl|my_center|LOCUS_10440 16090 15239 gene locus_tag LOCUS_10450 16090 15239 CDS product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254305.1 protein_id gnl|my_center|LOCUS_10450 16217 16882 gene locus_tag LOCUS_10460 16217 16882 CDS product hemolysin III family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254304.1 protein_id gnl|my_center|LOCUS_10460 <18167 16980 gene locus_tag LOCUS_10470 <18167 16980 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003547116.1:CCA tRNA nucleotidyltransferase >Feature sequence18 85 546 gene locus_tag LOCUS_10480 85 546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254564.1 protein_id gnl|my_center|LOCUS_10480 569 1198 gene locus_tag LOCUS_10490 569 1198 CDS product LVIS_2131 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549837.1 protein_id gnl|my_center|LOCUS_10490 1244 1858 gene locus_tag LOCUS_10500 1244 1858 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254130.1 protein_id gnl|my_center|LOCUS_10500 1877 2353 gene locus_tag LOCUS_10510 gene tadA 1877 2353 CDS product tRNA adenosine(34) deaminase TadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254132.1 protein_id gnl|my_center|LOCUS_10510 2536 4287 gene locus_tag LOCUS_10520 gene dnaX 2536 4287 CDS product DNA polymerase III subunit gamma/tau inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549111.1 protein_id gnl|my_center|LOCUS_10520 4333 4662 gene locus_tag LOCUS_10530 4333 4662 CDS product YbaB/EbfC family nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549112.1 protein_id gnl|my_center|LOCUS_10530 4662 5261 gene locus_tag LOCUS_10540 gene recR 4662 5261 CDS product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549113.1 protein_id gnl|my_center|LOCUS_10540 5258 5491 gene locus_tag LOCUS_10550 5258 5491 CDS product YaaL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549114.1 protein_id gnl|my_center|LOCUS_10550 5551 6192 gene locus_tag LOCUS_10560 gene tmk 5551 6192 CDS product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254134.1 protein_id gnl|my_center|LOCUS_10560 6209 7066 gene locus_tag LOCUS_10570 6209 7066 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549117.1 protein_id gnl|my_center|LOCUS_10570 7082 7435 gene locus_tag LOCUS_10580 gene yabA 7082 7435 CDS product DNA replication initiation control protein YabA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254135.1 protein_id gnl|my_center|LOCUS_10580 7438 8292 gene locus_tag LOCUS_10590 gene rsmI 7438 8292 CDS product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549119.1 protein_id gnl|my_center|LOCUS_10590 8302 9021 gene locus_tag LOCUS_10600 8302 9021 CDS product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254136.1 protein_id gnl|my_center|LOCUS_10600 9035 9772 gene locus_tag LOCUS_10610 gene tsaB 9035 9772 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549123.1 protein_id gnl|my_center|LOCUS_10610 9801 10283 gene locus_tag LOCUS_10620 gene rimI 9801 10283 CDS product ribosomal protein S18-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549125.1 protein_id gnl|my_center|LOCUS_10620 10303 11349 gene locus_tag LOCUS_10630 gene tsaD 10303 11349 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549127.1 protein_id gnl|my_center|LOCUS_10630 11381 12070 gene locus_tag LOCUS_10640 11381 12070 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549720.1 protein_id gnl|my_center|LOCUS_10640 12060 13241 gene locus_tag LOCUS_10650 12060 13241 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549721.1 protein_id gnl|my_center|LOCUS_10650 13276 14835 gene locus_tag LOCUS_10660 13276 14835 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254584.1 protein_id gnl|my_center|LOCUS_10660 14859 15605 gene locus_tag LOCUS_10670 14859 15605 CDS product amino acid racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549723.1 protein_id gnl|my_center|LOCUS_10670 <16320 15688 gene locus_tag LOCUS_10680 <16320 15688 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011254070.1:hydrolase >Feature sequence19 208 9222 gene locus_tag LOCUS_10690 208 9222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10690 9362 9586 gene locus_tag LOCUS_10700 9362 9586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10700 9590 10288 gene locus_tag LOCUS_10710 9590 10288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10710 10334 11677 gene locus_tag LOCUS_10720 10334 11677 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546431.1 protein_id gnl|my_center|LOCUS_10720 11770 12336 gene locus_tag LOCUS_10730 gene hpt 11770 12336 CDS product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254205.1 protein_id gnl|my_center|LOCUS_10730 12410 13627 gene locus_tag LOCUS_10740 12410 13627 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546440.1 protein_id gnl|my_center|LOCUS_10740 13718 13646 gene locus_tag LOCUS_t00210 13718 13646 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 13949 13770 gene locus_tag LOCUS_10750 13949 13770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10750 14062 15204 gene locus_tag LOCUS_10760 gene wecB 14062 15204 CDS product UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254552.1 protein_id gnl|my_center|LOCUS_10760 15717 15271 gene locus_tag LOCUS_10770 15717 15271 CDS product flavodoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546448.1 protein_id gnl|my_center|LOCUS_10770 >Feature sequence20 43 1353 gene locus_tag LOCUS_10780 43 1353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10780 1365 2513 gene locus_tag LOCUS_10790 gene rpoD 1365 2513 CDS product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254377.1 protein_id gnl|my_center|LOCUS_10790 2574 3257 gene locus_tag LOCUS_10800 2574 3257 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547613.1 protein_id gnl|my_center|LOCUS_10800 3244 4041 gene locus_tag LOCUS_10810 3244 4041 CDS product Nif3-like dinuclear metal center hexameric protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547612.1 protein_id gnl|my_center|LOCUS_10810 4061 5305 gene locus_tag LOCUS_10820 gene pepT 4061 5305 CDS product peptidase T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547606.1 protein_id gnl|my_center|LOCUS_10820 5616 5990 gene locus_tag LOCUS_10830 5616 5990 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547604.1 protein_id gnl|my_center|LOCUS_10830 5983 6672 gene locus_tag LOCUS_10840 5983 6672 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642672.1 protein_id gnl|my_center|LOCUS_10840 6690 7412 gene locus_tag LOCUS_10850 6690 7412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10850 7518 8408 gene locus_tag LOCUS_10860 7518 8408 CDS product GIY-YIG nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962520.1 protein_id gnl|my_center|LOCUS_10860 8946 8665 gene locus_tag LOCUS_10870 8946 8665 CDS product type II toxin-antitoxin system RelB/DinJ family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002665927.1 protein_id gnl|my_center|LOCUS_10870 9215 9928 gene locus_tag LOCUS_10880 9215 9928 CDS product SprT family zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681373.1 protein_id gnl|my_center|LOCUS_10880 10174 9989 gene locus_tag LOCUS_10890 10174 9989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10890 10792 10190 gene locus_tag LOCUS_10900 gene lepB 10792 10190 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547598.1 protein_id gnl|my_center|LOCUS_10900 10880 11626 gene locus_tag LOCUS_10910 10880 11626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254372.1 protein_id gnl|my_center|LOCUS_10910 11613 12599 gene locus_tag LOCUS_10920 11613 12599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10920 12592 14001 gene locus_tag LOCUS_10930 12592 14001 CDS product RsmF rRNA methyltransferase first C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254371.1 protein_id gnl|my_center|LOCUS_10930 >Feature sequence21 <1 916 gene locus_tag LOCUS_10940 <1 916 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003547883.1:signal recognition particle-docking protein FtsY 943 2367 gene locus_tag LOCUS_10950 943 2367 CDS product C69 family dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254410.1 protein_id gnl|my_center|LOCUS_10950 2479 3300 gene locus_tag LOCUS_10960 2479 3300 CDS product DivIVA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254259.1 protein_id gnl|my_center|LOCUS_10960 3514 6300 gene locus_tag LOCUS_10970 gene ileS 3514 6300 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254260.1 protein_id gnl|my_center|LOCUS_10970 6300 6518 gene locus_tag LOCUS_10980 6300 6518 CDS product cold shock domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546816.1 protein_id gnl|my_center|LOCUS_10980 6524 7087 gene locus_tag LOCUS_10990 6524 7087 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254261.1 protein_id gnl|my_center|LOCUS_10990 7080 7331 gene locus_tag LOCUS_11000 7080 7331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11000 7343 8032 gene locus_tag LOCUS_11010 7343 8032 CDS product 5'-methylthioadenosine/adenosylhomocysteine nucleosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254262.1 protein_id gnl|my_center|LOCUS_11010 8054 9199 gene locus_tag LOCUS_11020 8054 9199 CDS product cysteine desulfurase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101678.1 protein_id gnl|my_center|LOCUS_11020 9341 9676 gene locus_tag LOCUS_11030 gene folB 9341 9676 CDS product dihydroneopterin aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643485.1 protein_id gnl|my_center|LOCUS_11030 9673 10188 gene locus_tag LOCUS_11040 gene folK 9673 10188 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642516.1 protein_id gnl|my_center|LOCUS_11040 10169 10729 gene locus_tag LOCUS_11050 gene folE 10169 10729 CDS product GTP cyclohydrolase I FolE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642515.1 protein_id gnl|my_center|LOCUS_11050 10735 11997 gene locus_tag LOCUS_11060 10735 11997 CDS product Mur ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643484.1 protein_id gnl|my_center|LOCUS_11060 11990 12589 gene locus_tag LOCUS_11070 gene rdgB 11990 12589 CDS product RdgB/HAM1 family non-canonical purine NTP pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932022.1 protein_id gnl|my_center|LOCUS_11070 >Feature sequence22 354 1085 gene locus_tag LOCUS_11080 354 1085 CDS product segregation/condensation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547078.1 protein_id gnl|my_center|LOCUS_11080 1078 1653 gene locus_tag LOCUS_11090 gene scpB 1078 1653 CDS product SMC-Scp complex subunit ScpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547080.1 protein_id gnl|my_center|LOCUS_11090 1672 2391 gene locus_tag LOCUS_11100 1672 2391 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547082.1 protein_id gnl|my_center|LOCUS_11100 2458 3237 gene locus_tag LOCUS_11110 2458 3237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11110 3507 4100 gene locus_tag LOCUS_11120 3507 4100 CDS product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296977.1 protein_id gnl|my_center|LOCUS_11120 4188 4856 gene locus_tag LOCUS_11130 gene cmk 4188 4856 CDS product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254302.1 protein_id gnl|my_center|LOCUS_11130 4915 6102 gene locus_tag LOCUS_11140 gene rpsA 4915 6102 CDS product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547091.1 protein_id gnl|my_center|LOCUS_11140 6171 7478 gene locus_tag LOCUS_11150 gene der 6171 7478 CDS product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254303.1 protein_id gnl|my_center|LOCUS_11150 7624 7899 gene locus_tag LOCUS_11160 7624 7899 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547110.1 protein_id gnl|my_center|LOCUS_11160 7989 9239 gene locus_tag LOCUS_11170 7989 9239 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547113.1 protein_id gnl|my_center|LOCUS_11170 9283 10773 gene locus_tag LOCUS_11180 9283 10773 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011921882.1 protein_id gnl|my_center|LOCUS_11180 11785 10844 gene locus_tag LOCUS_11190 11785 10844 CDS product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547115.1 protein_id gnl|my_center|LOCUS_11190 >Feature sequence23 162 983 gene locus_tag LOCUS_11200 gene map 162 983 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254208.1 protein_id gnl|my_center|LOCUS_11200 987 1907 gene locus_tag LOCUS_11210 987 1907 CDS product YihY/virulence factor BrkB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546451.1 protein_id gnl|my_center|LOCUS_11210 1947 2834 gene locus_tag LOCUS_11220 gene galU 1947 2834 CDS product UTP--glucose-1-phosphate uridylyltransferase GalU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546456.1 protein_id gnl|my_center|LOCUS_11220 3166 2873 gene locus_tag LOCUS_11230 3166 2873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11230 3254 4207 gene locus_tag LOCUS_11240 3254 4207 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254232.1 protein_id gnl|my_center|LOCUS_11240 5821 4448 gene locus_tag LOCUS_11250 gene rlmD 5821 4448 CDS product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546467.1 protein_id gnl|my_center|LOCUS_11250 5929 6744 gene locus_tag LOCUS_11260 gene recX 5929 6744 CDS product recombination regulator RecX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546469.1 protein_id gnl|my_center|LOCUS_11260 6764 7255 gene locus_tag LOCUS_11270 6764 7255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254210.1 protein_id gnl|my_center|LOCUS_11270 7705 7259 gene locus_tag LOCUS_11280 7705 7259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11280 7812 8687 gene locus_tag LOCUS_11290 7812 8687 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546472.1 protein_id gnl|my_center|LOCUS_11290 8687 10258 gene locus_tag LOCUS_11300 8687 10258 CDS product peptide chain release factor 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546473.1 protein_id gnl|my_center|LOCUS_11300 >Feature sequence24 1060 764 gene locus_tag LOCUS_11310 1060 764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11310 3037 1427 gene locus_tag LOCUS_11320 3037 1427 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001108415.1 protein_id gnl|my_center|LOCUS_11320 3839 3069 gene locus_tag LOCUS_11330 3839 3069 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002485509.1 protein_id gnl|my_center|LOCUS_11330 4615 3857 gene locus_tag LOCUS_11340 4615 3857 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003645053.1 protein_id gnl|my_center|LOCUS_11340 5495 4605 gene locus_tag LOCUS_11350 5495 4605 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287087.1 protein_id gnl|my_center|LOCUS_11350 8166 5497 gene locus_tag LOCUS_11360 gene lanKC 8166 5497 CDS product class III lanthionine synthetase LanKC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_127742798.1 protein_id gnl|my_center|LOCUS_11360 8400 8272 gene locus_tag LOCUS_11370 8400 8272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11370 8858 9622 gene locus_tag LOCUS_11380 8858 9622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11380 10374 9859 gene locus_tag LOCUS_11390 10374 9859 CDS product O-acetyl-ADP-ribose deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549649.1 protein_id gnl|my_center|LOCUS_11390 >Feature sequence25 393 1514 gene locus_tag LOCUS_11400 393 1514 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_087235334.1 protein_id gnl|my_center|LOCUS_11400 2028 1664 gene locus_tag LOCUS_tm00010 2028 1664 tmRNA product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 3277 2066 gene locus_tag LOCUS_11410 3277 2066 CDS product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548234.1 protein_id gnl|my_center|LOCUS_11410 4289 3288 gene locus_tag LOCUS_11420 4289 3288 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546680.1 protein_id gnl|my_center|LOCUS_11420 4553 4380 gene locus_tag LOCUS_11430 4553 4380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11430 5028 4537 gene locus_tag LOCUS_11440 5028 4537 CDS product ComGF family competence protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546679.1 protein_id gnl|my_center|LOCUS_11440 5233 5015 gene locus_tag LOCUS_11450 5233 5015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11450 5654 5223 gene locus_tag LOCUS_11460 5654 5223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11460 5964 5638 gene locus_tag LOCUS_11470 gene comGC 5964 5638 CDS product competence type IV pilus major pilin ComGC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546673.1 protein_id gnl|my_center|LOCUS_11470 6977 5979 gene locus_tag LOCUS_11480 6977 5979 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021721297.1 protein_id gnl|my_center|LOCUS_11480 7920 6946 gene locus_tag LOCUS_11490 gene comGA 7920 6946 CDS product competence type IV pilus ATPase ComGA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546670.1 protein_id gnl|my_center|LOCUS_11490 >Feature sequence26 254 325 gene locus_tag LOCUS_t00220 254 325 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 362 453 gene locus_tag LOCUS_t00230 362 453 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 485 560 gene locus_tag LOCUS_t00240 485 560 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 569 644 gene locus_tag LOCUS_t00250 569 644 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 678 753 gene locus_tag LOCUS_t00260 678 753 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 755 830 gene locus_tag LOCUS_t00270 755 830 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 836 910 gene locus_tag LOCUS_t00280 836 910 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 917 1000 gene locus_tag LOCUS_t00290 917 1000 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 1003 1075 gene locus_tag LOCUS_t00300 1003 1075 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 1089 1162 gene locus_tag LOCUS_t00310 1089 1162 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 1168 1241 gene locus_tag LOCUS_t00320 1168 1241 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 1264 1334 gene locus_tag LOCUS_t00330 1264 1334 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 1367 1452 gene locus_tag LOCUS_t00340 1367 1452 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 1565 2719 gene locus_tag LOCUS_11500 1565 2719 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003550126.1 protein_id gnl|my_center|LOCUS_11500 2721 3764 gene locus_tag LOCUS_11510 2721 3764 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003550128.1 protein_id gnl|my_center|LOCUS_11510 3764 4774 gene locus_tag LOCUS_11520 3764 4774 CDS product lysylphosphatidylglycerol synthase transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003550130.1 protein_id gnl|my_center|LOCUS_11520 4833 6902 gene locus_tag LOCUS_11530 4833 6902 CDS product LTA synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254156.1 protein_id gnl|my_center|LOCUS_11530 >Feature sequence27 611 462 gene locus_tag LOCUS_11540 611 462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11540 937 608 gene locus_tag LOCUS_11550 937 608 CDS product DUF771 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475911.1 protein_id gnl|my_center|LOCUS_11550 1161 940 gene locus_tag LOCUS_11560 1161 940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11560 1347 1171 gene locus_tag LOCUS_11570 1347 1171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11570 2114 1344 gene locus_tag LOCUS_11580 2114 1344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11580 2336 2145 gene locus_tag LOCUS_11590 2336 2145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11590 2488 2799 gene locus_tag LOCUS_11600 2488 2799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11600 2832 3251 gene locus_tag LOCUS_11610 2832 3251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11610 3913 4086 gene locus_tag LOCUS_11620 3913 4086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11620 4247 4104 gene locus_tag LOCUS_11630 4247 4104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11630 4309 5460 gene locus_tag LOCUS_11640 4309 5460 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475894.1 protein_id gnl|my_center|LOCUS_11640 5970 5731 gene locus_tag LOCUS_11650 5970 5731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11650 6587 6054 gene locus_tag LOCUS_11660 6587 6054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11660 >Feature sequence28 1 153 gene locus_tag LOCUS_11670 1 153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11670 168 455 gene locus_tag LOCUS_11680 168 455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11680 463 657 gene locus_tag LOCUS_11690 463 657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11690 1033 1317 gene locus_tag LOCUS_11700 1033 1317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_11700 1372 1590 gene locus_tag LOCUS_11710 1372 1590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11710 1592 2539 gene locus_tag LOCUS_11720 1592 2539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11720 2541 3410 gene locus_tag LOCUS_11730 2541 3410 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000411125.1 protein_id gnl|my_center|LOCUS_11730 3394 4137 gene locus_tag LOCUS_11740 3394 4137 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000646283.1 protein_id gnl|my_center|LOCUS_11740 4146 4661 gene locus_tag LOCUS_11750 4146 4661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11750 4661 5053 gene locus_tag LOCUS_11760 4661 5053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11760 >Feature sequence29 2534 465 gene locus_tag LOCUS_11770 gene glyS 2534 465 CDS product glycine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547620.1 protein_id gnl|my_center|LOCUS_11770 3441 2536 gene locus_tag LOCUS_11780 gene glyQ 3441 2536 CDS product glycine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547621.1 protein_id gnl|my_center|LOCUS_11780 >Feature sequence30 208 1362 gene locus_tag LOCUS_11790 208 1362 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705504.1 protein_id gnl|my_center|LOCUS_11790 2036 3424 gene locus_tag LOCUS_11800 2036 3424 CDS product DHA2 family efflux MFS transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101592.1 protein_id gnl|my_center|LOCUS_11800 >Feature sequence31 <1 1617 gene locus_tag LOCUS_11810 <1 1617 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003547478.1:DNA topoisomerase IV subunit A 1696 2631 gene locus_tag LOCUS_11820 1696 2631 CDS product manganese-dependent inorganic pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547481.1 protein_id gnl|my_center|LOCUS_11820 2752 3348 gene locus_tag LOCUS_11830 2752 3348 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547484.1 protein_id gnl|my_center|LOCUS_11830 >Feature sequence32 131 1309 gene locus_tag LOCUS_11840 131 1309 CDS product IS256-like element ISEf1 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000997695.1 protein_id gnl|my_center|LOCUS_11840 1398 1592 gene locus_tag LOCUS_11850 1398 1592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11850 1593 1796 gene locus_tag LOCUS_11860 1593 1796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11860 1833 2567 gene locus_tag LOCUS_11870 1833 2567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11870 2582 2755 gene locus_tag LOCUS_11880 2582 2755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11880