>Feature sequence001 1024 143 gene locus_tag LOCUS_00010 1024 143 CDS product aldose 1-epimerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767778.1 protein_id gnl|my_center|LOCUS_00010 1708 1028 gene locus_tag LOCUS_00020 1708 1028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00020 2045 2977 gene locus_tag LOCUS_00030 2045 2977 CDS product DUF362 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107441.1 protein_id gnl|my_center|LOCUS_00030 2984 4582 gene locus_tag LOCUS_00040 2984 4582 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765637.1 protein_id gnl|my_center|LOCUS_00040 4619 5749 gene locus_tag LOCUS_00050 gene tgt 4619 5749 CDS product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202814.1 protein_id gnl|my_center|LOCUS_00050 5762 6847 gene locus_tag LOCUS_00060 5762 6847 CDS product LptF/LptG family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761518.1 protein_id gnl|my_center|LOCUS_00060 7942 6938 gene locus_tag LOCUS_00070 7942 6938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00070 8106 8495 gene locus_tag LOCUS_00080 8106 8495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00080 9894 8569 gene locus_tag LOCUS_00090 9894 8569 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788731.1 protein_id gnl|my_center|LOCUS_00090 10063 10674 gene locus_tag LOCUS_00100 10063 10674 CDS product MarC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759972.1 protein_id gnl|my_center|LOCUS_00100 13117 10751 gene locus_tag LOCUS_00110 13117 10751 CDS product outer membrane beta-barrel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107420.1 protein_id gnl|my_center|LOCUS_00110 13502 14452 gene locus_tag LOCUS_00120 13502 14452 CDS product linear amide C-N hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763035.1 protein_id gnl|my_center|LOCUS_00120 14525 15115 gene locus_tag LOCUS_00130 14525 15115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00130 15199 16719 gene locus_tag LOCUS_00140 15199 16719 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162303152.1 protein_id gnl|my_center|LOCUS_00140 16744 17427 gene locus_tag LOCUS_00150 16744 17427 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787526.1 protein_id gnl|my_center|LOCUS_00150 17674 17417 gene locus_tag LOCUS_00160 17674 17417 CDS product TIGR03905 family TSCPD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965683.1 protein_id gnl|my_center|LOCUS_00160 17758 19074 gene locus_tag LOCUS_00170 17758 19074 CDS product folylpolyglutamate synthase/dihydrofolate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962704.1 protein_id gnl|my_center|LOCUS_00170 19098 20513 gene locus_tag LOCUS_00180 19098 20513 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785475.1 protein_id gnl|my_center|LOCUS_00180 21625 22878 gene locus_tag LOCUS_00190 21625 22878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00190 23267 24082 gene locus_tag LOCUS_00200 gene ispE 23267 24082 CDS product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793430.1 protein_id gnl|my_center|LOCUS_00200 24079 24660 gene locus_tag LOCUS_00210 24079 24660 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948225.1 protein_id gnl|my_center|LOCUS_00210 24672 27164 gene locus_tag LOCUS_00220 24672 27164 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789772.1 protein_id gnl|my_center|LOCUS_00220 27363 27752 gene locus_tag LOCUS_00230 27363 27752 CDS product antibiotic biosynthesis monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764895.1 protein_id gnl|my_center|LOCUS_00230 28838 27837 gene locus_tag LOCUS_00240 28838 27837 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763609.1 protein_id gnl|my_center|LOCUS_00240 28993 30822 gene locus_tag LOCUS_00250 28993 30822 CDS product YgiQ family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788960.1 protein_id gnl|my_center|LOCUS_00250 30785 30970 gene locus_tag LOCUS_00260 30785 30970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00260 31340 30960 gene locus_tag LOCUS_00270 31340 30960 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762436.1 protein_id gnl|my_center|LOCUS_00270 32114 31368 gene locus_tag LOCUS_00280 gene rlmB 32114 31368 CDS product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788741.1 protein_id gnl|my_center|LOCUS_00280 32784 32164 gene locus_tag LOCUS_00290 32784 32164 CDS product thymidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784663.1 protein_id gnl|my_center|LOCUS_00290 33328 34167 gene locus_tag LOCUS_00300 33328 34167 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764995.1 protein_id gnl|my_center|LOCUS_00300 34173 37214 gene locus_tag LOCUS_00310 34173 37214 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203726.1 protein_id gnl|my_center|LOCUS_00310 37224 38534 gene locus_tag LOCUS_00320 37224 38534 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032555881.1 protein_id gnl|my_center|LOCUS_00320 38538 39578 gene locus_tag LOCUS_00330 38538 39578 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107683.1 protein_id gnl|my_center|LOCUS_00330 39571 40350 gene locus_tag LOCUS_00340 39571 40350 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107611.1 protein_id gnl|my_center|LOCUS_00340 40865 40347 gene locus_tag LOCUS_00350 40865 40347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00350 42719 41055 gene locus_tag LOCUS_00360 gene recN 42719 41055 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107738.1 protein_id gnl|my_center|LOCUS_00360 43638 42727 gene locus_tag LOCUS_00370 43638 42727 CDS product DUF4835 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963945.1 protein_id gnl|my_center|LOCUS_00370 44840 43635 gene locus_tag LOCUS_00380 gene coaBC 44840 43635 CDS product bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107739.1 protein_id gnl|my_center|LOCUS_00380 46041 44890 gene locus_tag LOCUS_00390 46041 44890 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143816.1 protein_id gnl|my_center|LOCUS_00390 46816 46046 gene locus_tag LOCUS_00400 46816 46046 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762413.1 protein_id gnl|my_center|LOCUS_00400 47951 46827 gene locus_tag LOCUS_00410 gene dnaN 47951 46827 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788748.1 protein_id gnl|my_center|LOCUS_00410 48324 48172 gene locus_tag LOCUS_00420 48324 48172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00420 48529 48341 gene locus_tag LOCUS_00430 gene rpmG 48529 48341 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761579.1 protein_id gnl|my_center|LOCUS_00430 48752 48549 gene locus_tag LOCUS_00440 48752 48549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00440 49011 49625 gene locus_tag LOCUS_00450 49011 49625 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783862.1 protein_id gnl|my_center|LOCUS_00450 49634 50989 gene locus_tag LOCUS_00460 gene lpdA 49634 50989 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786461.1 protein_id gnl|my_center|LOCUS_00460 51018 51761 gene locus_tag LOCUS_00470 51018 51761 CDS product lipoate--protein ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766154.1 protein_id gnl|my_center|LOCUS_00470 51865 53199 gene locus_tag LOCUS_00480 51865 53199 CDS product dihydrolipoamide acetyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766153.1 protein_id gnl|my_center|LOCUS_00480 53223 55256 gene locus_tag LOCUS_00490 53223 55256 CDS product alpha-ketoacid dehydrogenase subunit alpha/beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766152.1 protein_id gnl|my_center|LOCUS_00490 55290 55793 gene locus_tag LOCUS_00500 55290 55793 CDS product flavodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766151.1 protein_id gnl|my_center|LOCUS_00500 56074 56514 gene locus_tag LOCUS_00510 56074 56514 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765008.1 protein_id gnl|my_center|LOCUS_00510 56540 56803 gene locus_tag LOCUS_00520 56540 56803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_00520 56990 57814 gene locus_tag LOCUS_00530 56990 57814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_00530 57830 58900 gene locus_tag LOCUS_00540 57830 58900 CDS product HlyD family secretion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763044.1 protein_id gnl|my_center|LOCUS_00540 58897 60501 gene locus_tag LOCUS_00550 58897 60501 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_022471470.1 protein_id gnl|my_center|LOCUS_00550 60672 62726 gene locus_tag LOCUS_00560 gene htpG 60672 62726 CDS product molecular chaperone HtpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202859.1 protein_id gnl|my_center|LOCUS_00560 63107 62784 gene locus_tag LOCUS_00570 63107 62784 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795584.1 protein_id gnl|my_center|LOCUS_00570 63220 65538 gene locus_tag LOCUS_00580 63220 65538 CDS product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032840909.1 protein_id gnl|my_center|LOCUS_00580 65615 65691 gene locus_tag LOCUS_t00010 65615 65691 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 65719 65793 gene locus_tag LOCUS_t00020 65719 65793 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 65821 65895 gene locus_tag LOCUS_t00030 65821 65895 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 66599 65961 gene locus_tag LOCUS_00590 66599 65961 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764753.1 protein_id gnl|my_center|LOCUS_00590 67629 67012 gene locus_tag LOCUS_00600 67629 67012 CDS product master DNA invertase Mpi family serine-type recombinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005680425.1 protein_id gnl|my_center|LOCUS_00600 67693 68154 gene locus_tag LOCUS_00610 67693 68154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788217.1 protein_id gnl|my_center|LOCUS_00610 68251 69522 gene locus_tag LOCUS_00620 68251 69522 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763375.1 protein_id gnl|my_center|LOCUS_00620 71611 69614 gene locus_tag LOCUS_00630 gene pulA 71611 69614 CDS product type I pullulanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109382.1 protein_id gnl|my_center|LOCUS_00630 73207 71741 gene locus_tag LOCUS_00640 gene dnaB 73207 71741 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788141.1 protein_id gnl|my_center|LOCUS_00640 73349 74242 gene locus_tag LOCUS_00650 73349 74242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00650 74621 75547 gene locus_tag LOCUS_00660 74621 75547 CDS product magnesium transporter CorA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783972.1 protein_id gnl|my_center|LOCUS_00660 77887 75641 gene locus_tag LOCUS_00670 77887 75641 CDS product GH92 family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005800561.1 protein_id gnl|my_center|LOCUS_00670 80009 77928 gene locus_tag LOCUS_00680 80009 77928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00680 80478 80233 gene locus_tag LOCUS_00690 80478 80233 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787659.1 protein_id gnl|my_center|LOCUS_00690 81427 81083 gene locus_tag LOCUS_00700 gene rplT 81427 81083 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786577.1 protein_id gnl|my_center|LOCUS_00700 81730 81533 gene locus_tag LOCUS_00710 gene rpmI 81730 81533 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786574.1 protein_id gnl|my_center|LOCUS_00710 82412 81786 gene locus_tag LOCUS_00720 gene infC 82412 81786 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008768315.1 protein_id gnl|my_center|LOCUS_00720 84401 82446 gene locus_tag LOCUS_00730 gene thrS 84401 82446 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786570.1 protein_id gnl|my_center|LOCUS_00730 86615 84492 gene locus_tag LOCUS_00740 86615 84492 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107261.1 protein_id gnl|my_center|LOCUS_00740 86989 86657 gene locus_tag LOCUS_00750 86989 86657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00750 88549 87002 gene locus_tag LOCUS_00760 88549 87002 CDS product acyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081020.1 protein_id gnl|my_center|LOCUS_00760 89126 88569 gene locus_tag LOCUS_00770 gene def 89126 88569 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760700.1 protein_id gnl|my_center|LOCUS_00770 89570 89130 gene locus_tag LOCUS_00780 gene ruvX 89570 89130 CDS product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766074.1 protein_id gnl|my_center|LOCUS_00780 91019 89622 gene locus_tag LOCUS_00790 91019 89622 CDS product undecaprenyl-phosphate glucose phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788605.1 protein_id gnl|my_center|LOCUS_00790 92261 91116 gene locus_tag LOCUS_00800 92261 91116 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786002.1 protein_id gnl|my_center|LOCUS_00800 93520 92369 gene locus_tag LOCUS_00810 gene gmd 93520 92369 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706703.1 protein_id gnl|my_center|LOCUS_00810 94622 93546 gene locus_tag LOCUS_00820 94622 93546 CDS product GDP-L-fucose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808880.1 protein_id gnl|my_center|LOCUS_00820 95523 94648 gene locus_tag LOCUS_00830 gene rfbA 95523 94648 CDS product glucose-1-phosphate thymidylyltransferase RfbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202141.1 protein_id gnl|my_center|LOCUS_00830 96136 95612 gene locus_tag LOCUS_00840 96136 95612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00840 97087 96386 gene locus_tag LOCUS_00850 gene pgl 97087 96386 CDS product 6-phosphogluconolactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048696912.1 protein_id gnl|my_center|LOCUS_00850 98558 97092 gene locus_tag LOCUS_00860 gene zwf 98558 97092 CDS product glucose-6-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763420.1 protein_id gnl|my_center|LOCUS_00860 100023 98563 gene locus_tag LOCUS_00870 gene gnd 100023 98563 CDS product decarboxylating NADP(+)-dependent phosphogluconate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107660.1 protein_id gnl|my_center|LOCUS_00870 101413 100034 gene locus_tag LOCUS_00880 101413 100034 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008659213.1 protein_id gnl|my_center|LOCUS_00880 101792 102709 gene locus_tag LOCUS_00890 101792 102709 CDS product DUF2156 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108933.1 protein_id gnl|my_center|LOCUS_00890 102713 103675 gene locus_tag LOCUS_00900 102713 103675 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108932.1 protein_id gnl|my_center|LOCUS_00900 105869 103782 gene locus_tag LOCUS_00910 105869 103782 CDS product LruC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202965.1 protein_id gnl|my_center|LOCUS_00910 108153 106828 gene locus_tag LOCUS_00920 108153 106828 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762735.1 protein_id gnl|my_center|LOCUS_00920 109371 108199 gene locus_tag LOCUS_00930 109371 108199 CDS product DUF418 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798870.1 protein_id gnl|my_center|LOCUS_00930 112228 109742 gene locus_tag LOCUS_00940 112228 109742 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108984.1 protein_id gnl|my_center|LOCUS_00940 113962 112244 gene locus_tag LOCUS_00950 113962 112244 CDS product phosphoethanolamine transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798980.1 protein_id gnl|my_center|LOCUS_00950 115775 114099 gene locus_tag LOCUS_00960 115775 114099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00960 116264 115923 gene locus_tag LOCUS_00970 116264 115923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203154.1 protein_id gnl|my_center|LOCUS_00970 117382 116384 gene locus_tag LOCUS_00980 117382 116384 CDS product glycoside hydrolase family 130 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786056.1 protein_id gnl|my_center|LOCUS_00980 118721 117402 gene locus_tag LOCUS_00990 118721 117402 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786054.1 protein_id gnl|my_center|LOCUS_00990 119658 118774 gene locus_tag LOCUS_01000 119658 118774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01000 120685 119813 gene locus_tag LOCUS_01010 gene lsrF 120685 119813 CDS product 3-hydroxy-5-phosphonooxypentane-2,4-dione thiolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005175220.1 protein_id gnl|my_center|LOCUS_01010 121369 120755 gene locus_tag LOCUS_01020 gene dhaL 121369 120755 CDS product dihydroxyacetone kinase subunit DhaL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267780.1 protein_id gnl|my_center|LOCUS_01020 122395 121379 gene locus_tag LOCUS_01030 gene dhaK 122395 121379 CDS product dihydroxyacetone kinase subunit DhaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029494451.1 protein_id gnl|my_center|LOCUS_01030 122751 122437 gene locus_tag LOCUS_01040 122751 122437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01040 125217 122770 gene locus_tag LOCUS_01050 gene ccsA 125217 122770 CDS product cytochrome c biogenesis protein CcsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764579.1 protein_id gnl|my_center|LOCUS_01050 129338 125334 gene locus_tag LOCUS_01060 129338 125334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01060 130189 129431 gene locus_tag LOCUS_01070 130189 129431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01070 131318 130224 gene locus_tag LOCUS_01080 131318 130224 CDS product PTS cellobiose transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764578.1 protein_id gnl|my_center|LOCUS_01080 132970 131330 gene locus_tag LOCUS_01090 132970 131330 CDS product YncE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764577.1 protein_id gnl|my_center|LOCUS_01090 133920 133123 gene locus_tag LOCUS_01100 133920 133123 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391955.1 protein_id gnl|my_center|LOCUS_01100 134574 134086 gene locus_tag LOCUS_01110 134574 134086 CDS product Dps family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786060.1 protein_id gnl|my_center|LOCUS_01110 135412 134729 gene locus_tag LOCUS_01120 135412 134729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01120 136036 135548 gene locus_tag LOCUS_01130 136036 135548 CDS product Dps family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786060.1 protein_id gnl|my_center|LOCUS_01130 136585 136229 gene locus_tag LOCUS_01140 136585 136229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01140 136613 139981 gene locus_tag LOCUS_01150 gene mfd 136613 139981 CDS product transcription-repair coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203155.1 protein_id gnl|my_center|LOCUS_01150 140003 141904 gene locus_tag LOCUS_01160 140003 141904 CDS product AMP-dependent synthetase/ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926994.1 protein_id gnl|my_center|LOCUS_01160 142383 141991 gene locus_tag LOCUS_01170 142383 141991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01170 143438 142392 gene locus_tag LOCUS_01180 143438 142392 CDS product C10 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005681485.1 protein_id gnl|my_center|LOCUS_01180 144017 144757 gene locus_tag LOCUS_01190 144017 144757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01190 144929 147517 gene locus_tag LOCUS_01200 144929 147517 CDS product DUF5686 and carboxypeptidase-like regulatory domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107841.1 protein_id gnl|my_center|LOCUS_01200 147572 148867 gene locus_tag LOCUS_01210 147572 148867 CDS product Na+/H+ antiporter NhaC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764994.1 protein_id gnl|my_center|LOCUS_01210 149993 149025 gene locus_tag LOCUS_01220 149993 149025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963134.1 protein_id gnl|my_center|LOCUS_01220 150542 150000 gene locus_tag LOCUS_01230 150542 150000 CDS product DUF2148 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761545.1 protein_id gnl|my_center|LOCUS_01230 150964 150614 gene locus_tag LOCUS_01240 150964 150614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01240 153731 151329 gene locus_tag LOCUS_01250 153731 151329 CDS product S8 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974867.1 protein_id gnl|my_center|LOCUS_01250 154704 153745 gene locus_tag LOCUS_01260 154704 153745 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_146535726.1 protein_id gnl|my_center|LOCUS_01260 >Feature sequence002 <1 623 gene locus_tag LOCUS_01270 <1 623 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000839485.1:HAMP domain-containing sensor histidine kinase 613 1692 gene locus_tag LOCUS_01280 613 1692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01280 1682 2371 gene locus_tag LOCUS_01290 1682 2371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01290 2371 4233 gene locus_tag LOCUS_01300 2371 4233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01300 4557 4285 gene locus_tag LOCUS_01310 4557 4285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01310 5702 4644 gene locus_tag LOCUS_01320 5702 4644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01320 5855 7147 gene locus_tag LOCUS_01330 5855 7147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682207.1 protein_id gnl|my_center|LOCUS_01330 10118 7200 gene locus_tag LOCUS_01340 10118 7200 CDS product GIY-YIG nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033492290.1 protein_id gnl|my_center|LOCUS_01340 10500 10123 gene locus_tag LOCUS_01350 10500 10123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01350 10673 10921 gene locus_tag LOCUS_01360 10673 10921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01360 11585 10923 gene locus_tag LOCUS_01370 11585 10923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01370 13019 11823 gene locus_tag LOCUS_01380 13019 11823 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009039969.1 protein_id gnl|my_center|LOCUS_01380 13773 13024 gene locus_tag LOCUS_01390 13773 13024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01390 14734 13802 gene locus_tag LOCUS_01400 14734 13802 CDS product relaxase/mobilization nuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005944378.1 protein_id gnl|my_center|LOCUS_01400 15210 14731 gene locus_tag LOCUS_01410 15210 14731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01410 15806 15306 gene locus_tag LOCUS_01420 15806 15306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01420 16556 16870 gene locus_tag LOCUS_01430 16556 16870 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008628599.1 protein_id gnl|my_center|LOCUS_01430 16901 17212 gene locus_tag LOCUS_01440 16901 17212 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004295270.1 protein_id gnl|my_center|LOCUS_01440 18056 20218 gene locus_tag LOCUS_01450 gene bglX 18056 20218 CDS product beta-glucosidase BglX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203679.1 protein_id gnl|my_center|LOCUS_01450 20303 20700 gene locus_tag LOCUS_tm00010 20303 20700 tmRNA product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 21462 20743 gene locus_tag LOCUS_01460 21462 20743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01460 21987 22289 gene locus_tag LOCUS_01470 21987 22289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01470 22539 23534 gene locus_tag LOCUS_01480 22539 23534 CDS product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005449968.1 protein_id gnl|my_center|LOCUS_01480 23518 23988 gene locus_tag LOCUS_01490 23518 23988 CDS product TRAP transporter small permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461368.1 protein_id gnl|my_center|LOCUS_01490 24001 25299 gene locus_tag LOCUS_01500 24001 25299 CDS product TRAP transporter large permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461370.1 protein_id gnl|my_center|LOCUS_01500 26634 25456 gene locus_tag LOCUS_01510 gene uxuA 26634 25456 CDS product mannonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107776.1 protein_id gnl|my_center|LOCUS_01510 27529 26717 gene locus_tag LOCUS_01520 27529 26717 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762343.1 protein_id gnl|my_center|LOCUS_01520 28590 27529 gene locus_tag LOCUS_01530 28590 27529 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_061474082.1 protein_id gnl|my_center|LOCUS_01530 29116 28625 gene locus_tag LOCUS_01540 29116 28625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01540 29058 29330 gene locus_tag LOCUS_01550 29058 29330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01550 29552 30763 gene locus_tag LOCUS_01560 29552 30763 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108777.1 protein_id gnl|my_center|LOCUS_01560 30817 34038 gene locus_tag LOCUS_01570 30817 34038 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767547.1 protein_id gnl|my_center|LOCUS_01570 34042 35433 gene locus_tag LOCUS_01580 34042 35433 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783789.1 protein_id gnl|my_center|LOCUS_01580 35457 36224 gene locus_tag LOCUS_01590 gene lpxA 35457 36224 CDS product acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783787.1 protein_id gnl|my_center|LOCUS_01590 36409 36873 gene locus_tag LOCUS_01600 36409 36873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01600 38079 37138 gene locus_tag LOCUS_01610 gene mdh 38079 37138 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791692.1 protein_id gnl|my_center|LOCUS_01610 38352 41129 gene locus_tag LOCUS_01620 38352 41129 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202547.1 protein_id gnl|my_center|LOCUS_01620 41142 42767 gene locus_tag LOCUS_01630 41142 42767 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005794975.1 protein_id gnl|my_center|LOCUS_01630 44003 42819 gene locus_tag LOCUS_01640 44003 42819 CDS product class I SAM-dependent rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760004.1 protein_id gnl|my_center|LOCUS_01640 44585 44004 gene locus_tag LOCUS_01650 44585 44004 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760005.1 protein_id gnl|my_center|LOCUS_01650 45130 44582 gene locus_tag LOCUS_01660 45130 44582 CDS product DUF5063 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109201.1 protein_id gnl|my_center|LOCUS_01660 45342 46727 gene locus_tag LOCUS_01670 45342 46727 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009293026.1 protein_id gnl|my_center|LOCUS_01670 46749 48269 gene locus_tag LOCUS_01680 46749 48269 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765754.1 protein_id gnl|my_center|LOCUS_01680 48426 50954 gene locus_tag LOCUS_01690 48426 50954 CDS product DNA translocase FtsK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202242.1 protein_id gnl|my_center|LOCUS_01690 51044 51637 gene locus_tag LOCUS_01700 51044 51637 CDS product LolA-like putative outer membrane lipoprotein chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109203.1 protein_id gnl|my_center|LOCUS_01700 51675 52628 gene locus_tag LOCUS_01710 gene trxB 51675 52628 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785383.1 protein_id gnl|my_center|LOCUS_01710 52662 53477 gene locus_tag LOCUS_01720 52662 53477 CDS product glycerophosphodiester phosphodiesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788251.1 protein_id gnl|my_center|LOCUS_01720 53490 54977 gene locus_tag LOCUS_01730 53490 54977 CDS product family 10 glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107959.1 protein_id gnl|my_center|LOCUS_01730 55068 55451 gene locus_tag LOCUS_01740 55068 55451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01740 55563 57800 gene locus_tag LOCUS_01750 55563 57800 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787236.1 protein_id gnl|my_center|LOCUS_01750 57979 58314 gene locus_tag LOCUS_01760 57979 58314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01760 58483 59010 gene locus_tag LOCUS_01770 58483 59010 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786067.1 protein_id gnl|my_center|LOCUS_01770 59017 60285 gene locus_tag LOCUS_01780 59017 60285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01780 60342 61118 gene locus_tag LOCUS_01790 60342 61118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01790 61240 62001 gene locus_tag LOCUS_01800 61240 62001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01800 62055 62717 gene locus_tag LOCUS_01810 62055 62717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01810 62790 63356 gene locus_tag LOCUS_01820 62790 63356 CDS product Yip1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760494.1 protein_id gnl|my_center|LOCUS_01820 63371 63832 gene locus_tag LOCUS_01830 gene smpB 63371 63832 CDS product SsrA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005780358.1 protein_id gnl|my_center|LOCUS_01830 63839 64798 gene locus_tag LOCUS_01840 63839 64798 CDS product nucleoside recognition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389652.1 protein_id gnl|my_center|LOCUS_01840 64791 68483 gene locus_tag LOCUS_01850 64791 68483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01850 70185 68602 gene locus_tag LOCUS_01860 70185 68602 CDS product M81 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030661.1 protein_id gnl|my_center|LOCUS_01860 70440 71402 gene locus_tag LOCUS_01870 70440 71402 CDS product DUF3810 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109216.1 protein_id gnl|my_center|LOCUS_01870 71464 74886 gene locus_tag LOCUS_01880 gene ileS 71464 74886 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202809.1 protein_id gnl|my_center|LOCUS_01880 75055 75435 gene locus_tag LOCUS_01890 75055 75435 CDS product TraR/DksA C4-type zinc finger protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005931903.1 protein_id gnl|my_center|LOCUS_01890 75436 76053 gene locus_tag LOCUS_01900 75436 76053 CDS product lipoprotein signal peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765667.1 protein_id gnl|my_center|LOCUS_01900 76054 76839 gene locus_tag LOCUS_01910 76054 76839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01910 76912 77193 gene locus_tag LOCUS_01920 76912 77193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01920 77883 77116 gene locus_tag LOCUS_01930 77883 77116 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761499.1 protein_id gnl|my_center|LOCUS_01930 77960 80320 gene locus_tag LOCUS_01940 77960 80320 CDS product BamA/TamA family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202810.1 protein_id gnl|my_center|LOCUS_01940 80399 80473 gene locus_tag LOCUS_t00040 80399 80473 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 81018 85268 gene locus_tag LOCUS_01950 gene cas9 81018 85268 CDS product type II CRISPR RNA-guided endonuclease Cas9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963637.1 protein_id gnl|my_center|LOCUS_01950 85385 86314 gene locus_tag LOCUS_01960 gene cas1 85385 86314 CDS product type II CRISPR-associated endonuclease Cas1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963638.1 protein_id gnl|my_center|LOCUS_01960 86343 86648 gene locus_tag LOCUS_01970 gene cas2 86343 86648 CDS product CRISPR-associated endonuclease Cas2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963639.1 protein_id gnl|my_center|LOCUS_01970 86805 86904 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 89058 89402 gene locus_tag LOCUS_01980 gene trxA 89058 89402 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789105.1 protein_id gnl|my_center|LOCUS_01980 90982 89399 gene locus_tag LOCUS_01990 90982 89399 CDS product AbgT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202272.1 protein_id gnl|my_center|LOCUS_01990 92250 90979 gene locus_tag LOCUS_02000 gene rmuC 92250 90979 CDS product DNA recombination protein RmuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793488.1 protein_id gnl|my_center|LOCUS_02000 92415 92915 gene locus_tag LOCUS_02010 gene tpx 92415 92915 CDS product thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_165439256.1 protein_id gnl|my_center|LOCUS_02010 93690 93010 gene locus_tag LOCUS_02020 93690 93010 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761370.1 protein_id gnl|my_center|LOCUS_02020 96082 93740 gene locus_tag LOCUS_02030 96082 93740 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008659317.1 protein_id gnl|my_center|LOCUS_02030 96258 96782 gene locus_tag LOCUS_02040 96258 96782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02040 96779 97621 gene locus_tag LOCUS_02050 96779 97621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02050 97636 98943 gene locus_tag LOCUS_02060 97636 98943 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784716.1 protein_id gnl|my_center|LOCUS_02060 100789 99080 gene locus_tag LOCUS_02070 100789 99080 CDS product Acyl-CoA dehydrogenase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763249.1 protein_id gnl|my_center|LOCUS_02070 101811 100792 gene locus_tag LOCUS_02080 101811 100792 CDS product electron transfer flavoprotein subunit alpha/FixB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763251.1 protein_id gnl|my_center|LOCUS_02080 102721 101816 gene locus_tag LOCUS_02090 102721 101816 CDS product electron transfer flavoprotein subunit beta/FixA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789703.1 protein_id gnl|my_center|LOCUS_02090 108714 103090 gene locus_tag LOCUS_02100 108714 103090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02100 110671 109277 gene locus_tag LOCUS_02110 110671 109277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02110 111796 110708 gene locus_tag LOCUS_02120 111796 110708 CDS product FimB/Mfa2 family fimbrial subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763526.1 protein_id gnl|my_center|LOCUS_02120 113847 111898 gene locus_tag LOCUS_02130 113847 111898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02130 114497 114051 gene locus_tag LOCUS_02140 114497 114051 CDS product DsbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766754.1 protein_id gnl|my_center|LOCUS_02140 115935 114532 gene locus_tag LOCUS_02150 115935 114532 CDS product DUF3868 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764436.1 protein_id gnl|my_center|LOCUS_02150 116568 115996 gene locus_tag LOCUS_02160 116568 115996 CDS product DUF3575 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108436.1 protein_id gnl|my_center|LOCUS_02160 117718 116618 gene locus_tag LOCUS_02170 117718 116618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02170 119123 118170 gene locus_tag LOCUS_02180 119123 118170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02180 120603 119218 gene locus_tag LOCUS_02190 120603 119218 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202813.1 protein_id gnl|my_center|LOCUS_02190 121826 120717 gene locus_tag LOCUS_02200 121826 120717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02200 124675 121823 gene locus_tag LOCUS_02210 gene gcvP 124675 121823 CDS product aminomethyl-transferring glycine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765866.1 protein_id gnl|my_center|LOCUS_02210 125326 124688 gene locus_tag LOCUS_02220 125326 124688 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763490.1 protein_id gnl|my_center|LOCUS_02220 125985 125323 gene locus_tag LOCUS_02230 gene rsmG 125985 125323 CDS product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765865.1 protein_id gnl|my_center|LOCUS_02230 126856 126029 gene locus_tag LOCUS_02240 126856 126029 CDS product DUF3298 and DUF4163 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765864.1 protein_id gnl|my_center|LOCUS_02240 127508 127281 gene locus_tag LOCUS_02250 127508 127281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02250 127905 129719 gene locus_tag LOCUS_02260 127905 129719 CDS product glycoside hydrolase family 2 TIM barrel-domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784059.1 protein_id gnl|my_center|LOCUS_02260 129807 130310 gene locus_tag LOCUS_02270 129807 130310 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095190.1 protein_id gnl|my_center|LOCUS_02270 130377 130982 gene locus_tag LOCUS_02280 130377 130982 CDS product DUF4290 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790584.1 protein_id gnl|my_center|LOCUS_02280 130979 132283 gene locus_tag LOCUS_02290 gene murA 130979 132283 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108085.1 protein_id gnl|my_center|LOCUS_02290 132296 132829 gene locus_tag LOCUS_02300 gene rimM 132296 132829 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008657443.1 protein_id gnl|my_center|LOCUS_02300 132847 133710 gene locus_tag LOCUS_02310 132847 133710 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108084.1 protein_id gnl|my_center|LOCUS_02310 133717 134868 gene locus_tag LOCUS_02320 133717 134868 CDS product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766370.1 protein_id gnl|my_center|LOCUS_02320 134899 136227 gene locus_tag LOCUS_02330 gene rseP 134899 136227 CDS product RIP metalloprotease RseP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203410.1 protein_id gnl|my_center|LOCUS_02330 137061 136318 gene locus_tag LOCUS_02340 137061 136318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02340 138311 137217 gene locus_tag LOCUS_02350 gene ald 138311 137217 CDS product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795308.1 protein_id gnl|my_center|LOCUS_02350 141788 138408 gene locus_tag LOCUS_02360 gene secA 141788 138408 CDS product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202248.1 protein_id gnl|my_center|LOCUS_02360 143543 141954 gene locus_tag LOCUS_02370 143543 141954 CDS product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785445.1 protein_id gnl|my_center|LOCUS_02370 144727 143540 gene locus_tag LOCUS_02380 144727 143540 CDS product DUF4105 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764530.1 protein_id gnl|my_center|LOCUS_02380 145505 144738 gene locus_tag LOCUS_02390 gene argB 145505 144738 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783875.1 protein_id gnl|my_center|LOCUS_02390 145583 145656 gene locus_tag LOCUS_t00050 145583 145656 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 146018 145740 gene locus_tag LOCUS_02400 146018 145740 CDS product type II toxin-antitoxin system YafQ family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002360769.1 protein_id gnl|my_center|LOCUS_02400 146257 146015 gene locus_tag LOCUS_02410 146257 146015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02410 147511 147335 gene locus_tag LOCUS_02420 147511 147335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02420 >Feature sequence003 1057 212 gene locus_tag LOCUS_02430 1057 212 CDS product RteC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107118.1 protein_id gnl|my_center|LOCUS_02430 1695 1060 gene locus_tag LOCUS_02440 1695 1060 CDS product CatB-related O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108273.1 protein_id gnl|my_center|LOCUS_02440 2997 1708 gene locus_tag LOCUS_02450 2997 1708 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108042.1 protein_id gnl|my_center|LOCUS_02450 4126 3278 gene locus_tag LOCUS_02460 4126 3278 CDS product RteC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107118.1 protein_id gnl|my_center|LOCUS_02460 4718 4155 gene locus_tag LOCUS_02470 4718 4155 CDS product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966613.1 protein_id gnl|my_center|LOCUS_02470 5683 4721 gene locus_tag LOCUS_02480 5683 4721 CDS product arginase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705488.1 protein_id gnl|my_center|LOCUS_02480 5867 6217 gene locus_tag LOCUS_02490 5867 6217 CDS product winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245808.1 protein_id gnl|my_center|LOCUS_02490 6637 6861 gene locus_tag LOCUS_02500 6637 6861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02500 7346 7044 gene locus_tag LOCUS_02510 7346 7044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02510 8520 7501 gene locus_tag LOCUS_02520 gene pheS 8520 7501 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763378.1 protein_id gnl|my_center|LOCUS_02520 8740 9963 gene locus_tag LOCUS_02530 8740 9963 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963488.1 protein_id gnl|my_center|LOCUS_02530 10695 9973 gene locus_tag LOCUS_02540 10695 9973 CDS product porin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761413.1 protein_id gnl|my_center|LOCUS_02540 11266 10700 gene locus_tag LOCUS_02550 11266 10700 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005803433.1 protein_id gnl|my_center|LOCUS_02550 11822 11358 gene locus_tag LOCUS_02560 gene pyrI 11822 11358 CDS product aspartate carbamoyltransferase regulatory subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787546.1 protein_id gnl|my_center|LOCUS_02560 12755 11835 gene locus_tag LOCUS_02570 gene pyrB 12755 11835 CDS product aspartate carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787548.1 protein_id gnl|my_center|LOCUS_02570 14530 12830 gene locus_tag LOCUS_02580 14530 12830 CDS product alkaline phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_074555177.1 protein_id gnl|my_center|LOCUS_02580 15752 14574 gene locus_tag LOCUS_02590 15752 14574 CDS product Xaa-Pro peptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790476.1 protein_id gnl|my_center|LOCUS_02590 16531 16082 gene locus_tag LOCUS_02600 16531 16082 CDS product YhcH/YjgK/YiaL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761472.1 protein_id gnl|my_center|LOCUS_02600 16747 18960 gene locus_tag LOCUS_02610 16747 18960 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787240.1 protein_id gnl|my_center|LOCUS_02610 18976 19182 gene locus_tag LOCUS_02620 18976 19182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02620 19200 19850 gene locus_tag LOCUS_02630 19200 19850 CDS product hemolysin III family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817347.1 protein_id gnl|my_center|LOCUS_02630 21250 19931 gene locus_tag LOCUS_02640 21250 19931 CDS product TldD/PmbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762594.1 protein_id gnl|my_center|LOCUS_02640 22784 21252 gene locus_tag LOCUS_02650 22784 21252 CDS product TldD/PmbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767052.1 protein_id gnl|my_center|LOCUS_02650 24015 22774 gene locus_tag LOCUS_02660 24015 22774 CDS product anaerobic sulfatase-maturation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789094.1 protein_id gnl|my_center|LOCUS_02660 25806 24040 gene locus_tag LOCUS_02670 25806 24040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02670 27461 25905 gene locus_tag LOCUS_02680 27461 25905 CDS product DUF4435 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208070.1 protein_id gnl|my_center|LOCUS_02680 27812 27600 gene locus_tag LOCUS_02690 27812 27600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02690 29460 27973 gene locus_tag LOCUS_02700 29460 27973 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108360.1 protein_id gnl|my_center|LOCUS_02700 29658 30404 gene locus_tag LOCUS_02710 29658 30404 CDS product potassium channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784407.1 protein_id gnl|my_center|LOCUS_02710 30561 33416 gene locus_tag LOCUS_02720 gene uvrA 30561 33416 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032813763.1 protein_id gnl|my_center|LOCUS_02720 33413 33634 gene locus_tag LOCUS_02730 33413 33634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02730 33638 34237 gene locus_tag LOCUS_02740 33638 34237 CDS product YigZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005794496.1 protein_id gnl|my_center|LOCUS_02740 34345 35553 gene locus_tag LOCUS_02750 34345 35553 CDS product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788087.1 protein_id gnl|my_center|LOCUS_02750 35667 37028 gene locus_tag LOCUS_02760 gene nhaA 35667 37028 CDS product Na+/H+ antiporter NhaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788084.1 protein_id gnl|my_center|LOCUS_02760 37392 37141 gene locus_tag LOCUS_02770 37392 37141 CDS product GlsB/YeaQ/YmgE family stress response membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764857.1 protein_id gnl|my_center|LOCUS_02770 39256 37490 gene locus_tag LOCUS_02780 gene malL 39256 37490 CDS product oligo-1,6-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000415207.1 protein_id gnl|my_center|LOCUS_02780 39362 40810 gene locus_tag LOCUS_02790 39362 40810 CDS product alpha-amylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109383.1 protein_id gnl|my_center|LOCUS_02790 43116 40819 gene locus_tag LOCUS_02800 gene pbpC 43116 40819 CDS product penicillin-binding protein 1C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010992445.1 protein_id gnl|my_center|LOCUS_02800 43774 43337 gene locus_tag LOCUS_02810 43774 43337 CDS product DUF6078 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760904.1 protein_id gnl|my_center|LOCUS_02810 43922 49462 gene locus_tag LOCUS_02820 43922 49462 CDS product MG2 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202408.1 protein_id gnl|my_center|LOCUS_02820 49675 50046 gene locus_tag LOCUS_02830 49675 50046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02830 51001 50075 gene locus_tag LOCUS_02840 51001 50075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02840 51233 53452 gene locus_tag LOCUS_02850 51233 53452 CDS product outer membrane beta-barrel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784143.1 protein_id gnl|my_center|LOCUS_02850 53828 53598 gene locus_tag LOCUS_02860 53828 53598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02860 53958 56300 gene locus_tag LOCUS_02870 53958 56300 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107378.1 protein_id gnl|my_center|LOCUS_02870 56712 57851 gene locus_tag LOCUS_02880 gene nspC 56712 57851 CDS product carboxynorspermidine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107393.1 protein_id gnl|my_center|LOCUS_02880 57871 58824 gene locus_tag LOCUS_02890 gene ftsY 57871 58824 CDS product signal recognition particle-docking protein FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787934.1 protein_id gnl|my_center|LOCUS_02890 58821 60119 gene locus_tag LOCUS_02900 gene rimO 58821 60119 CDS product 30S ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765734.1 protein_id gnl|my_center|LOCUS_02900 60185 60487 gene locus_tag LOCUS_02910 60185 60487 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761575.1 protein_id gnl|my_center|LOCUS_02910 60480 61571 gene locus_tag LOCUS_02920 60480 61571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02920 61740 62735 gene locus_tag LOCUS_02930 61740 62735 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761573.1 protein_id gnl|my_center|LOCUS_02930 62736 63605 gene locus_tag LOCUS_02940 62736 63605 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793731.1 protein_id gnl|my_center|LOCUS_02940 63615 64589 gene locus_tag LOCUS_02950 63615 64589 CDS product BatD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107515.1 protein_id gnl|my_center|LOCUS_02950 64593 65579 gene locus_tag LOCUS_02960 64593 65579 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787921.1 protein_id gnl|my_center|LOCUS_02960 65593 67317 gene locus_tag LOCUS_02970 65593 67317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02970 67350 69161 gene locus_tag LOCUS_02980 67350 69161 CDS product BatD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025814212.1 protein_id gnl|my_center|LOCUS_02980 69166 69933 gene locus_tag LOCUS_02990 69166 69933 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765730.1 protein_id gnl|my_center|LOCUS_02990 69937 70629 gene locus_tag LOCUS_03000 69937 70629 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789818.1 protein_id gnl|my_center|LOCUS_03000 70769 71041 gene locus_tag LOCUS_03010 70769 71041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761566.1 protein_id gnl|my_center|LOCUS_03010 71156 72274 gene locus_tag LOCUS_03020 71156 72274 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765729.1 protein_id gnl|my_center|LOCUS_03020 72482 73015 gene locus_tag LOCUS_03030 72482 73015 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002117778.1 protein_id gnl|my_center|LOCUS_03030 73114 74562 gene locus_tag LOCUS_03040 73114 74562 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203597.1 protein_id gnl|my_center|LOCUS_03040 74585 75865 gene locus_tag LOCUS_03050 74585 75865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03050 75875 77395 gene locus_tag LOCUS_03060 75875 77395 CDS product MBOAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765451.1 protein_id gnl|my_center|LOCUS_03060 78405 77497 gene locus_tag LOCUS_03070 78405 77497 CDS product WYL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797826.1 protein_id gnl|my_center|LOCUS_03070 78858 80621 gene locus_tag LOCUS_03080 78858 80621 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764485.1 protein_id gnl|my_center|LOCUS_03080 81092 80730 gene locus_tag LOCUS_03090 81092 80730 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786310.1 protein_id gnl|my_center|LOCUS_03090 81403 81104 gene locus_tag LOCUS_03100 81403 81104 CDS product type II toxin-antitoxin system HigB family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203578.1 protein_id gnl|my_center|LOCUS_03100 81704 82234 gene locus_tag LOCUS_03110 81704 82234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03110 83223 83372 gene locus_tag LOCUS_03120 83223 83372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03120 83344 83487 gene locus_tag LOCUS_03130 83344 83487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03130 83492 84919 gene locus_tag LOCUS_03140 83492 84919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03140 84933 86048 gene locus_tag LOCUS_03150 84933 86048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03150 86449 87192 gene locus_tag LOCUS_03160 86449 87192 CDS product DUF3944 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000323695.1 protein_id gnl|my_center|LOCUS_03160 87199 88002 gene locus_tag LOCUS_03170 87199 88002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03170 88010 88876 gene locus_tag LOCUS_03180 88010 88876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03180 88986 89195 gene locus_tag LOCUS_03190 88986 89195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03190 89554 89363 gene locus_tag LOCUS_03200 89554 89363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03200 89897 89592 gene locus_tag LOCUS_03210 89897 89592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03210 90106 89867 gene locus_tag LOCUS_03220 90106 89867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03220 91355 90129 gene locus_tag LOCUS_03230 91355 90129 CDS product mechanosensitive ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760938.1 protein_id gnl|my_center|LOCUS_03230 92573 91425 gene locus_tag LOCUS_03240 92573 91425 CDS product mechanosensitive ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789244.1 protein_id gnl|my_center|LOCUS_03240 92737 95586 gene locus_tag LOCUS_03250 92737 95586 CDS product insulinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927048.1 protein_id gnl|my_center|LOCUS_03250 95586 96041 gene locus_tag LOCUS_03260 95586 96041 CDS product DUF4268 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964040.1 protein_id gnl|my_center|LOCUS_03260 96051 98579 gene locus_tag LOCUS_03270 96051 98579 CDS product M1 family aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202101.1 protein_id gnl|my_center|LOCUS_03270 98634 98798 gene locus_tag LOCUS_03280 98634 98798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03280 99043 99894 gene locus_tag LOCUS_03290 gene hisG 99043 99894 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789131.1 protein_id gnl|my_center|LOCUS_03290 99896 101176 gene locus_tag LOCUS_03300 gene hisD 99896 101176 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766232.1 protein_id gnl|my_center|LOCUS_03300 101173 102210 gene locus_tag LOCUS_03310 gene hisC 101173 102210 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766231.1 protein_id gnl|my_center|LOCUS_03310 102207 103343 gene locus_tag LOCUS_03320 gene hisB 102207 103343 CDS product bifunctional histidinol-phosphatase/imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766230.1 protein_id gnl|my_center|LOCUS_03320 104421 103474 gene locus_tag LOCUS_03330 gene cysK 104421 103474 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203747.1 protein_id gnl|my_center|LOCUS_03330 104531 107941 gene locus_tag LOCUS_03340 104531 107941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03340 109182 107998 gene locus_tag LOCUS_03350 109182 107998 CDS product dicarboxylate/amino acid:cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948034.1 protein_id gnl|my_center|LOCUS_03350 109306 109989 gene locus_tag LOCUS_03360 109306 109989 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203544.1 protein_id gnl|my_center|LOCUS_03360 109994 112510 gene locus_tag LOCUS_03370 109994 112510 CDS product DUF4965 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767695.1 protein_id gnl|my_center|LOCUS_03370 113439 112552 gene locus_tag LOCUS_03380 113439 112552 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203645.1 protein_id gnl|my_center|LOCUS_03380 114372 113455 gene locus_tag LOCUS_03390 114372 113455 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765597.1 protein_id gnl|my_center|LOCUS_03390 >Feature sequence004 1723 509 gene locus_tag LOCUS_03400 1723 509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03400 2710 1724 gene locus_tag LOCUS_03410 2710 1724 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784336.1 protein_id gnl|my_center|LOCUS_03410 3631 2753 gene locus_tag LOCUS_03420 3631 2753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03420 4156 3725 gene locus_tag LOCUS_03430 4156 3725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03430 6016 4247 gene locus_tag LOCUS_03440 6016 4247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767452.1 protein_id gnl|my_center|LOCUS_03440 6578 7954 gene locus_tag LOCUS_03450 6578 7954 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108266.1 protein_id gnl|my_center|LOCUS_03450 9667 8000 gene locus_tag LOCUS_03460 9667 8000 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005794975.1 protein_id gnl|my_center|LOCUS_03460 12698 9684 gene locus_tag LOCUS_03470 12698 9684 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202547.1 protein_id gnl|my_center|LOCUS_03470 12912 13523 gene locus_tag LOCUS_03480 12912 13523 CDS product RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784829.1 protein_id gnl|my_center|LOCUS_03480 13547 14548 gene locus_tag LOCUS_03490 13547 14548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03490 14545 16293 gene locus_tag LOCUS_03500 14545 16293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03500 16310 19498 gene locus_tag LOCUS_03510 16310 19498 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767240.1 protein_id gnl|my_center|LOCUS_03510 19610 21181 gene locus_tag LOCUS_03520 gene nadB 19610 21181 CDS product L-aspartate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108697.1 protein_id gnl|my_center|LOCUS_03520 21835 21257 gene locus_tag LOCUS_03530 21835 21257 CDS product rubrerythrin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762794.1 protein_id gnl|my_center|LOCUS_03530 22125 23804 gene locus_tag LOCUS_03540 gene sulP 22125 23804 CDS product sulfate permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797091.1 protein_id gnl|my_center|LOCUS_03540 25303 23858 gene locus_tag LOCUS_03550 25303 23858 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008659530.1 protein_id gnl|my_center|LOCUS_03550 25572 25408 gene locus_tag LOCUS_03560 25572 25408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03560 26188 25640 gene locus_tag LOCUS_03570 26188 25640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03570 27084 26209 gene locus_tag LOCUS_03580 27084 26209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03580 27441 27097 gene locus_tag LOCUS_03590 27441 27097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03590 29312 27615 gene locus_tag LOCUS_03600 29312 27615 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108833.1 protein_id gnl|my_center|LOCUS_03600 29818 30924 gene locus_tag LOCUS_03610 29818 30924 CDS product heparan-alpha-glucosaminide N-acetyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201990.1 protein_id gnl|my_center|LOCUS_03610 34632 31009 gene locus_tag LOCUS_03620 34632 31009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03620 35444 34665 gene locus_tag LOCUS_03630 35444 34665 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108683.1 protein_id gnl|my_center|LOCUS_03630 37448 35478 gene locus_tag LOCUS_03640 37448 35478 CDS product helix-hairpin-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797103.1 protein_id gnl|my_center|LOCUS_03640 38361 37552 gene locus_tag LOCUS_03650 38361 37552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03650 39210 38383 gene locus_tag LOCUS_03660 gene dinD 39210 38383 CDS product DNA damage-inducible protein D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962420.1 protein_id gnl|my_center|LOCUS_03660 39390 39935 gene locus_tag LOCUS_03670 39390 39935 CDS product DUF4294 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048698124.1 protein_id gnl|my_center|LOCUS_03670 40457 39927 gene locus_tag LOCUS_03680 40457 39927 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762785.1 protein_id gnl|my_center|LOCUS_03680 41154 42140 gene locus_tag LOCUS_03690 gene nadA 41154 42140 CDS product quinolinate synthase NadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005802044.1 protein_id gnl|my_center|LOCUS_03690 42718 45120 gene locus_tag LOCUS_03700 42718 45120 CDS product outer membrane beta-barrel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918700.1 protein_id gnl|my_center|LOCUS_03700 47518 45194 gene locus_tag LOCUS_03710 47518 45194 CDS product two-component regulator propeller domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962444.1 protein_id gnl|my_center|LOCUS_03710 48108 47524 gene locus_tag LOCUS_03720 48108 47524 CDS product non-canonical purine NTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108650.1 protein_id gnl|my_center|LOCUS_03720 48168 49283 gene locus_tag LOCUS_03730 48168 49283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03730 49280 50020 gene locus_tag LOCUS_03740 49280 50020 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_089713553.1 protein_id gnl|my_center|LOCUS_03740 50960 50082 gene locus_tag LOCUS_03750 50960 50082 CDS product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769516.1 protein_id gnl|my_center|LOCUS_03750 53797 50957 gene locus_tag LOCUS_03760 gene leuS 53797 50957 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108648.1 protein_id gnl|my_center|LOCUS_03760 54444 53887 gene locus_tag LOCUS_03770 54444 53887 CDS product ORF6N domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005806119.1 protein_id gnl|my_center|LOCUS_03770 55032 54469 gene locus_tag LOCUS_03780 55032 54469 CDS product ORF6N domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203655.1 protein_id gnl|my_center|LOCUS_03780 55439 57148 gene locus_tag LOCUS_03790 55439 57148 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108833.1 protein_id gnl|my_center|LOCUS_03790 57345 57713 gene locus_tag LOCUS_03800 57345 57713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03800 57699 57708 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 57710 59305 gene locus_tag LOCUS_03810 57710 59305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109284.1 protein_id gnl|my_center|LOCUS_03810 59445 59990 gene locus_tag LOCUS_03820 59445 59990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03820 59674 59683 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 60109 61005 gene locus_tag LOCUS_03830 60109 61005 CDS product Rpn family recombination-promoting nuclease/putative transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203118.1 protein_id gnl|my_center|LOCUS_03830 61059 62336 gene locus_tag LOCUS_03840 gene dcm 61059 62336 CDS product DNA (cytosine-5-)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963014.1 protein_id gnl|my_center|LOCUS_03840 62753 62436 gene locus_tag LOCUS_03850 62753 62436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03850 63518 66130 gene locus_tag LOCUS_03860 gene mutS 63518 66130 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203750.1 protein_id gnl|my_center|LOCUS_03860 66655 66179 gene locus_tag LOCUS_03870 66655 66179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03870 67040 66648 gene locus_tag LOCUS_03880 67040 66648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03880 67545 67033 gene locus_tag LOCUS_03890 67545 67033 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785783.1 protein_id gnl|my_center|LOCUS_03890 68012 67557 gene locus_tag LOCUS_03900 68012 67557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03900 69103 68183 gene locus_tag LOCUS_03910 69103 68183 CDS product TolB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037396629.1 protein_id gnl|my_center|LOCUS_03910 70296 69193 gene locus_tag LOCUS_03920 gene ychF 70296 69193 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108642.1 protein_id gnl|my_center|LOCUS_03920 73473 70708 gene locus_tag LOCUS_03930 gene polA 73473 70708 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796991.1 protein_id gnl|my_center|LOCUS_03930 73575 74549 gene locus_tag LOCUS_03940 73575 74549 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796989.1 protein_id gnl|my_center|LOCUS_03940 74797 75006 gene locus_tag LOCUS_03950 74797 75006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03950 76370 75114 gene locus_tag LOCUS_03960 76370 75114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03960 77023 76367 gene locus_tag LOCUS_03970 77023 76367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03970 78448 77513 gene locus_tag LOCUS_03980 gene deoC 78448 77513 CDS product deoxyribose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201863.1 protein_id gnl|my_center|LOCUS_03980 78785 78453 gene locus_tag LOCUS_03990 78785 78453 CDS product nucleotide pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762871.1 protein_id gnl|my_center|LOCUS_03990 79240 78788 gene locus_tag LOCUS_04000 gene dtd 79240 78788 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108726.1 protein_id gnl|my_center|LOCUS_04000 81093 79258 gene locus_tag LOCUS_04010 gene uvrC 81093 79258 CDS product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108727.1 protein_id gnl|my_center|LOCUS_04010 82763 81090 gene locus_tag LOCUS_04020 gene ade 82763 81090 CDS product adenine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022289.1 protein_id gnl|my_center|LOCUS_04020 84649 82772 gene locus_tag LOCUS_04030 gene mnmG 84649 82772 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783704.1 protein_id gnl|my_center|LOCUS_04030 84768 85916 gene locus_tag LOCUS_04040 84768 85916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04040 86062 86700 gene locus_tag LOCUS_04050 86062 86700 CDS product porin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790695.1 protein_id gnl|my_center|LOCUS_04050 87304 86873 gene locus_tag LOCUS_04060 gene ybeY 87304 86873 CDS product rRNA maturation RNase YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783716.1 protein_id gnl|my_center|LOCUS_04060 88624 87395 gene locus_tag LOCUS_04070 88624 87395 CDS product nucleoside recognition domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783728.1 protein_id gnl|my_center|LOCUS_04070 88709 89668 gene locus_tag LOCUS_04080 88709 89668 CDS product 2-hydroxyacid dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817430.1 protein_id gnl|my_center|LOCUS_04080 89665 90372 gene locus_tag LOCUS_04090 89665 90372 CDS product DNA alkylation repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783729.1 protein_id gnl|my_center|LOCUS_04090 90374 91120 gene locus_tag LOCUS_04100 90374 91120 CDS product TIGR02757 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793718.1 protein_id gnl|my_center|LOCUS_04100 91127 91729 gene locus_tag LOCUS_04110 91127 91729 CDS product TIGR00730 family Rossman fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005802006.1 protein_id gnl|my_center|LOCUS_04110 91739 92581 gene locus_tag LOCUS_04120 91739 92581 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582683.1 protein_id gnl|my_center|LOCUS_04120 92814 92590 gene locus_tag LOCUS_04130 92814 92590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04130 94477 93287 gene locus_tag LOCUS_04140 94477 93287 CDS product cyclically-permuted mutarotase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202544.1 protein_id gnl|my_center|LOCUS_04140 96508 94481 gene locus_tag LOCUS_04150 96508 94481 CDS product GDSL-type esterase/lipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202541.1 protein_id gnl|my_center|LOCUS_04150 98425 96578 gene locus_tag LOCUS_04160 98425 96578 CDS product family 20 glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202540.1 protein_id gnl|my_center|LOCUS_04160 100294 98606 gene locus_tag LOCUS_04170 100294 98606 CDS product exo-alpha-sialidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766031.1 protein_id gnl|my_center|LOCUS_04170 101940 100369 gene locus_tag LOCUS_04180 gene nanU 101940 100369 CDS product SusD family outer membrane lipoprotein NanU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795011.1 protein_id gnl|my_center|LOCUS_04180 105244 101969 gene locus_tag LOCUS_04190 105244 101969 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817018.1 protein_id gnl|my_center|LOCUS_04190 106386 105292 gene locus_tag LOCUS_04200 106386 105292 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793004.1 protein_id gnl|my_center|LOCUS_04200 106544 107752 gene locus_tag LOCUS_04210 106544 107752 CDS product ROK family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786608.1 protein_id gnl|my_center|LOCUS_04210 107894 108811 gene locus_tag LOCUS_04220 107894 108811 CDS product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786611.1 protein_id gnl|my_center|LOCUS_04220 108815 110017 gene locus_tag LOCUS_04230 108815 110017 CDS product AGE family epimerase/isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202525.1 protein_id gnl|my_center|LOCUS_04230 110120 110314 gene locus_tag LOCUS_04240 110120 110314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04240 111581 110286 gene locus_tag LOCUS_04250 111581 110286 CDS product HlyD family efflux transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203561.1 protein_id gnl|my_center|LOCUS_04250 <113029 111603 gene locus_tag LOCUS_04260 <113029 111603 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005791796.1:peptidase domain-containing ABC transporter >Feature sequence005 2447 81 gene locus_tag LOCUS_04270 2447 81 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202844.1 protein_id gnl|my_center|LOCUS_04270 2601 4010 gene locus_tag LOCUS_04280 2601 4010 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793798.1 protein_id gnl|my_center|LOCUS_04280 4007 5275 gene locus_tag LOCUS_04290 4007 5275 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787744.1 protein_id gnl|my_center|LOCUS_04290 5527 7365 gene locus_tag LOCUS_04300 gene glaB 5527 7365 CDS product alpha-1,3-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202199.1 protein_id gnl|my_center|LOCUS_04300 7478 8140 gene locus_tag LOCUS_04310 7478 8140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04310 9687 8170 gene locus_tag LOCUS_04320 9687 8170 CDS product GH3 auxin-responsive promoter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783832.1 protein_id gnl|my_center|LOCUS_04320 9768 10781 gene locus_tag LOCUS_04330 9768 10781 CDS product ATP-dependent 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201892.1 protein_id gnl|my_center|LOCUS_04330 13272 10846 gene locus_tag LOCUS_04340 13272 10846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04340 14293 13523 gene locus_tag LOCUS_04350 gene rnc 14293 13523 CDS product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108787.1 protein_id gnl|my_center|LOCUS_04350 15632 14367 gene locus_tag LOCUS_04360 gene fabF 15632 14367 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201893.1 protein_id gnl|my_center|LOCUS_04360 15890 15654 gene locus_tag LOCUS_04370 15890 15654 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004291965.1 protein_id gnl|my_center|LOCUS_04370 16045 16605 gene locus_tag LOCUS_04380 gene purN 16045 16605 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108788.1 protein_id gnl|my_center|LOCUS_04380 17728 16619 gene locus_tag LOCUS_04390 gene pdxB 17728 16619 CDS product 4-phosphoerythronate dehydrogenase PdxB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108789.1 protein_id gnl|my_center|LOCUS_04390 19243 18044 gene locus_tag LOCUS_04400 19243 18044 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769619.1 protein_id gnl|my_center|LOCUS_04400 21840 19315 gene locus_tag LOCUS_04410 21840 19315 CDS product carboxypeptidase-like regulatory domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962441.1 protein_id gnl|my_center|LOCUS_04410 22319 21837 gene locus_tag LOCUS_04420 22319 21837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04420 22378 23607 gene locus_tag LOCUS_04430 22378 23607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04430 23604 24287 gene locus_tag LOCUS_04440 gene mtrA 23604 24287 CDS product MtrAB system response regulator MtrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929974.1 protein_id gnl|my_center|LOCUS_04440 24372 24977 gene locus_tag LOCUS_04450 24372 24977 CDS product DUF4254 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964557.1 protein_id gnl|my_center|LOCUS_04450 24977 26032 gene locus_tag LOCUS_04460 24977 26032 CDS product glycosyltransferase family 9 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108790.1 protein_id gnl|my_center|LOCUS_04460 26016 26750 gene locus_tag LOCUS_04470 26016 26750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108792.1 protein_id gnl|my_center|LOCUS_04470 26757 27620 gene locus_tag LOCUS_04480 26757 27620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04480 28661 27660 gene locus_tag LOCUS_04490 28661 27660 CDS product glycosyl transferase family 90 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108791.1 protein_id gnl|my_center|LOCUS_04490 29790 28663 gene locus_tag LOCUS_04500 29790 28663 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963743.1 protein_id gnl|my_center|LOCUS_04500 30087 29800 gene locus_tag LOCUS_04510 30087 29800 CDS product type II toxin-antitoxin system YafQ family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002360769.1 protein_id gnl|my_center|LOCUS_04510 30341 30084 gene locus_tag LOCUS_04520 30341 30084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04520 31035 30400 gene locus_tag LOCUS_04530 31035 30400 CDS product ribonuclease H family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108811.1 protein_id gnl|my_center|LOCUS_04530 31819 31022 gene locus_tag LOCUS_04540 31819 31022 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767591.1 protein_id gnl|my_center|LOCUS_04540 32545 31829 gene locus_tag LOCUS_04550 32545 31829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04550 33732 32551 gene locus_tag LOCUS_04560 33732 32551 CDS product glycosyltransferase family 87 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963747.1 protein_id gnl|my_center|LOCUS_04560 33838 35508 gene locus_tag LOCUS_04570 33838 35508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108614.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04570 35534 35899 gene locus_tag LOCUS_04580 35534 35899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04580 35980 36501 gene locus_tag LOCUS_04590 35980 36501 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783866.1 protein_id gnl|my_center|LOCUS_04590 36505 37716 gene locus_tag LOCUS_04600 36505 37716 CDS product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963213.1 protein_id gnl|my_center|LOCUS_04600 37808 39655 gene locus_tag LOCUS_04610 37808 39655 CDS product 2-oxoacid:acceptor oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791976.1 protein_id gnl|my_center|LOCUS_04610 39679 40686 gene locus_tag LOCUS_04620 39679 40686 CDS product 2-oxoacid:ferredoxin oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108506.1 protein_id gnl|my_center|LOCUS_04620 40999 42606 gene locus_tag LOCUS_04630 gene pckA 40999 42606 CDS product phosphoenolpyruvate carboxykinase (ATP) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791971.1 protein_id gnl|my_center|LOCUS_04630 42796 43896 gene locus_tag LOCUS_04640 42796 43896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04640 43957 45495 gene locus_tag LOCUS_04650 43957 45495 CDS product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008661626.1 protein_id gnl|my_center|LOCUS_04650 46481 45504 gene locus_tag LOCUS_04660 46481 45504 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_022470046.1 protein_id gnl|my_center|LOCUS_04660 47250 48023 gene locus_tag LOCUS_04670 47250 48023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04670 48037 49341 gene locus_tag LOCUS_04680 48037 49341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04680 49353 51146 gene locus_tag LOCUS_04690 49353 51146 CDS product DUF4493 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203376.1 protein_id gnl|my_center|LOCUS_04690 51343 51486 gene locus_tag LOCUS_04700 51343 51486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04700 51500 52291 gene locus_tag LOCUS_04710 51500 52291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005781085.1 protein_id gnl|my_center|LOCUS_04710 52340 53965 gene locus_tag LOCUS_04720 52340 53965 CDS product PCMD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790465.1 protein_id gnl|my_center|LOCUS_04720 53989 55809 gene locus_tag LOCUS_04730 53989 55809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04730 55824 56684 gene locus_tag LOCUS_04740 55824 56684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04740 56885 58606 gene locus_tag LOCUS_04750 56885 58606 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764603.1 protein_id gnl|my_center|LOCUS_04750 58673 60019 gene locus_tag LOCUS_04760 58673 60019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04760 60667 60479 gene locus_tag LOCUS_04770 60667 60479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04770 60772 62811 gene locus_tag LOCUS_04780 gene metG 60772 62811 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791925.1 protein_id gnl|my_center|LOCUS_04780 62822 63952 gene locus_tag LOCUS_04790 62822 63952 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962574.1 protein_id gnl|my_center|LOCUS_04790 63949 64968 gene locus_tag LOCUS_04800 63949 64968 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272541.1 protein_id gnl|my_center|LOCUS_04800 66070 64937 gene locus_tag LOCUS_04810 66070 64937 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771113.1 protein_id gnl|my_center|LOCUS_04810 66930 67856 gene locus_tag LOCUS_04820 66930 67856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04820 68025 68843 gene locus_tag LOCUS_04830 68025 68843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04830 68845 70299 gene locus_tag LOCUS_04840 68845 70299 CDS product lipopolysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814097.1 protein_id gnl|my_center|LOCUS_04840 70313 71416 gene locus_tag LOCUS_04850 70313 71416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04850 71577 72503 gene locus_tag LOCUS_04860 71577 72503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04860 72576 73682 gene locus_tag LOCUS_04870 72576 73682 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202936.1 protein_id gnl|my_center|LOCUS_04870 73663 74232 gene locus_tag LOCUS_04880 73663 74232 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001084193.1 protein_id gnl|my_center|LOCUS_04880 74235 75182 gene locus_tag LOCUS_04890 74235 75182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04890 75179 75967 gene locus_tag LOCUS_04900 75179 75967 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546270.1 protein_id gnl|my_center|LOCUS_04900 76077 77342 gene locus_tag LOCUS_04910 76077 77342 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203722.1 protein_id gnl|my_center|LOCUS_04910 77437 79293 gene locus_tag LOCUS_04920 77437 79293 CDS product putative DNA binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109168.1 protein_id gnl|my_center|LOCUS_04920 79290 80051 gene locus_tag LOCUS_04930 79290 80051 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203723.1 protein_id gnl|my_center|LOCUS_04930 80087 82579 gene locus_tag LOCUS_04940 80087 82579 CDS product YfhO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108484.1 protein_id gnl|my_center|LOCUS_04940 83814 82687 gene locus_tag LOCUS_04950 83814 82687 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405119.1 protein_id gnl|my_center|LOCUS_04950 85335 83917 gene locus_tag LOCUS_04960 gene ahcY 85335 83917 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932403.1 protein_id gnl|my_center|LOCUS_04960 87163 85514 gene locus_tag LOCUS_04970 87163 85514 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203709.1 protein_id gnl|my_center|LOCUS_04970 87757 87176 gene locus_tag LOCUS_04980 87757 87176 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761981.1 protein_id gnl|my_center|LOCUS_04980 88186 87917 gene locus_tag LOCUS_04990 gene rpsO 88186 87917 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791955.1 protein_id gnl|my_center|LOCUS_04990 88357 90156 gene locus_tag LOCUS_05000 gene typA 88357 90156 CDS product translational GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791956.1 protein_id gnl|my_center|LOCUS_05000 90877 90371 gene locus_tag LOCUS_05010 90877 90371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05010 91280 91035 gene locus_tag LOCUS_05020 91280 91035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05020 91584 91303 gene locus_tag LOCUS_05030 91584 91303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05030 93457 91766 gene locus_tag LOCUS_05040 93457 91766 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791939.1 protein_id gnl|my_center|LOCUS_05040 95840 93723 gene locus_tag LOCUS_05050 95840 93723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05050 96128 97726 gene locus_tag LOCUS_05060 96128 97726 CDS product fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759583.1 protein_id gnl|my_center|LOCUS_05060 98875 97817 gene locus_tag LOCUS_05070 98875 97817 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763756.1 protein_id gnl|my_center|LOCUS_05070 99261 101000 gene locus_tag LOCUS_05080 99261 101000 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042366928.1 protein_id gnl|my_center|LOCUS_05080 101159 101449 gene locus_tag LOCUS_05090 101159 101449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05090 101541 102434 gene locus_tag LOCUS_05100 101541 102434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05100 102605 103234 gene locus_tag LOCUS_05110 102605 103234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05110 >Feature sequence006 465 1589 gene locus_tag LOCUS_05120 465 1589 CDS product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815367.1 protein_id gnl|my_center|LOCUS_05120 1601 2047 gene locus_tag LOCUS_05130 1601 2047 CDS product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080643.1 protein_id gnl|my_center|LOCUS_05130 2198 2863 gene locus_tag LOCUS_05140 2198 2863 CDS product iron-sulfur cluster assembly scaffold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005780363.1 protein_id gnl|my_center|LOCUS_05140 2856 3047 gene locus_tag LOCUS_05150 2856 3047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05150 3056 4057 gene locus_tag LOCUS_05160 3056 4057 CDS product GGGtGRT protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965854.1 protein_id gnl|my_center|LOCUS_05160 4152 5012 gene locus_tag LOCUS_05170 4152 5012 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_084558766.1 protein_id gnl|my_center|LOCUS_05170 5305 5150 gene locus_tag LOCUS_05180 5305 5150 CDS product DUF4250 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766883.1 protein_id gnl|my_center|LOCUS_05180 5490 5942 gene locus_tag LOCUS_05190 5490 5942 CDS product copper resistance protein NlpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107465.1 protein_id gnl|my_center|LOCUS_05190 6243 7862 gene locus_tag LOCUS_05200 6243 7862 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767969.1 protein_id gnl|my_center|LOCUS_05200 7859 8569 gene locus_tag LOCUS_05210 7859 8569 CDS product phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895939.1 protein_id gnl|my_center|LOCUS_05210 10472 8823 gene locus_tag LOCUS_05220 10472 8823 CDS product tetratricopeptide repeat-containing serine protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788738.1 protein_id gnl|my_center|LOCUS_05220 10694 11401 gene locus_tag LOCUS_05230 10694 11401 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766271.1 protein_id gnl|my_center|LOCUS_05230 12583 11393 gene locus_tag LOCUS_05240 12583 11393 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107546.1 protein_id gnl|my_center|LOCUS_05240 13646 12585 gene locus_tag LOCUS_05250 13646 12585 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107545.1 protein_id gnl|my_center|LOCUS_05250 14872 13886 gene locus_tag LOCUS_05260 14872 13886 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107544.1 protein_id gnl|my_center|LOCUS_05260 16342 14900 gene locus_tag LOCUS_05270 16342 14900 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202896.1 protein_id gnl|my_center|LOCUS_05270 17603 16404 gene locus_tag LOCUS_05280 17603 16404 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008660204.1 protein_id gnl|my_center|LOCUS_05280 18482 17943 gene locus_tag LOCUS_05290 18482 17943 CDS product FHA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107470.1 protein_id gnl|my_center|LOCUS_05290 19251 18862 gene locus_tag LOCUS_05300 19251 18862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05300 20493 19804 gene locus_tag LOCUS_05310 20493 19804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05310 21078 20527 gene locus_tag LOCUS_05320 21078 20527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05320 22317 21442 gene locus_tag LOCUS_05330 22317 21442 CDS product NAD kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760837.1 protein_id gnl|my_center|LOCUS_05330 22992 22333 gene locus_tag LOCUS_05340 22992 22333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05340 23077 23793 gene locus_tag LOCUS_05350 23077 23793 CDS product pyridoxine 5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791132.1 protein_id gnl|my_center|LOCUS_05350 23833 24543 gene locus_tag LOCUS_05360 23833 24543 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791129.1 protein_id gnl|my_center|LOCUS_05360 24677 25045 gene locus_tag LOCUS_05370 24677 25045 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791127.1 protein_id gnl|my_center|LOCUS_05370 25051 25905 gene locus_tag LOCUS_05380 25051 25905 CDS product TonB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203535.1 protein_id gnl|my_center|LOCUS_05380 25915 26460 gene locus_tag LOCUS_05390 25915 26460 CDS product DJ-1/PfpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760842.1 protein_id gnl|my_center|LOCUS_05390 27664 26588 gene locus_tag LOCUS_05400 27664 26588 CDS product choloylglycine hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263137.1 protein_id gnl|my_center|LOCUS_05400 27931 28530 gene locus_tag LOCUS_05410 27931 28530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05410 29048 28695 gene locus_tag LOCUS_05420 29048 28695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05420 29735 29145 gene locus_tag LOCUS_05430 29735 29145 CDS product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107355.1 protein_id gnl|my_center|LOCUS_05430 30967 29744 gene locus_tag LOCUS_05440 30967 29744 CDS product DegT/DnrJ/EryC1/StrS aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000609547.1 protein_id gnl|my_center|LOCUS_05440 31853 31002 gene locus_tag LOCUS_05450 31853 31002 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107948.1 protein_id gnl|my_center|LOCUS_05450 33014 31908 gene locus_tag LOCUS_05460 33014 31908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05460 34365 33073 gene locus_tag LOCUS_05470 34365 33073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05470 35789 34371 gene locus_tag LOCUS_05480 35789 34371 CDS product oligosaccharide flippase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000091276.1 protein_id gnl|my_center|LOCUS_05480 36985 35813 gene locus_tag LOCUS_05490 36985 35813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05490 38175 36988 gene locus_tag LOCUS_05500 38175 36988 CDS product Coenzyme F420 hydrogenase/dehydrogenase, beta subunit C-terminal domain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107236.1 protein_id gnl|my_center|LOCUS_05500 39326 38172 gene locus_tag LOCUS_05510 39326 38172 CDS product polysaccharide pyruvyl transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203004.1 protein_id gnl|my_center|LOCUS_05510 40421 39378 gene locus_tag LOCUS_05520 40421 39378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05520 41199 40423 gene locus_tag LOCUS_05530 41199 40423 CDS product acylneuraminate cytidylyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289370.1 protein_id gnl|my_center|LOCUS_05530 42149 41196 gene locus_tag LOCUS_05540 42149 41196 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289368.1 protein_id gnl|my_center|LOCUS_05540 43126 42149 gene locus_tag LOCUS_05550 43126 42149 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289366.1 protein_id gnl|my_center|LOCUS_05550 43748 43128 gene locus_tag LOCUS_05560 43748 43128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05560 44904 43750 gene locus_tag LOCUS_05570 gene neuC 44904 43750 CDS product UDP-N-acetylglucosamine 2-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000823150.1 protein_id gnl|my_center|LOCUS_05570 45908 44901 gene locus_tag LOCUS_05580 gene neuB 45908 44901 CDS product N-acetylneuraminate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001230564.1 protein_id gnl|my_center|LOCUS_05580 46537 45905 gene locus_tag LOCUS_05590 46537 45905 CDS product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942617.1 protein_id gnl|my_center|LOCUS_05590 47688 46540 gene locus_tag LOCUS_05600 47688 46540 CDS product LegC family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202419.1 protein_id gnl|my_center|LOCUS_05600 48908 47700 gene locus_tag LOCUS_05610 48908 47700 CDS product UDP-N-acetylglucosamine 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202418.1 protein_id gnl|my_center|LOCUS_05610 49610 49065 gene locus_tag LOCUS_05620 49610 49065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05620 49996 49622 gene locus_tag LOCUS_05630 49996 49622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05630 50104 50331 gene locus_tag LOCUS_05640 50104 50331 CDS product DUF4248 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790540.1 protein_id gnl|my_center|LOCUS_05640 50569 51060 gene locus_tag LOCUS_05650 50569 51060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05650 51231 51749 gene locus_tag LOCUS_05660 51231 51749 CDS product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766752.1 protein_id gnl|my_center|LOCUS_05660 53716 51782 gene locus_tag LOCUS_05670 53716 51782 CDS product nucleoside-diphosphate sugar epimerase/dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107228.1 protein_id gnl|my_center|LOCUS_05670 54163 53783 gene locus_tag LOCUS_05680 54163 53783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05680 55301 54189 gene locus_tag LOCUS_05690 55301 54189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05690 56748 55813 gene locus_tag LOCUS_05700 56748 55813 CDS product tyrosine-type DNA invertase cluster 3b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107953.1 protein_id gnl|my_center|LOCUS_05700 57694 56795 gene locus_tag LOCUS_05710 57694 56795 CDS product 1,4-dihydroxy-2-naphthoate polyprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797932.1 protein_id gnl|my_center|LOCUS_05710 57788 58189 gene locus_tag LOCUS_05720 57788 58189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05720 58328 58540 gene locus_tag LOCUS_05730 58328 58540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05730 58582 58776 gene locus_tag LOCUS_05740 58582 58776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05740 60286 58922 gene locus_tag LOCUS_05750 60286 58922 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814920.1 protein_id gnl|my_center|LOCUS_05750 61427 60414 gene locus_tag LOCUS_05760 61427 60414 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789577.1 protein_id gnl|my_center|LOCUS_05760 61827 62750 gene locus_tag LOCUS_05770 61827 62750 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_022470046.1 protein_id gnl|my_center|LOCUS_05770 64842 62815 gene locus_tag LOCUS_05780 64842 62815 CDS product M13 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814533.1 protein_id gnl|my_center|LOCUS_05780 65040 66578 gene locus_tag LOCUS_05790 65040 66578 CDS product alpha-L-arabinofuranosidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107210.1 protein_id gnl|my_center|LOCUS_05790 66661 67563 gene locus_tag LOCUS_05800 66661 67563 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203586.1 protein_id gnl|my_center|LOCUS_05800 68300 67779 gene locus_tag LOCUS_05810 68300 67779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05810 68742 68419 gene locus_tag LOCUS_05820 68742 68419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05820 68923 69576 gene locus_tag LOCUS_05830 68923 69576 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005792021.1 protein_id gnl|my_center|LOCUS_05830 69584 70348 gene locus_tag LOCUS_05840 69584 70348 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005792021.1 protein_id gnl|my_center|LOCUS_05840 70413 71498 gene locus_tag LOCUS_05850 gene dinB 70413 71498 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008768057.1 protein_id gnl|my_center|LOCUS_05850 74063 71505 gene locus_tag LOCUS_05860 74063 71505 CDS product DUF5686 and carboxypeptidase-like regulatory domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107841.1 protein_id gnl|my_center|LOCUS_05860 77135 74286 gene locus_tag LOCUS_05870 77135 74286 CDS product bifunctional fucokinase/fucose-1-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202940.1 protein_id gnl|my_center|LOCUS_05870 77344 77544 gene locus_tag LOCUS_05880 77344 77544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05880 77564 77573 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 77723 78091 gene locus_tag LOCUS_05890 77723 78091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05890 78316 78777 gene locus_tag LOCUS_05900 gene ndk 78316 78777 CDS product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008770040.1 protein_id gnl|my_center|LOCUS_05900 80163 78973 gene locus_tag LOCUS_05910 80163 78973 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107354.1 protein_id gnl|my_center|LOCUS_05910 81308 80160 gene locus_tag LOCUS_05920 gene wecB 81308 80160 CDS product UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005799504.1 protein_id gnl|my_center|LOCUS_05920 82555 81350 gene locus_tag LOCUS_05930 gene wecC 82555 81350 CDS product UDP-N-acetyl-D-mannosamine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202257.1 protein_id gnl|my_center|LOCUS_05930 84050 82617 gene locus_tag LOCUS_05940 84050 82617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05940 84614 84198 gene locus_tag LOCUS_05950 84614 84198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05950 84735 84571 gene locus_tag LOCUS_05960 84735 84571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05960 86151 85009 gene locus_tag LOCUS_05970 86151 85009 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868274.1 protein_id gnl|my_center|LOCUS_05970 87391 86348 gene locus_tag LOCUS_05980 87391 86348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05980 88912 87641 gene locus_tag LOCUS_05990 88912 87641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05990 90246 89431 gene locus_tag LOCUS_06000 90246 89431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06000 90739 90395 gene locus_tag LOCUS_06010 90739 90395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06010 90975 93050 gene locus_tag LOCUS_06020 90975 93050 CDS product VapE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203399.1 protein_id gnl|my_center|LOCUS_06020 93233 93445 gene locus_tag LOCUS_06030 93233 93445 CDS product DUF4248 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763347.1 protein_id gnl|my_center|LOCUS_06030 93704 94171 gene locus_tag LOCUS_06040 93704 94171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06040 94531 94977 gene locus_tag LOCUS_06050 94531 94977 CDS product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765882.1 protein_id gnl|my_center|LOCUS_06050 96166 95027 gene locus_tag LOCUS_06060 96166 95027 CDS product MraY family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107718.1 protein_id gnl|my_center|LOCUS_06060 98487 96181 gene locus_tag LOCUS_06070 98487 96181 CDS product polysaccharide biosynthesis tyrosine autokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202999.1 protein_id gnl|my_center|LOCUS_06070 99469 98672 gene locus_tag LOCUS_06080 99469 98672 CDS product polysaccharide biosynthesis/export family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766005.1 protein_id gnl|my_center|LOCUS_06080 99945 99517 gene locus_tag LOCUS_06090 99945 99517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761508.1 protein_id gnl|my_center|LOCUS_06090 100516 100112 gene locus_tag LOCUS_06100 100516 100112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06100 101634 100522 gene locus_tag LOCUS_06110 101634 100522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06110 >Feature sequence007 544 5541 gene locus_tag LOCUS_06120 544 5541 CDS product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202675.1 protein_id gnl|my_center|LOCUS_06120 5900 7543 gene locus_tag LOCUS_06130 5900 7543 CDS product diphosphate--fructose-6-phosphate 1-phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788903.1 protein_id gnl|my_center|LOCUS_06130 7664 9901 gene locus_tag LOCUS_06140 7664 9901 CDS product beta-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203551.1 protein_id gnl|my_center|LOCUS_06140 9898 11436 gene locus_tag LOCUS_06150 9898 11436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005801402.1 protein_id gnl|my_center|LOCUS_06150 11489 11737 gene locus_tag LOCUS_06160 11489 11737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06160 11916 12938 gene locus_tag LOCUS_06170 11916 12938 CDS product low specificity L-threonine aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108001.1 protein_id gnl|my_center|LOCUS_06170 12953 14839 gene locus_tag LOCUS_06180 12953 14839 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048692652.1 protein_id gnl|my_center|LOCUS_06180 14848 15477 gene locus_tag LOCUS_06190 14848 15477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06190 15552 16118 gene locus_tag LOCUS_06200 gene xpt 15552 16118 CDS product xanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786581.1 protein_id gnl|my_center|LOCUS_06200 16129 16542 gene locus_tag LOCUS_06210 16129 16542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06210 16570 18429 gene locus_tag LOCUS_06220 16570 18429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06220 18696 18624 gene locus_tag LOCUS_t00060 18696 18624 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 18847 19440 gene locus_tag LOCUS_06230 18847 19440 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005792010.1 protein_id gnl|my_center|LOCUS_06230 19458 20402 gene locus_tag LOCUS_06240 19458 20402 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117506.1 protein_id gnl|my_center|LOCUS_06240 20423 21169 gene locus_tag LOCUS_06250 gene fabG 20423 21169 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005792012.1 protein_id gnl|my_center|LOCUS_06250 21171 21845 gene locus_tag LOCUS_06260 21171 21845 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005792014.1 protein_id gnl|my_center|LOCUS_06260 22121 23287 gene locus_tag LOCUS_06270 22121 23287 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788929.1 protein_id gnl|my_center|LOCUS_06270 23284 26400 gene locus_tag LOCUS_06280 23284 26400 CDS product multidrug efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769702.1 protein_id gnl|my_center|LOCUS_06280 26551 27930 gene locus_tag LOCUS_06290 26551 27930 CDS product efflux transporter outer membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766157.1 protein_id gnl|my_center|LOCUS_06290 28145 29428 gene locus_tag LOCUS_06300 28145 29428 CDS product 6-bladed beta-propeller inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005801462.1 protein_id gnl|my_center|LOCUS_06300 29479 30411 gene locus_tag LOCUS_06310 gene metA 29479 30411 CDS product homoserine O-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764097.1 protein_id gnl|my_center|LOCUS_06310 30412 32256 gene locus_tag LOCUS_06320 30412 32256 CDS product U32 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108288.1 protein_id gnl|my_center|LOCUS_06320 32296 33114 gene locus_tag LOCUS_06330 32296 33114 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762736.1 protein_id gnl|my_center|LOCUS_06330 33735 33268 gene locus_tag LOCUS_06340 33735 33268 CDS product WbuC family cupin fold metalloprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786607.1 protein_id gnl|my_center|LOCUS_06340 33856 35313 gene locus_tag LOCUS_06350 33856 35313 CDS product MBOAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963532.1 protein_id gnl|my_center|LOCUS_06350 35499 36227 gene locus_tag LOCUS_06360 35499 36227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06360 36272 39007 gene locus_tag LOCUS_06370 36272 39007 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203735.1 protein_id gnl|my_center|LOCUS_06370 39183 40061 gene locus_tag LOCUS_06380 39183 40061 CDS product carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011067996.1 protein_id gnl|my_center|LOCUS_06380 40842 40354 gene locus_tag LOCUS_06390 40842 40354 CDS product SPOR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766080.1 protein_id gnl|my_center|LOCUS_06390 40928 43039 gene locus_tag LOCUS_06400 40928 43039 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202942.1 protein_id gnl|my_center|LOCUS_06400 44166 43108 gene locus_tag LOCUS_06410 44166 43108 CDS product class I fructose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203205.1 protein_id gnl|my_center|LOCUS_06410 44322 44873 gene locus_tag LOCUS_06420 44322 44873 CDS product NADH peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005780311.1 protein_id gnl|my_center|LOCUS_06420 45012 45099 gene locus_tag LOCUS_t00070 45012 45099 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 45628 45107 gene locus_tag LOCUS_06430 45628 45107 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010774219.1 protein_id gnl|my_center|LOCUS_06430 47868 45670 gene locus_tag LOCUS_06440 47868 45670 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107937.1 protein_id gnl|my_center|LOCUS_06440 47955 49742 gene locus_tag LOCUS_06450 gene lepA 47955 49742 CDS product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765513.1 protein_id gnl|my_center|LOCUS_06450 50707 49838 gene locus_tag LOCUS_06460 50707 49838 CDS product S1-like domain-containing RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796486.1 protein_id gnl|my_center|LOCUS_06460 50874 51677 gene locus_tag LOCUS_06470 50874 51677 CDS product polysaccharide biosynthesis/export family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107248.1 protein_id gnl|my_center|LOCUS_06470 51685 53298 gene locus_tag LOCUS_06480 51685 53298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06480 53305 54168 gene locus_tag LOCUS_06490 53305 54168 CDS product phosphorylcholine transferase LicD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000811992.1 protein_id gnl|my_center|LOCUS_06490 55292 54213 gene locus_tag LOCUS_06500 55292 54213 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704481.1 protein_id gnl|my_center|LOCUS_06500 56512 55289 gene locus_tag LOCUS_06510 56512 55289 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928857.1 protein_id gnl|my_center|LOCUS_06510 57353 56490 gene locus_tag LOCUS_06520 57353 56490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06520 58125 59456 gene locus_tag LOCUS_06530 58125 59456 CDS product MBOAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048068.1 protein_id gnl|my_center|LOCUS_06530 59502 60407 gene locus_tag LOCUS_06540 59502 60407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06540 62062 60815 gene locus_tag LOCUS_06550 62062 60815 CDS product flippase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966346.1 protein_id gnl|my_center|LOCUS_06550 63905 62088 gene locus_tag LOCUS_06560 63905 62088 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203684.1 protein_id gnl|my_center|LOCUS_06560 64992 64045 gene locus_tag LOCUS_06570 64992 64045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06570 65117 66433 gene locus_tag LOCUS_06580 65117 66433 CDS product UDP-glucose/GDP-mannose dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787721.1 protein_id gnl|my_center|LOCUS_06580 67681 66437 gene locus_tag LOCUS_06590 67681 66437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06590 70421 67932 gene locus_tag LOCUS_06600 gene feoB 70421 67932 CDS product ferrous iron transport protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767925.1 protein_id gnl|my_center|LOCUS_06600 70612 71547 gene locus_tag LOCUS_06610 70612 71547 CDS product tyrosine-type DNA invertase cluster 3b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107953.1 protein_id gnl|my_center|LOCUS_06610 72211 73176 gene locus_tag LOCUS_06620 72211 73176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06620 73231 73620 gene locus_tag LOCUS_06630 73231 73620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06630 74151 74297 gene locus_tag LOCUS_06640 74151 74297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06640 74370 75014 gene locus_tag LOCUS_06650 74370 75014 CDS product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107947.1 protein_id gnl|my_center|LOCUS_06650 75070 75831 gene locus_tag LOCUS_06660 75070 75831 CDS product DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009039993.1 protein_id gnl|my_center|LOCUS_06660 76066 77469 gene locus_tag LOCUS_06670 76066 77469 CDS product lipopolysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015752.1 protein_id gnl|my_center|LOCUS_06670 77785 78735 gene locus_tag LOCUS_06680 77785 78735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06680 78752 79771 gene locus_tag LOCUS_06690 gene waaH 78752 79771 CDS product UDP-glucuronate:LPS(HepIII) glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001303717.1 protein_id gnl|my_center|LOCUS_06690 79959 80678 gene locus_tag LOCUS_06700 79959 80678 CDS product IspD/TarI family cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454982.1 protein_id gnl|my_center|LOCUS_06700 80684 81661 gene locus_tag LOCUS_06710 80684 81661 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765263.1 protein_id gnl|my_center|LOCUS_06710 81774 82946 gene locus_tag LOCUS_06720 81774 82946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06720 82943 83824 gene locus_tag LOCUS_06730 82943 83824 CDS product SP_1767 family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765893.1 protein_id gnl|my_center|LOCUS_06730 84070 84882 gene locus_tag LOCUS_06740 84070 84882 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107948.1 protein_id gnl|my_center|LOCUS_06740 85018 85248 gene locus_tag LOCUS_06750 85018 85248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06750 85477 86418 gene locus_tag LOCUS_06760 85477 86418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06760 86415 86993 gene locus_tag LOCUS_06770 86415 86993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06770 87010 87420 gene locus_tag LOCUS_06780 87010 87420 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761418.1 protein_id gnl|my_center|LOCUS_06780 88377 87364 gene locus_tag LOCUS_06790 88377 87364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06790 89494 88361 gene locus_tag LOCUS_06800 89494 88361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06800 90680 89499 gene locus_tag LOCUS_06810 90680 89499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06810 91384 90749 gene locus_tag LOCUS_06820 91384 90749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06820 92730 91423 gene locus_tag LOCUS_06830 92730 91423 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047913.1 protein_id gnl|my_center|LOCUS_06830 93674 92721 gene locus_tag LOCUS_06840 93674 92721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06840 94765 93716 gene locus_tag LOCUS_06850 gene recA 94765 93716 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785787.1 protein_id gnl|my_center|LOCUS_06850 95286 94774 gene locus_tag LOCUS_06860 gene bcp 95286 94774 CDS product thioredoxin-dependent thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785789.1 protein_id gnl|my_center|LOCUS_06860 96427 95234 gene locus_tag LOCUS_06870 96427 95234 CDS product saccharopine dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785790.1 protein_id gnl|my_center|LOCUS_06870 >Feature sequence008 228 617 gene locus_tag LOCUS_06880 228 617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06880 1161 1307 gene locus_tag LOCUS_06890 1161 1307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06890 1380 2024 gene locus_tag LOCUS_06900 1380 2024 CDS product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107947.1 protein_id gnl|my_center|LOCUS_06900 2169 3557 gene locus_tag LOCUS_06910 2169 3557 CDS product nucleotide sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107343.1 protein_id gnl|my_center|LOCUS_06910 3576 4835 gene locus_tag LOCUS_06920 3576 4835 CDS product flippase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966346.1 protein_id gnl|my_center|LOCUS_06920 4832 6868 gene locus_tag LOCUS_06930 4832 6868 CDS product polysaccharide lyase 8 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767251.1 protein_id gnl|my_center|LOCUS_06930 7105 8112 gene locus_tag LOCUS_06940 7105 8112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06940 8081 8965 gene locus_tag LOCUS_06950 8081 8965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06950 8962 9675 gene locus_tag LOCUS_06960 8962 9675 CDS product IspD/TarI family cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765262.1 protein_id gnl|my_center|LOCUS_06960 9672 10652 gene locus_tag LOCUS_06970 9672 10652 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765263.1 protein_id gnl|my_center|LOCUS_06970 10665 11582 gene locus_tag LOCUS_06980 10665 11582 CDS product LicD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455037.1 protein_id gnl|my_center|LOCUS_06980 11926 12786 gene locus_tag LOCUS_06990 gene glf 11926 12786 CDS product UDP-galactopyranose mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986979.1 protein_id gnl|my_center|LOCUS_06990 12788 13552 gene locus_tag LOCUS_07000 12788 13552 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422862.1 protein_id gnl|my_center|LOCUS_07000 14262 14669 gene locus_tag LOCUS_07010 14262 14669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07010 14733 15854 gene locus_tag LOCUS_07020 14733 15854 CDS product DUF5009 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073343.1 protein_id gnl|my_center|LOCUS_07020 16065 17219 gene locus_tag LOCUS_07030 16065 17219 CDS product L-serine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_022470187.1 protein_id gnl|my_center|LOCUS_07030 17259 18263 gene locus_tag LOCUS_07040 17259 18263 CDS product glycoside hydrolase family 43 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795630.1 protein_id gnl|my_center|LOCUS_07040 18474 19103 gene locus_tag LOCUS_07050 18474 19103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07050 19093 20427 gene locus_tag LOCUS_07060 19093 20427 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048692557.1 protein_id gnl|my_center|LOCUS_07060 20455 21345 gene locus_tag LOCUS_07070 20455 21345 CDS product HlyD family efflux transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788227.1 protein_id gnl|my_center|LOCUS_07070 21338 22243 gene locus_tag LOCUS_07080 21338 22243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07080 22330 23064 gene locus_tag LOCUS_07090 22330 23064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07090 23068 24153 gene locus_tag LOCUS_07100 23068 24153 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107326.1 protein_id gnl|my_center|LOCUS_07100 24157 25248 gene locus_tag LOCUS_07110 24157 25248 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202951.1 protein_id gnl|my_center|LOCUS_07110 25312 26631 gene locus_tag LOCUS_07120 gene gntT 25312 26631 CDS product gluconate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209513.1 protein_id gnl|my_center|LOCUS_07120 26650 27171 gene locus_tag LOCUS_07130 26650 27171 CDS product DUF4833 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963144.1 protein_id gnl|my_center|LOCUS_07130 27199 27684 gene locus_tag LOCUS_07140 27199 27684 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007332434.1 protein_id gnl|my_center|LOCUS_07140 27688 28791 gene locus_tag LOCUS_07150 27688 28791 CDS product D-TA family PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921979.1 protein_id gnl|my_center|LOCUS_07150 28839 29921 gene locus_tag LOCUS_07160 28839 29921 CDS product membrane dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480024.1 protein_id gnl|my_center|LOCUS_07160 31484 29970 gene locus_tag LOCUS_07170 31484 29970 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814235.1 protein_id gnl|my_center|LOCUS_07170 31774 33582 gene locus_tag LOCUS_07180 31774 33582 CDS product glycoside hydrolase family 127 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976323.1 protein_id gnl|my_center|LOCUS_07180 34485 33598 gene locus_tag LOCUS_07190 34485 33598 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762705.1 protein_id gnl|my_center|LOCUS_07190 34580 36001 gene locus_tag LOCUS_07200 gene rhaB 34580 36001 CDS product rhamnulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108961.1 protein_id gnl|my_center|LOCUS_07200 36040 37299 gene locus_tag LOCUS_07210 36040 37299 CDS product L-rhamnose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010536410.1 protein_id gnl|my_center|LOCUS_07210 37296 38324 gene locus_tag LOCUS_07220 gene rhaT 37296 38324 CDS product L-rhamnose/proton symporter RhaT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762702.1 protein_id gnl|my_center|LOCUS_07220 38336 39136 gene locus_tag LOCUS_07230 gene rhaD 38336 39136 CDS product rhamnulose-1-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766960.1 protein_id gnl|my_center|LOCUS_07230 39140 40888 gene locus_tag LOCUS_07240 39140 40888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07240 41037 43253 gene locus_tag LOCUS_07250 41037 43253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07250 43891 43250 gene locus_tag LOCUS_07260 43891 43250 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764753.1 protein_id gnl|my_center|LOCUS_07260 44303 45583 gene locus_tag LOCUS_07270 44303 45583 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108087.1 protein_id gnl|my_center|LOCUS_07270 46069 45656 gene locus_tag LOCUS_07280 46069 45656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07280 46596 48035 gene locus_tag LOCUS_07290 46596 48035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07290 48066 49112 gene locus_tag LOCUS_07300 48066 49112 CDS product DUF1848 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938772.1 protein_id gnl|my_center|LOCUS_07300 49308 50663 gene locus_tag LOCUS_07310 49308 50663 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767538.1 protein_id gnl|my_center|LOCUS_07310 50808 51443 gene locus_tag LOCUS_07320 50808 51443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07320 51602 52285 gene locus_tag LOCUS_07330 51602 52285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07330 53581 52580 gene locus_tag LOCUS_07340 53581 52580 CDS product ankyrin repeat domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016207.1 protein_id gnl|my_center|LOCUS_07340 53875 54888 gene locus_tag LOCUS_07350 53875 54888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07350 54970 56031 gene locus_tag LOCUS_07360 54970 56031 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107941.1 protein_id gnl|my_center|LOCUS_07360 56042 59086 gene locus_tag LOCUS_07370 56042 59086 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763357.1 protein_id gnl|my_center|LOCUS_07370 59092 60384 gene locus_tag LOCUS_07380 59092 60384 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789589.1 protein_id gnl|my_center|LOCUS_07380 60574 61863 gene locus_tag LOCUS_07390 60574 61863 CDS product nucleotide sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942587.1 protein_id gnl|my_center|LOCUS_07390 63631 62075 gene locus_tag LOCUS_07400 63631 62075 CDS product carboxypeptidase-like regulatory domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005794770.1 protein_id gnl|my_center|LOCUS_07400 64461 63610 gene locus_tag LOCUS_07410 64461 63610 CDS product FecR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202634.1 protein_id gnl|my_center|LOCUS_07410 65006 64467 gene locus_tag LOCUS_07420 65006 64467 CDS product RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766886.1 protein_id gnl|my_center|LOCUS_07420 66354 65089 gene locus_tag LOCUS_07430 66354 65089 CDS product carboxypeptidase-like regulatory domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005818018.1 protein_id gnl|my_center|LOCUS_07430 67367 66441 gene locus_tag LOCUS_07440 67367 66441 CDS product hydrogen peroxide-inducible genes activator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816458.1 protein_id gnl|my_center|LOCUS_07440 67659 68408 gene locus_tag LOCUS_07450 67659 68408 CDS product polyprenol monophosphomannose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203156.1 protein_id gnl|my_center|LOCUS_07450 68448 69794 gene locus_tag LOCUS_07460 68448 69794 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788965.1 protein_id gnl|my_center|LOCUS_07460 70375 69830 gene locus_tag LOCUS_07470 70375 69830 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032840540.1 protein_id gnl|my_center|LOCUS_07470 70694 70362 gene locus_tag LOCUS_07480 gene queD 70694 70362 CDS product 6-carboxytetrahydropterin synthase QueD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790409.1 protein_id gnl|my_center|LOCUS_07480 71980 70856 gene locus_tag LOCUS_07490 71980 70856 CDS product hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763530.1 protein_id gnl|my_center|LOCUS_07490 72935 72093 gene locus_tag LOCUS_07500 72935 72093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07500 73880 72948 gene locus_tag LOCUS_07510 73880 72948 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_054958832.1 protein_id gnl|my_center|LOCUS_07510 74644 73901 gene locus_tag LOCUS_07520 74644 73901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07520 76228 74999 gene locus_tag LOCUS_07530 76228 74999 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765881.1 protein_id gnl|my_center|LOCUS_07530 77709 76225 gene locus_tag LOCUS_07540 77709 76225 CDS product O-antigen ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765879.1 protein_id gnl|my_center|LOCUS_07540 79877 77718 gene locus_tag LOCUS_07550 79877 77718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765878.1 protein_id gnl|my_center|LOCUS_07550 80532 79882 gene locus_tag LOCUS_07560 80532 79882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07560 80936 80679 gene locus_tag LOCUS_07570 80936 80679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07570 81853 80945 gene locus_tag LOCUS_07580 81853 80945 CDS product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765042.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07580 82218 81853 gene locus_tag LOCUS_07590 82218 81853 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763087.1 protein_id gnl|my_center|LOCUS_07590 82398 84887 gene locus_tag LOCUS_07600 82398 84887 CDS product alpha-L-arabinofuranosidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584086.1 protein_id gnl|my_center|LOCUS_07600 84976 86502 gene locus_tag LOCUS_07610 84976 86502 CDS product bifunctional GNAT family N-acetyltransferase/carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787651.1 protein_id gnl|my_center|LOCUS_07610 89056 86705 gene locus_tag LOCUS_07620 89056 86705 CDS product family 20 glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005822184.1 protein_id gnl|my_center|LOCUS_07620 90466 89186 gene locus_tag LOCUS_07630 90466 89186 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107424.1 protein_id gnl|my_center|LOCUS_07630 91251 90598 gene locus_tag LOCUS_07640 91251 90598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07640 92966 91278 gene locus_tag LOCUS_07650 gene ettA 92966 91278 CDS product energy-dependent translational throttle protein EttA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005776885.1 protein_id gnl|my_center|LOCUS_07650 93460 93533 gene locus_tag LOCUS_t00080 93460 93533 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 93804 95024 gene locus_tag LOCUS_07660 93804 95024 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005776823.1 protein_id gnl|my_center|LOCUS_07660 95048 95443 gene locus_tag LOCUS_07670 95048 95443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07670 95390 95399 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence009 151 918 gene locus_tag LOCUS_07680 151 918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07680 1040 1840 gene locus_tag LOCUS_07690 1040 1840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07690 2819 1980 gene locus_tag LOCUS_07700 2819 1980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816479.1 protein_id gnl|my_center|LOCUS_07700 2930 3148 gene locus_tag LOCUS_07710 2930 3148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07710 4169 4426 gene locus_tag LOCUS_07720 4169 4426 CDS product GlsB/YeaQ/YmgE family stress response membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791529.1 protein_id gnl|my_center|LOCUS_07720 4463 4759 gene locus_tag LOCUS_07730 4463 4759 CDS product YtxH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766979.1 protein_id gnl|my_center|LOCUS_07730 4803 5753 gene locus_tag LOCUS_07740 4803 5753 CDS product manganese catalase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731124.1 protein_id gnl|my_center|LOCUS_07740 7125 6088 gene locus_tag LOCUS_07750 7125 6088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07750 8367 7219 gene locus_tag LOCUS_07760 8367 7219 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786002.1 protein_id gnl|my_center|LOCUS_07760 8926 8423 gene locus_tag LOCUS_07770 8926 8423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07770 9819 9310 gene locus_tag LOCUS_07780 9819 9310 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763441.1 protein_id gnl|my_center|LOCUS_07780 10012 9824 gene locus_tag LOCUS_07790 10012 9824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07790 10265 11128 gene locus_tag LOCUS_07800 10265 11128 CDS product IS3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765456.1 protein_id gnl|my_center|LOCUS_07800 11270 11279 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 13231 11795 gene locus_tag LOCUS_07810 13231 11795 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016269382.1 protein_id gnl|my_center|LOCUS_07810 13439 14983 gene locus_tag LOCUS_07820 13439 14983 CDS product glycine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784203.1 protein_id gnl|my_center|LOCUS_07820 14988 15506 gene locus_tag LOCUS_07830 14988 15506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07830 16638 15844 gene locus_tag LOCUS_07840 16638 15844 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202222.1 protein_id gnl|my_center|LOCUS_07840 17422 16646 gene locus_tag LOCUS_07850 17422 16646 CDS product DUF5668 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109111.1 protein_id gnl|my_center|LOCUS_07850 17724 20789 gene locus_tag LOCUS_07860 17724 20789 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765000.1 protein_id gnl|my_center|LOCUS_07860 22227 20995 gene locus_tag LOCUS_07870 22227 20995 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015207390.1 protein_id gnl|my_center|LOCUS_07870 23367 22261 gene locus_tag LOCUS_07880 23367 22261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07880 24650 23895 gene locus_tag LOCUS_07890 24650 23895 CDS product succinate dehydrogenase/fumarate reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783491.1 protein_id gnl|my_center|LOCUS_07890 26624 24681 gene locus_tag LOCUS_07900 26624 24681 CDS product fumarate reductase/succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783490.1 protein_id gnl|my_center|LOCUS_07900 27275 26673 gene locus_tag LOCUS_07910 27275 26673 CDS product succinate dehydrogenase/fumarate reductase cytochrome b subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783488.1 protein_id gnl|my_center|LOCUS_07910 27551 28966 gene locus_tag LOCUS_07920 27551 28966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07920 29205 30299 gene locus_tag LOCUS_07930 29205 30299 CDS product 6-bladed beta-propeller inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005802156.1 protein_id gnl|my_center|LOCUS_07930 30725 31201 gene locus_tag LOCUS_07940 30725 31201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07940 31316 31678 gene locus_tag LOCUS_07950 31316 31678 CDS product BlaI/MecI/CopY family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791717.1 protein_id gnl|my_center|LOCUS_07950 31696 33519 gene locus_tag LOCUS_07960 31696 33519 CDS product M56 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109009.1 protein_id gnl|my_center|LOCUS_07960 33576 35438 gene locus_tag LOCUS_07970 33576 35438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07970 35471 36628 gene locus_tag LOCUS_07980 35471 36628 CDS product 6-bladed beta-propeller inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005801462.1 protein_id gnl|my_center|LOCUS_07980 37110 39278 gene locus_tag LOCUS_07990 37110 39278 CDS product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203147.1 protein_id gnl|my_center|LOCUS_07990 39316 39987 gene locus_tag LOCUS_08000 39316 39987 CDS product DUF2461 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761471.1 protein_id gnl|my_center|LOCUS_08000 41090 39999 gene locus_tag LOCUS_08010 41090 39999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08010 41500 41910 gene locus_tag LOCUS_08020 41500 41910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08020 43349 41988 gene locus_tag LOCUS_08030 43349 41988 CDS product TrpB-like pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760379.1 protein_id gnl|my_center|LOCUS_08030 43539 44738 gene locus_tag LOCUS_08040 43539 44738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201881.1 protein_id gnl|my_center|LOCUS_08040 44755 45981 gene locus_tag LOCUS_08050 44755 45981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201881.1 protein_id gnl|my_center|LOCUS_08050 47087 46077 gene locus_tag LOCUS_08060 47087 46077 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762581.1 protein_id gnl|my_center|LOCUS_08060 47242 49614 gene locus_tag LOCUS_08070 47242 49614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08070 49648 49800 gene locus_tag LOCUS_08080 49648 49800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08080 51045 49912 gene locus_tag LOCUS_08090 51045 49912 CDS product clostripain-related cysteine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107701.1 protein_id gnl|my_center|LOCUS_08090 51242 51757 gene locus_tag LOCUS_08100 51242 51757 CDS product DUF3575 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107790.1 protein_id gnl|my_center|LOCUS_08100 51770 52276 gene locus_tag LOCUS_08110 51770 52276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08110 52391 52630 gene locus_tag LOCUS_08120 52391 52630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08120 55189 54263 gene locus_tag LOCUS_08130 55189 54263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08130 56233 55217 gene locus_tag LOCUS_08140 56233 55217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08140 57306 56311 gene locus_tag LOCUS_08150 57306 56311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08150 58261 57350 gene locus_tag LOCUS_08160 58261 57350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08160 59129 58395 gene locus_tag LOCUS_08170 59129 58395 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783483.1 protein_id gnl|my_center|LOCUS_08170 60790 59261 gene locus_tag LOCUS_08180 60790 59261 CDS product family 10 glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798918.1 protein_id gnl|my_center|LOCUS_08180 60997 63780 gene locus_tag LOCUS_08190 gene uvrA 60997 63780 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789604.1 protein_id gnl|my_center|LOCUS_08190 64546 64328 gene locus_tag LOCUS_08200 64546 64328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08200 66242 64596 gene locus_tag LOCUS_08210 66242 64596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08210 66472 67683 gene locus_tag LOCUS_08220 gene hflX 66472 67683 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759581.1 protein_id gnl|my_center|LOCUS_08220 67705 69693 gene locus_tag LOCUS_08230 67705 69693 CDS product DUF4954 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108193.1 protein_id gnl|my_center|LOCUS_08230 69699 70580 gene locus_tag LOCUS_08240 69699 70580 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_194105476.1 protein_id gnl|my_center|LOCUS_08240 70678 71235 gene locus_tag LOCUS_08250 70678 71235 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706187.1 protein_id gnl|my_center|LOCUS_08250 71239 72198 gene locus_tag LOCUS_08260 71239 72198 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081773.1 protein_id gnl|my_center|LOCUS_08260 72179 72967 gene locus_tag LOCUS_08270 72179 72967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08270 73027 74436 gene locus_tag LOCUS_08280 73027 74436 CDS product sugar porter family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005772424.1 protein_id gnl|my_center|LOCUS_08280 74576 75697 gene locus_tag LOCUS_08290 74576 75697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08290 75853 78072 gene locus_tag LOCUS_08300 75853 78072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08300 78225 79622 gene locus_tag LOCUS_08310 78225 79622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08310 79640 81085 gene locus_tag LOCUS_08320 79640 81085 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108889.1 protein_id gnl|my_center|LOCUS_08320 81412 82314 gene locus_tag LOCUS_08330 81412 82314 CDS product Rpn family recombination-promoting nuclease/putative transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203118.1 protein_id gnl|my_center|LOCUS_08330 83259 82354 gene locus_tag LOCUS_08340 gene xerD 83259 82354 CDS product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791940.1 protein_id gnl|my_center|LOCUS_08340 83360 83776 gene locus_tag LOCUS_08350 gene aroQ 83360 83776 CDS product type II 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761921.1 protein_id gnl|my_center|LOCUS_08350 83837 85294 gene locus_tag LOCUS_08360 gene pyk 83837 85294 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761922.1 protein_id gnl|my_center|LOCUS_08360 85300 85935 gene locus_tag LOCUS_08370 85300 85935 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791943.1 protein_id gnl|my_center|LOCUS_08370 85948 86283 gene locus_tag LOCUS_08380 gene rbfA 85948 86283 CDS product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791944.1 protein_id gnl|my_center|LOCUS_08380 86371 87525 gene locus_tag LOCUS_08390 86371 87525 CDS product FtsX-like permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765300.1 protein_id gnl|my_center|LOCUS_08390 88652 87570 gene locus_tag LOCUS_08400 88652 87570 CDS product mannose-1-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791384.1 protein_id gnl|my_center|LOCUS_08400 88856 88940 gene locus_tag LOCUS_t00090 88856 88940 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 89178 90086 gene locus_tag LOCUS_08410 89178 90086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08410 90212 90499 gene locus_tag LOCUS_08420 90212 90499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08420 90499 91578 gene locus_tag LOCUS_08430 90499 91578 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816490.1 protein_id gnl|my_center|LOCUS_08430 >Feature sequence010 1177 1701 gene locus_tag LOCUS_08440 1177 1701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08440 2377 1796 gene locus_tag LOCUS_08450 2377 1796 CDS product DUF3109 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763683.1 protein_id gnl|my_center|LOCUS_08450 3917 2394 gene locus_tag LOCUS_08460 gene gpmI 3917 2394 CDS product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783975.1 protein_id gnl|my_center|LOCUS_08460 4024 4722 gene locus_tag LOCUS_08470 4024 4722 CDS product SprT family zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767602.1 protein_id gnl|my_center|LOCUS_08470 7538 4824 gene locus_tag LOCUS_08480 7538 4824 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107990.1 protein_id gnl|my_center|LOCUS_08480 15057 7639 gene locus_tag LOCUS_08490 gene sprA 15057 7639 CDS product cell surface protein SprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062175791.1 protein_id gnl|my_center|LOCUS_08490 15698 15108 gene locus_tag LOCUS_08500 gene ruvA 15698 15108 CDS product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790555.1 protein_id gnl|my_center|LOCUS_08500 16674 15763 gene locus_tag LOCUS_08510 16674 15763 CDS product SMP-30/gluconolactonase/LRE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275434.1 protein_id gnl|my_center|LOCUS_08510 18116 16662 gene locus_tag LOCUS_08520 18116 16662 CDS product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109098.1 protein_id gnl|my_center|LOCUS_08520 19463 18126 gene locus_tag LOCUS_08530 gene trkA 19463 18126 CDS product Trk system potassium transporter TrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785058.1 protein_id gnl|my_center|LOCUS_08530 21382 19484 gene locus_tag LOCUS_08540 gene dxs 21382 19484 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010992199.1 protein_id gnl|my_center|LOCUS_08540 22414 22001 gene locus_tag LOCUS_08550 22414 22001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08550 24090 22453 gene locus_tag LOCUS_08560 24090 22453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767452.1 protein_id gnl|my_center|LOCUS_08560 25207 24413 gene locus_tag LOCUS_08570 25207 24413 CDS product inositol monophosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108488.1 protein_id gnl|my_center|LOCUS_08570 25376 26050 gene locus_tag LOCUS_08580 25376 26050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08580 26080 30690 gene locus_tag LOCUS_08590 26080 30690 CDS product translocation/assembly module TamB domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203588.1 protein_id gnl|my_center|LOCUS_08590 30945 33140 gene locus_tag LOCUS_08600 30945 33140 CDS product BamA/TamA family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203587.1 protein_id gnl|my_center|LOCUS_08600 33291 34541 gene locus_tag LOCUS_08610 33291 34541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08610 35543 34647 gene locus_tag LOCUS_08620 gene rocF 35543 34647 CDS product arginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964372.1 protein_id gnl|my_center|LOCUS_08620 36755 35547 gene locus_tag LOCUS_08630 gene rocD 36755 35547 CDS product ornithine--oxo-acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962898.1 protein_id gnl|my_center|LOCUS_08630 38139 36976 gene locus_tag LOCUS_08640 38139 36976 CDS product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108940.1 protein_id gnl|my_center|LOCUS_08640 39138 38146 gene locus_tag LOCUS_08650 39138 38146 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202023.1 protein_id gnl|my_center|LOCUS_08650 40220 39141 gene locus_tag LOCUS_08660 40220 39141 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796526.1 protein_id gnl|my_center|LOCUS_08660 40851 40225 gene locus_tag LOCUS_08670 40851 40225 CDS product PASTA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766997.1 protein_id gnl|my_center|LOCUS_08670 41355 42263 gene locus_tag LOCUS_08680 41355 42263 CDS product Rpn family recombination-promoting nuclease/putative transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203118.1 protein_id gnl|my_center|LOCUS_08680 43252 42287 gene locus_tag LOCUS_08690 43252 42287 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764184.1 protein_id gnl|my_center|LOCUS_08690 43586 43882 gene locus_tag LOCUS_08700 43586 43882 CDS product OadG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798575.1 protein_id gnl|my_center|LOCUS_08700 43901 45826 gene locus_tag LOCUS_08710 43901 45826 CDS product pyruvate carboxylase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763354.1 protein_id gnl|my_center|LOCUS_08710 45826 47061 gene locus_tag LOCUS_08720 45826 47061 CDS product sodium ion-translocating decarboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763355.1 protein_id gnl|my_center|LOCUS_08720 47278 49131 gene locus_tag LOCUS_08730 47278 49131 CDS product DUF349 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764283.1 protein_id gnl|my_center|LOCUS_08730 49195 50403 gene locus_tag LOCUS_08740 49195 50403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032528599.1 protein_id gnl|my_center|LOCUS_08740 50469 51662 gene locus_tag LOCUS_08750 50469 51662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08750 52290 51712 gene locus_tag LOCUS_08760 52290 51712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08760 53591 52530 gene locus_tag LOCUS_08770 53591 52530 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144327.1 protein_id gnl|my_center|LOCUS_08770 57859 54263 gene locus_tag LOCUS_08780 57859 54263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08780 58676 60460 gene locus_tag LOCUS_08790 58676 60460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08790 60457 61290 gene locus_tag LOCUS_08800 60457 61290 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205421593.1 protein_id gnl|my_center|LOCUS_08800 62327 61299 gene locus_tag LOCUS_08810 62327 61299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08810 62657 62475 gene locus_tag LOCUS_08820 62657 62475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08820 63902 62670 gene locus_tag LOCUS_08830 63902 62670 CDS product TIGR04150 pseudo-rSAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797445.1 protein_id gnl|my_center|LOCUS_08830 65248 63908 gene locus_tag LOCUS_08840 65248 63908 CDS product radical SAM peptide maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010993584.1 protein_id gnl|my_center|LOCUS_08840 65669 67990 gene locus_tag LOCUS_08850 65669 67990 CDS product glycoside hydrolase family 20 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107277.1 protein_id gnl|my_center|LOCUS_08850 68065 70548 gene locus_tag LOCUS_08860 68065 70548 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_055229518.1 protein_id gnl|my_center|LOCUS_08860 71096 74212 gene locus_tag LOCUS_08870 71096 74212 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005792393.1 protein_id gnl|my_center|LOCUS_08870 74262 75854 gene locus_tag LOCUS_08880 74262 75854 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796344.1 protein_id gnl|my_center|LOCUS_08880 76034 79723 gene locus_tag LOCUS_08890 gene purL 76034 79723 CDS product phosphoribosylformylglycinamidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814911.1 protein_id gnl|my_center|LOCUS_08890 80027 80641 gene locus_tag LOCUS_08900 80027 80641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08900 80856 83981 gene locus_tag LOCUS_08910 80856 83981 CDS product carboxypeptidase regulatory-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765900.1 protein_id gnl|my_center|LOCUS_08910 84020 85438 gene locus_tag LOCUS_08920 84020 85438 CDS product calcineurin-like phosphoesterase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766056.1 protein_id gnl|my_center|LOCUS_08920 89434 86513 gene locus_tag LOCUS_08930 89434 86513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08930 >Feature sequence011 3061 1484 gene locus_tag LOCUS_08940 3061 1484 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766109.1 protein_id gnl|my_center|LOCUS_08940 3345 4382 gene locus_tag LOCUS_08950 gene ruvB 3345 4382 CDS product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783731.1 protein_id gnl|my_center|LOCUS_08950 4393 5889 gene locus_tag LOCUS_08960 4393 5889 CDS product oligosaccharide flippase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813883.1 protein_id gnl|my_center|LOCUS_08960 7832 5886 gene locus_tag LOCUS_08970 7832 5886 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202779.1 protein_id gnl|my_center|LOCUS_08970 8105 9463 gene locus_tag LOCUS_08980 8105 9463 CDS product TIGR00341 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783735.1 protein_id gnl|my_center|LOCUS_08980 9484 11625 gene locus_tag LOCUS_08990 9484 11625 CDS product S46 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108743.1 protein_id gnl|my_center|LOCUS_08990 12934 11765 gene locus_tag LOCUS_09000 12934 11765 CDS product C1 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789686.1 protein_id gnl|my_center|LOCUS_09000 14618 13008 gene locus_tag LOCUS_09010 14618 13008 CDS product C69 family dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767963.1 protein_id gnl|my_center|LOCUS_09010 16481 14727 gene locus_tag LOCUS_09020 16481 14727 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108753.1 protein_id gnl|my_center|LOCUS_09020 17223 17579 gene locus_tag LOCUS_09030 17223 17579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09030 17601 18179 gene locus_tag LOCUS_09040 17601 18179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09040 18176 18739 gene locus_tag LOCUS_09050 18176 18739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09050 19865 18810 gene locus_tag LOCUS_09060 19865 18810 CDS product tyrosine-protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201876.1 protein_id gnl|my_center|LOCUS_09060 20868 19939 gene locus_tag LOCUS_09070 20868 19939 CDS product carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201877.1 protein_id gnl|my_center|LOCUS_09070 21591 20887 gene locus_tag LOCUS_09080 21591 20887 CDS product SIS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762908.1 protein_id gnl|my_center|LOCUS_09080 23239 21593 gene locus_tag LOCUS_09090 23239 21593 CDS product M28 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035282.1 protein_id gnl|my_center|LOCUS_09090 24812 23244 gene locus_tag LOCUS_09100 24812 23244 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107814.1 protein_id gnl|my_center|LOCUS_09100 24987 26207 gene locus_tag LOCUS_09110 24987 26207 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108756.1 protein_id gnl|my_center|LOCUS_09110 27403 26210 gene locus_tag LOCUS_09120 27403 26210 CDS product acyloxyacyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108825.1 protein_id gnl|my_center|LOCUS_09120 28839 27439 gene locus_tag LOCUS_09130 28839 27439 CDS product alanine/glycine:cation symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790372.1 protein_id gnl|my_center|LOCUS_09130 29015 31342 gene locus_tag LOCUS_09140 29015 31342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09140 31382 31888 gene locus_tag LOCUS_09150 31382 31888 CDS product flavin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107336.1 protein_id gnl|my_center|LOCUS_09150 32655 31891 gene locus_tag LOCUS_09160 32655 31891 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026184045.1 protein_id gnl|my_center|LOCUS_09160 34427 32781 gene locus_tag LOCUS_09170 34427 32781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09170 35725 34439 gene locus_tag LOCUS_09180 35725 34439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09180 38639 35736 gene locus_tag LOCUS_09190 38639 35736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09190 41602 38696 gene locus_tag LOCUS_09200 41602 38696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09200 43477 41786 gene locus_tag LOCUS_09210 43477 41786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09210 44295 43564 gene locus_tag LOCUS_09220 44295 43564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09220 45737 44373 gene locus_tag LOCUS_09230 45737 44373 CDS product sodium-dependent transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762587.1 protein_id gnl|my_center|LOCUS_09230 45856 46815 gene locus_tag LOCUS_09240 45856 46815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09240 47426 48016 gene locus_tag LOCUS_09250 47426 48016 CDS product DUF3575 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108436.1 protein_id gnl|my_center|LOCUS_09250 48036 49505 gene locus_tag LOCUS_09260 48036 49505 CDS product DUF3868 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764436.1 protein_id gnl|my_center|LOCUS_09260 49569 51680 gene locus_tag LOCUS_09270 49569 51680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09270 51848 52966 gene locus_tag LOCUS_09280 51848 52966 CDS product FimB/Mfa2 family fimbrial subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763526.1 protein_id gnl|my_center|LOCUS_09280 52990 54648 gene locus_tag LOCUS_09290 52990 54648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09290 54684 60734 gene locus_tag LOCUS_09300 54684 60734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09300 61450 60794 gene locus_tag LOCUS_09310 61450 60794 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762585.1 protein_id gnl|my_center|LOCUS_09310 62163 61447 gene locus_tag LOCUS_09320 62163 61447 CDS product tRNA threonylcarbamoyladenosine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108916.1 protein_id gnl|my_center|LOCUS_09320 64323 62344 gene locus_tag LOCUS_09330 64323 62344 CDS product glycoside hydrolase family 97 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265628.1 protein_id gnl|my_center|LOCUS_09330 65725 64442 gene locus_tag LOCUS_09340 65725 64442 CDS product sugar MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162303135.1 protein_id gnl|my_center|LOCUS_09340 66663 65737 gene locus_tag LOCUS_09350 66663 65737 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109361.1 protein_id gnl|my_center|LOCUS_09350 67401 66679 gene locus_tag LOCUS_09360 67401 66679 CDS product galactosamine-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001307409.1 protein_id gnl|my_center|LOCUS_09360 68214 67408 gene locus_tag LOCUS_09370 68214 67408 CDS product DUF1080 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763946.1 protein_id gnl|my_center|LOCUS_09370 69786 68302 gene locus_tag LOCUS_09380 69786 68302 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763947.1 protein_id gnl|my_center|LOCUS_09380 70062 69919 gene locus_tag LOCUS_09390 70062 69919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09390 71396 70059 gene locus_tag LOCUS_09400 71396 70059 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767239.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09400 74640 71479 gene locus_tag LOCUS_09410 74640 71479 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767240.1 protein_id gnl|my_center|LOCUS_09410 75858 74884 gene locus_tag LOCUS_09420 75858 74884 CDS product FecR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108957.1 protein_id gnl|my_center|LOCUS_09420 76399 75929 gene locus_tag LOCUS_09430 76399 75929 CDS product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788614.1 protein_id gnl|my_center|LOCUS_09430 76830 76396 gene locus_tag LOCUS_09440 76830 76396 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107253.1 protein_id gnl|my_center|LOCUS_09440 77006 78130 gene locus_tag LOCUS_09450 77006 78130 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790984.1 protein_id gnl|my_center|LOCUS_09450 79433 78195 gene locus_tag LOCUS_09460 79433 78195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09460 80907 79744 gene locus_tag LOCUS_09470 80907 79744 CDS product 6-bladed beta-propeller inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005801462.1 protein_id gnl|my_center|LOCUS_09470 81132 80947 gene locus_tag LOCUS_09480 81132 80947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09480 81528 81307 gene locus_tag LOCUS_09490 81528 81307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09490 82462 82235 gene locus_tag LOCUS_09500 82462 82235 CDS product DUF4248 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109076.1 protein_id gnl|my_center|LOCUS_09500 82973 82449 gene locus_tag LOCUS_09510 82973 82449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09510 83460 82966 gene locus_tag LOCUS_09520 83460 82966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09520 >Feature sequence012 2228 1272 gene locus_tag LOCUS_09530 2228 1272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09530 2472 2690 gene locus_tag LOCUS_09540 2472 2690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09540 2699 3748 gene locus_tag LOCUS_09550 2699 3748 CDS product TolB-like 6-bladed beta-propeller domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789047.1 protein_id gnl|my_center|LOCUS_09550 3761 4615 gene locus_tag LOCUS_09560 3761 4615 CDS product DUF1573 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203167.1 protein_id gnl|my_center|LOCUS_09560 4779 4994 gene locus_tag LOCUS_09570 4779 4994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09570 4985 6169 gene locus_tag LOCUS_09580 4985 6169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09580 6531 7292 gene locus_tag LOCUS_09590 gene lepB 6531 7292 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789018.1 protein_id gnl|my_center|LOCUS_09590 7691 8698 gene locus_tag LOCUS_09600 7691 8698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09600 9526 10515 gene locus_tag LOCUS_09610 9526 10515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09610 10610 11677 gene locus_tag LOCUS_09620 10610 11677 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203162.1 protein_id gnl|my_center|LOCUS_09620 11705 14770 gene locus_tag LOCUS_09630 11705 14770 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798729.1 protein_id gnl|my_center|LOCUS_09630 14767 16260 gene locus_tag LOCUS_09640 14767 16260 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789010.1 protein_id gnl|my_center|LOCUS_09640 16250 19480 gene locus_tag LOCUS_09650 16250 19480 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789008.1 protein_id gnl|my_center|LOCUS_09650 19533 20879 gene locus_tag LOCUS_09660 19533 20879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09660 22678 20987 gene locus_tag LOCUS_09670 22678 20987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005801402.1 protein_id gnl|my_center|LOCUS_09670 25429 22691 gene locus_tag LOCUS_09680 25429 22691 CDS product carboxypeptidase-like regulatory domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202132.1 protein_id gnl|my_center|LOCUS_09680 26079 25429 gene locus_tag LOCUS_09690 26079 25429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784880.1 protein_id gnl|my_center|LOCUS_09690 27308 26184 gene locus_tag LOCUS_09700 27308 26184 CDS product DUF4249 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005801400.1 protein_id gnl|my_center|LOCUS_09700 27811 27491 gene locus_tag LOCUS_09710 27811 27491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09710 29274 28177 gene locus_tag LOCUS_09720 29274 28177 CDS product DUF4249 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005801400.1 protein_id gnl|my_center|LOCUS_09720 29795 29358 gene locus_tag LOCUS_09730 29795 29358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09730 31252 30143 gene locus_tag LOCUS_09740 31252 30143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09740 31629 31327 gene locus_tag LOCUS_09750 31629 31327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09750 32586 33020 gene locus_tag LOCUS_09760 32586 33020 CDS product DUF6078 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760904.1 protein_id gnl|my_center|LOCUS_09760 34932 33214 gene locus_tag LOCUS_09770 34932 33214 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764603.1 protein_id gnl|my_center|LOCUS_09770 35246 38464 gene locus_tag LOCUS_09780 gene carB 35246 38464 CDS product carbamoyl-phosphate synthase (glutamine-hydrolyzing) large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109000.1 protein_id gnl|my_center|LOCUS_09780 38515 40602 gene locus_tag LOCUS_09790 38515 40602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09790 40805 42181 gene locus_tag LOCUS_09800 40805 42181 CDS product FAD/NAD(P)-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259724.1 protein_id gnl|my_center|LOCUS_09800 45053 42282 gene locus_tag LOCUS_09810 45053 42282 CDS product FAD-binding and (Fe-S)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937562.1 protein_id gnl|my_center|LOCUS_09810 46235 45117 gene locus_tag LOCUS_09820 46235 45117 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202774.1 protein_id gnl|my_center|LOCUS_09820 47350 46235 gene locus_tag LOCUS_09830 47350 46235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09830 49310 47364 gene locus_tag LOCUS_09840 49310 47364 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202481.1 protein_id gnl|my_center|LOCUS_09840 49660 50613 gene locus_tag LOCUS_09850 49660 50613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09850 51099 52199 gene locus_tag LOCUS_09860 51099 52199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09860 52249 52821 gene locus_tag LOCUS_09870 52249 52821 CDS product DUF3575 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108436.1 protein_id gnl|my_center|LOCUS_09870 52882 54279 gene locus_tag LOCUS_09880 52882 54279 CDS product DUF3868 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764436.1 protein_id gnl|my_center|LOCUS_09880 54316 54762 gene locus_tag LOCUS_09890 54316 54762 CDS product DsbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766754.1 protein_id gnl|my_center|LOCUS_09890 55065 57014 gene locus_tag LOCUS_09900 55065 57014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09900 57175 58206 gene locus_tag LOCUS_09910 57175 58206 CDS product FimB/Mfa2 family fimbrial subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763526.1 protein_id gnl|my_center|LOCUS_09910 58324 59607 gene locus_tag LOCUS_09920 58324 59607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09920 59632 64635 gene locus_tag LOCUS_09930 59632 64635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09930 64795 64992 gene locus_tag LOCUS_09940 64795 64992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09940 65052 65210 gene locus_tag LOCUS_09950 65052 65210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09950 65330 66427 gene locus_tag LOCUS_09960 65330 66427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09960 66990 67787 gene locus_tag LOCUS_09970 gene djlA 66990 67787 CDS product co-chaperone DjlA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073436.1 protein_id gnl|my_center|LOCUS_09970 70180 67997 gene locus_tag LOCUS_09980 70180 67997 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032555650.1 protein_id gnl|my_center|LOCUS_09980 70693 72900 gene locus_tag LOCUS_09990 70693 72900 CDS product anaerobic ribonucleoside triphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790561.1 protein_id gnl|my_center|LOCUS_09990 72934 73434 gene locus_tag LOCUS_10000 gene nrdG 72934 73434 CDS product anaerobic ribonucleoside-triphosphate reductase activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203409.1 protein_id gnl|my_center|LOCUS_10000 73803 75137 gene locus_tag LOCUS_10010 73803 75137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10010 76325 75252 gene locus_tag LOCUS_10020 76325 75252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10020 77152 76322 gene locus_tag LOCUS_10030 77152 76322 CDS product alpha/beta hydrolase-fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072930.1 protein_id gnl|my_center|LOCUS_10030 78577 77162 gene locus_tag LOCUS_10040 78577 77162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10040 80938 78641 gene locus_tag LOCUS_10050 80938 78641 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108117.1 protein_id gnl|my_center|LOCUS_10050 >Feature sequence013 <1 922 gene locus_tag LOCUS_10060 <1 922 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011107917.1:glycosyltransferase family 2 protein 919 1782 gene locus_tag LOCUS_10070 919 1782 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001114264.1 protein_id gnl|my_center|LOCUS_10070 1798 2616 gene locus_tag LOCUS_10080 1798 2616 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107948.1 protein_id gnl|my_center|LOCUS_10080 2616 3188 gene locus_tag LOCUS_10090 2616 3188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10090 3192 4082 gene locus_tag LOCUS_10100 3192 4082 CDS product DUF3473 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942624.1 protein_id gnl|my_center|LOCUS_10100 5166 4036 gene locus_tag LOCUS_10110 5166 4036 CDS product type II toxin-antitoxin system HipA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003816638.1 protein_id gnl|my_center|LOCUS_10110 5501 5166 gene locus_tag LOCUS_10120 5501 5166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10120 5723 6040 gene locus_tag LOCUS_10130 gene rplU 5723 6040 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005775748.1 protein_id gnl|my_center|LOCUS_10130 6063 6329 gene locus_tag LOCUS_10140 gene rpmA 6063 6329 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785336.1 protein_id gnl|my_center|LOCUS_10140 6486 7892 gene locus_tag LOCUS_10150 6486 7892 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795565.1 protein_id gnl|my_center|LOCUS_10150 7949 9169 gene locus_tag LOCUS_10160 gene pepT 7949 9169 CDS product peptidase T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786005.1 protein_id gnl|my_center|LOCUS_10160 9183 10268 gene locus_tag LOCUS_10170 gene gcvT 9183 10268 CDS product glycine cleavage system aminomethyltransferase GcvT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795559.1 protein_id gnl|my_center|LOCUS_10170 10939 10352 gene locus_tag LOCUS_10180 10939 10352 CDS product DUF4251 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786125.1 protein_id gnl|my_center|LOCUS_10180 11106 12119 gene locus_tag LOCUS_10190 11106 12119 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439589.1 protein_id gnl|my_center|LOCUS_10190 12274 12678 gene locus_tag LOCUS_10200 12274 12678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10200 12630 14447 gene locus_tag LOCUS_10210 12630 14447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10210 16514 14592 gene locus_tag LOCUS_10220 16514 14592 CDS product NAD(+) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107164.1 protein_id gnl|my_center|LOCUS_10220 16850 16527 gene locus_tag LOCUS_10230 16850 16527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10230 17098 16841 gene locus_tag LOCUS_10240 17098 16841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10240 19422 17236 gene locus_tag LOCUS_10250 19422 17236 CDS product glutamine synthetase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765057.1 protein_id gnl|my_center|LOCUS_10250 20688 19459 gene locus_tag LOCUS_10260 20688 19459 CDS product LL-diaminopimelate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765060.1 protein_id gnl|my_center|LOCUS_10260 21527 20745 gene locus_tag LOCUS_10270 gene dapF 21527 20745 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202959.1 protein_id gnl|my_center|LOCUS_10270 23967 22309 gene locus_tag LOCUS_10280 23967 22309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10280 25760 24090 gene locus_tag LOCUS_10290 gene asnB 25760 24090 CDS product asparagine synthase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202957.1 protein_id gnl|my_center|LOCUS_10290 27205 25781 gene locus_tag LOCUS_10300 27205 25781 CDS product glutamate synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763133.1 protein_id gnl|my_center|LOCUS_10300 31748 27231 gene locus_tag LOCUS_10310 gene gltB 31748 27231 CDS product glutamate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107318.1 protein_id gnl|my_center|LOCUS_10310 33281 32010 gene locus_tag LOCUS_10320 33281 32010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10320 33478 33927 gene locus_tag LOCUS_10330 33478 33927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_10330 33994 36273 gene locus_tag LOCUS_10340 33994 36273 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769481.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_10340 36310 37671 gene locus_tag LOCUS_10350 36310 37671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10350 37774 38244 gene locus_tag LOCUS_10360 37774 38244 CDS product toxin-antitoxin system YwqK family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029491510.1 protein_id gnl|my_center|LOCUS_10360 38851 38420 gene locus_tag LOCUS_10370 38851 38420 CDS product S4 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760336.1 protein_id gnl|my_center|LOCUS_10370 39435 38872 gene locus_tag LOCUS_10380 gene pth 39435 38872 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785758.1 protein_id gnl|my_center|LOCUS_10380 40105 39521 gene locus_tag LOCUS_10390 40105 39521 CDS product 50S ribosomal protein L25/general stress protein Ctc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785759.1 protein_id gnl|my_center|LOCUS_10390 41033 40242 gene locus_tag LOCUS_10400 41033 40242 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162992443.1 protein_id gnl|my_center|LOCUS_10400 42256 41033 gene locus_tag LOCUS_10410 42256 41033 CDS product NADH:flavin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769934.1 protein_id gnl|my_center|LOCUS_10410 42586 42293 gene locus_tag LOCUS_10420 42586 42293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762066.1 protein_id gnl|my_center|LOCUS_10420 45777 42757 gene locus_tag LOCUS_10430 45777 42757 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005804147.1 protein_id gnl|my_center|LOCUS_10430 46908 45883 gene locus_tag LOCUS_10440 46908 45883 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791602.1 protein_id gnl|my_center|LOCUS_10440 48319 46955 gene locus_tag LOCUS_10450 48319 46955 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791600.1 protein_id gnl|my_center|LOCUS_10450 48991 48389 gene locus_tag LOCUS_10460 48991 48389 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791598.1 protein_id gnl|my_center|LOCUS_10460 49303 50208 gene locus_tag LOCUS_10470 49303 50208 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763406.1 protein_id gnl|my_center|LOCUS_10470 50739 50203 gene locus_tag LOCUS_10480 50739 50203 CDS product DUF308 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763102.1 protein_id gnl|my_center|LOCUS_10480 51810 51664 gene locus_tag LOCUS_10490 51810 51664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10490 52126 53145 gene locus_tag LOCUS_10500 52126 53145 CDS product L,D-transpeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108011.1 protein_id gnl|my_center|LOCUS_10500 53294 53920 gene locus_tag LOCUS_10510 53294 53920 CDS product murein L,D-transpeptidase catalytic domain family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784354.1 protein_id gnl|my_center|LOCUS_10510 53980 54055 gene locus_tag LOCUS_t00100 53980 54055 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 54559 55893 gene locus_tag LOCUS_10520 54559 55893 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062694823.1 protein_id gnl|my_center|LOCUS_10520 55941 57191 gene locus_tag LOCUS_10530 55941 57191 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762307.1 protein_id gnl|my_center|LOCUS_10530 57204 59579 gene locus_tag LOCUS_10540 57204 59579 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202761.1 protein_id gnl|my_center|LOCUS_10540 59611 61938 gene locus_tag LOCUS_10550 59611 61938 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107802.1 protein_id gnl|my_center|LOCUS_10550 61960 64317 gene locus_tag LOCUS_10560 61960 64317 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009195517.1 protein_id gnl|my_center|LOCUS_10560 65377 64328 gene locus_tag LOCUS_10570 65377 64328 CDS product linear amide C-N hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769957.1 protein_id gnl|my_center|LOCUS_10570 65706 66308 gene locus_tag LOCUS_10580 65706 66308 CDS product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788568.1 protein_id gnl|my_center|LOCUS_10580 66512 67426 gene locus_tag LOCUS_10590 66512 67426 CDS product J domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107998.1 protein_id gnl|my_center|LOCUS_10590 67439 67756 gene locus_tag LOCUS_10600 67439 67756 CDS product chaperone modulator CbpM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005802742.1 protein_id gnl|my_center|LOCUS_10600 67903 67975 gene locus_tag LOCUS_t00110 67903 67975 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 69426 68071 gene locus_tag LOCUS_10610 69426 68071 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861455.1 protein_id gnl|my_center|LOCUS_10610 70815 69445 gene locus_tag LOCUS_10620 70815 69445 CDS product YihY/virulence factor BrkB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788563.1 protein_id gnl|my_center|LOCUS_10620 71604 73127 gene locus_tag LOCUS_10630 71604 73127 CDS product trypsin-like peptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788554.1 protein_id gnl|my_center|LOCUS_10630 73267 74127 gene locus_tag LOCUS_10640 73267 74127 CDS product RNA polymerase sigma factor RpoD/SigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002561589.1 protein_id gnl|my_center|LOCUS_10640 74235 75707 gene locus_tag LOCUS_10650 74235 75707 CDS product glycoside hydrolase family 125 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201944.1 protein_id gnl|my_center|LOCUS_10650 75810 77387 gene locus_tag LOCUS_10660 75810 77387 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032555796.1 protein_id gnl|my_center|LOCUS_10660 >Feature sequence014 63 1178 gene locus_tag LOCUS_10670 63 1178 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009292376.1 protein_id gnl|my_center|LOCUS_10670 1186 4323 gene locus_tag LOCUS_10680 1186 4323 CDS product multidrug efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202854.1 protein_id gnl|my_center|LOCUS_10680 4834 4433 gene locus_tag LOCUS_10690 4834 4433 CDS product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005794500.1 protein_id gnl|my_center|LOCUS_10690 5753 6730 gene locus_tag LOCUS_10700 5753 6730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10700 7226 6852 gene locus_tag LOCUS_10710 7226 6852 CDS product YbaN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764611.1 protein_id gnl|my_center|LOCUS_10710 8200 7226 gene locus_tag LOCUS_10720 gene fmt 8200 7226 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008770001.1 protein_id gnl|my_center|LOCUS_10720 10015 8231 gene locus_tag LOCUS_10730 10015 8231 CDS product chloride channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760864.1 protein_id gnl|my_center|LOCUS_10730 11417 10017 gene locus_tag LOCUS_10740 11417 10017 CDS product undecaprenyl-phosphate glucose phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461019.1 protein_id gnl|my_center|LOCUS_10740 11980 11420 gene locus_tag LOCUS_10750 11980 11420 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109029.1 protein_id gnl|my_center|LOCUS_10750 12204 13928 gene locus_tag LOCUS_10760 gene recJ 12204 13928 CDS product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203525.1 protein_id gnl|my_center|LOCUS_10760 13938 15854 gene locus_tag LOCUS_10770 13938 15854 CDS product RecQ family ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203526.1 protein_id gnl|my_center|LOCUS_10770 16863 15952 gene locus_tag LOCUS_10780 16863 15952 CDS product ThuA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921645.1 protein_id gnl|my_center|LOCUS_10780 17759 16908 gene locus_tag LOCUS_10790 17759 16908 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014548276.1 protein_id gnl|my_center|LOCUS_10790 19734 18004 gene locus_tag LOCUS_10800 19734 18004 CDS product putative transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793588.1 protein_id gnl|my_center|LOCUS_10800 19789 20598 gene locus_tag LOCUS_10810 19789 20598 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005792021.1 protein_id gnl|my_center|LOCUS_10810 20611 21000 gene locus_tag LOCUS_10820 20611 21000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10820 22127 20994 gene locus_tag LOCUS_10830 22127 20994 CDS product glycoside hydrolase family 43 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008658092.1 protein_id gnl|my_center|LOCUS_10830 23737 22133 gene locus_tag LOCUS_10840 23737 22133 CDS product FAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108284.1 protein_id gnl|my_center|LOCUS_10840 25121 23751 gene locus_tag LOCUS_10850 gene radA 25121 23751 CDS product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764082.1 protein_id gnl|my_center|LOCUS_10850 26171 25155 gene locus_tag LOCUS_10860 26171 25155 CDS product isoaspartyl peptidase/L-asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072178.1 protein_id gnl|my_center|LOCUS_10860 28734 26482 gene locus_tag LOCUS_10870 28734 26482 CDS product GH92 family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008658550.1 protein_id gnl|my_center|LOCUS_10870 28924 29505 gene locus_tag LOCUS_10880 28924 29505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10880 29454 29603 gene locus_tag LOCUS_10890 29454 29603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10890 30515 29682 gene locus_tag LOCUS_10900 gene tatC 30515 29682 CDS product twin-arginine translocase subunit TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005801307.1 protein_id gnl|my_center|LOCUS_10900 30716 30522 gene locus_tag LOCUS_10910 gene tatA 30716 30522 CDS product twin-arginine translocase TatA/TatE family subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760985.1 protein_id gnl|my_center|LOCUS_10910 30856 31737 gene locus_tag LOCUS_10920 gene fabD 30856 31737 CDS product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765648.1 protein_id gnl|my_center|LOCUS_10920 31906 32712 gene locus_tag LOCUS_10930 31906 32712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10930 33487 32723 gene locus_tag LOCUS_10940 33487 32723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10940 34632 33484 gene locus_tag LOCUS_10950 34632 33484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10950 36683 34755 gene locus_tag LOCUS_10960 36683 34755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10960 39883 36716 gene locus_tag LOCUS_10970 39883 36716 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766148.1 protein_id gnl|my_center|LOCUS_10970 42232 40289 gene locus_tag LOCUS_10980 42232 40289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10980 45372 42241 gene locus_tag LOCUS_10990 45372 42241 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766148.1 protein_id gnl|my_center|LOCUS_10990 45984 49397 gene locus_tag LOCUS_11000 45984 49397 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786949.1 protein_id gnl|my_center|LOCUS_11000 49421 51274 gene locus_tag LOCUS_11010 49421 51274 CDS product SusD/RagB family nutrient-binding outer membrane lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786951.1 protein_id gnl|my_center|LOCUS_11010 51404 51742 gene locus_tag LOCUS_11020 51404 51742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11020 51827 52030 gene locus_tag LOCUS_11030 51827 52030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11030 53036 52056 gene locus_tag LOCUS_11040 53036 52056 CDS product M20/M25/M40 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796268.1 protein_id gnl|my_center|LOCUS_11040 53455 53294 gene locus_tag LOCUS_11050 53455 53294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11050 54184 53642 gene locus_tag LOCUS_11060 54184 53642 CDS product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789526.1 protein_id gnl|my_center|LOCUS_11060 54995 54219 gene locus_tag LOCUS_11070 54995 54219 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785293.1 protein_id gnl|my_center|LOCUS_11070 55138 55893 gene locus_tag LOCUS_11080 55138 55893 CDS product DUF1080 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265727.1 protein_id gnl|my_center|LOCUS_11080 56076 57245 gene locus_tag LOCUS_11090 56076 57245 CDS product OprO/OprP family phosphate-selective porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785545.1 protein_id gnl|my_center|LOCUS_11090 61102 57551 gene locus_tag LOCUS_11100 gene nifJ 61102 57551 CDS product pyruvate:ferredoxin (flavodoxin) oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789619.1 protein_id gnl|my_center|LOCUS_11100 62250 61141 gene locus_tag LOCUS_11110 62250 61141 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763300.1 protein_id gnl|my_center|LOCUS_11110 63519 62500 gene locus_tag LOCUS_11120 63519 62500 CDS product branched-chain amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791729.1 protein_id gnl|my_center|LOCUS_11120 64060 65013 gene locus_tag LOCUS_11130 gene metF 64060 65013 CDS product methylenetetrahydrofolate reductase [NAD(P)H] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766920.1 protein_id gnl|my_center|LOCUS_11130 65269 66393 gene locus_tag LOCUS_11140 65269 66393 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108989.1 protein_id gnl|my_center|LOCUS_11140 67720 66398 gene locus_tag LOCUS_11150 67720 66398 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788174.1 protein_id gnl|my_center|LOCUS_11150 67829 68827 gene locus_tag LOCUS_11160 gene gldB 67829 68827 CDS product gliding motility lipoprotein GldB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202220.1 protein_id gnl|my_center|LOCUS_11160 69009 70580 gene locus_tag LOCUS_11170 69009 70580 CDS product ClC family H(+)/Cl(-) exchange transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202333.1 protein_id gnl|my_center|LOCUS_11170 71984 70662 gene locus_tag LOCUS_11180 71984 70662 CDS product DcaP family trimeric outer membrane transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202431.1 protein_id gnl|my_center|LOCUS_11180 >Feature sequence015 398 832 gene locus_tag LOCUS_11190 398 832 CDS product nucleotidyltransferase substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258723.1 protein_id gnl|my_center|LOCUS_11190 897 2264 gene locus_tag LOCUS_11200 897 2264 CDS product DUF1343 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108150.1 protein_id gnl|my_center|LOCUS_11200 2271 4328 gene locus_tag LOCUS_11210 2271 4328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11210 4827 4378 gene locus_tag LOCUS_11220 4827 4378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11220 5261 4827 gene locus_tag LOCUS_11230 5261 4827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11230 6364 5384 gene locus_tag LOCUS_11240 6364 5384 CDS product 6-bladed beta-propeller inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203752.1 protein_id gnl|my_center|LOCUS_11240 7556 6555 gene locus_tag LOCUS_11250 7556 6555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11250 7717 7553 gene locus_tag LOCUS_11260 7717 7553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11260 8669 7704 gene locus_tag LOCUS_11270 8669 7704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267860.1 protein_id gnl|my_center|LOCUS_11270 9055 8906 gene locus_tag LOCUS_11280 9055 8906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11280 10573 9176 gene locus_tag LOCUS_11290 10573 9176 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202606.1 protein_id gnl|my_center|LOCUS_11290 10713 12011 gene locus_tag LOCUS_11300 10713 12011 CDS product peptidoglycan DD-metalloendopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118840118.1 protein_id gnl|my_center|LOCUS_11300 12015 12383 gene locus_tag LOCUS_11310 12015 12383 CDS product YccF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764760.1 protein_id gnl|my_center|LOCUS_11310 13525 12695 gene locus_tag LOCUS_11320 gene murI 13525 12695 CDS product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202028.1 protein_id gnl|my_center|LOCUS_11320 14110 13616 gene locus_tag LOCUS_11330 14110 13616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11330 14700 14185 gene locus_tag LOCUS_11340 14700 14185 CDS product OmpH family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784368.1 protein_id gnl|my_center|LOCUS_11340 17548 14873 gene locus_tag LOCUS_11350 17548 14873 CDS product POTRA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784370.1 protein_id gnl|my_center|LOCUS_11350 18306 17563 gene locus_tag LOCUS_11360 18306 17563 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766989.1 protein_id gnl|my_center|LOCUS_11360 19022 18318 gene locus_tag LOCUS_11370 19022 18318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11370 20489 19104 gene locus_tag LOCUS_11380 20489 19104 CDS product DUF6242 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202030.1 protein_id gnl|my_center|LOCUS_11380 21679 20600 gene locus_tag LOCUS_11390 gene ribD 21679 20600 CDS product bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766987.1 protein_id gnl|my_center|LOCUS_11390 21736 22692 gene locus_tag LOCUS_11400 gene prmC 21736 22692 CDS product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202032.1 protein_id gnl|my_center|LOCUS_11400 22689 23189 gene locus_tag LOCUS_11410 22689 23189 CDS product regulatory protein RecX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784379.1 protein_id gnl|my_center|LOCUS_11410 23170 23859 gene locus_tag LOCUS_11420 23170 23859 CDS product ComF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108487.1 protein_id gnl|my_center|LOCUS_11420 23946 24581 gene locus_tag LOCUS_11430 gene pyrE 23946 24581 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784381.1 protein_id gnl|my_center|LOCUS_11430 24604 25017 gene locus_tag LOCUS_11440 24604 25017 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796501.1 protein_id gnl|my_center|LOCUS_11440 25031 26371 gene locus_tag LOCUS_11450 gene argH 25031 26371 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766984.1 protein_id gnl|my_center|LOCUS_11450 26364 26825 gene locus_tag LOCUS_11460 26364 26825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11460 26899 26972 gene locus_tag LOCUS_t00120 26899 26972 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 27182 27415 gene locus_tag LOCUS_11470 27182 27415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11470 27381 27776 gene locus_tag LOCUS_11480 27381 27776 CDS product DUF3037 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760453.1 protein_id gnl|my_center|LOCUS_11480 29339 27864 gene locus_tag LOCUS_11490 29339 27864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_11490 30157 29360 gene locus_tag LOCUS_11500 30157 29360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_11500 30635 30249 gene locus_tag LOCUS_11510 30635 30249 CDS product co-chaperone GroES family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932256.1 protein_id gnl|my_center|LOCUS_11510 31338 30745 gene locus_tag LOCUS_11520 31338 30745 CDS product DUF4251 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786125.1 protein_id gnl|my_center|LOCUS_11520 32769 31423 gene locus_tag LOCUS_11530 32769 31423 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766607.1 protein_id gnl|my_center|LOCUS_11530 33736 32777 gene locus_tag LOCUS_11540 33736 32777 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202775.1 protein_id gnl|my_center|LOCUS_11540 34827 33793 gene locus_tag LOCUS_11550 34827 33793 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787518.1 protein_id gnl|my_center|LOCUS_11550 35040 35417 gene locus_tag LOCUS_11560 35040 35417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11560 35383 35847 gene locus_tag LOCUS_11570 35383 35847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11570 36442 36032 gene locus_tag LOCUS_11580 36442 36032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11580 38076 36517 gene locus_tag LOCUS_11590 38076 36517 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767239.1 protein_id gnl|my_center|LOCUS_11590 40995 38095 gene locus_tag LOCUS_11600 40995 38095 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767240.1 protein_id gnl|my_center|LOCUS_11600 42229 41267 gene locus_tag LOCUS_11610 42229 41267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11610 44923 42923 gene locus_tag LOCUS_11620 44923 42923 CDS product fructose-1,6-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763412.1 protein_id gnl|my_center|LOCUS_11620 46446 44962 gene locus_tag LOCUS_11630 46446 44962 CDS product PD40 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813223.1 protein_id gnl|my_center|LOCUS_11630 48087 46450 gene locus_tag LOCUS_11640 48087 46450 CDS product DUF6057 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202172.1 protein_id gnl|my_center|LOCUS_11640 50803 48329 gene locus_tag LOCUS_11650 50803 48329 CDS product outer membrane beta-barrel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784143.1 protein_id gnl|my_center|LOCUS_11650 51025 51633 gene locus_tag LOCUS_11660 51025 51633 CDS product SagB/ThcOx family dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760532.1 protein_id gnl|my_center|LOCUS_11660 52027 51839 gene locus_tag LOCUS_11670 52027 51839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11670 54203 52032 gene locus_tag LOCUS_11680 54203 52032 CDS product peptidase domain-containing ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791796.1 protein_id gnl|my_center|LOCUS_11680 54943 54275 gene locus_tag LOCUS_11690 54943 54275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11690 55544 54954 gene locus_tag LOCUS_11700 55544 54954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11700 56136 55522 gene locus_tag LOCUS_11710 56136 55522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11710 57212 56268 gene locus_tag LOCUS_11720 57212 56268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11720 59567 57258 gene locus_tag LOCUS_11730 59567 57258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11730 60933 59599 gene locus_tag LOCUS_11740 60933 59599 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010993585.1 protein_id gnl|my_center|LOCUS_11740 61450 61313 gene locus_tag LOCUS_11750 61450 61313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11750 61833 62987 gene locus_tag LOCUS_11760 61833 62987 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201883.1 protein_id gnl|my_center|LOCUS_11760 62994 63686 gene locus_tag LOCUS_11770 62994 63686 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080003.1 protein_id gnl|my_center|LOCUS_11770 64053 65069 gene locus_tag LOCUS_11780 64053 65069 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109126.1 protein_id gnl|my_center|LOCUS_11780 65072 66250 gene locus_tag LOCUS_11790 65072 66250 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109126.1 protein_id gnl|my_center|LOCUS_11790 67958 66321 gene locus_tag LOCUS_11800 67958 66321 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765353.1 protein_id gnl|my_center|LOCUS_11800 69086 68076 gene locus_tag LOCUS_11810 69086 68076 CDS product adenosine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797481.1 protein_id gnl|my_center|LOCUS_11810 >Feature sequence016 326 916 gene locus_tag LOCUS_11820 gene hisH 326 916 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005803062.1 protein_id gnl|my_center|LOCUS_11820 913 1632 gene locus_tag LOCUS_11830 gene hisA 913 1632 CDS product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino]imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764911.1 protein_id gnl|my_center|LOCUS_11830 1650 2405 gene locus_tag LOCUS_11840 gene hisF 1650 2405 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762398.1 protein_id gnl|my_center|LOCUS_11840 2421 3017 gene locus_tag LOCUS_11850 gene hisIE 2421 3017 CDS product bifunctional phosphoribosyl-AMP cyclohydrolase/phosphoribosyl-ATP diphosphatase HisIE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762399.1 protein_id gnl|my_center|LOCUS_11850 3026 3703 gene locus_tag LOCUS_11860 3026 3703 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762400.1 protein_id gnl|my_center|LOCUS_11860 3770 5086 gene locus_tag LOCUS_11870 3770 5086 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764912.1 protein_id gnl|my_center|LOCUS_11870 5149 6309 gene locus_tag LOCUS_11880 gene lysA 5149 6309 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762402.1 protein_id gnl|my_center|LOCUS_11880 6419 7582 gene locus_tag LOCUS_11890 6419 7582 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795161.1 protein_id gnl|my_center|LOCUS_11890 7713 9440 gene locus_tag LOCUS_11900 7713 9440 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764485.1 protein_id gnl|my_center|LOCUS_11900 9949 9434 gene locus_tag LOCUS_11910 9949 9434 CDS product very short patch repair endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203406.1 protein_id gnl|my_center|LOCUS_11910 11236 9992 gene locus_tag LOCUS_11920 11236 9992 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762301.1 protein_id gnl|my_center|LOCUS_11920 12406 11237 gene locus_tag LOCUS_11930 12406 11237 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005776370.1 protein_id gnl|my_center|LOCUS_11930 13797 12514 gene locus_tag LOCUS_11940 13797 12514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11940 14758 13859 gene locus_tag LOCUS_11950 14758 13859 CDS product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000592064.1 protein_id gnl|my_center|LOCUS_11950 15292 14900 gene locus_tag LOCUS_11960 15292 14900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763961.1 protein_id gnl|my_center|LOCUS_11960 15750 15367 gene locus_tag LOCUS_11970 15750 15367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790982.1 protein_id gnl|my_center|LOCUS_11970 16608 16207 gene locus_tag LOCUS_11980 16608 16207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763961.1 protein_id gnl|my_center|LOCUS_11980 17602 16709 gene locus_tag LOCUS_11990 17602 16709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11990 18269 17613 gene locus_tag LOCUS_12000 18269 17613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12000 19473 18298 gene locus_tag LOCUS_12010 19473 18298 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763377.1 protein_id gnl|my_center|LOCUS_12010 21370 19487 gene locus_tag LOCUS_12020 21370 19487 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795166.1 protein_id gnl|my_center|LOCUS_12020 21470 22132 gene locus_tag LOCUS_12030 gene ung 21470 22132 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005802535.1 protein_id gnl|my_center|LOCUS_12030 22160 22870 gene locus_tag LOCUS_12040 22160 22870 CDS product DUF169 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107443.1 protein_id gnl|my_center|LOCUS_12040 22860 23171 gene locus_tag LOCUS_12050 22860 23171 CDS product MGMT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005802790.1 protein_id gnl|my_center|LOCUS_12050 23967 24953 gene locus_tag LOCUS_12060 gene msrB 23967 24953 CDS product peptide-methionine (R)-S-oxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203359.1 protein_id gnl|my_center|LOCUS_12060 25070 25879 gene locus_tag LOCUS_12070 25070 25879 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107775.1 protein_id gnl|my_center|LOCUS_12070 25990 26859 gene locus_tag LOCUS_12080 25990 26859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12080 27542 26976 gene locus_tag LOCUS_12090 27542 26976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12090 27690 28340 gene locus_tag LOCUS_12100 27690 28340 CDS product pentapeptide repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764720.1 protein_id gnl|my_center|LOCUS_12100 28597 28337 gene locus_tag LOCUS_12110 28597 28337 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788897.1 protein_id gnl|my_center|LOCUS_12110 31840 28601 gene locus_tag LOCUS_12120 31840 28601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12120 32976 31972 gene locus_tag LOCUS_12130 32976 31972 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764604.1 protein_id gnl|my_center|LOCUS_12130 34451 33000 gene locus_tag LOCUS_12140 34451 33000 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007333793.1 protein_id gnl|my_center|LOCUS_12140 35384 34602 gene locus_tag LOCUS_12150 35384 34602 CDS product porin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798129.1 protein_id gnl|my_center|LOCUS_12150 36492 35398 gene locus_tag LOCUS_12160 36492 35398 CDS product PCMD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766479.1 protein_id gnl|my_center|LOCUS_12160 36757 38070 gene locus_tag LOCUS_12170 36757 38070 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922199.1 protein_id gnl|my_center|LOCUS_12170 39639 38119 gene locus_tag LOCUS_12180 39639 38119 CDS product DUF4301 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787470.1 protein_id gnl|my_center|LOCUS_12180 39938 42028 gene locus_tag LOCUS_12190 39938 42028 CDS product RelA/SpoT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107405.1 protein_id gnl|my_center|LOCUS_12190 43588 42158 gene locus_tag LOCUS_12200 43588 42158 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162303110.1 protein_id gnl|my_center|LOCUS_12200 43677 44501 gene locus_tag LOCUS_12210 43677 44501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12210 47228 44610 gene locus_tag LOCUS_12220 47228 44610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12220 47860 47531 gene locus_tag LOCUS_12230 47860 47531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12230 49198 48353 gene locus_tag LOCUS_12240 49198 48353 CDS product mechanosensitive ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796397.1 protein_id gnl|my_center|LOCUS_12240 49357 50178 gene locus_tag LOCUS_12250 49357 50178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12250 51372 50311 gene locus_tag LOCUS_12260 gene leuB 51372 50311 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789841.1 protein_id gnl|my_center|LOCUS_12260 51831 51388 gene locus_tag LOCUS_12270 51831 51388 CDS product methylglyoxal synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004295275.1 protein_id gnl|my_center|LOCUS_12270 53354 51852 gene locus_tag LOCUS_12280 53354 51852 CDS product alpha-isopropylmalate synthase regulatory domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763199.1 protein_id gnl|my_center|LOCUS_12280 53956 53369 gene locus_tag LOCUS_12290 gene leuD 53956 53369 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789845.1 protein_id gnl|my_center|LOCUS_12290 55380 53983 gene locus_tag LOCUS_12300 gene leuC 55380 53983 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763197.1 protein_id gnl|my_center|LOCUS_12300 56897 55395 gene locus_tag LOCUS_12310 56897 55395 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763196.1 protein_id gnl|my_center|LOCUS_12310 60735 57307 gene locus_tag LOCUS_12320 60735 57307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12320 65145 60739 gene locus_tag LOCUS_12330 65145 60739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12330 65817 65353 gene locus_tag LOCUS_12340 65817 65353 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791037.1 protein_id gnl|my_center|LOCUS_12340 >Feature sequence017 1102 734 gene locus_tag LOCUS_12350 1102 734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12350 1640 1083 gene locus_tag LOCUS_12360 1640 1083 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767733.1 protein_id gnl|my_center|LOCUS_12360 1790 2200 gene locus_tag LOCUS_12370 1790 2200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108002.1 protein_id gnl|my_center|LOCUS_12370 2891 2250 gene locus_tag LOCUS_12380 2891 2250 CDS product carbohydrate-binding family 9-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762936.1 protein_id gnl|my_center|LOCUS_12380 3552 2893 gene locus_tag LOCUS_12390 3552 2893 CDS product LysE family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786014.1 protein_id gnl|my_center|LOCUS_12390 5410 3863 gene locus_tag LOCUS_12400 5410 3863 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795196.1 protein_id gnl|my_center|LOCUS_12400 7116 6094 gene locus_tag LOCUS_12410 7116 6094 CDS product virulence RhuM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681377.1 protein_id gnl|my_center|LOCUS_12410 7422 7195 gene locus_tag LOCUS_12420 7422 7195 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202676.1 protein_id gnl|my_center|LOCUS_12420 8436 8705 gene locus_tag LOCUS_12430 8436 8705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12430 8715 9374 gene locus_tag LOCUS_12440 8715 9374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12440 9566 9760 gene locus_tag LOCUS_12450 9566 9760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12450 10049 9708 gene locus_tag LOCUS_12460 10049 9708 CDS product type II toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002668012.1 protein_id gnl|my_center|LOCUS_12460 10321 10061 gene locus_tag LOCUS_12470 10321 10061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12470 10723 11964 gene locus_tag LOCUS_12480 10723 11964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108309.1 protein_id gnl|my_center|LOCUS_12480 11995 13206 gene locus_tag LOCUS_12490 11995 13206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12490 13224 14630 gene locus_tag LOCUS_12500 13224 14630 CDS product di-heme oxidoredictase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005680411.1 protein_id gnl|my_center|LOCUS_12500 14653 15888 gene locus_tag LOCUS_12510 14653 15888 CDS product OprO/OprP family phosphate-selective porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007748002.1 protein_id gnl|my_center|LOCUS_12510 15922 16605 gene locus_tag LOCUS_12520 15922 16605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12520 16617 17771 gene locus_tag LOCUS_12530 16617 17771 CDS product Rid family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005680414.1 protein_id gnl|my_center|LOCUS_12530 17854 18543 gene locus_tag LOCUS_12540 17854 18543 CDS product hemerythrin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763082.1 protein_id gnl|my_center|LOCUS_12540 18554 19168 gene locus_tag LOCUS_12550 18554 19168 CDS product LuxR C-terminal-related transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765039.1 protein_id gnl|my_center|LOCUS_12550 19582 23061 gene locus_tag LOCUS_12560 19582 23061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12560 24353 23283 gene locus_tag LOCUS_12570 24353 23283 CDS product nitronate monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016269667.1 protein_id gnl|my_center|LOCUS_12570 24609 25895 gene locus_tag LOCUS_12580 24609 25895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12580 25981 26799 gene locus_tag LOCUS_12590 25981 26799 CDS product PstS family phosphate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010538556.1 protein_id gnl|my_center|LOCUS_12590 27672 26893 gene locus_tag LOCUS_12600 27672 26893 CDS product UDP-2,3-diacylglucosamine diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767009.1 protein_id gnl|my_center|LOCUS_12600 27944 27669 gene locus_tag LOCUS_12610 27944 27669 CDS product iron-sulfur cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784330.1 protein_id gnl|my_center|LOCUS_12610 28765 28058 gene locus_tag LOCUS_12620 gene radC 28765 28058 CDS product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005801604.1 protein_id gnl|my_center|LOCUS_12620 29417 28851 gene locus_tag LOCUS_12630 gene efp 29417 28851 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766998.1 protein_id gnl|my_center|LOCUS_12630 30221 29517 gene locus_tag LOCUS_12640 30221 29517 CDS product LrgB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784312.1 protein_id gnl|my_center|LOCUS_12640 30563 30225 gene locus_tag LOCUS_12650 30563 30225 CDS product CidA/LrgA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963932.1 protein_id gnl|my_center|LOCUS_12650 32021 30675 gene locus_tag LOCUS_12660 gene mgtE 32021 30675 CDS product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760927.1 protein_id gnl|my_center|LOCUS_12660 32837 32037 gene locus_tag LOCUS_12670 gene rsmA 32837 32037 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760928.1 protein_id gnl|my_center|LOCUS_12670 33023 33946 gene locus_tag LOCUS_12680 33023 33946 CDS product lysylphosphatidylglycerol synthase transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760929.1 protein_id gnl|my_center|LOCUS_12680 33997 35451 gene locus_tag LOCUS_12690 33997 35451 CDS product aminoacyl-histidine dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764285.1 protein_id gnl|my_center|LOCUS_12690 36436 39810 gene locus_tag LOCUS_12700 36436 39810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12700 40058 42634 gene locus_tag LOCUS_12710 40058 42634 CDS product M14 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838916.1 protein_id gnl|my_center|LOCUS_12710 42690 43340 gene locus_tag LOCUS_12720 42690 43340 CDS product redox-sensing transcriptional repressor Rex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008770252.1 protein_id gnl|my_center|LOCUS_12720 43344 43958 gene locus_tag LOCUS_12730 43344 43958 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791742.1 protein_id gnl|my_center|LOCUS_12730 43955 47329 gene locus_tag LOCUS_12740 gene porU 43955 47329 CDS product type IX secretion system sortase PorU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963516.1 protein_id gnl|my_center|LOCUS_12740 47358 48623 gene locus_tag LOCUS_12750 gene porV 47358 48623 CDS product type IX secretion system outer membrane channel protein PorV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963515.1 protein_id gnl|my_center|LOCUS_12750 48624 49106 gene locus_tag LOCUS_12760 gene ispF 48624 49106 CDS product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764145.1 protein_id gnl|my_center|LOCUS_12760 49463 49116 gene locus_tag LOCUS_12770 49463 49116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12770 50215 49694 gene locus_tag LOCUS_12780 50215 49694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12780 51359 50307 gene locus_tag LOCUS_12790 51359 50307 CDS product 6-bladed beta-propeller inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201847.1 protein_id gnl|my_center|LOCUS_12790 51679 51443 gene locus_tag LOCUS_12800 51679 51443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12800 51742 51751 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 51862 52206 gene locus_tag LOCUS_12810 51862 52206 CDS product translation initiation factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764143.1 protein_id gnl|my_center|LOCUS_12810 52219 55386 gene locus_tag LOCUS_12820 52219 55386 CDS product UvrD-helicase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202755.1 protein_id gnl|my_center|LOCUS_12820 55459 56121 gene locus_tag LOCUS_12830 55459 56121 CDS product phosphatidylserine decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784739.1 protein_id gnl|my_center|LOCUS_12830 56190 56819 gene locus_tag LOCUS_12840 gene pssA 56190 56819 CDS product CDP-diacylglycerol--serine O-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784737.1 protein_id gnl|my_center|LOCUS_12840 56876 57154 gene locus_tag LOCUS_12850 56876 57154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12850 57598 57158 gene locus_tag LOCUS_12860 57598 57158 CDS product nucleoside deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784733.1 protein_id gnl|my_center|LOCUS_12860 57756 57595 gene locus_tag LOCUS_12870 57756 57595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12870 57865 58257 gene locus_tag LOCUS_12880 57865 58257 CDS product YraN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764002.1 protein_id gnl|my_center|LOCUS_12880 58270 58629 gene locus_tag LOCUS_12890 58270 58629 CDS product MmcQ/YjbR family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784727.1 protein_id gnl|my_center|LOCUS_12890 58616 59365 gene locus_tag LOCUS_12900 58616 59365 CDS product biotin--[acetyl-CoA-carboxylase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769390.1 protein_id gnl|my_center|LOCUS_12900 59967 63269 gene locus_tag LOCUS_12910 59967 63269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12910 64118 64312 gene locus_tag LOCUS_12920 64118 64312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12920 64323 64634 gene locus_tag LOCUS_12930 64323 64634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12930 >Feature sequence018 <1 1552 gene locus_tag LOCUS_12940 <1 1552 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011108455.1:DNA-directed RNA polymerase subunit beta' 1737 2576 gene locus_tag LOCUS_12950 1737 2576 CDS product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202553.1 protein_id gnl|my_center|LOCUS_12950 2592 3476 gene locus_tag LOCUS_12960 2592 3476 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005775503.1 protein_id gnl|my_center|LOCUS_12960 3839 4153 gene locus_tag LOCUS_12970 3839 4153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12970 5315 4353 gene locus_tag LOCUS_12980 5315 4353 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202024.1 protein_id gnl|my_center|LOCUS_12980 6870 5395 gene locus_tag LOCUS_12990 6870 5395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12990 8168 6921 gene locus_tag LOCUS_13000 8168 6921 CDS product glutamate-5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010992045.1 protein_id gnl|my_center|LOCUS_13000 9247 8174 gene locus_tag LOCUS_13010 gene proB 9247 8174 CDS product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202027.1 protein_id gnl|my_center|LOCUS_13010 10918 9263 gene locus_tag LOCUS_13020 10918 9263 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784390.1 protein_id gnl|my_center|LOCUS_13020 11485 10931 gene locus_tag LOCUS_13030 11485 10931 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784392.1 protein_id gnl|my_center|LOCUS_13030 12322 11669 gene locus_tag LOCUS_13040 12322 11669 CDS product DUF1349 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791447.1 protein_id gnl|my_center|LOCUS_13040 12664 12476 gene locus_tag LOCUS_13050 12664 12476 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459700.1 protein_id gnl|my_center|LOCUS_13050 12881 14512 gene locus_tag LOCUS_13060 gene pruA 12881 14512 CDS product L-glutamate gamma-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962584.1 protein_id gnl|my_center|LOCUS_13060 14539 15774 gene locus_tag LOCUS_13070 14539 15774 CDS product proline dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963816.1 protein_id gnl|my_center|LOCUS_13070 16719 15916 gene locus_tag LOCUS_13080 gene proC 16719 15916 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762694.1 protein_id gnl|my_center|LOCUS_13080 16874 18091 gene locus_tag LOCUS_13090 16874 18091 CDS product C1 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107980.1 protein_id gnl|my_center|LOCUS_13090 18811 18197 gene locus_tag LOCUS_13100 18811 18197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13100 20765 18906 gene locus_tag LOCUS_13110 20765 18906 CDS product mechanosensitive ion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203738.1 protein_id gnl|my_center|LOCUS_13110 23015 20781 gene locus_tag LOCUS_13120 23015 20781 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921395.1 protein_id gnl|my_center|LOCUS_13120 23145 23660 gene locus_tag LOCUS_13130 23145 23660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13130 23883 24827 gene locus_tag LOCUS_13140 23883 24827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13140 24824 25993 gene locus_tag LOCUS_13150 24824 25993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13150 26586 25999 gene locus_tag LOCUS_13160 26586 25999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765473.1 protein_id gnl|my_center|LOCUS_13160 29419 26741 gene locus_tag LOCUS_13170 29419 26741 CDS product calcium-translocating P-type ATPase, PMCA-type inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203665.1 protein_id gnl|my_center|LOCUS_13170 29542 29877 gene locus_tag LOCUS_13180 29542 29877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13180 29912 30871 gene locus_tag LOCUS_13190 29912 30871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13190 30986 31480 gene locus_tag LOCUS_13200 30986 31480 CDS product DUF4251 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765910.1 protein_id gnl|my_center|LOCUS_13200 32392 31466 gene locus_tag LOCUS_13210 32392 31466 CDS product TIGR01212 family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202224.1 protein_id gnl|my_center|LOCUS_13210 32752 32537 gene locus_tag LOCUS_13220 32752 32537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13220 32706 33005 gene locus_tag LOCUS_13230 32706 33005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13230 33466 33014 gene locus_tag LOCUS_13240 33466 33014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13240 33722 33889 gene locus_tag LOCUS_13250 33722 33889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13250 34130 34549 gene locus_tag LOCUS_13260 34130 34549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13260 34551 35873 gene locus_tag LOCUS_13270 34551 35873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13270 36251 38425 gene locus_tag LOCUS_13280 36251 38425 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795983.1 protein_id gnl|my_center|LOCUS_13280 38429 39274 gene locus_tag LOCUS_13290 gene lipA 38429 39274 CDS product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767975.1 protein_id gnl|my_center|LOCUS_13290 39709 40455 gene locus_tag LOCUS_13300 39709 40455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13300 40961 40461 gene locus_tag LOCUS_13310 40961 40461 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766431.1 protein_id gnl|my_center|LOCUS_13310 41020 43098 gene locus_tag LOCUS_13320 41020 43098 CDS product RNA degradosome polyphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008657449.1 protein_id gnl|my_center|LOCUS_13320 43104 43787 gene locus_tag LOCUS_13330 43104 43787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13330 44120 44995 gene locus_tag LOCUS_13340 44120 44995 CDS product DUF4837 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764535.1 protein_id gnl|my_center|LOCUS_13340 46381 44984 gene locus_tag LOCUS_13350 46381 44984 CDS product rRNA cytosine-C5-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203417.1 protein_id gnl|my_center|LOCUS_13350 46468 47139 gene locus_tag LOCUS_13360 46468 47139 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202221.1 protein_id gnl|my_center|LOCUS_13360 47150 47743 gene locus_tag LOCUS_13370 47150 47743 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582951.1 protein_id gnl|my_center|LOCUS_13370 47884 50106 gene locus_tag LOCUS_13380 47884 50106 CDS product GH92 family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762721.1 protein_id gnl|my_center|LOCUS_13380 50314 51687 gene locus_tag LOCUS_13390 50314 51687 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109290.1 protein_id gnl|my_center|LOCUS_13390 53473 51827 gene locus_tag LOCUS_13400 53473 51827 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202279.1 protein_id gnl|my_center|LOCUS_13400 55014 53473 gene locus_tag LOCUS_13410 55014 53473 CDS product family 43 glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109097.1 protein_id gnl|my_center|LOCUS_13410 55530 55018 gene locus_tag LOCUS_13420 55530 55018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109293.1 protein_id gnl|my_center|LOCUS_13420 56072 55587 gene locus_tag LOCUS_13430 56072 55587 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766887.1 protein_id gnl|my_center|LOCUS_13430 56604 56059 gene locus_tag LOCUS_13440 56604 56059 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107442.1 protein_id gnl|my_center|LOCUS_13440 57158 56601 gene locus_tag LOCUS_13450 57158 56601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13450 58000 57173 gene locus_tag LOCUS_13460 58000 57173 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202283.1 protein_id gnl|my_center|LOCUS_13460 58150 59436 gene locus_tag LOCUS_13470 58150 59436 CDS product TIGR01777 family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203144.1 protein_id gnl|my_center|LOCUS_13470 59854 59543 gene locus_tag LOCUS_13480 59854 59543 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764435.1 protein_id gnl|my_center|LOCUS_13480 60164 59829 gene locus_tag LOCUS_13490 60164 59829 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766756.1 protein_id gnl|my_center|LOCUS_13490 60788 60219 gene locus_tag LOCUS_13500 60788 60219 CDS product flavin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681169.1 protein_id gnl|my_center|LOCUS_13500 61331 60789 gene locus_tag LOCUS_13510 61331 60789 CDS product flavodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202636.1 protein_id gnl|my_center|LOCUS_13510 61602 62456 gene locus_tag LOCUS_13520 61602 62456 CDS product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795587.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13520 >Feature sequence019 80 6211 gene locus_tag LOCUS_13530 80 6211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13530 6281 6658 gene locus_tag LOCUS_13540 6281 6658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13540 6727 7083 gene locus_tag LOCUS_13550 6727 7083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13550 7605 8150 gene locus_tag LOCUS_13560 7605 8150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007246043.1 protein_id gnl|my_center|LOCUS_13560 8582 9484 gene locus_tag LOCUS_13570 8582 9484 CDS product outer membrane beta-barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_055229865.1 protein_id gnl|my_center|LOCUS_13570 9509 10432 gene locus_tag LOCUS_13580 9509 10432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13580 10566 11096 gene locus_tag LOCUS_13590 10566 11096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13590 11239 11943 gene locus_tag LOCUS_13600 11239 11943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787535.1 protein_id gnl|my_center|LOCUS_13600 12095 12499 gene locus_tag LOCUS_13610 12095 12499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13610 12510 13856 gene locus_tag LOCUS_13620 gene lpdA 12510 13856 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766155.1 protein_id gnl|my_center|LOCUS_13620 13893 14618 gene locus_tag LOCUS_13630 13893 14618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13630 14609 15370 gene locus_tag LOCUS_13640 14609 15370 CDS product uroporphyrinogen-III synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962359.1 protein_id gnl|my_center|LOCUS_13640 15370 15756 gene locus_tag LOCUS_13650 gene rnpA 15370 15756 CDS product ribonuclease P protein component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783651.1 protein_id gnl|my_center|LOCUS_13650 15961 16632 gene locus_tag LOCUS_13660 15961 16632 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783653.1 protein_id gnl|my_center|LOCUS_13660 16736 18028 gene locus_tag LOCUS_13670 gene tyrS 16736 18028 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783655.1 protein_id gnl|my_center|LOCUS_13670 18101 18172 gene locus_tag LOCUS_t00130 18101 18172 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 18348 19160 gene locus_tag LOCUS_13680 18348 19160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13680 19284 22106 gene locus_tag LOCUS_13690 19284 22106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203680.1 protein_id gnl|my_center|LOCUS_13690 22593 25637 gene locus_tag LOCUS_13700 22593 25637 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203678.1 protein_id gnl|my_center|LOCUS_13700 25667 27145 gene locus_tag LOCUS_13710 25667 27145 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203677.1 protein_id gnl|my_center|LOCUS_13710 27260 29425 gene locus_tag LOCUS_13720 27260 29425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13720 29653 31815 gene locus_tag LOCUS_13730 29653 31815 CDS product family 43 glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203676.1 protein_id gnl|my_center|LOCUS_13730 31825 33204 gene locus_tag LOCUS_13740 31825 33204 CDS product glucoamylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108887.1 protein_id gnl|my_center|LOCUS_13740 33369 35618 gene locus_tag LOCUS_13750 gene bglX 33369 35618 CDS product beta-glucosidase BglX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203679.1 protein_id gnl|my_center|LOCUS_13750 35633 37909 gene locus_tag LOCUS_13760 gene bglX 35633 37909 CDS product beta-glucosidase BglX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203679.1 protein_id gnl|my_center|LOCUS_13760 37928 39721 gene locus_tag LOCUS_13770 37928 39721 CDS product family 43 glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203676.1 protein_id gnl|my_center|LOCUS_13770 39897 40388 gene locus_tag LOCUS_13780 39897 40388 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694149.1 protein_id gnl|my_center|LOCUS_13780 40540 41331 gene locus_tag LOCUS_13790 40540 41331 CDS product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108741.1 protein_id gnl|my_center|LOCUS_13790 41625 42056 gene locus_tag LOCUS_13800 41625 42056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13800 42926 43744 gene locus_tag LOCUS_13810 42926 43744 CDS product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769516.1 protein_id gnl|my_center|LOCUS_13810 46606 43784 gene locus_tag LOCUS_13820 46606 43784 CDS product insulinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202237.1 protein_id gnl|my_center|LOCUS_13820 46922 50179 gene locus_tag LOCUS_13830 46922 50179 CDS product DUF2723 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783669.1 protein_id gnl|my_center|LOCUS_13830 50186 50797 gene locus_tag LOCUS_13840 50186 50797 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783668.1 protein_id gnl|my_center|LOCUS_13840 50797 51714 gene locus_tag LOCUS_13850 gene queG 50797 51714 CDS product tRNA epoxyqueuosine(34) reductase QueG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108711.1 protein_id gnl|my_center|LOCUS_13850 51721 53010 gene locus_tag LOCUS_13860 51721 53010 CDS product S28 family serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062695986.1 protein_id gnl|my_center|LOCUS_13860 53168 54052 gene locus_tag LOCUS_13870 53168 54052 CDS product zinc ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797001.1 protein_id gnl|my_center|LOCUS_13870 54036 54797 gene locus_tag LOCUS_13880 54036 54797 CDS product metal ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062696006.1 protein_id gnl|my_center|LOCUS_13880 54825 55031 gene locus_tag LOCUS_13890 54825 55031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13890 55028 56044 gene locus_tag LOCUS_13900 55028 56044 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783520.1 protein_id gnl|my_center|LOCUS_13900 56848 56048 gene locus_tag LOCUS_13910 56848 56048 CDS product head GIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010956832.1 protein_id gnl|my_center|LOCUS_13910 57633 56845 gene locus_tag LOCUS_13920 57633 56845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13920 58609 57785 gene locus_tag LOCUS_13930 58609 57785 CDS product head GIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258992.1 protein_id gnl|my_center|LOCUS_13930 59400 58630 gene locus_tag LOCUS_13940 59400 58630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13940 59552 60031 gene locus_tag LOCUS_13950 59552 60031 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783533.1 protein_id gnl|my_center|LOCUS_13950 >Feature sequence020 218 721 gene locus_tag LOCUS_13960 218 721 CDS product DUF4494 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762440.1 protein_id gnl|my_center|LOCUS_13960 726 1394 gene locus_tag LOCUS_13970 726 1394 CDS product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010538563.1 protein_id gnl|my_center|LOCUS_13970 1424 2401 gene locus_tag LOCUS_13980 1424 2401 CDS product dihydroorotate dehydrogenase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203072.1 protein_id gnl|my_center|LOCUS_13980 2545 2910 gene locus_tag LOCUS_13990 2545 2910 CDS product winged helix DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784476.1 protein_id gnl|my_center|LOCUS_13990 2978 5446 gene locus_tag LOCUS_14000 2978 5446 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784478.1 protein_id gnl|my_center|LOCUS_14000 6796 5522 gene locus_tag LOCUS_14010 gene serS 6796 5522 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785334.1 protein_id gnl|my_center|LOCUS_14010 7395 6844 gene locus_tag LOCUS_14020 7395 6844 CDS product NlpC/P60 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759987.1 protein_id gnl|my_center|LOCUS_14020 8316 7606 gene locus_tag LOCUS_14030 8316 7606 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817185.1 protein_id gnl|my_center|LOCUS_14030 9305 8313 gene locus_tag LOCUS_14040 9305 8313 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786905.1 protein_id gnl|my_center|LOCUS_14040 11861 9381 gene locus_tag LOCUS_14050 11861 9381 CDS product outer membrane beta-barrel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108886.1 protein_id gnl|my_center|LOCUS_14050 13924 11966 gene locus_tag LOCUS_14060 13924 11966 CDS product glycoside hydrolase family 97 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108029.1 protein_id gnl|my_center|LOCUS_14060 14043 15782 gene locus_tag LOCUS_14070 14043 15782 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032555717.1 protein_id gnl|my_center|LOCUS_14070 16331 15795 gene locus_tag LOCUS_14080 16331 15795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14080 17413 16394 gene locus_tag LOCUS_14090 gene tsaD 17413 16394 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107518.1 protein_id gnl|my_center|LOCUS_14090 17553 22016 gene locus_tag LOCUS_14100 17553 22016 CDS product translocation/assembly module TamB domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107519.1 protein_id gnl|my_center|LOCUS_14100 22905 21973 gene locus_tag LOCUS_14110 22905 21973 CDS product tRNA-dihydrouridine synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767537.1 protein_id gnl|my_center|LOCUS_14110 23572 22907 gene locus_tag LOCUS_14120 gene lipB 23572 22907 CDS product lipoyl(octanoyl) transferase LipB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787244.1 protein_id gnl|my_center|LOCUS_14120 24318 23518 gene locus_tag LOCUS_14130 gene mtgA 24318 23518 CDS product monofunctional biosynthetic peptidoglycan transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107650.1 protein_id gnl|my_center|LOCUS_14130 24459 26117 gene locus_tag LOCUS_14140 24459 26117 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107663.1 protein_id gnl|my_center|LOCUS_14140 26677 26168 gene locus_tag LOCUS_14150 26677 26168 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763441.1 protein_id gnl|my_center|LOCUS_14150 26943 28322 gene locus_tag LOCUS_14160 26943 28322 CDS product nodulation protein NfeD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230024.1 protein_id gnl|my_center|LOCUS_14160 28964 28329 gene locus_tag LOCUS_14170 28964 28329 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203360.1 protein_id gnl|my_center|LOCUS_14170 29092 31305 gene locus_tag LOCUS_14180 29092 31305 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107617.1 protein_id gnl|my_center|LOCUS_14180 31320 32075 gene locus_tag LOCUS_14190 gene kdsB 31320 32075 CDS product 3-deoxy-manno-octulosonate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761419.1 protein_id gnl|my_center|LOCUS_14190 33327 32092 gene locus_tag LOCUS_14200 33327 32092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14200 33709 33329 gene locus_tag LOCUS_14210 33709 33329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14210 35970 34069 gene locus_tag LOCUS_14220 gene yidC 35970 34069 CDS product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815482.1 protein_id gnl|my_center|LOCUS_14220 37588 35981 gene locus_tag LOCUS_14230 37588 35981 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788170.1 protein_id gnl|my_center|LOCUS_14230 38006 39550 gene locus_tag LOCUS_14240 38006 39550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14240 39652 40068 gene locus_tag LOCUS_14250 39652 40068 CDS product SoxR reducing system RseC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793421.1 protein_id gnl|my_center|LOCUS_14250 40078 41010 gene locus_tag LOCUS_14260 40078 41010 CDS product Fe-S cluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788160.1 protein_id gnl|my_center|LOCUS_14260 41022 42353 gene locus_tag LOCUS_14270 gene rsxC 41022 42353 CDS product electron transport complex subunit RsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107360.1 protein_id gnl|my_center|LOCUS_14270 42432 43334 gene locus_tag LOCUS_14280 42432 43334 CDS product RnfABCDGE type electron transport complex subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788156.1 protein_id gnl|my_center|LOCUS_14280 43337 43951 gene locus_tag LOCUS_14290 43337 43951 CDS product RnfABCDGE type electron transport complex subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202941.1 protein_id gnl|my_center|LOCUS_14290 43969 44553 gene locus_tag LOCUS_14300 43969 44553 CDS product electron transport complex subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788152.1 protein_id gnl|my_center|LOCUS_14300 44566 45138 gene locus_tag LOCUS_14310 gene rsxA 44566 45138 CDS product electron transport complex subunit RsxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005778198.1 protein_id gnl|my_center|LOCUS_14310 45152 46204 gene locus_tag LOCUS_14320 gene galE 45152 46204 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107362.1 protein_id gnl|my_center|LOCUS_14320 48172 46274 gene locus_tag LOCUS_14330 48172 46274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14330 48655 48194 gene locus_tag LOCUS_14340 48655 48194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14340 48978 48694 gene locus_tag LOCUS_14350 48978 48694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14350 50348 49101 gene locus_tag LOCUS_14360 50348 49101 CDS product DUF1015 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763485.1 protein_id gnl|my_center|LOCUS_14360 51284 50361 gene locus_tag LOCUS_14370 51284 50361 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765870.1 protein_id gnl|my_center|LOCUS_14370 52369 51302 gene locus_tag LOCUS_14380 gene serC 52369 51302 CDS product 3-phosphoserine/phosphohydroxythreonine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763483.1 protein_id gnl|my_center|LOCUS_14380 53773 52502 gene locus_tag LOCUS_14390 53773 52502 CDS product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765915.1 protein_id gnl|my_center|LOCUS_14390 55823 54255 gene locus_tag LOCUS_14400 55823 54255 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766448.1 protein_id gnl|my_center|LOCUS_14400 59043 55846 gene locus_tag LOCUS_14410 59043 55846 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766447.1 protein_id gnl|my_center|LOCUS_14410 >Feature sequence021 296 862 gene locus_tag LOCUS_14420 296 862 CDS product RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791946.1 protein_id gnl|my_center|LOCUS_14420 882 1085 gene locus_tag LOCUS_14430 882 1085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14430 1304 2266 gene locus_tag LOCUS_14440 1304 2266 CDS product FecR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766765.1 protein_id gnl|my_center|LOCUS_14440 2605 6054 gene locus_tag LOCUS_14450 2605 6054 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798139.1 protein_id gnl|my_center|LOCUS_14450 6075 7904 gene locus_tag LOCUS_14460 6075 7904 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107068.1 protein_id gnl|my_center|LOCUS_14460 7918 8760 gene locus_tag LOCUS_14470 7918 8760 CDS product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108968.1 protein_id gnl|my_center|LOCUS_14470 8798 9715 gene locus_tag LOCUS_14480 8798 9715 CDS product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004304952.1 protein_id gnl|my_center|LOCUS_14480 10664 13885 gene locus_tag LOCUS_14490 10664 13885 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759576.1 protein_id gnl|my_center|LOCUS_14490 13906 15417 gene locus_tag LOCUS_14500 13906 15417 CDS product SusD/RagB family nutrient-binding outer membrane lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_100991023.1 protein_id gnl|my_center|LOCUS_14500 15439 16143 gene locus_tag LOCUS_14510 15439 16143 CDS product DUF5012 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108196.1 protein_id gnl|my_center|LOCUS_14510 16157 16660 gene locus_tag LOCUS_14520 16157 16660 CDS product lipid-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759578.1 protein_id gnl|my_center|LOCUS_14520 16895 17464 gene locus_tag LOCUS_14530 16895 17464 CDS product RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766886.1 protein_id gnl|my_center|LOCUS_14530 17540 18523 gene locus_tag LOCUS_14540 17540 18523 CDS product FecR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765756.1 protein_id gnl|my_center|LOCUS_14540 18729 22106 gene locus_tag LOCUS_14550 18729 22106 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791110.1 protein_id gnl|my_center|LOCUS_14550 22125 23789 gene locus_tag LOCUS_14560 22125 23789 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791109.1 protein_id gnl|my_center|LOCUS_14560 23907 25610 gene locus_tag LOCUS_14570 23907 25610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14570 25597 27030 gene locus_tag LOCUS_14580 25597 27030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14580 27162 27716 gene locus_tag LOCUS_14590 27162 27716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14590 29910 28054 gene locus_tag LOCUS_14600 29910 28054 CDS product glycoside hydrolase family 2 TIM barrel-domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201936.1 protein_id gnl|my_center|LOCUS_14600 30187 31332 gene locus_tag LOCUS_14610 30187 31332 CDS product glycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107778.1 protein_id gnl|my_center|LOCUS_14610 31336 32592 gene locus_tag LOCUS_14620 31336 32592 CDS product GntP family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693828.1 protein_id gnl|my_center|LOCUS_14620 33040 32774 gene locus_tag LOCUS_14630 33040 32774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_14630 33393 33235 gene locus_tag LOCUS_14640 33393 33235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_14640 33810 34508 gene locus_tag LOCUS_14650 33810 34508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14650 34709 36910 gene locus_tag LOCUS_14660 34709 36910 CDS product GH92 family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108997.1 protein_id gnl|my_center|LOCUS_14660 37039 38781 gene locus_tag LOCUS_14670 37039 38781 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108823.1 protein_id gnl|my_center|LOCUS_14670 38903 40303 gene locus_tag LOCUS_14680 38903 40303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14680 40389 41210 gene locus_tag LOCUS_14690 40389 41210 CDS product alpha/beta hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786111.1 protein_id gnl|my_center|LOCUS_14690 41735 42994 gene locus_tag LOCUS_14700 gene aroA 41735 42994 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162303115.1 protein_id gnl|my_center|LOCUS_14700 43030 43449 gene locus_tag LOCUS_14710 43030 43449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763987.1 protein_id gnl|my_center|LOCUS_14710 43467 44270 gene locus_tag LOCUS_14720 43467 44270 CDS product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784764.1 protein_id gnl|my_center|LOCUS_14720 44278 47787 gene locus_tag LOCUS_14730 44278 47787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14730 47851 48159 gene locus_tag LOCUS_14740 47851 48159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14740 48845 48081 gene locus_tag LOCUS_14750 48845 48081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14750 50280 48961 gene locus_tag LOCUS_14760 50280 48961 CDS product peptidoglycan DD-metalloendopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010991962.1 protein_id gnl|my_center|LOCUS_14760 51132 50287 gene locus_tag LOCUS_14770 51132 50287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14770 52847 51129 gene locus_tag LOCUS_14780 52847 51129 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201932.1 protein_id gnl|my_center|LOCUS_14780 53310 52876 gene locus_tag LOCUS_14790 gene dut 53310 52876 CDS product dUTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767650.1 protein_id gnl|my_center|LOCUS_14790 55179 53344 gene locus_tag LOCUS_14800 55179 53344 CDS product 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203674.1 protein_id gnl|my_center|LOCUS_14800 55792 55286 gene locus_tag LOCUS_14810 gene purE 55792 55286 CDS product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797496.1 protein_id gnl|my_center|LOCUS_14810 56175 55795 gene locus_tag LOCUS_14820 gene gcvH 56175 55795 CDS product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203673.1 protein_id gnl|my_center|LOCUS_14820 56812 56192 gene locus_tag LOCUS_14830 56812 56192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14830 58276 56819 gene locus_tag LOCUS_14840 gene rpoN 58276 56819 CDS product RNA polymerase factor sigma-54 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108333.1 protein_id gnl|my_center|LOCUS_14840 >Feature sequence022 279 3068 gene locus_tag LOCUS_14850 279 3068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14850 3292 5478 gene locus_tag LOCUS_14860 3292 5478 CDS product DUF2339 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764135.1 protein_id gnl|my_center|LOCUS_14860 6756 5473 gene locus_tag LOCUS_14870 6756 5473 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108918.1 protein_id gnl|my_center|LOCUS_14870 6886 7725 gene locus_tag LOCUS_14880 gene folP 6886 7725 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767053.1 protein_id gnl|my_center|LOCUS_14880 7753 8538 gene locus_tag LOCUS_14890 gene cdaA 7753 8538 CDS product diadenylate cyclase CdaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005779023.1 protein_id gnl|my_center|LOCUS_14890 8666 9679 gene locus_tag LOCUS_14900 gene pta 8666 9679 CDS product phosphate acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762631.1 protein_id gnl|my_center|LOCUS_14900 9705 10907 gene locus_tag LOCUS_14910 9705 10907 CDS product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762632.1 protein_id gnl|my_center|LOCUS_14910 11060 11353 gene locus_tag LOCUS_14920 11060 11353 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759700.1 protein_id gnl|my_center|LOCUS_14920 11346 11717 gene locus_tag LOCUS_14930 11346 11717 CDS product DUF86 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759699.1 protein_id gnl|my_center|LOCUS_14930 11760 12470 gene locus_tag LOCUS_14940 gene pyrH 11760 12470 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759596.1 protein_id gnl|my_center|LOCUS_14940 12728 15289 gene locus_tag LOCUS_14950 12728 15289 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203735.1 protein_id gnl|my_center|LOCUS_14950 15457 17226 gene locus_tag LOCUS_14960 15457 17226 CDS product DUF4980 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767782.1 protein_id gnl|my_center|LOCUS_14960 17245 18117 gene locus_tag LOCUS_14970 17245 18117 CDS product carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011067996.1 protein_id gnl|my_center|LOCUS_14970 18121 19287 gene locus_tag LOCUS_14980 18121 19287 CDS product sugar MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763289.1 protein_id gnl|my_center|LOCUS_14980 19415 19978 gene locus_tag LOCUS_14990 gene frr 19415 19978 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005775374.1 protein_id gnl|my_center|LOCUS_14990 20074 21006 gene locus_tag LOCUS_15000 gene rsgA 20074 21006 CDS product ribosome small subunit-dependent GTPase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764015.1 protein_id gnl|my_center|LOCUS_15000 22347 21022 gene locus_tag LOCUS_15010 22347 21022 CDS product deoxyguanosinetriphosphate triphosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108842.1 protein_id gnl|my_center|LOCUS_15010 22971 26006 gene locus_tag LOCUS_15020 22971 26006 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203657.1 protein_id gnl|my_center|LOCUS_15020 26025 27677 gene locus_tag LOCUS_15030 26025 27677 CDS product SusD/RagB family nutrient-binding outer membrane lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786046.1 protein_id gnl|my_center|LOCUS_15030 27872 30424 gene locus_tag LOCUS_15040 27872 30424 CDS product beta galactosidase jelly roll domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108903.1 protein_id gnl|my_center|LOCUS_15040 31005 30403 gene locus_tag LOCUS_15050 31005 30403 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761010.1 protein_id gnl|my_center|LOCUS_15050 31864 31007 gene locus_tag LOCUS_15060 31864 31007 CDS product enoyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759864.1 protein_id gnl|my_center|LOCUS_15060 34465 32000 gene locus_tag LOCUS_15070 34465 32000 CDS product bifunctional UDP-N-acetylmuramoyl-tripeptide:D-alanyl-D-alanine ligase/alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785097.1 protein_id gnl|my_center|LOCUS_15070 35456 34470 gene locus_tag LOCUS_15080 35456 34470 CDS product GSCFA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764326.1 protein_id gnl|my_center|LOCUS_15080 36492 35695 gene locus_tag LOCUS_15090 36492 35695 CDS product basic secretory family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764203.1 protein_id gnl|my_center|LOCUS_15090 38839 36524 gene locus_tag LOCUS_15100 38839 36524 CDS product GH92 family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764202.1 protein_id gnl|my_center|LOCUS_15100 40615 39020 gene locus_tag LOCUS_15110 40615 39020 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767239.1 protein_id gnl|my_center|LOCUS_15110 43676 40647 gene locus_tag LOCUS_15120 43676 40647 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767240.1 protein_id gnl|my_center|LOCUS_15120 47823 43879 gene locus_tag LOCUS_15130 47823 43879 CDS product two-component regulator propeller domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108752.1 protein_id gnl|my_center|LOCUS_15130 48137 50377 gene locus_tag LOCUS_15140 gene pflB 48137 50377 CDS product formate C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903513.1 protein_id gnl|my_center|LOCUS_15140 50378 51112 gene locus_tag LOCUS_15150 gene pflA 50378 51112 CDS product pyruvate formate-lyase-activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903514.1 protein_id gnl|my_center|LOCUS_15150 51299 51889 gene locus_tag LOCUS_15160 51299 51889 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786786.1 protein_id gnl|my_center|LOCUS_15160 52091 52657 gene locus_tag LOCUS_15170 gene ahpC 52091 52657 CDS product alkyl hydroperoxide reductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005775969.1 protein_id gnl|my_center|LOCUS_15170 52677 54230 gene locus_tag LOCUS_15180 gene ahpF 52677 54230 CDS product alkyl hydroperoxide reductase subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202340.1 protein_id gnl|my_center|LOCUS_15180 54316 54666 gene locus_tag LOCUS_15190 54316 54666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788335.1 protein_id gnl|my_center|LOCUS_15190 54851 57160 gene locus_tag LOCUS_15200 54851 57160 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769027.1 protein_id gnl|my_center|LOCUS_15200 58163 57312 gene locus_tag LOCUS_15210 58163 57312 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764604.1 protein_id gnl|my_center|LOCUS_15210 >Feature sequence023 268 50 gene locus_tag LOCUS_15220 268 50 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15220 807 250 gene locus_tag LOCUS_15230 807 250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15230 1725 814 gene locus_tag LOCUS_15240 1725 814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15240 2193 1975 gene locus_tag LOCUS_15250 2193 1975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15250 3258 2401 gene locus_tag LOCUS_15260 3258 2401 CDS product DUF1573 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005799326.1 protein_id gnl|my_center|LOCUS_15260 4596 3820 gene locus_tag LOCUS_15270 4596 3820 CDS product IS3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765456.1 protein_id gnl|my_center|LOCUS_15270 5087 4680 gene locus_tag LOCUS_15280 5087 4680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15280 6216 5218 gene locus_tag LOCUS_15290 6216 5218 CDS product class II fructose-1,6-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763359.1 protein_id gnl|my_center|LOCUS_15290 6440 6694 gene locus_tag LOCUS_15300 6440 6694 CDS product type B 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005678397.1 protein_id gnl|my_center|LOCUS_15300 6783 7880 gene locus_tag LOCUS_15310 6783 7880 CDS product aminoglycoside phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785173.1 protein_id gnl|my_center|LOCUS_15310 8347 7946 gene locus_tag LOCUS_15320 8347 7946 CDS product Dabb family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329772.1 protein_id gnl|my_center|LOCUS_15320 9953 8652 gene locus_tag LOCUS_15330 9953 8652 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786305.1 protein_id gnl|my_center|LOCUS_15330 11336 9966 gene locus_tag LOCUS_15340 11336 9966 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762237.1 protein_id gnl|my_center|LOCUS_15340 12853 11387 gene locus_tag LOCUS_15350 12853 11387 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107843.1 protein_id gnl|my_center|LOCUS_15350 13704 13000 gene locus_tag LOCUS_15360 13704 13000 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764714.1 protein_id gnl|my_center|LOCUS_15360 14746 13706 gene locus_tag LOCUS_15370 14746 13706 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764715.1 protein_id gnl|my_center|LOCUS_15370 14965 15342 gene locus_tag LOCUS_15380 14965 15342 CDS product diacylglycerol kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005794207.1 protein_id gnl|my_center|LOCUS_15380 15380 15904 gene locus_tag LOCUS_15390 gene lpxF 15380 15904 CDS product lipid A 4'-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000734132.1 protein_id gnl|my_center|LOCUS_15390 17190 16003 gene locus_tag LOCUS_15400 17190 16003 CDS product FtsX-like permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764774.1 protein_id gnl|my_center|LOCUS_15400 18582 17281 gene locus_tag LOCUS_15410 18582 17281 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202449.1 protein_id gnl|my_center|LOCUS_15410 20002 18740 gene locus_tag LOCUS_15420 20002 18740 CDS product FtsX-like permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202450.1 protein_id gnl|my_center|LOCUS_15420 21341 20046 gene locus_tag LOCUS_15430 21341 20046 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202449.1 protein_id gnl|my_center|LOCUS_15430 22687 21389 gene locus_tag LOCUS_15440 22687 21389 CDS product FtsX-like permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202450.1 protein_id gnl|my_center|LOCUS_15440 24024 22705 gene locus_tag LOCUS_15450 24024 22705 CDS product FtsX-like permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202445.1 protein_id gnl|my_center|LOCUS_15450 24729 24094 gene locus_tag LOCUS_15460 24729 24094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15460 24836 25573 gene locus_tag LOCUS_15470 24836 25573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15470 26386 25721 gene locus_tag LOCUS_15480 26386 25721 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786290.1 protein_id gnl|my_center|LOCUS_15480 27965 26547 gene locus_tag LOCUS_15490 27965 26547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15490 28546 28196 gene locus_tag LOCUS_15500 28546 28196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15500 28817 28536 gene locus_tag LOCUS_15510 28817 28536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15510 30296 29028 gene locus_tag LOCUS_15520 30296 29028 CDS product FtsX-like permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005800756.1 protein_id gnl|my_center|LOCUS_15520 31623 30352 gene locus_tag LOCUS_15530 31623 30352 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202444.1 protein_id gnl|my_center|LOCUS_15530 32907 31654 gene locus_tag LOCUS_15540 32907 31654 CDS product FtsX-like permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005800756.1 protein_id gnl|my_center|LOCUS_15540 34204 32933 gene locus_tag LOCUS_15550 34204 32933 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202444.1 protein_id gnl|my_center|LOCUS_15550 35452 34208 gene locus_tag LOCUS_15560 35452 34208 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107845.1 protein_id gnl|my_center|LOCUS_15560 35636 36469 gene locus_tag LOCUS_15570 35636 36469 CDS product PepSY-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107520.1 protein_id gnl|my_center|LOCUS_15570 39042 36538 gene locus_tag LOCUS_15580 gene galB 39042 36538 CDS product beta-galactosidase GalB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202546.1 protein_id gnl|my_center|LOCUS_15580 39130 40440 gene locus_tag LOCUS_15590 39130 40440 CDS product anaerobic C4-dicarboxylate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791486.1 protein_id gnl|my_center|LOCUS_15590 40870 40511 gene locus_tag LOCUS_15600 40870 40511 CDS product thioredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107395.1 protein_id gnl|my_center|LOCUS_15600 40968 42167 gene locus_tag LOCUS_15610 gene ilvA 40968 42167 CDS product threonine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083156.1 protein_id gnl|my_center|LOCUS_15610 42614 42330 gene locus_tag LOCUS_15620 42614 42330 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762199.1 protein_id gnl|my_center|LOCUS_15620 43336 42599 gene locus_tag LOCUS_15630 43336 42599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107867.1 protein_id gnl|my_center|LOCUS_15630 45698 43326 gene locus_tag LOCUS_15640 45698 43326 CDS product outer membrane beta-barrel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107868.1 protein_id gnl|my_center|LOCUS_15640 46041 45703 gene locus_tag LOCUS_15650 46041 45703 CDS product DUF2141 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762156.1 protein_id gnl|my_center|LOCUS_15650 46409 46936 gene locus_tag LOCUS_15660 46409 46936 CDS product O-acetyl-ADP-ribose deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933872.1 protein_id gnl|my_center|LOCUS_15660 47576 46917 gene locus_tag LOCUS_15670 47576 46917 CDS product DUF5715 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759894.1 protein_id gnl|my_center|LOCUS_15670 47803 48795 gene locus_tag LOCUS_15680 47803 48795 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785156.1 protein_id gnl|my_center|LOCUS_15680 48807 49757 gene locus_tag LOCUS_15690 48807 49757 CDS product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759891.1 protein_id gnl|my_center|LOCUS_15690 49768 50511 gene locus_tag LOCUS_15700 gene ubiE 49768 50511 CDS product bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764422.1 protein_id gnl|my_center|LOCUS_15700 50526 51269 gene locus_tag LOCUS_15710 50526 51269 CDS product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202198.1 protein_id gnl|my_center|LOCUS_15710 51995 51378 gene locus_tag LOCUS_15720 51995 51378 CDS product 4'-phosphopantetheinyl transferase superfamily protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009291961.1 protein_id gnl|my_center|LOCUS_15720 52584 51997 gene locus_tag LOCUS_15730 52584 51997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15730 53937 52585 gene locus_tag LOCUS_15740 53937 52585 CDS product gliding motility-associated protein GldE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795192.1 protein_id gnl|my_center|LOCUS_15740 54472 53963 gene locus_tag LOCUS_15750 gene ssb 54472 53963 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107825.1 protein_id gnl|my_center|LOCUS_15750 54681 56465 gene locus_tag LOCUS_15760 54681 56465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15760 >Feature sequence024 1045 149 gene locus_tag LOCUS_15770 gene folD 1045 149 CDS product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767914.1 protein_id gnl|my_center|LOCUS_15770 2405 1068 gene locus_tag LOCUS_15780 gene ffh 2405 1068 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789195.1 protein_id gnl|my_center|LOCUS_15780 4360 2507 gene locus_tag LOCUS_15790 4360 2507 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032840776.1 protein_id gnl|my_center|LOCUS_15790 4935 4498 gene locus_tag LOCUS_15800 4935 4498 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795574.1 protein_id gnl|my_center|LOCUS_15800 6401 5079 gene locus_tag LOCUS_15810 6401 5079 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203189.1 protein_id gnl|my_center|LOCUS_15810 6850 6500 gene locus_tag LOCUS_15820 6850 6500 CDS product aspartate 1-decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759980.1 protein_id gnl|my_center|LOCUS_15820 7730 6864 gene locus_tag LOCUS_15830 gene panC 7730 6864 CDS product pantoate--beta-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202230.1 protein_id gnl|my_center|LOCUS_15830 7933 8628 gene locus_tag LOCUS_15840 7933 8628 CDS product glycogen/starch synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759978.1 protein_id gnl|my_center|LOCUS_15840 8640 10016 gene locus_tag LOCUS_15850 8640 10016 CDS product DUF4270 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202229.1 protein_id gnl|my_center|LOCUS_15850 11447 10155 gene locus_tag LOCUS_15860 11447 10155 CDS product glycoside hydrolase family 57 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785317.1 protein_id gnl|my_center|LOCUS_15860 12751 11483 gene locus_tag LOCUS_15870 12751 11483 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767983.1 protein_id gnl|my_center|LOCUS_15870 14670 12766 gene locus_tag LOCUS_15880 14670 12766 CDS product glycogen debranching enzyme N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202228.1 protein_id gnl|my_center|LOCUS_15880 15961 14978 gene locus_tag LOCUS_15890 15961 14978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15890 17664 15958 gene locus_tag LOCUS_15900 17664 15958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15900 20120 17661 gene locus_tag LOCUS_15910 20120 17661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15910 23375 20133 gene locus_tag LOCUS_15920 23375 20133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15920 24987 23413 gene locus_tag LOCUS_15930 24987 23413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15930 26138 25098 gene locus_tag LOCUS_15940 26138 25098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15940 26808 26128 gene locus_tag LOCUS_15950 26808 26128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15950 26966 27193 gene locus_tag LOCUS_15960 26966 27193 CDS product DUF4248 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790540.1 protein_id gnl|my_center|LOCUS_15960 27438 27929 gene locus_tag LOCUS_15970 27438 27929 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109078.1 protein_id gnl|my_center|LOCUS_15970 28100 28615 gene locus_tag LOCUS_15980 28100 28615 CDS product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766752.1 protein_id gnl|my_center|LOCUS_15980 28809 31938 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtctcaataccgctctcgcagtagactaagcagtc 31939 32038 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 32039 32277 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtctcaataccgctctcgcagtagactaagcagtca 35309 33039 gene locus_tag LOCUS_15990 35309 33039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15990 36724 35408 gene locus_tag LOCUS_16000 36724 35408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16000 37580 36744 gene locus_tag LOCUS_16010 gene cmr4 37580 36744 CDS product type III-B CRISPR module RAMP protein Cmr4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986672.1 protein_id gnl|my_center|LOCUS_16010 38653 37580 gene locus_tag LOCUS_16020 38653 37580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16020 40122 38650 gene locus_tag LOCUS_16030 gene cas10 40122 38650 CDS product type III-B CRISPR-associated protein Cas10/Cmr2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986674.1 protein_id gnl|my_center|LOCUS_16030 41312 40119 gene locus_tag LOCUS_16040 41312 40119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986675.1 protein_id gnl|my_center|LOCUS_16040 42360 41374 gene locus_tag LOCUS_16050 42360 41374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16050 42647 42357 gene locus_tag LOCUS_16060 42647 42357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16060 44902 42635 gene locus_tag LOCUS_16070 44902 42635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16070 45525 44905 gene locus_tag LOCUS_16080 45525 44905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16080 47055 48593 gene locus_tag LOCUS_16090 47055 48593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16090 48720 50771 gene locus_tag LOCUS_16100 48720 50771 CDS product M3 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109177.1 protein_id gnl|my_center|LOCUS_16100 50852 51286 gene locus_tag LOCUS_16110 50852 51286 CDS product dCMP deaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759937.1 protein_id gnl|my_center|LOCUS_16110 51300 53033 gene locus_tag LOCUS_16120 51300 53033 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764456.1 protein_id gnl|my_center|LOCUS_16120 52939 53493 gene locus_tag LOCUS_16130 52939 53493 CDS product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008658777.1 protein_id gnl|my_center|LOCUS_16130 53896 53603 gene locus_tag LOCUS_16140 53896 53603 CDS product DUF721 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005775689.1 protein_id gnl|my_center|LOCUS_16140 54996 53899 gene locus_tag LOCUS_16150 gene recF 54996 53899 CDS product DNA replication and repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785234.1 protein_id gnl|my_center|LOCUS_16150 55145 55828 gene locus_tag LOCUS_16160 55145 55828 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785232.1 protein_id gnl|my_center|LOCUS_16160 55905 56387 gene locus_tag LOCUS_16170 gene ribH 55905 56387 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785230.1 protein_id gnl|my_center|LOCUS_16170 >Feature sequence025 1345 578 gene locus_tag LOCUS_16180 1345 578 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790717.1 protein_id gnl|my_center|LOCUS_16180 3196 1775 gene locus_tag LOCUS_16190 3196 1775 CDS product sialate O-acetylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767100.1 protein_id gnl|my_center|LOCUS_16190 4477 3278 gene locus_tag LOCUS_16200 4477 3278 CDS product cellobiose 2-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202171.1 protein_id gnl|my_center|LOCUS_16200 5861 4470 gene locus_tag LOCUS_16210 5861 4470 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032496674.1 protein_id gnl|my_center|LOCUS_16210 7052 5880 gene locus_tag LOCUS_16220 7052 5880 CDS product 4-O-beta-D-mannosyl-D-glucose phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202169.1 protein_id gnl|my_center|LOCUS_16220 8259 7153 gene locus_tag LOCUS_16230 8259 7153 CDS product glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785016.1 protein_id gnl|my_center|LOCUS_16230 9811 8345 gene locus_tag LOCUS_16240 9811 8345 CDS product PD40 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813223.1 protein_id gnl|my_center|LOCUS_16240 11587 9818 gene locus_tag LOCUS_16250 11587 9818 CDS product DUF6057 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202172.1 protein_id gnl|my_center|LOCUS_16250 13067 11595 gene locus_tag LOCUS_16260 13067 11595 CDS product PD40 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202208.1 protein_id gnl|my_center|LOCUS_16260 14629 13064 gene locus_tag LOCUS_16270 14629 13064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16270 15215 14613 gene locus_tag LOCUS_16280 15215 14613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16280 16527 15400 gene locus_tag LOCUS_16290 16527 15400 CDS product aminotransferase class III-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202045.1 protein_id gnl|my_center|LOCUS_16290 17510 16542 gene locus_tag LOCUS_16300 gene argC 17510 16542 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796494.1 protein_id gnl|my_center|LOCUS_16300 18706 17507 gene locus_tag LOCUS_16310 18706 17507 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005778881.1 protein_id gnl|my_center|LOCUS_16310 19311 18745 gene locus_tag LOCUS_16320 19311 18745 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784400.1 protein_id gnl|my_center|LOCUS_16320 19807 19367 gene locus_tag LOCUS_16330 19807 19367 CDS product arginine repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762699.1 protein_id gnl|my_center|LOCUS_16330 20189 20980 gene locus_tag LOCUS_16340 20189 20980 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963826.1 protein_id gnl|my_center|LOCUS_16340 22834 21026 gene locus_tag LOCUS_16350 22834 21026 CDS product MutS family DNA mismatch repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009293016.1 protein_id gnl|my_center|LOCUS_16350 23034 23822 gene locus_tag LOCUS_16360 23034 23822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16360 23964 25508 gene locus_tag LOCUS_16370 23964 25508 CDS product acyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005800651.1 protein_id gnl|my_center|LOCUS_16370 25521 27032 gene locus_tag LOCUS_16380 gene accC 25521 27032 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202499.1 protein_id gnl|my_center|LOCUS_16380 27044 27574 gene locus_tag LOCUS_16390 27044 27574 CDS product acetyl-CoA carboxylase biotin carboxyl carrier protein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786452.1 protein_id gnl|my_center|LOCUS_16390 27743 29170 gene locus_tag LOCUS_16400 gene nhaD 27743 29170 CDS product sodium:proton antiporter NhaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966224.1 protein_id gnl|my_center|LOCUS_16400 29178 30032 gene locus_tag LOCUS_16410 29178 30032 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784230.1 protein_id gnl|my_center|LOCUS_16410 30036 30866 gene locus_tag LOCUS_16420 gene murQ 30036 30866 CDS product N-acetylmuramic acid 6-phosphate etherase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760452.1 protein_id gnl|my_center|LOCUS_16420 30911 31552 gene locus_tag LOCUS_16430 30911 31552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760131.1 protein_id gnl|my_center|LOCUS_16430 31549 32124 gene locus_tag LOCUS_16440 31549 32124 CDS product uracil-DNA glycosylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008657288.1 protein_id gnl|my_center|LOCUS_16440 32332 33261 gene locus_tag LOCUS_16450 32332 33261 CDS product Abi family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946804.1 protein_id gnl|my_center|LOCUS_16450 33693 33472 gene locus_tag LOCUS_16460 33693 33472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16460 35441 35070 gene locus_tag LOCUS_16470 35441 35070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16470 36302 35454 gene locus_tag LOCUS_16480 36302 35454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16480 38108 36330 gene locus_tag LOCUS_16490 38108 36330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16490 41354 38121 gene locus_tag LOCUS_16500 41354 38121 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203678.1 protein_id gnl|my_center|LOCUS_16500 42597 41719 gene locus_tag LOCUS_16510 42597 41719 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005775503.1 protein_id gnl|my_center|LOCUS_16510 44830 42632 gene locus_tag LOCUS_16520 44830 42632 CDS product alpha-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201924.1 protein_id gnl|my_center|LOCUS_16520 46394 44901 gene locus_tag LOCUS_16530 46394 44901 CDS product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005802512.1 protein_id gnl|my_center|LOCUS_16530 46555 47268 gene locus_tag LOCUS_16540 46555 47268 CDS product pirin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789136.1 protein_id gnl|my_center|LOCUS_16540 48636 47344 gene locus_tag LOCUS_16550 48636 47344 CDS product IgA Peptidase M64 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797944.1 protein_id gnl|my_center|LOCUS_16550 48746 49222 gene locus_tag LOCUS_16560 48746 49222 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009291426.1 protein_id gnl|my_center|LOCUS_16560 49894 49262 gene locus_tag LOCUS_16570 49894 49262 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787656.1 protein_id gnl|my_center|LOCUS_16570 50067 51935 gene locus_tag LOCUS_16580 50067 51935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16580 52106 53332 gene locus_tag LOCUS_16590 52106 53332 CDS product glycine betaine/L-proline ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767787.1 protein_id gnl|my_center|LOCUS_16590 >Feature sequence026 957 2060 gene locus_tag LOCUS_16600 957 2060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16600 2127 2516 gene locus_tag LOCUS_16610 2127 2516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16610 2513 3661 gene locus_tag LOCUS_16620 2513 3661 CDS product MraY family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790532.1 protein_id gnl|my_center|LOCUS_16620 3745 3894 gene locus_tag LOCUS_16630 3745 3894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16630 3866 4351 gene locus_tag LOCUS_16640 3866 4351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16640 4836 4384 gene locus_tag LOCUS_16650 4836 4384 CDS product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767830.1 protein_id gnl|my_center|LOCUS_16650 6003 5542 gene locus_tag LOCUS_16660 6003 5542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16660 6470 6264 gene locus_tag LOCUS_16670 6470 6264 CDS product DUF4248 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763347.1 protein_id gnl|my_center|LOCUS_16670 8396 6558 gene locus_tag LOCUS_16680 8396 6558 CDS product DUF3987 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107945.1 protein_id gnl|my_center|LOCUS_16680 9058 8495 gene locus_tag LOCUS_16690 9058 8495 CDS product BT4734/BF3469 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767834.1 protein_id gnl|my_center|LOCUS_16690 9256 9600 gene locus_tag LOCUS_16700 9256 9600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16700 9652 11235 gene locus_tag LOCUS_16710 9652 11235 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107911.1 protein_id gnl|my_center|LOCUS_16710 11287 11520 gene locus_tag LOCUS_16720 11287 11520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16720 11584 13113 gene locus_tag LOCUS_16730 11584 13113 CDS product oligosaccharide flippase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016267807.1 protein_id gnl|my_center|LOCUS_16730 13120 14076 gene locus_tag LOCUS_16740 13120 14076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16740 14100 15125 gene locus_tag LOCUS_16750 14100 15125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16750 15136 15999 gene locus_tag LOCUS_16760 15136 15999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16760 16380 17045 gene locus_tag LOCUS_16770 16380 17045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16770 17100 18218 gene locus_tag LOCUS_16780 17100 18218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16780 19417 20565 gene locus_tag LOCUS_16790 19417 20565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16790 20565 21236 gene locus_tag LOCUS_16800 20565 21236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16800 21273 22373 gene locus_tag LOCUS_16810 21273 22373 CDS product polysaccharide pyruvyl transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143696.1 protein_id gnl|my_center|LOCUS_16810 22451 23581 gene locus_tag LOCUS_16820 22451 23581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16820 23609 24754 gene locus_tag LOCUS_16830 23609 24754 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550082.1 protein_id gnl|my_center|LOCUS_16830 24794 25051 gene locus_tag LOCUS_16840 24794 25051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16840 25048 25458 gene locus_tag LOCUS_16850 25048 25458 CDS product PIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680561.1 protein_id gnl|my_center|LOCUS_16850 25488 26540 gene locus_tag LOCUS_16860 25488 26540 CDS product NAD-dependent epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817148.1 protein_id gnl|my_center|LOCUS_16860 26557 27870 gene locus_tag LOCUS_16870 26557 27870 CDS product UDP-glucose/GDP-mannose dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817149.1 protein_id gnl|my_center|LOCUS_16870 28994 28086 gene locus_tag LOCUS_16880 28994 28086 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004079989.1 protein_id gnl|my_center|LOCUS_16880 29596 31482 gene locus_tag LOCUS_16890 29596 31482 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765068.1 protein_id gnl|my_center|LOCUS_16890 31479 32660 gene locus_tag LOCUS_16900 gene carA 31479 32660 CDS product glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107319.1 protein_id gnl|my_center|LOCUS_16900 32779 36006 gene locus_tag LOCUS_16910 gene carB 32779 36006 CDS product carbamoyl-phosphate synthase (glutamine-hydrolyzing) large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107320.1 protein_id gnl|my_center|LOCUS_16910 36073 36660 gene locus_tag LOCUS_16920 36073 36660 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786786.1 protein_id gnl|my_center|LOCUS_16920 36722 37462 gene locus_tag LOCUS_16930 36722 37462 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760113.1 protein_id gnl|my_center|LOCUS_16930 37459 38826 gene locus_tag LOCUS_16940 37459 38826 CDS product lactate utilization protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764614.1 protein_id gnl|my_center|LOCUS_16940 38826 39404 gene locus_tag LOCUS_16950 38826 39404 CDS product LUD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764615.1 protein_id gnl|my_center|LOCUS_16950 40642 39500 gene locus_tag LOCUS_16960 40642 39500 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763097.1 protein_id gnl|my_center|LOCUS_16960 41458 40685 gene locus_tag LOCUS_16970 gene trpA 41458 40685 CDS product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765046.1 protein_id gnl|my_center|LOCUS_16970 42149 41484 gene locus_tag LOCUS_16980 42149 41484 CDS product phosphoribosylanthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202963.1 protein_id gnl|my_center|LOCUS_16980 42940 42146 gene locus_tag LOCUS_16990 gene trpC 42940 42146 CDS product indole-3-glycerol phosphate synthase TrpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765048.1 protein_id gnl|my_center|LOCUS_16990 43952 42957 gene locus_tag LOCUS_17000 gene trpD 43952 42957 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005803789.1 protein_id gnl|my_center|LOCUS_17000 44687 44121 gene locus_tag LOCUS_17010 44687 44121 CDS product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763094.1 protein_id gnl|my_center|LOCUS_17010 46114 44747 gene locus_tag LOCUS_17020 46114 44747 CDS product anthranilate synthase component I family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788280.1 protein_id gnl|my_center|LOCUS_17020 47354 46161 gene locus_tag LOCUS_17030 gene trpB 47354 46161 CDS product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788278.1 protein_id gnl|my_center|LOCUS_17030 47805 49238 gene locus_tag LOCUS_17040 gene aspA 47805 49238 CDS product aspartate ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791488.1 protein_id gnl|my_center|LOCUS_17040 49413 50291 gene locus_tag LOCUS_17050 49413 50291 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764604.1 protein_id gnl|my_center|LOCUS_17050 50914 50342 gene locus_tag LOCUS_17060 50914 50342 CDS product RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786040.1 protein_id gnl|my_center|LOCUS_17060 51727 50981 gene locus_tag LOCUS_17070 gene gpmA 51727 50981 CDS product 2,3-diphosphoglycerate-dependent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789269.1 protein_id gnl|my_center|LOCUS_17070 52110 51742 gene locus_tag LOCUS_17080 52110 51742 CDS product DUF488 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109389.1 protein_id gnl|my_center|LOCUS_17080 52271 52900 gene locus_tag LOCUS_17090 52271 52900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17090 >Feature sequence027 73 1 gene locus_tag LOCUS_t00140 73 1 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 986 261 gene locus_tag LOCUS_17100 gene recO 986 261 CDS product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108822.1 protein_id gnl|my_center|LOCUS_17100 1065 1469 gene locus_tag LOCUS_17110 1065 1469 CDS product DUF2721 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788775.1 protein_id gnl|my_center|LOCUS_17110 1586 1658 gene locus_tag LOCUS_t00150 1586 1658 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 1699 1953 gene locus_tag LOCUS_17120 gene rpsT 1699 1953 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767624.1 protein_id gnl|my_center|LOCUS_17120 2022 2096 gene locus_tag LOCUS_t00160 2022 2096 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 2361 4223 gene locus_tag LOCUS_17130 gene gyrB 2361 4223 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783987.1 protein_id gnl|my_center|LOCUS_17130 4216 6000 gene locus_tag LOCUS_17140 4216 6000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17140 6023 7873 gene locus_tag LOCUS_17150 6023 7873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17150 7965 8876 gene locus_tag LOCUS_17160 7965 8876 CDS product M28 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797516.1 protein_id gnl|my_center|LOCUS_17160 8889 9314 gene locus_tag LOCUS_17170 8889 9314 CDS product SufE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763578.1 protein_id gnl|my_center|LOCUS_17170 10031 9432 gene locus_tag LOCUS_17180 10031 9432 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763678.1 protein_id gnl|my_center|LOCUS_17180 10466 10068 gene locus_tag LOCUS_17190 10466 10068 CDS product VanZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202006.1 protein_id gnl|my_center|LOCUS_17190 11683 10469 gene locus_tag LOCUS_17200 11683 10469 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767609.1 protein_id gnl|my_center|LOCUS_17200 13230 11815 gene locus_tag LOCUS_17210 13230 11815 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_155594933.1 protein_id gnl|my_center|LOCUS_17210 16398 13255 gene locus_tag LOCUS_17220 16398 13255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17220 16596 18431 gene locus_tag LOCUS_17230 16596 18431 CDS product glycoside hydrolase family 13 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203224.1 protein_id gnl|my_center|LOCUS_17230 19080 18574 gene locus_tag LOCUS_17240 19080 18574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17240 19874 20683 gene locus_tag LOCUS_17250 19874 20683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17250 21644 20808 gene locus_tag LOCUS_17260 21644 20808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17260 23109 21757 gene locus_tag LOCUS_17270 gene sufD 23109 21757 CDS product Fe-S cluster assembly protein SufD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201910.1 protein_id gnl|my_center|LOCUS_17270 23857 23102 gene locus_tag LOCUS_17280 gene sufC 23857 23102 CDS product Fe-S cluster assembly ATPase SufC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763669.1 protein_id gnl|my_center|LOCUS_17280 25345 23900 gene locus_tag LOCUS_17290 gene sufB 25345 23900 CDS product Fe-S cluster assembly protein SufB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783924.1 protein_id gnl|my_center|LOCUS_17290 25867 25376 gene locus_tag LOCUS_17300 25867 25376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17300 28791 25870 gene locus_tag LOCUS_17310 gene infB 28791 25870 CDS product translation initiation factor IF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783920.1 protein_id gnl|my_center|LOCUS_17310 30077 28812 gene locus_tag LOCUS_17320 gene nusA 30077 28812 CDS product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783919.1 protein_id gnl|my_center|LOCUS_17320 30555 30082 gene locus_tag LOCUS_17330 gene rimP 30555 30082 CDS product ribosome assembly cofactor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783918.1 protein_id gnl|my_center|LOCUS_17330 30940 33138 gene locus_tag LOCUS_17340 30940 33138 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813448.1 protein_id gnl|my_center|LOCUS_17340 33159 33746 gene locus_tag LOCUS_17350 gene pnuC 33159 33746 CDS product nicotinamide riboside transporter PnuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108279.1 protein_id gnl|my_center|LOCUS_17350 33764 34423 gene locus_tag LOCUS_17360 33764 34423 CDS product thiamine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108280.1 protein_id gnl|my_center|LOCUS_17360 34884 34504 gene locus_tag LOCUS_17370 34884 34504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17370 36432 34936 gene locus_tag LOCUS_17380 36432 34936 CDS product DUF3868 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786444.1 protein_id gnl|my_center|LOCUS_17380 37016 36429 gene locus_tag LOCUS_17390 37016 36429 CDS product DUF3575 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107605.1 protein_id gnl|my_center|LOCUS_17390 37298 37029 gene locus_tag LOCUS_17400 37298 37029 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931854.1 protein_id gnl|my_center|LOCUS_17400 40870 38381 gene locus_tag LOCUS_17410 40870 38381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17410 41957 40881 gene locus_tag LOCUS_17420 41957 40881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17420 43007 41979 gene locus_tag LOCUS_17430 43007 41979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17430 44805 43324 gene locus_tag LOCUS_17440 44805 43324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17440 46452 44824 gene locus_tag LOCUS_17450 46452 44824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17450 48006 46678 gene locus_tag LOCUS_17460 48006 46678 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048053195.1 protein_id gnl|my_center|LOCUS_17460 48139 48975 gene locus_tag LOCUS_17470 48139 48975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17470 49192 50073 gene locus_tag LOCUS_17480 49192 50073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17480 >Feature sequence028 <1 683 gene locus_tag LOCUS_17490 <1 683 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005789145.1:uridine kinase 1986 640 gene locus_tag LOCUS_17500 1986 640 CDS product cobyrinate a,c-diamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932609.1 protein_id gnl|my_center|LOCUS_17500 2819 1998 gene locus_tag LOCUS_17510 gene panB 2819 1998 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787461.1 protein_id gnl|my_center|LOCUS_17510 3309 2863 gene locus_tag LOCUS_17520 3309 2863 CDS product cold shock domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765470.1 protein_id gnl|my_center|LOCUS_17520 3555 4133 gene locus_tag LOCUS_17530 3555 4133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17530 4211 5203 gene locus_tag LOCUS_17540 4211 5203 CDS product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766270.1 protein_id gnl|my_center|LOCUS_17540 5384 6070 gene locus_tag LOCUS_17550 5384 6070 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786394.1 protein_id gnl|my_center|LOCUS_17550 6158 7855 gene locus_tag LOCUS_17560 6158 7855 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762293.1 protein_id gnl|my_center|LOCUS_17560 7936 10005 gene locus_tag LOCUS_17570 7936 10005 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203187.1 protein_id gnl|my_center|LOCUS_17570 10764 10000 gene locus_tag LOCUS_17580 10764 10000 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798355.1 protein_id gnl|my_center|LOCUS_17580 11822 10761 gene locus_tag LOCUS_17590 11822 10761 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109044.1 protein_id gnl|my_center|LOCUS_17590 12745 11819 gene locus_tag LOCUS_17600 12745 11819 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109045.1 protein_id gnl|my_center|LOCUS_17600 17074 12764 gene locus_tag LOCUS_17610 17074 12764 CDS product CusA/CzcA family heavy metal efflux RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203498.1 protein_id gnl|my_center|LOCUS_17610 18182 17289 gene locus_tag LOCUS_17620 gene dapA 18182 17289 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761561.1 protein_id gnl|my_center|LOCUS_17620 18756 18235 gene locus_tag LOCUS_17630 18756 18235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17630 20751 18757 gene locus_tag LOCUS_17640 gene ligA 20751 18757 CDS product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765723.1 protein_id gnl|my_center|LOCUS_17640 21736 20753 gene locus_tag LOCUS_17650 21736 20753 CDS product PCMD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107259.1 protein_id gnl|my_center|LOCUS_17650 22875 21772 gene locus_tag LOCUS_17660 22875 21772 CDS product sulfotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760696.1 protein_id gnl|my_center|LOCUS_17660 24321 22879 gene locus_tag LOCUS_17670 gene cysN 24321 22879 CDS product sulfate adenylyltransferase subunit CysN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786535.1 protein_id gnl|my_center|LOCUS_17670 25242 24334 gene locus_tag LOCUS_17680 gene cysD 25242 24334 CDS product sulfate adenylyltransferase subunit CysD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005776455.1 protein_id gnl|my_center|LOCUS_17680 25862 25251 gene locus_tag LOCUS_17690 gene cysC 25862 25251 CDS product adenylyl-sulfate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202511.1 protein_id gnl|my_center|LOCUS_17690 27403 25850 gene locus_tag LOCUS_17700 27403 25850 CDS product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786530.1 protein_id gnl|my_center|LOCUS_17700 28459 27650 gene locus_tag LOCUS_17710 gene cysQ 28459 27650 CDS product 3'(2'),5'-bisphosphate nucleotidase CysQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786528.1 protein_id gnl|my_center|LOCUS_17710 29807 28512 gene locus_tag LOCUS_17720 29807 28512 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942128.1 protein_id gnl|my_center|LOCUS_17720 32930 29850 gene locus_tag LOCUS_17730 32930 29850 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262950.1 protein_id gnl|my_center|LOCUS_17730 33949 32927 gene locus_tag LOCUS_17740 33949 32927 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263238.1 protein_id gnl|my_center|LOCUS_17740 34104 34982 gene locus_tag LOCUS_17750 34104 34982 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763406.1 protein_id gnl|my_center|LOCUS_17750 35041 35355 gene locus_tag LOCUS_17760 35041 35355 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764355.1 protein_id gnl|my_center|LOCUS_17760 35352 35759 gene locus_tag LOCUS_17770 35352 35759 CDS product HEPN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392906.1 protein_id gnl|my_center|LOCUS_17770 36678 35773 gene locus_tag LOCUS_17780 36678 35773 CDS product glycyl-radical enzyme activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015848914.1 protein_id gnl|my_center|LOCUS_17780 39042 36682 gene locus_tag LOCUS_17790 39042 36682 CDS product glycyl radical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870178.1 protein_id gnl|my_center|LOCUS_17790 39460 41712 gene locus_tag LOCUS_17800 39460 41712 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009195517.1 protein_id gnl|my_center|LOCUS_17800 43334 41787 gene locus_tag LOCUS_17810 gene xylE 43334 41787 CDS product D-xylose transporter XylE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001097267.1 protein_id gnl|my_center|LOCUS_17810 44759 43431 gene locus_tag LOCUS_17820 gene xylA 44759 43431 CDS product xylose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107447.1 protein_id gnl|my_center|LOCUS_17820 46279 44795 gene locus_tag LOCUS_17830 46279 44795 CDS product FGGY-family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765651.1 protein_id gnl|my_center|LOCUS_17830 47032 46292 gene locus_tag LOCUS_17840 47032 46292 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107446.1 protein_id gnl|my_center|LOCUS_17840 47273 49093 gene locus_tag LOCUS_17850 47273 49093 CDS product potassium transporter TrkG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109365.1 protein_id gnl|my_center|LOCUS_17850 49106 49795 gene locus_tag LOCUS_17860 49106 49795 CDS product TrkA family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785882.1 protein_id gnl|my_center|LOCUS_17860 >Feature sequence029 3133 1466 gene locus_tag LOCUS_17870 3133 1466 CDS product nucleoside kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791317.1 protein_id gnl|my_center|LOCUS_17870 3217 4902 gene locus_tag LOCUS_17880 3217 4902 CDS product Na/Pi cotransporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765170.1 protein_id gnl|my_center|LOCUS_17880 4979 6361 gene locus_tag LOCUS_17890 4979 6361 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786996.1 protein_id gnl|my_center|LOCUS_17890 6373 7548 gene locus_tag LOCUS_17900 gene nagA 6373 7548 CDS product N-acetylglucosamine-6-phosphate deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765558.1 protein_id gnl|my_center|LOCUS_17900 7605 8618 gene locus_tag LOCUS_17910 7605 8618 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202490.1 protein_id gnl|my_center|LOCUS_17910 14355 8755 gene locus_tag LOCUS_17920 14355 8755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17920 14560 18267 gene locus_tag LOCUS_17930 14560 18267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17930 19718 18378 gene locus_tag LOCUS_17940 19718 18378 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460406.1 protein_id gnl|my_center|LOCUS_17940 20717 19863 gene locus_tag LOCUS_17950 20717 19863 CDS product phosphatidylinositol-specific phospholipase C/glycerophosphodiester phosphodiesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027645.1 protein_id gnl|my_center|LOCUS_17950 22491 20863 gene locus_tag LOCUS_17960 22491 20863 CDS product trehalase family glycosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202555.1 protein_id gnl|my_center|LOCUS_17960 23833 22739 gene locus_tag LOCUS_17970 23833 22739 CDS product alkaline phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005794948.1 protein_id gnl|my_center|LOCUS_17970 26597 23964 gene locus_tag LOCUS_17980 26597 23964 CDS product GH92 family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009292032.1 protein_id gnl|my_center|LOCUS_17980 28630 26999 gene locus_tag LOCUS_17990 28630 26999 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005794953.1 protein_id gnl|my_center|LOCUS_17990 32124 28672 gene locus_tag LOCUS_18000 32124 28672 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202552.1 protein_id gnl|my_center|LOCUS_18000 33483 32506 gene locus_tag LOCUS_18010 33483 32506 CDS product FecR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763955.1 protein_id gnl|my_center|LOCUS_18010 34124 33534 gene locus_tag LOCUS_18020 34124 33534 CDS product RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109055.1 protein_id gnl|my_center|LOCUS_18020 35600 34197 gene locus_tag LOCUS_18030 gene uxaC 35600 34197 CDS product glucuronate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765680.1 protein_id gnl|my_center|LOCUS_18030 36271 35597 gene locus_tag LOCUS_18040 36271 35597 CDS product bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763050.1 protein_id gnl|my_center|LOCUS_18040 37351 36308 gene locus_tag LOCUS_18050 37351 36308 CDS product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391957.1 protein_id gnl|my_center|LOCUS_18050 39002 37434 gene locus_tag LOCUS_18060 39002 37434 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766109.1 protein_id gnl|my_center|LOCUS_18060 40291 39302 gene locus_tag LOCUS_18070 gene dusB 40291 39302 CDS product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797153.1 protein_id gnl|my_center|LOCUS_18070 40571 41830 gene locus_tag LOCUS_18080 40571 41830 CDS product peptidase U32 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761719.1 protein_id gnl|my_center|LOCUS_18080 41830 42243 gene locus_tag LOCUS_18090 41830 42243 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783508.1 protein_id gnl|my_center|LOCUS_18090 42244 43362 gene locus_tag LOCUS_18100 gene dprA 42244 43362 CDS product DNA-processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048698553.1 protein_id gnl|my_center|LOCUS_18100 43772 43690 gene locus_tag LOCUS_t00170 43772 43690 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 44862 43846 gene locus_tag LOCUS_18110 44862 43846 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005801668.1 protein_id gnl|my_center|LOCUS_18110 45743 44874 gene locus_tag LOCUS_18120 45743 44874 CDS product DUF3316 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762529.1 protein_id gnl|my_center|LOCUS_18120 48482 45747 gene locus_tag LOCUS_18130 48482 45747 CDS product DNA gyrase/topoisomerase IV subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048696320.1 protein_id gnl|my_center|LOCUS_18130 >Feature sequence030 3169 1418 gene locus_tag LOCUS_18140 3169 1418 CDS product DUF6057 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202172.1 protein_id gnl|my_center|LOCUS_18140 4177 3251 gene locus_tag LOCUS_18150 gene pfkA 4177 3251 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761048.1 protein_id gnl|my_center|LOCUS_18150 5201 4329 gene locus_tag LOCUS_18160 5201 4329 CDS product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797949.1 protein_id gnl|my_center|LOCUS_18160 6074 5385 gene locus_tag LOCUS_18170 gene cmk 6074 5385 CDS product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769932.1 protein_id gnl|my_center|LOCUS_18170 7105 6095 gene locus_tag LOCUS_18180 7105 6095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18180 7313 8005 gene locus_tag LOCUS_18190 7313 8005 CDS product energy transducer TonB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761051.1 protein_id gnl|my_center|LOCUS_18190 8086 9060 gene locus_tag LOCUS_18200 8086 9060 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203421.1 protein_id gnl|my_center|LOCUS_18200 9064 9849 gene locus_tag LOCUS_18210 9064 9849 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817413.1 protein_id gnl|my_center|LOCUS_18210 9997 10085 gene locus_tag LOCUS_t00180 9997 10085 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 10165 10908 gene locus_tag LOCUS_18220 10165 10908 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790652.1 protein_id gnl|my_center|LOCUS_18220 10918 11391 gene locus_tag LOCUS_18230 10918 11391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790650.1 protein_id gnl|my_center|LOCUS_18230 11424 12014 gene locus_tag LOCUS_18240 11424 12014 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790648.1 protein_id gnl|my_center|LOCUS_18240 12014 12484 gene locus_tag LOCUS_18250 12014 12484 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005781259.1 protein_id gnl|my_center|LOCUS_18250 13085 12537 gene locus_tag LOCUS_18260 13085 12537 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766462.1 protein_id gnl|my_center|LOCUS_18260 13230 13700 gene locus_tag LOCUS_18270 13230 13700 CDS product Lrp/AsnC ligand binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761061.1 protein_id gnl|my_center|LOCUS_18270 15190 13784 gene locus_tag LOCUS_18280 gene asnS 15190 13784 CDS product asparagine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203550.1 protein_id gnl|my_center|LOCUS_18280 16210 15206 gene locus_tag LOCUS_18290 16210 15206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18290 16608 16192 gene locus_tag LOCUS_18300 16608 16192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18300 18102 16753 gene locus_tag LOCUS_18310 gene purB 18102 16753 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791759.1 protein_id gnl|my_center|LOCUS_18310 18333 18408 gene locus_tag LOCUS_t00190 18333 18408 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 18926 18519 gene locus_tag LOCUS_18320 18926 18519 CDS product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107464.1 protein_id gnl|my_center|LOCUS_18320 19159 19581 gene locus_tag LOCUS_18330 19159 19581 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948558.1 protein_id gnl|my_center|LOCUS_18330 19718 19644 gene locus_tag LOCUS_t00200 19718 19644 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 19915 20952 gene locus_tag LOCUS_18340 gene asnA 19915 20952 CDS product aspartate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790904.1 protein_id gnl|my_center|LOCUS_18340 20974 21636 gene locus_tag LOCUS_18350 gene ung 20974 21636 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759768.1 protein_id gnl|my_center|LOCUS_18350 24444 21700 gene locus_tag LOCUS_18360 24444 21700 CDS product putative LPS assembly protein LptD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203455.1 protein_id gnl|my_center|LOCUS_18360 25052 24510 gene locus_tag LOCUS_18370 25052 24510 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203456.1 protein_id gnl|my_center|LOCUS_18370 27611 25197 gene locus_tag LOCUS_18380 27611 25197 CDS product DPP IV N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839992.1 protein_id gnl|my_center|LOCUS_18380 27809 28942 gene locus_tag LOCUS_18390 27809 28942 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005834079.1 protein_id gnl|my_center|LOCUS_18390 29079 29291 gene locus_tag LOCUS_18400 29079 29291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18400 29288 29761 gene locus_tag LOCUS_18410 29288 29761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18410 29762 29995 gene locus_tag LOCUS_18420 29762 29995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18420 32249 30084 gene locus_tag LOCUS_18430 32249 30084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18430 32781 33365 gene locus_tag LOCUS_18440 32781 33365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18440 33692 34279 gene locus_tag LOCUS_18450 33692 34279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18450 34301 35920 gene locus_tag LOCUS_18460 34301 35920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18460 35959 42936 gene locus_tag LOCUS_18470 35959 42936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18470 42949 45267 gene locus_tag LOCUS_18480 42949 45267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18480 45298 46857 gene locus_tag LOCUS_18490 45298 46857 CDS product putative DNA binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109168.1 protein_id gnl|my_center|LOCUS_18490 46888 47181 gene locus_tag LOCUS_18500 46888 47181 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962894.1 protein_id gnl|my_center|LOCUS_18500 48181 47729 gene locus_tag LOCUS_18510 48181 47729 CDS product DsbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765180.1 protein_id gnl|my_center|LOCUS_18510 >Feature sequence031 93 2750 gene locus_tag LOCUS_18520 93 2750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18520 2771 8116 gene locus_tag LOCUS_18530 2771 8116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18530 8294 8446 gene locus_tag LOCUS_18540 8294 8446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18540 8447 8869 gene locus_tag LOCUS_18550 8447 8869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18550 9037 9915 gene locus_tag LOCUS_18560 9037 9915 CDS product permease-like cell division protein FtsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005779718.1 protein_id gnl|my_center|LOCUS_18560 9943 10182 gene locus_tag LOCUS_18570 9943 10182 CDS product DUF3098 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964448.1 protein_id gnl|my_center|LOCUS_18570 10179 10979 gene locus_tag LOCUS_18580 10179 10979 CDS product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783633.1 protein_id gnl|my_center|LOCUS_18580 10983 11690 gene locus_tag LOCUS_18590 gene truB 10983 11690 CDS product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783635.1 protein_id gnl|my_center|LOCUS_18590 11703 12752 gene locus_tag LOCUS_18600 gene queA 11703 12752 CDS product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762821.1 protein_id gnl|my_center|LOCUS_18600 12763 13221 gene locus_tag LOCUS_18610 gene folK 12763 13221 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783639.1 protein_id gnl|my_center|LOCUS_18610 13252 13446 gene locus_tag LOCUS_18620 13252 13446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18620 13635 14921 gene locus_tag LOCUS_18630 gene metK 13635 14921 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762826.1 protein_id gnl|my_center|LOCUS_18630 15852 15082 gene locus_tag LOCUS_18640 15852 15082 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764109.1 protein_id gnl|my_center|LOCUS_18640 16601 15855 gene locus_tag LOCUS_18650 16601 15855 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791870.1 protein_id gnl|my_center|LOCUS_18650 16921 17163 gene locus_tag LOCUS_18660 16921 17163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18660 17246 18418 gene locus_tag LOCUS_18670 17246 18418 CDS product 6-bladed beta-propeller inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203609.1 protein_id gnl|my_center|LOCUS_18670 18510 20054 gene locus_tag LOCUS_18680 18510 20054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18680 20067 21092 gene locus_tag LOCUS_18690 20067 21092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18690 21103 21888 gene locus_tag LOCUS_18700 21103 21888 CDS product galactosyltransferase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797451.1 protein_id gnl|my_center|LOCUS_18700 22168 22920 gene locus_tag LOCUS_18710 gene lptB 22168 22920 CDS product LPS export ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005782293.1 protein_id gnl|my_center|LOCUS_18710 23493 22915 gene locus_tag LOCUS_18720 23493 22915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18720 23946 25298 gene locus_tag LOCUS_18730 gene tig 23946 25298 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791866.1 protein_id gnl|my_center|LOCUS_18730 25488 26150 gene locus_tag LOCUS_18740 gene clpP 25488 26150 CDS product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005782306.1 protein_id gnl|my_center|LOCUS_18740 26172 27404 gene locus_tag LOCUS_18750 gene clpX 26172 27404 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791864.1 protein_id gnl|my_center|LOCUS_18750 27437 29617 gene locus_tag LOCUS_18760 gene recQ 27437 29617 CDS product DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764112.1 protein_id gnl|my_center|LOCUS_18760 29859 31307 gene locus_tag LOCUS_18770 gene guaB 29859 31307 CDS product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791859.1 protein_id gnl|my_center|LOCUS_18770 31401 33002 gene locus_tag LOCUS_18780 31401 33002 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963306.1 protein_id gnl|my_center|LOCUS_18780 33031 33870 gene locus_tag LOCUS_18790 33031 33870 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814398.1 protein_id gnl|my_center|LOCUS_18790 33950 35260 gene locus_tag LOCUS_18800 33950 35260 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760775.1 protein_id gnl|my_center|LOCUS_18800 35341 36858 gene locus_tag LOCUS_18810 35341 36858 CDS product OstA-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010993642.1 protein_id gnl|my_center|LOCUS_18810 36888 37190 gene locus_tag LOCUS_18820 36888 37190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18820 37190 39037 gene locus_tag LOCUS_18830 gene mutL 37190 39037 CDS product DNA mismatch repair endonuclease MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760778.1 protein_id gnl|my_center|LOCUS_18830 39802 43218 gene locus_tag LOCUS_18840 39802 43218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18840 43994 44404 gene locus_tag LOCUS_18850 gene rpsL 43994 44404 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005675419.1 protein_id gnl|my_center|LOCUS_18850 44558 45034 gene locus_tag LOCUS_18860 gene rpsG 44558 45034 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791536.1 protein_id gnl|my_center|LOCUS_18860 45058 47184 gene locus_tag LOCUS_18870 gene fusA 45058 47184 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762033.1 protein_id gnl|my_center|LOCUS_18870 47207 47512 gene locus_tag LOCUS_18880 gene rpsJ 47207 47512 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002558075.1 protein_id gnl|my_center|LOCUS_18880 >Feature sequence032 504 2696 gene locus_tag LOCUS_18890 504 2696 CDS product glutamine synthetase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765057.1 protein_id gnl|my_center|LOCUS_18890 3667 2804 gene locus_tag LOCUS_18900 3667 2804 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764604.1 protein_id gnl|my_center|LOCUS_18900 3766 5094 gene locus_tag LOCUS_18910 3766 5094 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786958.1 protein_id gnl|my_center|LOCUS_18910 5165 6445 gene locus_tag LOCUS_18920 5165 6445 CDS product O-acetylhomoserine aminocarboxypropyltransferase/cysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790318.1 protein_id gnl|my_center|LOCUS_18920 7967 6639 gene locus_tag LOCUS_18930 7967 6639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18930 9530 7980 gene locus_tag LOCUS_18940 9530 7980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18940 11098 9527 gene locus_tag LOCUS_18950 11098 9527 CDS product FHA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108469.1 protein_id gnl|my_center|LOCUS_18950 11728 11144 gene locus_tag LOCUS_18960 11728 11144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18960 12970 11768 gene locus_tag LOCUS_18970 12970 11768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18970 14192 12987 gene locus_tag LOCUS_18980 14192 12987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18980 15651 14206 gene locus_tag LOCUS_18990 15651 14206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18990 16593 15679 gene locus_tag LOCUS_19000 16593 15679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19000 18375 16639 gene locus_tag LOCUS_19010 18375 16639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19010 19121 18393 gene locus_tag LOCUS_19020 19121 18393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19020 20902 19748 gene locus_tag LOCUS_19030 20902 19748 CDS product glycosyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203171.1 protein_id gnl|my_center|LOCUS_19030 21256 20960 gene locus_tag LOCUS_19040 21256 20960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19040 23497 21341 gene locus_tag LOCUS_19050 23497 21341 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763951.1 protein_id gnl|my_center|LOCUS_19050 23763 24815 gene locus_tag LOCUS_19060 gene hemW 23763 24815 CDS product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203488.1 protein_id gnl|my_center|LOCUS_19060 25032 25532 gene locus_tag LOCUS_19070 25032 25532 CDS product zeta toxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766449.1 protein_id gnl|my_center|LOCUS_19070 25525 25692 gene locus_tag LOCUS_19080 25525 25692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19080 27991 25832 gene locus_tag LOCUS_19090 27991 25832 CDS product S46 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203170.1 protein_id gnl|my_center|LOCUS_19090 28461 27988 gene locus_tag LOCUS_19100 28461 27988 CDS product CYTH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108881.1 protein_id gnl|my_center|LOCUS_19100 29536 28451 gene locus_tag LOCUS_19110 29536 28451 CDS product DUF2027 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203494.1 protein_id gnl|my_center|LOCUS_19110 29744 30979 gene locus_tag LOCUS_19120 29744 30979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19120 30991 31626 gene locus_tag LOCUS_19130 30991 31626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19130 31836 33050 gene locus_tag LOCUS_19140 31836 33050 CDS product S-adenosylmethionine:tRNA ribosyltransferase-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760889.1 protein_id gnl|my_center|LOCUS_19140 33111 35087 gene locus_tag LOCUS_19150 33111 35087 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964499.1 protein_id gnl|my_center|LOCUS_19150 35447 35079 gene locus_tag LOCUS_19160 35447 35079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19160 36772 35624 gene locus_tag LOCUS_19170 36772 35624 CDS product galactose mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201945.1 protein_id gnl|my_center|LOCUS_19170 37166 37960 gene locus_tag LOCUS_19180 37166 37960 CDS product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761063.1 protein_id gnl|my_center|LOCUS_19180 38037 38534 gene locus_tag LOCUS_19190 38037 38534 CDS product dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797943.1 protein_id gnl|my_center|LOCUS_19190 38682 44303 gene locus_tag LOCUS_19200 38682 44303 CDS product alpha-2-macroglobulin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202133.1 protein_id gnl|my_center|LOCUS_19200 44496 44873 gene locus_tag LOCUS_19210 44496 44873 CDS product DUF1573 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005794475.1 protein_id gnl|my_center|LOCUS_19210 44900 46009 gene locus_tag LOCUS_19220 44900 46009 CDS product DUF1573 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796193.1 protein_id gnl|my_center|LOCUS_19220 46019 47116 gene locus_tag LOCUS_19230 gene meaB 46019 47116 CDS product methylmalonyl Co-A mutase-associated GTPase MeaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760933.1 protein_id gnl|my_center|LOCUS_19230 >Feature sequence033 <1 1223 gene locus_tag LOCUS_19240 <1 1223 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005775782.1:30S ribosomal protein S1 1547 1305 gene locus_tag LOCUS_19250 1547 1305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005778611.1 protein_id gnl|my_center|LOCUS_19250 1726 2373 gene locus_tag LOCUS_19260 1726 2373 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785068.1 protein_id gnl|my_center|LOCUS_19260 2719 3639 gene locus_tag LOCUS_19270 2719 3639 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760890.1 protein_id gnl|my_center|LOCUS_19270 3636 3911 gene locus_tag LOCUS_19280 3636 3911 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545969.1 protein_id gnl|my_center|LOCUS_19280 5092 3992 gene locus_tag LOCUS_19290 5092 3992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19290 6602 5133 gene locus_tag LOCUS_19300 6602 5133 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839858.1 protein_id gnl|my_center|LOCUS_19300 9655 7049 gene locus_tag LOCUS_19310 9655 7049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19310 9811 10344 gene locus_tag LOCUS_19320 9811 10344 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704720.1 protein_id gnl|my_center|LOCUS_19320 14111 10584 gene locus_tag LOCUS_19330 14111 10584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19330 15062 15262 gene locus_tag LOCUS_19340 15062 15262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19340 15266 15538 gene locus_tag LOCUS_19350 15266 15538 CDS product type II toxin-antitoxin system YafQ family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002676650.1 protein_id gnl|my_center|LOCUS_19350 16797 15535 gene locus_tag LOCUS_19360 16797 15535 CDS product serpin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584016.1 protein_id gnl|my_center|LOCUS_19360 17567 16977 gene locus_tag LOCUS_19370 gene folE 17567 16977 CDS product GTP cyclohydrolase I FolE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760851.1 protein_id gnl|my_center|LOCUS_19370 18112 17573 gene locus_tag LOCUS_19380 18112 17573 CDS product SPOR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791114.1 protein_id gnl|my_center|LOCUS_19380 18872 18150 gene locus_tag LOCUS_19390 gene tpiA 18872 18150 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791115.1 protein_id gnl|my_center|LOCUS_19390 20225 18942 gene locus_tag LOCUS_19400 20225 18942 CDS product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791116.1 protein_id gnl|my_center|LOCUS_19400 20776 20231 gene locus_tag LOCUS_19410 20776 20231 CDS product DUF1599 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203534.1 protein_id gnl|my_center|LOCUS_19410 22185 20935 gene locus_tag LOCUS_19420 22185 20935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19420 24492 22396 gene locus_tag LOCUS_19430 gene recG 24492 22396 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791121.1 protein_id gnl|my_center|LOCUS_19430 25260 24667 gene locus_tag LOCUS_19440 25260 24667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19440 26390 25257 gene locus_tag LOCUS_19450 26390 25257 CDS product 6-bladed beta-propeller inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816589.1 protein_id gnl|my_center|LOCUS_19450 26628 26395 gene locus_tag LOCUS_19460 26628 26395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19460 29064 27496 gene locus_tag LOCUS_19470 29064 27496 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766109.1 protein_id gnl|my_center|LOCUS_19470 29874 29173 gene locus_tag LOCUS_19480 29874 29173 CDS product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791123.1 protein_id gnl|my_center|LOCUS_19480 30071 29874 gene locus_tag LOCUS_19490 30071 29874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19490 31519 30173 gene locus_tag LOCUS_19500 gene xseA 31519 30173 CDS product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203547.1 protein_id gnl|my_center|LOCUS_19500 32882 31500 gene locus_tag LOCUS_19510 32882 31500 CDS product S8 family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005799138.1 protein_id gnl|my_center|LOCUS_19510 33413 32946 gene locus_tag LOCUS_19520 33413 32946 CDS product Lrp/AsnC ligand binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010993802.1 protein_id gnl|my_center|LOCUS_19520 34309 33599 gene locus_tag LOCUS_19530 34309 33599 CDS product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761811.1 protein_id gnl|my_center|LOCUS_19530 34917 34330 gene locus_tag LOCUS_19540 34917 34330 CDS product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761811.1 protein_id gnl|my_center|LOCUS_19540 35079 35768 gene locus_tag LOCUS_19550 35079 35768 CDS product NAD-dependent deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108550.1 protein_id gnl|my_center|LOCUS_19550 39674 36012 gene locus_tag LOCUS_19560 39674 36012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19560 41669 40710 gene locus_tag LOCUS_19570 41669 40710 CDS product PCMD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107259.1 protein_id gnl|my_center|LOCUS_19570 41802 43244 gene locus_tag LOCUS_19580 41802 43244 CDS product Na+/H+ antiporter NhaC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786127.1 protein_id gnl|my_center|LOCUS_19580 43328 44794 gene locus_tag LOCUS_19590 43328 44794 CDS product Na+/H+ antiporter NhaC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786127.1 protein_id gnl|my_center|LOCUS_19590 44763 45935 gene locus_tag LOCUS_19600 44763 45935 CDS product dicarboxylate/amino acid:cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808836.1 protein_id gnl|my_center|LOCUS_19600 46481 45936 gene locus_tag LOCUS_19610 46481 45936 CDS product 3'-5' exoribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762345.1 protein_id gnl|my_center|LOCUS_19610 >Feature sequence034 <1 616 gene locus_tag LOCUS_19620 <1 616 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008762034.1:50S ribosomal protein L3 616 1245 gene locus_tag LOCUS_19630 gene rplD 616 1245 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005782191.1 protein_id gnl|my_center|LOCUS_19630 1257 1550 gene locus_tag LOCUS_19640 gene rplW 1257 1550 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007747932.1 protein_id gnl|my_center|LOCUS_19640 1559 2383 gene locus_tag LOCUS_19650 gene rplB 1559 2383 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765427.1 protein_id gnl|my_center|LOCUS_19650 2404 2673 gene locus_tag LOCUS_19660 gene rpsS 2404 2673 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005782197.1 protein_id gnl|my_center|LOCUS_19660 2726 3136 gene locus_tag LOCUS_19670 gene rplV 2726 3136 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002558069.1 protein_id gnl|my_center|LOCUS_19670 3144 3878 gene locus_tag LOCUS_19680 gene rpsC 3144 3878 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762038.1 protein_id gnl|my_center|LOCUS_19680 3899 4333 gene locus_tag LOCUS_19690 gene rplP 3899 4333 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791549.1 protein_id gnl|my_center|LOCUS_19690 4339 4536 gene locus_tag LOCUS_19700 gene rpmC 4339 4536 CDS product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005782204.1 protein_id gnl|my_center|LOCUS_19700 4546 4803 gene locus_tag LOCUS_19710 gene rpsQ 4546 4803 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762040.1 protein_id gnl|my_center|LOCUS_19710 4805 5170 gene locus_tag LOCUS_19720 gene rplN 4805 5170 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004296340.1 protein_id gnl|my_center|LOCUS_19720 5190 5510 gene locus_tag LOCUS_19730 gene rplX 5190 5510 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791554.1 protein_id gnl|my_center|LOCUS_19730 5510 6067 gene locus_tag LOCUS_19740 gene rplE 5510 6067 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005675434.1 protein_id gnl|my_center|LOCUS_19740 6074 6343 gene locus_tag LOCUS_19750 gene rpsN 6074 6343 CDS product 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963457.1 protein_id gnl|my_center|LOCUS_19750 6402 6797 gene locus_tag LOCUS_19760 gene rpsH 6402 6797 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762043.1 protein_id gnl|my_center|LOCUS_19760 6814 7365 gene locus_tag LOCUS_19770 gene rplF 6814 7365 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791561.1 protein_id gnl|my_center|LOCUS_19770 7387 7731 gene locus_tag LOCUS_19780 gene rplR 7387 7731 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791562.1 protein_id gnl|my_center|LOCUS_19780 7731 8249 gene locus_tag LOCUS_19790 gene rpsE 7731 8249 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762045.1 protein_id gnl|my_center|LOCUS_19790 8267 8443 gene locus_tag LOCUS_19800 gene rpmD 8267 8443 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004296332.1 protein_id gnl|my_center|LOCUS_19800 8473 8919 gene locus_tag LOCUS_19810 gene rplO 8473 8919 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005804135.1 protein_id gnl|my_center|LOCUS_19810 8923 10263 gene locus_tag LOCUS_19820 gene secY 8923 10263 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005782223.1 protein_id gnl|my_center|LOCUS_19820 10268 11053 gene locus_tag LOCUS_19830 gene map 10268 11053 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108453.1 protein_id gnl|my_center|LOCUS_19830 11064 11282 gene locus_tag LOCUS_19840 gene infA 11064 11282 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002558052.1 protein_id gnl|my_center|LOCUS_19840 11242 11412 gene locus_tag LOCUS_19850 11242 11412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19850 11448 11828 gene locus_tag LOCUS_19860 gene rpsM 11448 11828 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002558050.1 protein_id gnl|my_center|LOCUS_19860 11840 12229 gene locus_tag LOCUS_19870 gene rpsK 11840 12229 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004296327.1 protein_id gnl|my_center|LOCUS_19870 12353 12958 gene locus_tag LOCUS_19880 gene rpsD 12353 12958 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791575.1 protein_id gnl|my_center|LOCUS_19880 12971 13963 gene locus_tag LOCUS_19890 12971 13963 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762051.1 protein_id gnl|my_center|LOCUS_19890 13971 14456 gene locus_tag LOCUS_19900 gene rplQ 13971 14456 CDS product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791577.1 protein_id gnl|my_center|LOCUS_19900 14637 15920 gene locus_tag LOCUS_19910 gene eno 14637 15920 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760327.1 protein_id gnl|my_center|LOCUS_19910 17630 21214 gene locus_tag LOCUS_19920 17630 21214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19920 21208 22824 gene locus_tag LOCUS_19930 21208 22824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19930 23355 23008 gene locus_tag LOCUS_19940 gene rplS 23355 23008 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005675578.1 protein_id gnl|my_center|LOCUS_19940 23575 26574 gene locus_tag LOCUS_19950 23575 26574 CDS product glycoside hydrolase family 3 N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202060.1 protein_id gnl|my_center|LOCUS_19950 26622 27650 gene locus_tag LOCUS_19960 gene cobD 26622 27650 CDS product threonine-phosphate decarboxylase CobD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008768909.1 protein_id gnl|my_center|LOCUS_19960 27884 27714 gene locus_tag LOCUS_19970 27884 27714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19970 28022 28759 gene locus_tag LOCUS_19980 28022 28759 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789007.1 protein_id gnl|my_center|LOCUS_19980 30211 28769 gene locus_tag LOCUS_19990 30211 28769 CDS product capsule assembly Wzi family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786397.1 protein_id gnl|my_center|LOCUS_19990 31317 30316 gene locus_tag LOCUS_20000 31317 30316 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207085.1 protein_id gnl|my_center|LOCUS_20000 31572 31877 gene locus_tag LOCUS_20010 31572 31877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20010 31936 32493 gene locus_tag LOCUS_20020 31936 32493 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766891.1 protein_id gnl|my_center|LOCUS_20020 32712 33791 gene locus_tag LOCUS_20030 32712 33791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20030 34052 37303 gene locus_tag LOCUS_20040 34052 37303 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202338.1 protein_id gnl|my_center|LOCUS_20040 37315 38847 gene locus_tag LOCUS_20050 37315 38847 CDS product SusD/RagB family nutrient-binding outer membrane lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785902.1 protein_id gnl|my_center|LOCUS_20050 38936 39979 gene locus_tag LOCUS_20060 38936 39979 CDS product SPOR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107471.1 protein_id gnl|my_center|LOCUS_20060 40212 40012 gene locus_tag LOCUS_20070 40212 40012 CDS product Arc family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764408.1 protein_id gnl|my_center|LOCUS_20070 40656 40264 gene locus_tag LOCUS_20080 40656 40264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20080 40792 42795 gene locus_tag LOCUS_20090 40792 42795 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761012.1 protein_id gnl|my_center|LOCUS_20090 45930 42856 gene locus_tag LOCUS_20100 45930 42856 CDS product carboxypeptidase regulatory-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765900.1 protein_id gnl|my_center|LOCUS_20100 >Feature sequence035 62 1270 gene locus_tag LOCUS_20110 62 1270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20110 1853 3490 gene locus_tag LOCUS_20120 1853 3490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767452.1 protein_id gnl|my_center|LOCUS_20120 3634 3972 gene locus_tag LOCUS_20130 3634 3972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20130 3984 4199 gene locus_tag LOCUS_20140 3984 4199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20140 4269 5396 gene locus_tag LOCUS_20150 4269 5396 CDS product 6-bladed beta-propeller inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203575.1 protein_id gnl|my_center|LOCUS_20150 5393 6280 gene locus_tag LOCUS_20160 5393 6280 CDS product DUF1573 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203167.1 protein_id gnl|my_center|LOCUS_20160 6293 7279 gene locus_tag LOCUS_20170 6293 7279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201954.1 protein_id gnl|my_center|LOCUS_20170 7398 8960 gene locus_tag LOCUS_20180 7398 8960 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107814.1 protein_id gnl|my_center|LOCUS_20180 9030 9929 gene locus_tag LOCUS_20190 9030 9929 CDS product serine acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762864.1 protein_id gnl|my_center|LOCUS_20190 10060 11610 gene locus_tag LOCUS_20200 10060 11610 CDS product THUMP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010991905.1 protein_id gnl|my_center|LOCUS_20200 11651 13792 gene locus_tag LOCUS_20210 11651 13792 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032555778.1 protein_id gnl|my_center|LOCUS_20210 13814 15085 gene locus_tag LOCUS_20220 gene purD 13814 15085 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108718.1 protein_id gnl|my_center|LOCUS_20220 15086 17692 gene locus_tag LOCUS_20230 15086 17692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20230 17856 18104 gene locus_tag LOCUS_20240 17856 18104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_20240 18355 18525 gene locus_tag LOCUS_20250 18355 18525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20250 18888 18541 gene locus_tag LOCUS_20260 18888 18541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20260 19943 22114 gene locus_tag LOCUS_20270 19943 22114 CDS product Plug domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008658068.1 protein_id gnl|my_center|LOCUS_20270 22739 23755 gene locus_tag LOCUS_20280 22739 23755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20280 23740 24189 gene locus_tag LOCUS_20290 23740 24189 CDS product VTT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783683.1 protein_id gnl|my_center|LOCUS_20290 25560 24286 gene locus_tag LOCUS_20300 25560 24286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20300 26619 25564 gene locus_tag LOCUS_20310 26619 25564 CDS product M20 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767146.1 protein_id gnl|my_center|LOCUS_20310 27541 26621 gene locus_tag LOCUS_20320 27541 26621 CDS product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203664.1 protein_id gnl|my_center|LOCUS_20320 27727 27557 gene locus_tag LOCUS_20330 27727 27557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20330 28273 27770 gene locus_tag LOCUS_20340 28273 27770 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763441.1 protein_id gnl|my_center|LOCUS_20340 28381 28390 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 28680 30962 gene locus_tag LOCUS_20350 28680 30962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20350 30976 31161 gene locus_tag LOCUS_20360 30976 31161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20360 31109 35107 gene locus_tag LOCUS_20370 31109 35107 CDS product hybrid sensor histidine kinase/response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108607.1 protein_id gnl|my_center|LOCUS_20370 35338 38184 gene locus_tag LOCUS_20380 35338 38184 CDS product glycoside hydrolase family 31 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036929.1 protein_id gnl|my_center|LOCUS_20380 38358 40820 gene locus_tag LOCUS_20390 38358 40820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20390 40843 43041 gene locus_tag LOCUS_20400 40843 43041 CDS product glycoside hydrolase family 3 C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108762.1 protein_id gnl|my_center|LOCUS_20400 43254 44204 gene locus_tag LOCUS_20410 43254 44204 CDS product Dyp-type peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202784.1 protein_id gnl|my_center|LOCUS_20410 45281 46186 gene locus_tag LOCUS_20420 45281 46186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20420 >Feature sequence036 37 1146 gene locus_tag LOCUS_20430 37 1146 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228257.1 protein_id gnl|my_center|LOCUS_20430 1204 2235 gene locus_tag LOCUS_20440 1204 2235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20440 2381 3547 gene locus_tag LOCUS_20450 2381 3547 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259192.1 protein_id gnl|my_center|LOCUS_20450 3537 4010 gene locus_tag LOCUS_20460 3537 4010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868781.1 protein_id gnl|my_center|LOCUS_20460 4119 4727 gene locus_tag LOCUS_20470 4119 4727 CDS product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002902061.1 protein_id gnl|my_center|LOCUS_20470 4720 5541 gene locus_tag LOCUS_20480 4720 5541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20480 5538 6452 gene locus_tag LOCUS_20490 5538 6452 CDS product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048420.1 protein_id gnl|my_center|LOCUS_20490 6449 7555 gene locus_tag LOCUS_20500 6449 7555 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937635.1 protein_id gnl|my_center|LOCUS_20500 7812 9530 gene locus_tag LOCUS_20510 7812 9530 CDS product nucleoside-diphosphate sugar epimerase/dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788730.1 protein_id gnl|my_center|LOCUS_20510 9493 10434 gene locus_tag LOCUS_20520 9493 10434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20520 10431 11171 gene locus_tag LOCUS_20530 10431 11171 CDS product YjbH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005800614.1 protein_id gnl|my_center|LOCUS_20530 11244 12404 gene locus_tag LOCUS_20540 11244 12404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20540 12666 12893 gene locus_tag LOCUS_20550 12666 12893 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760626.1 protein_id gnl|my_center|LOCUS_20550 12908 13987 gene locus_tag LOCUS_20560 12908 13987 CDS product 3-methyl-2-oxobutanoate dehydrogenase subunit VorB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786497.1 protein_id gnl|my_center|LOCUS_20560 13993 14163 gene locus_tag LOCUS_20570 13993 14163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20570 14176 14940 gene locus_tag LOCUS_20580 14176 14940 CDS product thiamine pyrophosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760623.1 protein_id gnl|my_center|LOCUS_20580 14959 15501 gene locus_tag LOCUS_20590 14959 15501 CDS product 2-oxoacid:acceptor oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760622.1 protein_id gnl|my_center|LOCUS_20590 15606 17687 gene locus_tag LOCUS_20600 15606 17687 CDS product putative porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107202.1 protein_id gnl|my_center|LOCUS_20600 17697 18521 gene locus_tag LOCUS_20610 17697 18521 CDS product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202508.1 protein_id gnl|my_center|LOCUS_20610 20347 18524 gene locus_tag LOCUS_20620 20347 18524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20620 20529 21809 gene locus_tag LOCUS_20630 20529 21809 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765688.1 protein_id gnl|my_center|LOCUS_20630 23942 21906 gene locus_tag LOCUS_20640 23942 21906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20640 25406 24090 gene locus_tag LOCUS_20650 gene tilS 25406 24090 CDS product tRNA lysidine(34) synthetase TilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107882.1 protein_id gnl|my_center|LOCUS_20650 26244 25480 gene locus_tag LOCUS_20660 26244 25480 CDS product C4-type zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787827.1 protein_id gnl|my_center|LOCUS_20660 27343 26246 gene locus_tag LOCUS_20670 27343 26246 CDS product Nif3-like dinuclear metal center hexameric protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202852.1 protein_id gnl|my_center|LOCUS_20670 29212 27455 gene locus_tag LOCUS_20680 gene aspS 29212 27455 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765710.1 protein_id gnl|my_center|LOCUS_20680 29506 29333 gene locus_tag LOCUS_20690 29506 29333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20690 30587 29775 gene locus_tag LOCUS_20700 30587 29775 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107948.1 protein_id gnl|my_center|LOCUS_20700 31607 30810 gene locus_tag LOCUS_20710 31607 30810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20710 32180 31611 gene locus_tag LOCUS_20720 gene rfbC 32180 31611 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868297.1 protein_id gnl|my_center|LOCUS_20720 33111 32200 gene locus_tag LOCUS_20730 33111 32200 CDS product NAD-dependent 4,6-dehydratase LegB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887356.1 protein_id gnl|my_center|LOCUS_20730 34186 33119 gene locus_tag LOCUS_20740 gene rfbG 34186 33119 CDS product CDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000565909.1 protein_id gnl|my_center|LOCUS_20740 35017 34202 gene locus_tag LOCUS_20750 gene rfbF 35017 34202 CDS product glucose-1-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816687.1 protein_id gnl|my_center|LOCUS_20750 36148 35060 gene locus_tag LOCUS_20760 36148 35060 CDS product CDP-glycerol glycerophosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905634.1 protein_id gnl|my_center|LOCUS_20760 36938 36267 gene locus_tag LOCUS_20770 gene rpe 36938 36267 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002354925.1 protein_id gnl|my_center|LOCUS_20770 37965 36928 gene locus_tag LOCUS_20780 37965 36928 CDS product galactitol-1-phosphate 5-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004058044.1 protein_id gnl|my_center|LOCUS_20780 38617 37970 gene locus_tag LOCUS_20790 38617 37970 CDS product IspD/TarI family cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460780.1 protein_id gnl|my_center|LOCUS_20790 39759 38782 gene locus_tag LOCUS_20800 39759 38782 CDS product glycosyltransferase family 8 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201896.1 protein_id gnl|my_center|LOCUS_20800 40046 40225 gene locus_tag LOCUS_20810 40046 40225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20810 42555 40990 gene locus_tag LOCUS_20820 42555 40990 CDS product sugar transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107733.1 protein_id gnl|my_center|LOCUS_20820 43544 42552 gene locus_tag LOCUS_20830 43544 42552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20830 44065 43739 gene locus_tag LOCUS_20840 44065 43739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20840 44962 44204 gene locus_tag LOCUS_20850 44962 44204 CDS product DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009039993.1 protein_id gnl|my_center|LOCUS_20850 45679 45014 gene locus_tag LOCUS_20860 45679 45014 CDS product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107947.1 protein_id gnl|my_center|LOCUS_20860 46065 45676 gene locus_tag LOCUS_20870 46065 45676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20870 >Feature sequence037 961 29 gene locus_tag LOCUS_20880 961 29 CDS product tyrosine-type DNA invertase cluster 3b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766168.1 protein_id gnl|my_center|LOCUS_20880 1048 1437 gene locus_tag LOCUS_20890 1048 1437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20890 1451 1633 gene locus_tag LOCUS_20900 1451 1633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002562412.1 protein_id gnl|my_center|LOCUS_20900 1799 3133 gene locus_tag LOCUS_20910 1799 3133 CDS product NADP-specific glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108072.1 protein_id gnl|my_center|LOCUS_20910 3322 4752 gene locus_tag LOCUS_20920 3322 4752 CDS product RNase adapter RapZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107905.1 protein_id gnl|my_center|LOCUS_20920 4749 5483 gene locus_tag LOCUS_20930 4749 5483 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767893.1 protein_id gnl|my_center|LOCUS_20930 8534 5580 gene locus_tag LOCUS_20940 8534 5580 CDS product PEP/pyruvate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761136.1 protein_id gnl|my_center|LOCUS_20940 8730 10064 gene locus_tag LOCUS_20950 gene gdhA 8730 10064 CDS product NADP-specific glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203378.1 protein_id gnl|my_center|LOCUS_20950 10720 10163 gene locus_tag LOCUS_20960 gene ruvC 10720 10163 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_199350787.1 protein_id gnl|my_center|LOCUS_20960 11064 10717 gene locus_tag LOCUS_20970 11064 10717 CDS product DUF4286 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203211.1 protein_id gnl|my_center|LOCUS_20970 11118 11194 gene locus_tag LOCUS_t00210 11118 11194 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 11505 11432 gene locus_tag LOCUS_t00220 11505 11432 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 12006 11545 gene locus_tag LOCUS_20980 12006 11545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20980 13085 12069 gene locus_tag LOCUS_20990 13085 12069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20990 13993 13142 gene locus_tag LOCUS_21000 13993 13142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21000 15887 14028 gene locus_tag LOCUS_21010 15887 14028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21010 18805 16184 gene locus_tag LOCUS_21020 18805 16184 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005801208.1 protein_id gnl|my_center|LOCUS_21020 19173 20087 gene locus_tag LOCUS_21030 19173 20087 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765521.1 protein_id gnl|my_center|LOCUS_21030 20109 22196 gene locus_tag LOCUS_21040 20109 22196 CDS product cytochrome c biogenesis protein CcdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203179.1 protein_id gnl|my_center|LOCUS_21040 22267 23052 gene locus_tag LOCUS_21050 gene mazG 22267 23052 CDS product nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785408.1 protein_id gnl|my_center|LOCUS_21050 23636 23163 gene locus_tag LOCUS_21060 23636 23163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785406.1 protein_id gnl|my_center|LOCUS_21060 24075 23683 gene locus_tag LOCUS_21070 24075 23683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21070 24776 24692 gene locus_tag LOCUS_t00230 24776 24692 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 26561 24921 gene locus_tag LOCUS_21080 gene groL 26561 24921 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763228.1 protein_id gnl|my_center|LOCUS_21080 26872 26603 gene locus_tag LOCUS_21090 26872 26603 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010539043.1 protein_id gnl|my_center|LOCUS_21090 28491 27061 gene locus_tag LOCUS_21100 28491 27061 CDS product glycoside hydrolase family 30 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948839.1 protein_id gnl|my_center|LOCUS_21100 29981 28626 gene locus_tag LOCUS_21110 gene hisS 29981 28626 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767712.1 protein_id gnl|my_center|LOCUS_21110 30843 30157 gene locus_tag LOCUS_21120 30843 30157 CDS product zinc metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763217.1 protein_id gnl|my_center|LOCUS_21120 32235 30964 gene locus_tag LOCUS_21130 32235 30964 CDS product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763215.1 protein_id gnl|my_center|LOCUS_21130 32730 32269 gene locus_tag LOCUS_21140 32730 32269 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767710.1 protein_id gnl|my_center|LOCUS_21140 33481 32786 gene locus_tag LOCUS_21150 33481 32786 CDS product DNA alkylation repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763213.1 protein_id gnl|my_center|LOCUS_21150 35521 33485 gene locus_tag LOCUS_21160 35521 33485 CDS product dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769535.1 protein_id gnl|my_center|LOCUS_21160 35715 36791 gene locus_tag LOCUS_21170 gene mnmA 35715 36791 CDS product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107145.1 protein_id gnl|my_center|LOCUS_21170 37810 36869 gene locus_tag LOCUS_21180 37810 36869 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008768748.1 protein_id gnl|my_center|LOCUS_21180 39714 38086 gene locus_tag LOCUS_21190 39714 38086 CDS product alpha-amylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765636.1 protein_id gnl|my_center|LOCUS_21190 40686 39850 gene locus_tag LOCUS_21200 40686 39850 CDS product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787611.1 protein_id gnl|my_center|LOCUS_21200 40934 43057 gene locus_tag LOCUS_21210 40934 43057 CDS product sodium-translocating pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767612.1 protein_id gnl|my_center|LOCUS_21210 43389 44942 gene locus_tag LOCUS_21220 43389 44942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21220 >Feature sequence038 848 201 gene locus_tag LOCUS_21230 848 201 CDS product superoxide dismutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107376.1 protein_id gnl|my_center|LOCUS_21230 1045 1584 gene locus_tag LOCUS_21240 1045 1584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21240 1692 2168 gene locus_tag LOCUS_21250 1692 2168 CDS product PaaI family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798782.1 protein_id gnl|my_center|LOCUS_21250 2197 3042 gene locus_tag LOCUS_21260 gene nfo 2197 3042 CDS product deoxyribonuclease IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795638.1 protein_id gnl|my_center|LOCUS_21260 3047 4456 gene locus_tag LOCUS_21270 gene nhaD 3047 4456 CDS product sodium:proton antiporter NhaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966224.1 protein_id gnl|my_center|LOCUS_21270 4469 6109 gene locus_tag LOCUS_21280 4469 6109 CDS product C69 family dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786228.1 protein_id gnl|my_center|LOCUS_21280 6168 6635 gene locus_tag LOCUS_21290 6168 6635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21290 7544 6894 gene locus_tag LOCUS_21300 7544 6894 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005794216.1 protein_id gnl|my_center|LOCUS_21300 7647 8456 gene locus_tag LOCUS_21310 7647 8456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21310 8563 9864 gene locus_tag LOCUS_21320 8563 9864 CDS product phenylacetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107332.1 protein_id gnl|my_center|LOCUS_21320 9885 10310 gene locus_tag LOCUS_21330 9885 10310 CDS product amino acid-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763158.1 protein_id gnl|my_center|LOCUS_21330 10377 11186 gene locus_tag LOCUS_21340 gene bamD 10377 11186 CDS product outer membrane protein assembly factor BamD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788200.1 protein_id gnl|my_center|LOCUS_21340 11211 11543 gene locus_tag LOCUS_21350 11211 11543 CDS product DNA-directed RNA polymerase subunit omega inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788198.1 protein_id gnl|my_center|LOCUS_21350 11620 12081 gene locus_tag LOCUS_21360 11620 12081 CDS product DUF4293 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788196.1 protein_id gnl|my_center|LOCUS_21360 12263 13795 gene locus_tag LOCUS_21370 12263 13795 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108979.1 protein_id gnl|my_center|LOCUS_21370 13818 14810 gene locus_tag LOCUS_21380 13818 14810 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796125.1 protein_id gnl|my_center|LOCUS_21380 14944 17823 gene locus_tag LOCUS_21390 14944 17823 CDS product PD-(D/E)XK nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202754.1 protein_id gnl|my_center|LOCUS_21390 18451 17975 gene locus_tag LOCUS_21400 18451 17975 CDS product GAF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107997.1 protein_id gnl|my_center|LOCUS_21400 18514 19863 gene locus_tag LOCUS_21410 18514 19863 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798170.1 protein_id gnl|my_center|LOCUS_21410 19853 20881 gene locus_tag LOCUS_21420 19853 20881 CDS product agmatine deiminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765713.1 protein_id gnl|my_center|LOCUS_21420 21033 21908 gene locus_tag LOCUS_21430 21033 21908 CDS product carbon-nitrogen hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761543.1 protein_id gnl|my_center|LOCUS_21430 21908 22915 gene locus_tag LOCUS_21440 21908 22915 CDS product aminodeoxychorismate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765632.1 protein_id gnl|my_center|LOCUS_21440 22899 23513 gene locus_tag LOCUS_21450 22899 23513 CDS product aminotransferase class IV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107438.1 protein_id gnl|my_center|LOCUS_21450 25405 23615 gene locus_tag LOCUS_21460 25405 23615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21460 27496 25475 gene locus_tag LOCUS_21470 27496 25475 CDS product DUF5686 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008658844.1 protein_id gnl|my_center|LOCUS_21470 28826 27615 gene locus_tag LOCUS_21480 gene preA 28826 27615 CDS product NAD-dependent dihydropyrimidine dehydrogenase subunit PreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987091.1 protein_id gnl|my_center|LOCUS_21480 31551 29122 gene locus_tag LOCUS_21490 31551 29122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21490 32311 31643 gene locus_tag LOCUS_21500 32311 31643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21500 32895 32506 gene locus_tag LOCUS_21510 32895 32506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21510 34596 33076 gene locus_tag LOCUS_21520 34596 33076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21520 37039 34685 gene locus_tag LOCUS_21530 37039 34685 CDS product carboxypeptidase-like regulatory domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203196.1 protein_id gnl|my_center|LOCUS_21530 38706 37189 gene locus_tag LOCUS_21540 38706 37189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21540 39891 38713 gene locus_tag LOCUS_21550 39891 38713 CDS product DUF4876 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004312956.1 protein_id gnl|my_center|LOCUS_21550 41830 39986 gene locus_tag LOCUS_21560 gene recQ 41830 39986 CDS product DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032555810.1 protein_id gnl|my_center|LOCUS_21560 42138 43403 gene locus_tag LOCUS_21570 42138 43403 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786517.1 protein_id gnl|my_center|LOCUS_21570 43659 43895 gene locus_tag LOCUS_21580 43659 43895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21580 43977 44999 gene locus_tag LOCUS_21590 43977 44999 CDS product FecR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049100798.1 protein_id gnl|my_center|LOCUS_21590 >Feature sequence039 4395 3214 gene locus_tag LOCUS_21600 4395 3214 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017115.1 protein_id gnl|my_center|LOCUS_21600 4858 4538 gene locus_tag LOCUS_21610 4858 4538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21610 5859 4945 gene locus_tag LOCUS_21620 5859 4945 CDS product ribonuclease Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005801215.1 protein_id gnl|my_center|LOCUS_21620 6184 7779 gene locus_tag LOCUS_21630 6184 7779 CDS product M28 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035282.1 protein_id gnl|my_center|LOCUS_21630 8905 7895 gene locus_tag LOCUS_21640 8905 7895 CDS product cytochrome d ubiquinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765918.1 protein_id gnl|my_center|LOCUS_21640 10523 9087 gene locus_tag LOCUS_21650 10523 9087 CDS product cytochrome ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763430.1 protein_id gnl|my_center|LOCUS_21650 11278 12660 gene locus_tag LOCUS_21660 11278 12660 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109263.1 protein_id gnl|my_center|LOCUS_21660 12684 13538 gene locus_tag LOCUS_21670 12684 13538 CDS product DUF1080 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763946.1 protein_id gnl|my_center|LOCUS_21670 13656 14162 gene locus_tag LOCUS_21680 13656 14162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21680 14168 15826 gene locus_tag LOCUS_21690 14168 15826 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921601.1 protein_id gnl|my_center|LOCUS_21690 16004 16411 gene locus_tag LOCUS_21700 16004 16411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21700 16422 16985 gene locus_tag LOCUS_21710 16422 16985 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256305.1 protein_id gnl|my_center|LOCUS_21710 16982 17365 gene locus_tag LOCUS_21720 16982 17365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21720 18497 17412 gene locus_tag LOCUS_21730 18497 17412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21730 19059 18523 gene locus_tag LOCUS_21740 19059 18523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21740 19592 19062 gene locus_tag LOCUS_21750 19592 19062 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786067.1 protein_id gnl|my_center|LOCUS_21750 20486 19725 gene locus_tag LOCUS_21760 20486 19725 CDS product NigD-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010992089.1 protein_id gnl|my_center|LOCUS_21760 21714 20581 gene locus_tag LOCUS_21770 gene lpxB 21714 20581 CDS product lipid-A-disaccharide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764238.1 protein_id gnl|my_center|LOCUS_21770 22499 21732 gene locus_tag LOCUS_21780 gene surE 22499 21732 CDS product 5'/3'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764237.1 protein_id gnl|my_center|LOCUS_21780 23566 22625 gene locus_tag LOCUS_21790 23566 22625 CDS product Rpn family recombination-promoting nuclease/putative transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108099.1 protein_id gnl|my_center|LOCUS_21790 24655 27864 gene locus_tag LOCUS_21800 24655 27864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21800 28197 28829 gene locus_tag LOCUS_21810 28197 28829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21810 29025 29480 gene locus_tag LOCUS_21820 gene rplM 29025 29480 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005782434.1 protein_id gnl|my_center|LOCUS_21820 29486 29872 gene locus_tag LOCUS_21830 gene rpsI 29486 29872 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109004.1 protein_id gnl|my_center|LOCUS_21830 30013 30849 gene locus_tag LOCUS_21840 gene rpsB 30013 30849 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791748.1 protein_id gnl|my_center|LOCUS_21840 30994 31983 gene locus_tag LOCUS_21850 gene tsf 30994 31983 CDS product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764142.1 protein_id gnl|my_center|LOCUS_21850 33278 32139 gene locus_tag LOCUS_21860 33278 32139 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796424.1 protein_id gnl|my_center|LOCUS_21860 34631 33414 gene locus_tag LOCUS_21870 34631 33414 CDS product bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784515.1 protein_id gnl|my_center|LOCUS_21870 36610 34634 gene locus_tag LOCUS_21880 36610 34634 CDS product LptF/LptG family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784513.1 protein_id gnl|my_center|LOCUS_21880 37066 36683 gene locus_tag LOCUS_21890 37066 36683 CDS product START-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784512.1 protein_id gnl|my_center|LOCUS_21890 37270 37345 gene locus_tag LOCUS_t00240 37270 37345 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 38991 38059 gene locus_tag LOCUS_21900 38991 38059 CDS product FimB/Mfa2 family fimbrial subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203337.1 protein_id gnl|my_center|LOCUS_21900 39252 39052 gene locus_tag LOCUS_21910 39252 39052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21910 39725 41455 gene locus_tag LOCUS_21920 39725 41455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21920 41875 43245 gene locus_tag LOCUS_21930 41875 43245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21930 >Feature sequence040 123 419 gene locus_tag LOCUS_21940 123 419 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002667001.1 protein_id gnl|my_center|LOCUS_21940 412 762 gene locus_tag LOCUS_21950 412 762 CDS product DUF86 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680824.1 protein_id gnl|my_center|LOCUS_21950 1375 2469 gene locus_tag LOCUS_21960 1375 2469 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765274.1 protein_id gnl|my_center|LOCUS_21960 3201 4724 gene locus_tag LOCUS_21970 gene purH 3201 4724 CDS product bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005792044.1 protein_id gnl|my_center|LOCUS_21970 4736 5755 gene locus_tag LOCUS_21980 4736 5755 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005792050.1 protein_id gnl|my_center|LOCUS_21980 5858 6712 gene locus_tag LOCUS_21990 gene mreC 5858 6712 CDS product rod shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005792052.1 protein_id gnl|my_center|LOCUS_21990 6705 7223 gene locus_tag LOCUS_22000 gene mreD 6705 7223 CDS product rod shape-determining protein MreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005792054.1 protein_id gnl|my_center|LOCUS_22000 7213 9081 gene locus_tag LOCUS_22010 gene mrdA 7213 9081 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005792058.1 protein_id gnl|my_center|LOCUS_22010 9137 10516 gene locus_tag LOCUS_22020 gene rodA 9137 10516 CDS product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005792061.1 protein_id gnl|my_center|LOCUS_22020 12477 10963 gene locus_tag LOCUS_22030 12477 10963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22030 13839 12652 gene locus_tag LOCUS_22040 13839 12652 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202847.1 protein_id gnl|my_center|LOCUS_22040 14038 15009 gene locus_tag LOCUS_22050 14038 15009 CDS product YegS/Rv2252/BmrU family lipid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793782.1 protein_id gnl|my_center|LOCUS_22050 15707 14994 gene locus_tag LOCUS_22060 15707 14994 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202815.1 protein_id gnl|my_center|LOCUS_22060 15796 18267 gene locus_tag LOCUS_22070 gene lon 15796 18267 CDS product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793926.1 protein_id gnl|my_center|LOCUS_22070 19227 18412 gene locus_tag LOCUS_22080 19227 18412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22080 20600 19230 gene locus_tag LOCUS_22090 20600 19230 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763947.1 protein_id gnl|my_center|LOCUS_22090 21605 20742 gene locus_tag LOCUS_22100 21605 20742 CDS product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118840050.1 protein_id gnl|my_center|LOCUS_22100 22889 21726 gene locus_tag LOCUS_22110 22889 21726 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970383.1 protein_id gnl|my_center|LOCUS_22110 23687 22911 gene locus_tag LOCUS_22120 23687 22911 CDS product DUF1080 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118831743.1 protein_id gnl|my_center|LOCUS_22120 23856 24749 gene locus_tag LOCUS_22130 23856 24749 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005801276.1 protein_id gnl|my_center|LOCUS_22130 25414 24824 gene locus_tag LOCUS_22140 25414 24824 CDS product sugar O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203642.1 protein_id gnl|my_center|LOCUS_22140 26408 25479 gene locus_tag LOCUS_22150 26408 25479 CDS product glycyl-radical enzyme activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012099515.1 protein_id gnl|my_center|LOCUS_22150 28677 26398 gene locus_tag LOCUS_22160 28677 26398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22160 29425 28685 gene locus_tag LOCUS_22170 29425 28685 CDS product N-acetylmannosamine-6-phosphate 2-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009930423.1 protein_id gnl|my_center|LOCUS_22170 30402 29437 gene locus_tag LOCUS_22180 30402 29437 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392351.1 protein_id gnl|my_center|LOCUS_22180 31046 30609 gene locus_tag LOCUS_22190 31046 30609 CDS product DUF5606 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760341.1 protein_id gnl|my_center|LOCUS_22190 31839 31258 gene locus_tag LOCUS_22200 gene coaE 31839 31258 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785766.1 protein_id gnl|my_center|LOCUS_22200 32845 31832 gene locus_tag LOCUS_22210 32845 31832 CDS product YbbR-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109340.1 protein_id gnl|my_center|LOCUS_22210 33111 32860 gene locus_tag LOCUS_22220 gene yajC 33111 32860 CDS product preprotein translocase subunit YajC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005775925.1 protein_id gnl|my_center|LOCUS_22220 33956 33237 gene locus_tag LOCUS_22230 33956 33237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22230 34375 34776 gene locus_tag LOCUS_22240 34375 34776 CDS product PUR family DNA/RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764746.1 protein_id gnl|my_center|LOCUS_22240 35054 34884 gene locus_tag LOCUS_22250 35054 34884 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784522.1 protein_id gnl|my_center|LOCUS_22250 35253 35909 gene locus_tag LOCUS_22260 35253 35909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22260 36729 35896 gene locus_tag LOCUS_22270 36729 35896 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796208.1 protein_id gnl|my_center|LOCUS_22270 38926 36872 gene locus_tag LOCUS_22280 gene ftsH 38926 36872 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062695721.1 protein_id gnl|my_center|LOCUS_22280 39316 38957 gene locus_tag LOCUS_22290 gene rsfS 39316 38957 CDS product ribosome silencing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764242.1 protein_id gnl|my_center|LOCUS_22290 39476 39279 gene locus_tag LOCUS_22300 39476 39279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22300 39604 39675 gene locus_tag LOCUS_t00250 39604 39675 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 39708 39779 gene locus_tag LOCUS_t00260 39708 39779 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 41157 39841 gene locus_tag LOCUS_22310 41157 39841 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962828.1 protein_id gnl|my_center|LOCUS_22310 42026 41154 gene locus_tag LOCUS_22320 42026 41154 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962829.1 protein_id gnl|my_center|LOCUS_22320 44156 42039 gene locus_tag LOCUS_22330 gene dnaG 44156 42039 CDS product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109025.1 protein_id gnl|my_center|LOCUS_22330 >Feature sequence041 955 302 gene locus_tag LOCUS_22340 gene upp 955 302 CDS product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791972.1 protein_id gnl|my_center|LOCUS_22340 1391 1107 gene locus_tag LOCUS_22350 1391 1107 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931854.1 protein_id gnl|my_center|LOCUS_22350 2410 1574 gene locus_tag LOCUS_22360 2410 1574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791738.1 protein_id gnl|my_center|LOCUS_22360 2511 3524 gene locus_tag LOCUS_22370 gene murB 2511 3524 CDS product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764915.1 protein_id gnl|my_center|LOCUS_22370 3524 4279 gene locus_tag LOCUS_22380 3524 4279 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203087.1 protein_id gnl|my_center|LOCUS_22380 4398 6776 gene locus_tag LOCUS_22390 4398 6776 CDS product SLBB domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202522.1 protein_id gnl|my_center|LOCUS_22390 6783 7889 gene locus_tag LOCUS_22400 6783 7889 CDS product Wzz/FepE/Etk N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786605.1 protein_id gnl|my_center|LOCUS_22400 8683 7886 gene locus_tag LOCUS_22410 8683 7886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22410 9429 8764 gene locus_tag LOCUS_22420 gene nth 9429 8764 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767855.1 protein_id gnl|my_center|LOCUS_22420 11967 9454 gene locus_tag LOCUS_22430 11967 9454 CDS product beta-N-acetylglucosaminidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203553.1 protein_id gnl|my_center|LOCUS_22430 13653 12070 gene locus_tag LOCUS_22440 13653 12070 CDS product DUF3858 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203668.1 protein_id gnl|my_center|LOCUS_22440 15586 13667 gene locus_tag LOCUS_22450 15586 13667 CDS product DUF3857 and transglutaminase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108263.1 protein_id gnl|my_center|LOCUS_22450 16725 15589 gene locus_tag LOCUS_22460 16725 15589 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786035.1 protein_id gnl|my_center|LOCUS_22460 17787 16729 gene locus_tag LOCUS_22470 17787 16729 CDS product o-succinylbenzoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202359.1 protein_id gnl|my_center|LOCUS_22470 18648 17824 gene locus_tag LOCUS_22480 gene menB 18648 17824 CDS product 1,4-dihydroxy-2-naphthoyl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795543.1 protein_id gnl|my_center|LOCUS_22480 20340 18652 gene locus_tag LOCUS_22490 gene menD 20340 18652 CDS product 2-succinyl-5-enolpyruvyl-6-hydroxy-3-cyclohexene-1-carboxylic-acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786027.1 protein_id gnl|my_center|LOCUS_22490 20684 20358 gene locus_tag LOCUS_22500 20684 20358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22500 20962 20669 gene locus_tag LOCUS_22510 20962 20669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22510 22112 21015 gene locus_tag LOCUS_22520 22112 21015 CDS product isochorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202358.1 protein_id gnl|my_center|LOCUS_22520 23341 22109 gene locus_tag LOCUS_22530 23341 22109 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786023.1 protein_id gnl|my_center|LOCUS_22530 24406 23600 gene locus_tag LOCUS_22540 24406 23600 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201882.1 protein_id gnl|my_center|LOCUS_22540 26318 24396 gene locus_tag LOCUS_22550 26318 24396 CDS product AAA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062695901.1 protein_id gnl|my_center|LOCUS_22550 26504 26875 gene locus_tag LOCUS_22560 26504 26875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22560 26920 28212 gene locus_tag LOCUS_22570 26920 28212 CDS product L-serine ammonia-lyase, iron-sulfur-dependent, subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798122.1 protein_id gnl|my_center|LOCUS_22570 28222 29124 gene locus_tag LOCUS_22580 28222 29124 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783522.1 protein_id gnl|my_center|LOCUS_22580 29143 30477 gene locus_tag LOCUS_22590 gene guaD 29143 30477 CDS product guanine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001311109.1 protein_id gnl|my_center|LOCUS_22590 30768 30442 gene locus_tag LOCUS_22600 30768 30442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22600 32723 31455 gene locus_tag LOCUS_22610 32723 31455 CDS product DUF5103 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962586.1 protein_id gnl|my_center|LOCUS_22610 32856 34202 gene locus_tag LOCUS_22620 32856 34202 CDS product Na(+)-translocating NADH-quinone reductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787198.1 protein_id gnl|my_center|LOCUS_22620 34226 35428 gene locus_tag LOCUS_22630 34226 35428 CDS product NADH:ubiquinone reductase (Na(+)-transporting) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787201.1 protein_id gnl|my_center|LOCUS_22630 35442 36254 gene locus_tag LOCUS_22640 35442 36254 CDS product Na(+)-translocating NADH-quinone reductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787203.1 protein_id gnl|my_center|LOCUS_22640 36262 36891 gene locus_tag LOCUS_22650 36262 36891 CDS product NADH:ubiquinone reductase (Na(+)-transporting) subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787205.1 protein_id gnl|my_center|LOCUS_22650 36917 37534 gene locus_tag LOCUS_22660 gene nqrE 36917 37534 CDS product NADH:ubiquinone reductase (Na(+)-transporting) subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787208.1 protein_id gnl|my_center|LOCUS_22660 37563 38849 gene locus_tag LOCUS_22670 gene nqrF 37563 38849 CDS product NADH:ubiquinone reductase (Na(+)-transporting) subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787210.1 protein_id gnl|my_center|LOCUS_22670 39053 39340 gene locus_tag LOCUS_22680 39053 39340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22680 39418 39669 gene locus_tag LOCUS_22690 39418 39669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22690 40192 39731 gene locus_tag LOCUS_22700 40192 39731 CDS product type I restriction enzyme HsdR N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761554.1 protein_id gnl|my_center|LOCUS_22700 40248 41024 gene locus_tag LOCUS_22710 40248 41024 CDS product AMP nucleosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787839.1 protein_id gnl|my_center|LOCUS_22710 41044 42066 gene locus_tag LOCUS_22720 gene holA 41044 42066 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765717.1 protein_id gnl|my_center|LOCUS_22720 >Feature sequence042 107 934 gene locus_tag LOCUS_22730 107 934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22730 3034 929 gene locus_tag LOCUS_22740 3034 929 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963130.1 protein_id gnl|my_center|LOCUS_22740 3330 3136 gene locus_tag LOCUS_22750 3330 3136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22750 5160 3496 gene locus_tag LOCUS_22760 5160 3496 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798215.1 protein_id gnl|my_center|LOCUS_22760 5360 6958 gene locus_tag LOCUS_22770 5360 6958 CDS product family 20 glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_225269715.1 protein_id gnl|my_center|LOCUS_22770 7431 8765 gene locus_tag LOCUS_22780 gene mtaB 7431 8765 CDS product tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase MtaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763943.1 protein_id gnl|my_center|LOCUS_22780 8767 9657 gene locus_tag LOCUS_22790 8767 9657 CDS product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759751.1 protein_id gnl|my_center|LOCUS_22790 9654 10679 gene locus_tag LOCUS_22800 9654 10679 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759752.1 protein_id gnl|my_center|LOCUS_22800 11674 10682 gene locus_tag LOCUS_22810 11674 10682 CDS product YihY/virulence factor BrkB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203185.1 protein_id gnl|my_center|LOCUS_22810 11998 12273 gene locus_tag LOCUS_22820 11998 12273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22820 12323 13534 gene locus_tag LOCUS_22830 12323 13534 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108952.1 protein_id gnl|my_center|LOCUS_22830 14092 13799 gene locus_tag LOCUS_22840 14092 13799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22840 14356 14613 gene locus_tag LOCUS_22850 14356 14613 CDS product GlsB/YeaQ/YmgE family stress response membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764857.1 protein_id gnl|my_center|LOCUS_22850 14646 14942 gene locus_tag LOCUS_22860 14646 14942 CDS product YtxH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766979.1 protein_id gnl|my_center|LOCUS_22860 15191 16135 gene locus_tag LOCUS_22870 15191 16135 CDS product manganese catalase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731124.1 protein_id gnl|my_center|LOCUS_22870 20204 16431 gene locus_tag LOCUS_22880 20204 16431 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107906.1 protein_id gnl|my_center|LOCUS_22880 22025 21381 gene locus_tag LOCUS_22890 22025 21381 CDS product MarC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005778522.1 protein_id gnl|my_center|LOCUS_22890 23284 22121 gene locus_tag LOCUS_22900 23284 22121 CDS product PNGase F N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813194.1 protein_id gnl|my_center|LOCUS_22900 24810 23374 gene locus_tag LOCUS_22910 24810 23374 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763223.1 protein_id gnl|my_center|LOCUS_22910 25256 24888 gene locus_tag LOCUS_22920 gene folB 25256 24888 CDS product dihydroneopterin aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759754.1 protein_id gnl|my_center|LOCUS_22920 25345 25719 gene locus_tag LOCUS_22930 25345 25719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22930 28446 25759 gene locus_tag LOCUS_22940 28446 25759 CDS product 4-alpha-glucanotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203461.1 protein_id gnl|my_center|LOCUS_22940 31010 28470 gene locus_tag LOCUS_22950 31010 28470 CDS product adenosylcobalamin-dependent ribonucleoside-diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769973.1 protein_id gnl|my_center|LOCUS_22950 32683 31268 gene locus_tag LOCUS_22960 gene dnaA 32683 31268 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798188.1 protein_id gnl|my_center|LOCUS_22960 33916 33032 gene locus_tag LOCUS_22970 33916 33032 CDS product MlaD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790918.1 protein_id gnl|my_center|LOCUS_22970 35063 33954 gene locus_tag LOCUS_22980 35063 33954 CDS product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032840465.1 protein_id gnl|my_center|LOCUS_22980 35699 35253 gene locus_tag LOCUS_22990 gene rplI 35699 35253 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759741.1 protein_id gnl|my_center|LOCUS_22990 35990 35721 gene locus_tag LOCUS_23000 gene rpsR 35990 35721 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759740.1 protein_id gnl|my_center|LOCUS_23000 36349 35993 gene locus_tag LOCUS_23010 gene rpsF 36349 35993 CDS product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759739.1 protein_id gnl|my_center|LOCUS_23010 36994 36497 gene locus_tag LOCUS_23020 36994 36497 CDS product RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784499.1 protein_id gnl|my_center|LOCUS_23020 37376 38335 gene locus_tag LOCUS_23030 gene cbiB 37376 38335 CDS product adenosylcobinamide-phosphate synthase CbiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005803605.1 protein_id gnl|my_center|LOCUS_23030 38346 38915 gene locus_tag LOCUS_23040 38346 38915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23040 38908 39423 gene locus_tag LOCUS_23050 gene cobU 38908 39423 CDS product bifunctional adenosylcobinamide kinase/adenosylcobinamide-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202889.1 protein_id gnl|my_center|LOCUS_23050 39454 40494 gene locus_tag LOCUS_23060 gene cobT 39454 40494 CDS product nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202890.1 protein_id gnl|my_center|LOCUS_23060 40496 41245 gene locus_tag LOCUS_23070 40496 41245 CDS product adenosylcobinamide-GDP ribazoletransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009292396.1 protein_id gnl|my_center|LOCUS_23070 41248 41781 gene locus_tag LOCUS_23080 gene cobC 41248 41781 CDS product alpha-ribazole phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787967.1 protein_id gnl|my_center|LOCUS_23080 >Feature sequence043 960 28 gene locus_tag LOCUS_23090 960 28 CDS product tyrosine-type DNA invertase cluster 3b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765099.1 protein_id gnl|my_center|LOCUS_23090 4064 1059 gene locus_tag LOCUS_23100 gene secDF 4064 1059 CDS product protein translocase subunit SecDF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765303.1 protein_id gnl|my_center|LOCUS_23100 4237 5211 gene locus_tag LOCUS_23110 4237 5211 CDS product DUF4468 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795332.1 protein_id gnl|my_center|LOCUS_23110 5232 5786 gene locus_tag LOCUS_23120 5232 5786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23120 6894 5797 gene locus_tag LOCUS_23130 6894 5797 CDS product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791183.1 protein_id gnl|my_center|LOCUS_23130 7791 6904 gene locus_tag LOCUS_23140 7791 6904 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791185.1 protein_id gnl|my_center|LOCUS_23140 8485 7763 gene locus_tag LOCUS_23150 8485 7763 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765306.1 protein_id gnl|my_center|LOCUS_23150 8672 8944 gene locus_tag LOCUS_23160 8672 8944 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761933.1 protein_id gnl|my_center|LOCUS_23160 9047 10840 gene locus_tag LOCUS_23170 gene argS 9047 10840 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797416.1 protein_id gnl|my_center|LOCUS_23170 11048 10860 gene locus_tag LOCUS_23180 11048 10860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23180 13321 10973 gene locus_tag LOCUS_23190 gene topA 13321 10973 CDS product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765309.1 protein_id gnl|my_center|LOCUS_23190 13432 13746 gene locus_tag LOCUS_23200 13432 13746 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786499.1 protein_id gnl|my_center|LOCUS_23200 13860 13959 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 13994 14179 gene locus_tag LOCUS_23210 13994 14179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23210 14261 15049 gene locus_tag LOCUS_23220 14261 15049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23220 15093 16235 gene locus_tag LOCUS_23230 15093 16235 CDS product C10 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783712.1 protein_id gnl|my_center|LOCUS_23230 16228 16674 gene locus_tag LOCUS_23240 16228 16674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23240 17648 16806 gene locus_tag LOCUS_23250 gene lepB 17648 16806 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789018.1 protein_id gnl|my_center|LOCUS_23250 18842 17652 gene locus_tag LOCUS_23260 18842 17652 CDS product DUF4221 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203430.1 protein_id gnl|my_center|LOCUS_23260 19733 18861 gene locus_tag LOCUS_23270 19733 18861 CDS product DUF1573 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005799326.1 protein_id gnl|my_center|LOCUS_23270 20420 20202 gene locus_tag LOCUS_23280 20420 20202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23280 21294 20713 gene locus_tag LOCUS_23290 21294 20713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23290 22440 21298 gene locus_tag LOCUS_23300 22440 21298 CDS product DUF4221 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203430.1 protein_id gnl|my_center|LOCUS_23300 22801 22544 gene locus_tag LOCUS_23310 22801 22544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23310 22979 23335 gene locus_tag LOCUS_23320 22979 23335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23320 23618 24433 gene locus_tag LOCUS_23330 23618 24433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23330 24648 25184 gene locus_tag LOCUS_23340 24648 25184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23340 26495 25332 gene locus_tag LOCUS_23350 26495 25332 CDS product SpoIIE family protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203082.1 protein_id gnl|my_center|LOCUS_23350 27358 26507 gene locus_tag LOCUS_23360 27358 26507 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203077.1 protein_id gnl|my_center|LOCUS_23360 28491 27361 gene locus_tag LOCUS_23370 28491 27361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23370 29607 28507 gene locus_tag LOCUS_23380 29607 28507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23380 31424 29625 gene locus_tag LOCUS_23390 31424 29625 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791194.1 protein_id gnl|my_center|LOCUS_23390 34388 31434 gene locus_tag LOCUS_23400 34388 31434 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108497.1 protein_id gnl|my_center|LOCUS_23400 35051 34530 gene locus_tag LOCUS_23410 35051 34530 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791198.1 protein_id gnl|my_center|LOCUS_23410 36141 35155 gene locus_tag LOCUS_23420 36141 35155 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784451.1 protein_id gnl|my_center|LOCUS_23420 36687 36313 gene locus_tag LOCUS_23430 36687 36313 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786184.1 protein_id gnl|my_center|LOCUS_23430 37458 36736 gene locus_tag LOCUS_23440 37458 36736 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786188.1 protein_id gnl|my_center|LOCUS_23440 37793 37533 gene locus_tag LOCUS_23450 37793 37533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23450 38461 38817 gene locus_tag LOCUS_23460 38461 38817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23460 >Feature sequence044 1529 123 gene locus_tag LOCUS_23470 1529 123 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202853.1 protein_id gnl|my_center|LOCUS_23470 1625 2104 gene locus_tag LOCUS_23480 1625 2104 CDS product DUF456 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788959.1 protein_id gnl|my_center|LOCUS_23480 2129 3022 gene locus_tag LOCUS_23490 2129 3022 CDS product D-2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476165.1 protein_id gnl|my_center|LOCUS_23490 5433 3148 gene locus_tag LOCUS_23500 5433 3148 CDS product NADP-dependent malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790429.1 protein_id gnl|my_center|LOCUS_23500 5646 6092 gene locus_tag LOCUS_23510 5646 6092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23510 6487 7737 gene locus_tag LOCUS_23520 6487 7737 CDS product exonuclease SbcCD subunit D C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203161.1 protein_id gnl|my_center|LOCUS_23520 7734 10715 gene locus_tag LOCUS_23530 7734 10715 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766204.1 protein_id gnl|my_center|LOCUS_23530 11263 10718 gene locus_tag LOCUS_23540 11263 10718 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766706.1 protein_id gnl|my_center|LOCUS_23540 13582 11333 gene locus_tag LOCUS_23550 13582 11333 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107975.1 protein_id gnl|my_center|LOCUS_23550 13720 15738 gene locus_tag LOCUS_23560 13720 15738 CDS product alpha amylase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787605.1 protein_id gnl|my_center|LOCUS_23560 15761 16738 gene locus_tag LOCUS_23570 15761 16738 CDS product class I mannose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760658.1 protein_id gnl|my_center|LOCUS_23570 17366 16794 gene locus_tag LOCUS_23580 17366 16794 CDS product DNA-3-methyladenine glycosylase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764076.1 protein_id gnl|my_center|LOCUS_23580 18838 17519 gene locus_tag LOCUS_23590 18838 17519 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546519.1 protein_id gnl|my_center|LOCUS_23590 19650 18970 gene locus_tag LOCUS_23600 19650 18970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23600 20992 20051 gene locus_tag LOCUS_23610 20992 20051 CDS product 2-dehydropantoate 2-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259194.1 protein_id gnl|my_center|LOCUS_23610 21901 21044 gene locus_tag LOCUS_23620 21901 21044 CDS product pyridoxamine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944146.1 protein_id gnl|my_center|LOCUS_23620 23603 21957 gene locus_tag LOCUS_23630 gene hcp 23603 21957 CDS product hydroxylamine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272545.1 protein_id gnl|my_center|LOCUS_23630 23718 24362 gene locus_tag LOCUS_23640 23718 24362 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765568.1 protein_id gnl|my_center|LOCUS_23640 24444 25409 gene locus_tag LOCUS_23650 24444 25409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107601.1 protein_id gnl|my_center|LOCUS_23650 25647 26606 gene locus_tag LOCUS_23660 25647 26606 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763527.1 protein_id gnl|my_center|LOCUS_23660 26945 29731 gene locus_tag LOCUS_23670 26945 29731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109385.1 protein_id gnl|my_center|LOCUS_23670 29743 30618 gene locus_tag LOCUS_23680 29743 30618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_23680 30597 31535 gene locus_tag LOCUS_23690 30597 31535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_23690 31618 33273 gene locus_tag LOCUS_23700 31618 33273 CDS product Mfa1 family fimbria major subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107602.1 protein_id gnl|my_center|LOCUS_23700 33390 34370 gene locus_tag LOCUS_23710 33390 34370 CDS product FimB/Mfa2 family fimbrial subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763526.1 protein_id gnl|my_center|LOCUS_23710 34968 34378 gene locus_tag LOCUS_23720 34968 34378 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790890.1 protein_id gnl|my_center|LOCUS_23720 36311 34965 gene locus_tag LOCUS_23730 36311 34965 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009292596.1 protein_id gnl|my_center|LOCUS_23730 36473 37348 gene locus_tag LOCUS_23740 36473 37348 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962773.1 protein_id gnl|my_center|LOCUS_23740 37516 37428 gene locus_tag LOCUS_t00270 37516 37428 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence045 646 293 gene locus_tag LOCUS_23750 646 293 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763033.1 protein_id gnl|my_center|LOCUS_23750 813 1343 gene locus_tag LOCUS_23760 813 1343 CDS product DJ-1/PfpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765001.1 protein_id gnl|my_center|LOCUS_23760 1973 1752 gene locus_tag LOCUS_23770 1973 1752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_23770 4167 2080 gene locus_tag LOCUS_23780 4167 2080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23780 4438 5514 gene locus_tag LOCUS_23790 4438 5514 CDS product galactose mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766110.1 protein_id gnl|my_center|LOCUS_23790 5560 6834 gene locus_tag LOCUS_23800 5560 6834 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786507.1 protein_id gnl|my_center|LOCUS_23800 6888 8087 gene locus_tag LOCUS_23810 gene galK 6888 8087 CDS product galactokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005800633.1 protein_id gnl|my_center|LOCUS_23810 8108 8800 gene locus_tag LOCUS_23820 8108 8800 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760645.1 protein_id gnl|my_center|LOCUS_23820 8981 11011 gene locus_tag LOCUS_23830 8981 11011 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786503.1 protein_id gnl|my_center|LOCUS_23830 11014 11445 gene locus_tag LOCUS_23840 gene rpiB 11014 11445 CDS product ribose 5-phosphate isomerase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786501.1 protein_id gnl|my_center|LOCUS_23840 13165 11588 gene locus_tag LOCUS_23850 13165 11588 CDS product oxaloacetate decarboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355994.1 protein_id gnl|my_center|LOCUS_23850 14192 13272 gene locus_tag LOCUS_23860 14192 13272 CDS product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004304952.1 protein_id gnl|my_center|LOCUS_23860 15318 14272 gene locus_tag LOCUS_23870 15318 14272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23870 15521 15315 gene locus_tag LOCUS_23880 15521 15315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23880 16501 15518 gene locus_tag LOCUS_23890 16501 15518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23890 16692 16865 gene locus_tag LOCUS_23900 16692 16865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23900 17158 18177 gene locus_tag LOCUS_23910 17158 18177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23910 18197 18769 gene locus_tag LOCUS_23920 18197 18769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23920 19054 19821 gene locus_tag LOCUS_23930 19054 19821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23930 20815 19883 gene locus_tag LOCUS_23940 20815 19883 CDS product alkaline phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203438.1 protein_id gnl|my_center|LOCUS_23940 20950 22041 gene locus_tag LOCUS_23950 20950 22041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23950 24013 22439 gene locus_tag LOCUS_23960 24013 22439 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767323.1 protein_id gnl|my_center|LOCUS_23960 25440 24010 gene locus_tag LOCUS_23970 25440 24010 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121702.1 protein_id gnl|my_center|LOCUS_23970 26866 25547 gene locus_tag LOCUS_23980 26866 25547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23980 28400 26895 gene locus_tag LOCUS_23990 28400 26895 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005801521.1 protein_id gnl|my_center|LOCUS_23990 31763 28419 gene locus_tag LOCUS_24000 31763 28419 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202210.1 protein_id gnl|my_center|LOCUS_24000 32900 31965 gene locus_tag LOCUS_24010 32900 31965 CDS product FecR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785220.1 protein_id gnl|my_center|LOCUS_24010 33368 33880 gene locus_tag LOCUS_24020 33368 33880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24020 34479 33937 gene locus_tag LOCUS_24030 34479 33937 CDS product RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008770321.1 protein_id gnl|my_center|LOCUS_24030 35064 34570 gene locus_tag LOCUS_24040 35064 34570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24040 35703 37802 gene locus_tag LOCUS_24050 35703 37802 CDS product DNA topoisomerase 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108131.1 protein_id gnl|my_center|LOCUS_24050 37806 38297 gene locus_tag LOCUS_24060 37806 38297 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760888.1 protein_id gnl|my_center|LOCUS_24060 >Feature sequence046 239 3553 gene locus_tag LOCUS_24070 239 3553 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108629.1 protein_id gnl|my_center|LOCUS_24070 3587 5101 gene locus_tag LOCUS_24080 3587 5101 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108628.1 protein_id gnl|my_center|LOCUS_24080 5490 6650 gene locus_tag LOCUS_24090 5490 6650 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764309.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_24090 6718 9288 gene locus_tag LOCUS_24100 6718 9288 CDS product glycoside hydrolase family 38 C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764306.1 protein_id gnl|my_center|LOCUS_24100 9401 10351 gene locus_tag LOCUS_24110 9401 10351 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790916.1 protein_id gnl|my_center|LOCUS_24110 10657 10418 gene locus_tag LOCUS_24120 10657 10418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24120 11086 12366 gene locus_tag LOCUS_24130 11086 12366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24130 12915 12412 gene locus_tag LOCUS_24140 12915 12412 CDS product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009902015.1 protein_id gnl|my_center|LOCUS_24140 13073 13555 gene locus_tag LOCUS_24150 13073 13555 CDS product ferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762403.1 protein_id gnl|my_center|LOCUS_24150 13674 14114 gene locus_tag LOCUS_24160 13674 14114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24160 15532 14219 gene locus_tag LOCUS_24170 gene thrC 15532 14219 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202074.1 protein_id gnl|my_center|LOCUS_24170 16744 15536 gene locus_tag LOCUS_24180 16744 15536 CDS product cofactor-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763759.1 protein_id gnl|my_center|LOCUS_24180 19188 16747 gene locus_tag LOCUS_24190 gene thrA 19188 16747 CDS product bifunctional aspartate kinase/homoserine dehydrogenase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108282.1 protein_id gnl|my_center|LOCUS_24190 20436 19471 gene locus_tag LOCUS_24200 20436 19471 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764292.1 protein_id gnl|my_center|LOCUS_24200 20677 21408 gene locus_tag LOCUS_24210 20677 21408 CDS product copper homeostasis protein CutC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203367.1 protein_id gnl|my_center|LOCUS_24210 21576 21956 gene locus_tag LOCUS_24220 21576 21956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24220 22164 23210 gene locus_tag LOCUS_24230 22164 23210 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783796.1 protein_id gnl|my_center|LOCUS_24230 23216 26374 gene locus_tag LOCUS_24240 23216 26374 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963080.1 protein_id gnl|my_center|LOCUS_24240 26364 27806 gene locus_tag LOCUS_24250 26364 27806 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963081.1 protein_id gnl|my_center|LOCUS_24250 28039 30582 gene locus_tag LOCUS_24260 28039 30582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24260 30800 30618 gene locus_tag LOCUS_24270 30800 30618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24270 30845 31048 gene locus_tag LOCUS_24280 30845 31048 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202295.1 protein_id gnl|my_center|LOCUS_24280 31056 31820 gene locus_tag LOCUS_24290 31056 31820 CDS product DUF2971 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172680449.1 protein_id gnl|my_center|LOCUS_24290 31825 33414 gene locus_tag LOCUS_24300 31825 33414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24300 33401 34441 gene locus_tag LOCUS_24310 33401 34441 CDS product PDDEXK nuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004329798.1 protein_id gnl|my_center|LOCUS_24310 34443 35558 gene locus_tag LOCUS_24320 34443 35558 CDS product restriction endonuclease subunit S inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000072584.1 protein_id gnl|my_center|LOCUS_24320 35571 37523 gene locus_tag LOCUS_24330 35571 37523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24330 >Feature sequence047 932 30 gene locus_tag LOCUS_24340 932 30 CDS product IS982 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403403.1 protein_id gnl|my_center|LOCUS_24340 1242 2906 gene locus_tag LOCUS_24350 1242 2906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24350 3302 2979 gene locus_tag LOCUS_24360 3302 2979 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107149.1 protein_id gnl|my_center|LOCUS_24360 3741 3373 gene locus_tag LOCUS_24370 3741 3373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24370 4027 3731 gene locus_tag LOCUS_24380 4027 3731 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767829.1 protein_id gnl|my_center|LOCUS_24380 4148 5098 gene locus_tag LOCUS_24390 4148 5098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109301.1 protein_id gnl|my_center|LOCUS_24390 5127 5705 gene locus_tag LOCUS_24400 5127 5705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24400 7537 5762 gene locus_tag LOCUS_24410 7537 5762 CDS product DUF4091 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108456.1 protein_id gnl|my_center|LOCUS_24410 8671 7595 gene locus_tag LOCUS_24420 8671 7595 CDS product TIGR04133 family radical SAM/SPASM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005803875.1 protein_id gnl|my_center|LOCUS_24420 9145 8675 gene locus_tag LOCUS_24430 9145 8675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24430 9991 9149 gene locus_tag LOCUS_24440 9991 9149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24440 10121 11968 gene locus_tag LOCUS_24450 10121 11968 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783855.1 protein_id gnl|my_center|LOCUS_24450 12249 13937 gene locus_tag LOCUS_24460 12249 13937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24460 13958 14383 gene locus_tag LOCUS_24470 13958 14383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24470 14448 15203 gene locus_tag LOCUS_24480 14448 15203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24480 15278 17728 gene locus_tag LOCUS_24490 15278 17728 CDS product glycoside hydrolase family 95 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_076055503.1 protein_id gnl|my_center|LOCUS_24490 19003 17789 gene locus_tag LOCUS_24500 19003 17789 CDS product porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814336.1 protein_id gnl|my_center|LOCUS_24500 19718 19044 gene locus_tag LOCUS_24510 gene phoU 19718 19044 CDS product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788573.1 protein_id gnl|my_center|LOCUS_24510 20509 19757 gene locus_tag LOCUS_24520 gene pstB 20509 19757 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010538553.1 protein_id gnl|my_center|LOCUS_24520 21412 20525 gene locus_tag LOCUS_24530 gene pstA 21412 20525 CDS product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788578.1 protein_id gnl|my_center|LOCUS_24530 22569 21421 gene locus_tag LOCUS_24540 gene pstC 22569 21421 CDS product phosphate ABC transporter permease subunit PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107710.1 protein_id gnl|my_center|LOCUS_24540 23899 23015 gene locus_tag LOCUS_24550 23899 23015 CDS product Rpn family recombination-promoting nuclease/putative transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108099.1 protein_id gnl|my_center|LOCUS_24550 24535 27915 gene locus_tag LOCUS_24560 24535 27915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24560 29852 28356 gene locus_tag LOCUS_24570 29852 28356 CDS product acetyl-CoA hydrolase/transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797086.1 protein_id gnl|my_center|LOCUS_24570 30412 29954 gene locus_tag LOCUS_24580 30412 29954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24580 30673 32046 gene locus_tag LOCUS_24590 gene miaB 30673 32046 CDS product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783584.1 protein_id gnl|my_center|LOCUS_24590 33735 32107 gene locus_tag LOCUS_24600 33735 32107 CDS product alpha-L-rhamnosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102178.1 protein_id gnl|my_center|LOCUS_24600 34036 33767 gene locus_tag LOCUS_24610 34036 33767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24610 34719 34069 gene locus_tag LOCUS_24620 34719 34069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24620 35090 34737 gene locus_tag LOCUS_24630 35090 34737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24630 >Feature sequence048 121 534 gene locus_tag LOCUS_24640 121 534 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203080.1 protein_id gnl|my_center|LOCUS_24640 546 857 gene locus_tag LOCUS_24650 546 857 CDS product STAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011176701.1 protein_id gnl|my_center|LOCUS_24650 1874 915 gene locus_tag LOCUS_24660 1874 915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24660 2054 3184 gene locus_tag LOCUS_24670 2054 3184 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919503.1 protein_id gnl|my_center|LOCUS_24670 3199 4191 gene locus_tag LOCUS_24680 3199 4191 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007333876.1 protein_id gnl|my_center|LOCUS_24680 4242 5225 gene locus_tag LOCUS_24690 4242 5225 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785904.1 protein_id gnl|my_center|LOCUS_24690 5329 6225 gene locus_tag LOCUS_24700 5329 6225 CDS product diaminopimelate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761129.1 protein_id gnl|my_center|LOCUS_24700 6321 7154 gene locus_tag LOCUS_24710 gene lgt 6321 7154 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403744.1 protein_id gnl|my_center|LOCUS_24710 7217 8428 gene locus_tag LOCUS_24720 7217 8428 CDS product FprA family A-type flavoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795977.1 protein_id gnl|my_center|LOCUS_24720 8471 9283 gene locus_tag LOCUS_24730 gene nagB 8471 9283 CDS product glucosamine-6-phosphate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005775719.1 protein_id gnl|my_center|LOCUS_24730 11928 9511 gene locus_tag LOCUS_24740 11928 9511 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920521.1 protein_id gnl|my_center|LOCUS_24740 13507 12005 gene locus_tag LOCUS_24750 13507 12005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24750 16692 13534 gene locus_tag LOCUS_24760 16692 13534 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202496.1 protein_id gnl|my_center|LOCUS_24760 18523 17165 gene locus_tag LOCUS_24770 18523 17165 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796464.1 protein_id gnl|my_center|LOCUS_24770 19657 18536 gene locus_tag LOCUS_24780 19657 18536 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005801569.1 protein_id gnl|my_center|LOCUS_24780 20950 19691 gene locus_tag LOCUS_24790 20950 19691 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784442.1 protein_id gnl|my_center|LOCUS_24790 22245 20971 gene locus_tag LOCUS_24800 22245 20971 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784445.1 protein_id gnl|my_center|LOCUS_24800 22924 22238 gene locus_tag LOCUS_24810 22924 22238 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796460.1 protein_id gnl|my_center|LOCUS_24810 23353 24534 gene locus_tag LOCUS_24820 gene purT 23353 24534 CDS product formate-dependent phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004406408.1 protein_id gnl|my_center|LOCUS_24820 26308 24890 gene locus_tag LOCUS_24830 26308 24890 CDS product PD40 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813223.1 protein_id gnl|my_center|LOCUS_24830 28148 26376 gene locus_tag LOCUS_24840 28148 26376 CDS product DUF6057 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202172.1 protein_id gnl|my_center|LOCUS_24840 29654 28185 gene locus_tag LOCUS_24850 29654 28185 CDS product PD40 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813223.1 protein_id gnl|my_center|LOCUS_24850 31403 29664 gene locus_tag LOCUS_24860 31403 29664 CDS product DUF6057 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202172.1 protein_id gnl|my_center|LOCUS_24860 33519 31657 gene locus_tag LOCUS_24870 33519 31657 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_136013900.1 protein_id gnl|my_center|LOCUS_24870 36843 33556 gene locus_tag LOCUS_24880 36843 33556 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_222838248.1 protein_id gnl|my_center|LOCUS_24880 >Feature sequence049 56 1069 gene locus_tag LOCUS_24890 56 1069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24890 1076 2026 gene locus_tag LOCUS_24900 1076 2026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24900 2312 2761 gene locus_tag LOCUS_24910 2312 2761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24910 2763 3626 gene locus_tag LOCUS_24920 gene lepB 2763 3626 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789018.1 protein_id gnl|my_center|LOCUS_24920 5768 3789 gene locus_tag LOCUS_24930 5768 3789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24930 5904 6509 gene locus_tag LOCUS_24940 5904 6509 CDS product DUF4923 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765853.1 protein_id gnl|my_center|LOCUS_24940 6576 7883 gene locus_tag LOCUS_24950 6576 7883 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766368.1 protein_id gnl|my_center|LOCUS_24950 9998 7854 gene locus_tag LOCUS_24960 9998 7854 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202769.1 protein_id gnl|my_center|LOCUS_24960 11577 10042 gene locus_tag LOCUS_24970 11577 10042 CDS product TrkA C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765024.1 protein_id gnl|my_center|LOCUS_24970 11771 12529 gene locus_tag LOCUS_24980 gene truA 11771 12529 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764438.1 protein_id gnl|my_center|LOCUS_24980 12533 13429 gene locus_tag LOCUS_24990 12533 13429 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008658736.1 protein_id gnl|my_center|LOCUS_24990 13441 14070 gene locus_tag LOCUS_25000 13441 14070 CDS product DUF3256 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202200.1 protein_id gnl|my_center|LOCUS_25000 15010 14189 gene locus_tag LOCUS_25010 15010 14189 CDS product PepSY-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202990.1 protein_id gnl|my_center|LOCUS_25010 15476 15081 gene locus_tag LOCUS_25020 15476 15081 CDS product PepSY-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760391.1 protein_id gnl|my_center|LOCUS_25020 16863 15592 gene locus_tag LOCUS_25030 16863 15592 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107523.1 protein_id gnl|my_center|LOCUS_25030 17546 16866 gene locus_tag LOCUS_25040 17546 16866 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788535.1 protein_id gnl|my_center|LOCUS_25040 18076 17624 gene locus_tag LOCUS_25050 18076 17624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25050 18233 18697 gene locus_tag LOCUS_25060 18233 18697 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786485.1 protein_id gnl|my_center|LOCUS_25060 18688 19233 gene locus_tag LOCUS_25070 18688 19233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008768304.1 protein_id gnl|my_center|LOCUS_25070 19265 19711 gene locus_tag LOCUS_25080 19265 19711 CDS product DUF6108 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786482.1 protein_id gnl|my_center|LOCUS_25080 19733 20638 gene locus_tag LOCUS_25090 19733 20638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107199.1 protein_id gnl|my_center|LOCUS_25090 20859 21329 gene locus_tag LOCUS_25100 gene trxA 20859 21329 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107795.1 protein_id gnl|my_center|LOCUS_25100 21449 22285 gene locus_tag LOCUS_25110 21449 22285 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107849.1 protein_id gnl|my_center|LOCUS_25110 22379 22960 gene locus_tag LOCUS_25120 22379 22960 CDS product DUF417 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786253.1 protein_id gnl|my_center|LOCUS_25120 24502 23015 gene locus_tag LOCUS_25130 24502 23015 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009291422.1 protein_id gnl|my_center|LOCUS_25130 27622 24536 gene locus_tag LOCUS_25140 27622 24536 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201981.1 protein_id gnl|my_center|LOCUS_25140 27860 28252 gene locus_tag LOCUS_25150 27860 28252 CDS product YkvA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815873.1 protein_id gnl|my_center|LOCUS_25150 28940 28260 gene locus_tag LOCUS_25160 gene bioD 28940 28260 CDS product dethiobiotin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_136429216.1 protein_id gnl|my_center|LOCUS_25160 29921 29160 gene locus_tag LOCUS_25170 29921 29160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_25170 30577 29912 gene locus_tag LOCUS_25180 30577 29912 CDS product DUF452 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693578.1 protein_id gnl|my_center|LOCUS_25180 31730 30675 gene locus_tag LOCUS_25190 31730 30675 CDS product 8-amino-7-oxononanoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107783.1 protein_id gnl|my_center|LOCUS_25190 33149 31869 gene locus_tag LOCUS_25200 33149 31869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_25200 34129 33146 gene locus_tag LOCUS_25210 34129 33146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_25210 34782 34330 gene locus_tag LOCUS_25220 34782 34330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25220 36453 34798 gene locus_tag LOCUS_25230 36453 34798 CDS product peptide MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788185.1 protein_id gnl|my_center|LOCUS_25230 <37160 36480 gene locus_tag LOCUS_25240 <37160 36480 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011202253.1:DUF4831 family protein >Feature sequence050 213 749 gene locus_tag LOCUS_25250 213 749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25250 916 1212 gene locus_tag LOCUS_25260 916 1212 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767829.1 protein_id gnl|my_center|LOCUS_25260 1205 1588 gene locus_tag LOCUS_25270 1205 1588 CDS product DUF86 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020160.1 protein_id gnl|my_center|LOCUS_25270 1777 2106 gene locus_tag LOCUS_25280 1777 2106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25280 2589 4523 gene locus_tag LOCUS_25290 2589 4523 CDS product nucleoside-diphosphate sugar epimerase/dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107228.1 protein_id gnl|my_center|LOCUS_25290 4691 6826 gene locus_tag LOCUS_25300 4691 6826 CDS product anti-phage dCTP deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164996137.1 protein_id gnl|my_center|LOCUS_25300 6903 7844 gene locus_tag LOCUS_25310 gene rfbA 6903 7844 CDS product glucose-1-phosphate thymidylyltransferase RfbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202141.1 protein_id gnl|my_center|LOCUS_25310 7869 9008 gene locus_tag LOCUS_25320 gene rfbB 7869 9008 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766020.1 protein_id gnl|my_center|LOCUS_25320 9017 9427 gene locus_tag LOCUS_25330 9017 9427 CDS product FdtA/QdtA family cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005802400.1 protein_id gnl|my_center|LOCUS_25330 9414 9836 gene locus_tag LOCUS_25340 9414 9836 CDS product FdtA/QdtA family cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005802402.1 protein_id gnl|my_center|LOCUS_25340 9829 10803 gene locus_tag LOCUS_25350 9829 10803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963974.1 protein_id gnl|my_center|LOCUS_25350 10757 10924 gene locus_tag LOCUS_25360 10757 10924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25360 11109 12026 gene locus_tag LOCUS_25370 11109 12026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25370 12185 12535 gene locus_tag LOCUS_25380 12185 12535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25380 12532 13635 gene locus_tag LOCUS_25390 12532 13635 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203396.1 protein_id gnl|my_center|LOCUS_25390 13707 14918 gene locus_tag LOCUS_25400 13707 14918 CDS product O-antigen translocase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963976.1 protein_id gnl|my_center|LOCUS_25400 14921 16420 gene locus_tag LOCUS_25410 14921 16420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25410 16413 17054 gene locus_tag LOCUS_25420 16413 17054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25420 18232 19089 gene locus_tag LOCUS_25430 18232 19089 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101287.1 protein_id gnl|my_center|LOCUS_25430 19098 19817 gene locus_tag LOCUS_25440 19098 19817 CDS product IspD/TarI family cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454982.1 protein_id gnl|my_center|LOCUS_25440 19825 20724 gene locus_tag LOCUS_25450 19825 20724 CDS product LicD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455037.1 protein_id gnl|my_center|LOCUS_25450 20738 20950 gene locus_tag LOCUS_25460 20738 20950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25460 20940 21152 gene locus_tag LOCUS_25470 20940 21152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25470 21171 21401 gene locus_tag LOCUS_25480 21171 21401 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005775528.1 protein_id gnl|my_center|LOCUS_25480 21398 22162 gene locus_tag LOCUS_25490 21398 22162 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005801362.1 protein_id gnl|my_center|LOCUS_25490 22172 23170 gene locus_tag LOCUS_25500 22172 23170 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198211.1 protein_id gnl|my_center|LOCUS_25500 23109 24131 gene locus_tag LOCUS_25510 23109 24131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25510 24128 24979 gene locus_tag LOCUS_25520 24128 24979 CDS product DUF3473 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942624.1 protein_id gnl|my_center|LOCUS_25520 25018 25650 gene locus_tag LOCUS_25530 25018 25650 CDS product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202264.1 protein_id gnl|my_center|LOCUS_25530 25610 26212 gene locus_tag LOCUS_25540 25610 26212 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001102425.1 protein_id gnl|my_center|LOCUS_25540 26209 27240 gene locus_tag LOCUS_25550 26209 27240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25550 27233 28264 gene locus_tag LOCUS_25560 27233 28264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25560 28352 28660 gene locus_tag LOCUS_25570 28352 28660 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869621.1 protein_id gnl|my_center|LOCUS_25570 28838 30085 gene locus_tag LOCUS_25580 28838 30085 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202157.1 protein_id gnl|my_center|LOCUS_25580 30171 30536 gene locus_tag LOCUS_25590 30171 30536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25590 30681 33980 gene locus_tag LOCUS_25600 30681 33980 CDS product AsmA-like C-terminal region-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201927.1 protein_id gnl|my_center|LOCUS_25600 35111 33972 gene locus_tag LOCUS_25610 gene rfbB 35111 33972 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203413.1 protein_id gnl|my_center|LOCUS_25610 35682 35125 gene locus_tag LOCUS_25620 gene rfbC 35682 35125 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787720.1 protein_id gnl|my_center|LOCUS_25620 >Feature sequence051 246 4517 gene locus_tag LOCUS_25630 246 4517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25630 6194 4593 gene locus_tag LOCUS_25640 gene mobV 6194 4593 CDS product MobV family relaxase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203628.1 protein_id gnl|my_center|LOCUS_25640 7003 6284 gene locus_tag LOCUS_25650 7003 6284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25650 8826 7420 gene locus_tag LOCUS_25660 8826 7420 CDS product DUF3987 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162303146.1 protein_id gnl|my_center|LOCUS_25660 9182 8829 gene locus_tag LOCUS_25670 9182 8829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25670 10561 9419 gene locus_tag LOCUS_25680 10561 9419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25680 11963 10632 gene locus_tag LOCUS_25690 11963 10632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25690 13275 11977 gene locus_tag LOCUS_25700 13275 11977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25700 13693 13887 gene locus_tag LOCUS_25710 13693 13887 CDS product PspC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002899876.1 protein_id gnl|my_center|LOCUS_25710 13891 15912 gene locus_tag LOCUS_25720 gene uvrB 13891 15912 CDS product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763156.1 protein_id gnl|my_center|LOCUS_25720 15928 16788 gene locus_tag LOCUS_25730 15928 16788 CDS product DUF1460 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005794479.1 protein_id gnl|my_center|LOCUS_25730 18815 16782 gene locus_tag LOCUS_25740 18815 16782 CDS product DUF5686 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008658844.1 protein_id gnl|my_center|LOCUS_25740 19116 19817 gene locus_tag LOCUS_25750 19116 19817 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785389.1 protein_id gnl|my_center|LOCUS_25750 20727 19927 gene locus_tag LOCUS_25760 gene kdsA 20727 19927 CDS product 3-deoxy-8-phosphooctulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759991.1 protein_id gnl|my_center|LOCUS_25760 21647 20724 gene locus_tag LOCUS_25770 gene miaA 21647 20724 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759993.1 protein_id gnl|my_center|LOCUS_25770 22718 21717 gene locus_tag LOCUS_25780 gene gap 22718 21717 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785248.1 protein_id gnl|my_center|LOCUS_25780 23278 22904 gene locus_tag LOCUS_25790 23278 22904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25790 23642 23238 gene locus_tag LOCUS_25800 23642 23238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25800 23870 23649 gene locus_tag LOCUS_25810 23870 23649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25810 24811 23960 gene locus_tag LOCUS_25820 gene prmA 24811 23960 CDS product 50S ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766150.1 protein_id gnl|my_center|LOCUS_25820 25336 24890 gene locus_tag LOCUS_25830 25336 24890 CDS product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767438.1 protein_id gnl|my_center|LOCUS_25830 26546 26049 gene locus_tag LOCUS_25840 26546 26049 CDS product DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788616.1 protein_id gnl|my_center|LOCUS_25840 26781 27020 gene locus_tag LOCUS_25850 26781 27020 CDS product DUF4248 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790540.1 protein_id gnl|my_center|LOCUS_25850 29023 27218 gene locus_tag LOCUS_25860 29023 27218 CDS product DUF3987 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107945.1 protein_id gnl|my_center|LOCUS_25860 29683 29051 gene locus_tag LOCUS_25870 29683 29051 CDS product BT4734/BF3469 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767888.1 protein_id gnl|my_center|LOCUS_25870 29835 30767 gene locus_tag LOCUS_25880 29835 30767 CDS product tyrosine-type DNA invertase cluster 3b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107953.1 protein_id gnl|my_center|LOCUS_25880 31279 32391 gene locus_tag LOCUS_25890 31279 32391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25890 32447 32848 gene locus_tag LOCUS_25900 32447 32848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25900 33003 33146 gene locus_tag LOCUS_25910 33003 33146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25910 33164 34288 gene locus_tag LOCUS_25920 33164 34288 CDS product MraY family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790532.1 protein_id gnl|my_center|LOCUS_25920 34371 34568 gene locus_tag LOCUS_25930 34371 34568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25930 34778 35101 gene locus_tag LOCUS_25940 34778 35101 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764355.1 protein_id gnl|my_center|LOCUS_25940 35092 35496 gene locus_tag LOCUS_25950 35092 35496 CDS product HEPN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392906.1 protein_id gnl|my_center|LOCUS_25950 >Feature sequence052 793 86 gene locus_tag LOCUS_25960 793 86 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766952.1 protein_id gnl|my_center|LOCUS_25960 1165 812 gene locus_tag LOCUS_25970 1165 812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25970 2997 1270 gene locus_tag LOCUS_25980 2997 1270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767452.1 protein_id gnl|my_center|LOCUS_25980 4161 3127 gene locus_tag LOCUS_25990 4161 3127 CDS product Rpn family recombination-promoting nuclease/putative transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203118.1 protein_id gnl|my_center|LOCUS_25990 5397 4399 gene locus_tag LOCUS_26000 5397 4399 CDS product Rpn family recombination-promoting nuclease/putative transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203118.1 protein_id gnl|my_center|LOCUS_26000 7321 5624 gene locus_tag LOCUS_26010 7321 5624 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767239.1 protein_id gnl|my_center|LOCUS_26010 10372 7337 gene locus_tag LOCUS_26020 10372 7337 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767240.1 protein_id gnl|my_center|LOCUS_26020 11328 15131 gene locus_tag LOCUS_26030 gene dnaE 11328 15131 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010992125.1 protein_id gnl|my_center|LOCUS_26030 15219 15533 gene locus_tag LOCUS_26040 gene trxA 15219 15533 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784741.1 protein_id gnl|my_center|LOCUS_26040 16262 15597 gene locus_tag LOCUS_26050 gene mnmD 16262 15597 CDS product tRNA (5-methylaminomethyl-2-thiouridine)(34)-methyltransferase MnmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010991902.1 protein_id gnl|my_center|LOCUS_26050 16600 16271 gene locus_tag LOCUS_26060 16600 16271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26060 16785 16600 gene locus_tag LOCUS_26070 16785 16600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26070 16917 19310 gene locus_tag LOCUS_26080 16917 19310 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202406.1 protein_id gnl|my_center|LOCUS_26080 19443 22091 gene locus_tag LOCUS_26090 19443 22091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26090 23093 22086 gene locus_tag LOCUS_26100 23093 22086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26100 24454 23090 gene locus_tag LOCUS_26110 24454 23090 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793798.1 protein_id gnl|my_center|LOCUS_26110 24671 25276 gene locus_tag LOCUS_26120 24671 25276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26120 26020 25247 gene locus_tag LOCUS_26130 gene nudC 26020 25247 CDS product NAD(+) diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202441.1 protein_id gnl|my_center|LOCUS_26130 26234 28621 gene locus_tag LOCUS_26140 26234 28621 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009195517.1 protein_id gnl|my_center|LOCUS_26140 32588 28560 gene locus_tag LOCUS_26150 32588 28560 CDS product two-component regulator propeller domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029446868.1 protein_id gnl|my_center|LOCUS_26150 32832 35228 gene locus_tag LOCUS_26160 32832 35228 CDS product outer membrane beta-barrel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918700.1 protein_id gnl|my_center|LOCUS_26160 >Feature sequence053 1509 835 gene locus_tag LOCUS_26170 1509 835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26170 3523 1523 gene locus_tag LOCUS_26180 3523 1523 CDS product AIPR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_044008002.1 protein_id gnl|my_center|LOCUS_26180 3873 3571 gene locus_tag LOCUS_26190 3873 3571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26190 4402 3857 gene locus_tag LOCUS_26200 4402 3857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26200 6246 5539 gene locus_tag LOCUS_26210 6246 5539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26210 8134 6500 gene locus_tag LOCUS_26220 8134 6500 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107911.1 protein_id gnl|my_center|LOCUS_26220 10418 8127 gene locus_tag LOCUS_26230 10418 8127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26230 10470 10688 gene locus_tag LOCUS_26240 10470 10688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26240 10685 11563 gene locus_tag LOCUS_26250 10685 11563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26250 11560 12117 gene locus_tag LOCUS_26260 11560 12117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26260 12162 12872 gene locus_tag LOCUS_26270 12162 12872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26270 13742 12969 gene locus_tag LOCUS_26280 13742 12969 CDS product prephenate dehydrogenase/arogenate dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760853.1 protein_id gnl|my_center|LOCUS_26280 14821 13751 gene locus_tag LOCUS_26290 14821 13751 CDS product bifunctional 3-deoxy-7-phosphoheptulonate synthase/chorismate mutase type II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760854.1 protein_id gnl|my_center|LOCUS_26290 16034 14856 gene locus_tag LOCUS_26300 16034 14856 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760855.1 protein_id gnl|my_center|LOCUS_26300 16854 16009 gene locus_tag LOCUS_26310 16854 16009 CDS product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760856.1 protein_id gnl|my_center|LOCUS_26310 17965 17129 gene locus_tag LOCUS_26320 17965 17129 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787242.1 protein_id gnl|my_center|LOCUS_26320 18642 18061 gene locus_tag LOCUS_26330 18642 18061 CDS product DUF308 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788598.1 protein_id gnl|my_center|LOCUS_26330 18802 19206 gene locus_tag LOCUS_26340 18802 19206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26340 19813 19331 gene locus_tag LOCUS_26350 gene ybaK 19813 19331 CDS product Cys-tRNA(Pro) deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763164.1 protein_id gnl|my_center|LOCUS_26350 21943 19817 gene locus_tag LOCUS_26360 21943 19817 CDS product Tex family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_072067041.1 protein_id gnl|my_center|LOCUS_26360 22096 23604 gene locus_tag LOCUS_26370 22096 23604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26370 24985 23627 gene locus_tag LOCUS_26380 24985 23627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26380 25890 24982 gene locus_tag LOCUS_26390 25890 24982 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948969.1 protein_id gnl|my_center|LOCUS_26390 27614 26061 gene locus_tag LOCUS_26400 27614 26061 CDS product sodium:solute symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789151.1 protein_id gnl|my_center|LOCUS_26400 28193 27768 gene locus_tag LOCUS_26410 28193 27768 CDS product amino acid-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763158.1 protein_id gnl|my_center|LOCUS_26410 29518 28217 gene locus_tag LOCUS_26420 29518 28217 CDS product phenylacetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786583.1 protein_id gnl|my_center|LOCUS_26420 29717 30946 gene locus_tag LOCUS_26430 29717 30946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26430 31000 31572 gene locus_tag LOCUS_26440 31000 31572 CDS product DJ-1/PfpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791124.1 protein_id gnl|my_center|LOCUS_26440 32170 31661 gene locus_tag LOCUS_26450 32170 31661 CDS product ferritin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203292.1 protein_id gnl|my_center|LOCUS_26450 33601 32279 gene locus_tag LOCUS_26460 33601 32279 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922199.1 protein_id gnl|my_center|LOCUS_26460 35072 33606 gene locus_tag LOCUS_26470 35072 33606 CDS product cobyric acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787973.1 protein_id gnl|my_center|LOCUS_26470 >Feature sequence054 26 979 gene locus_tag LOCUS_26480 26 979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26480 1185 1532 gene locus_tag LOCUS_26490 1185 1532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26490 1557 1832 gene locus_tag LOCUS_26500 1557 1832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26500 1849 2949 gene locus_tag LOCUS_26510 1849 2949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26510 2963 5284 gene locus_tag LOCUS_26520 2963 5284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26520 5422 6276 gene locus_tag LOCUS_26530 5422 6276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_26530 6403 7383 gene locus_tag LOCUS_26540 6403 7383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_26540 7800 8756 gene locus_tag LOCUS_26550 7800 8756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26550 8753 9769 gene locus_tag LOCUS_26560 8753 9769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26560 10046 10948 gene locus_tag LOCUS_26570 10046 10948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26570 11053 11385 gene locus_tag LOCUS_26580 11053 11385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26580 13677 11491 gene locus_tag LOCUS_26590 gene rnr 13677 11491 CDS product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761713.1 protein_id gnl|my_center|LOCUS_26590 14763 13816 gene locus_tag LOCUS_26600 14763 13816 CDS product SMP-30/gluconolactonase/LRE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000492432.1 protein_id gnl|my_center|LOCUS_26600 14863 15990 gene locus_tag LOCUS_26610 14863 15990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783472.1 protein_id gnl|my_center|LOCUS_26610 15996 17861 gene locus_tag LOCUS_26620 15996 17861 CDS product DNA topoisomerase IV subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761752.1 protein_id gnl|my_center|LOCUS_26620 17848 18321 gene locus_tag LOCUS_26630 gene coaD 17848 18321 CDS product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761751.1 protein_id gnl|my_center|LOCUS_26630 18318 19934 gene locus_tag LOCUS_26640 18318 19934 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797168.1 protein_id gnl|my_center|LOCUS_26640 19956 20483 gene locus_tag LOCUS_26650 19956 20483 CDS product chromate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108481.1 protein_id gnl|my_center|LOCUS_26650 20485 21036 gene locus_tag LOCUS_26660 20485 21036 CDS product chromate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761975.1 protein_id gnl|my_center|LOCUS_26660 21314 22630 gene locus_tag LOCUS_26670 21314 22630 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107656.1 protein_id gnl|my_center|LOCUS_26670 22749 23975 gene locus_tag LOCUS_26680 22749 23975 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107657.1 protein_id gnl|my_center|LOCUS_26680 23984 24724 gene locus_tag LOCUS_26690 23984 24724 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763426.1 protein_id gnl|my_center|LOCUS_26690 24744 25964 gene locus_tag LOCUS_26700 24744 25964 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786907.1 protein_id gnl|my_center|LOCUS_26700 26047 27114 gene locus_tag LOCUS_26710 26047 27114 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763424.1 protein_id gnl|my_center|LOCUS_26710 27111 27866 gene locus_tag LOCUS_26720 27111 27866 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817185.1 protein_id gnl|my_center|LOCUS_26720 29280 27874 gene locus_tag LOCUS_26730 gene dacB 29280 27874 CDS product D-alanyl-D-alanine carboxypeptidase/D-alanyl-D-alanine-endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839168.1 protein_id gnl|my_center|LOCUS_26730 29390 30547 gene locus_tag LOCUS_26740 29390 30547 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108203.1 protein_id gnl|my_center|LOCUS_26740 30617 30690 gene locus_tag LOCUS_t00280 30617 30690 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 31583 32821 gene locus_tag LOCUS_26750 31583 32821 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765765.1 protein_id gnl|my_center|LOCUS_26750 33781 32885 gene locus_tag LOCUS_26760 33781 32885 CDS product PfkB family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762527.1 protein_id gnl|my_center|LOCUS_26760 >Feature sequence055 827 18 gene locus_tag LOCUS_26770 827 18 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26770 3788 933 gene locus_tag LOCUS_26780 3788 933 CDS product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203068.1 protein_id gnl|my_center|LOCUS_26780 5098 3800 gene locus_tag LOCUS_26790 5098 3800 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108087.1 protein_id gnl|my_center|LOCUS_26790 5631 6302 gene locus_tag LOCUS_26800 5631 6302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26800 7913 7443 gene locus_tag LOCUS_26810 7913 7443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26810 8484 7894 gene locus_tag LOCUS_26820 8484 7894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26820 9411 9773 gene locus_tag LOCUS_26830 9411 9773 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108047.1 protein_id gnl|my_center|LOCUS_26830 9809 10543 gene locus_tag LOCUS_26840 9809 10543 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048692954.1 protein_id gnl|my_center|LOCUS_26840 10621 11295 gene locus_tag LOCUS_26850 gene queC 10621 11295 CDS product 7-cyano-7-deazaguanine synthase QueC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786207.1 protein_id gnl|my_center|LOCUS_26850 11305 11769 gene locus_tag LOCUS_26860 gene queF 11305 11769 CDS product preQ(1) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762202.1 protein_id gnl|my_center|LOCUS_26860 11857 12654 gene locus_tag LOCUS_26870 11857 12654 CDS product DUF1080 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265727.1 protein_id gnl|my_center|LOCUS_26870 13664 12900 gene locus_tag LOCUS_26880 13664 12900 CDS product TIGR03915 family putative DNA repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005804815.1 protein_id gnl|my_center|LOCUS_26880 14950 13691 gene locus_tag LOCUS_26890 14950 13691 CDS product putative DNA modification/repair radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764634.1 protein_id gnl|my_center|LOCUS_26890 15167 15952 gene locus_tag LOCUS_26900 15167 15952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26900 15940 16317 gene locus_tag LOCUS_26910 15940 16317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_26910 16401 17252 gene locus_tag LOCUS_26920 16401 17252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_26920 17469 18260 gene locus_tag LOCUS_26930 17469 18260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26930 18288 19883 gene locus_tag LOCUS_26940 18288 19883 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108692.1 protein_id gnl|my_center|LOCUS_26940 19994 20914 gene locus_tag LOCUS_26950 19994 20914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26950 20933 22435 gene locus_tag LOCUS_26960 20933 22435 CDS product glutamine synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765644.1 protein_id gnl|my_center|LOCUS_26960 22997 24208 gene locus_tag LOCUS_26970 22997 24208 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108042.1 protein_id gnl|my_center|LOCUS_26970 24243 24878 gene locus_tag LOCUS_26980 24243 24878 CDS product CatB-related O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108273.1 protein_id gnl|my_center|LOCUS_26980 26368 24884 gene locus_tag LOCUS_26990 26368 24884 CDS product glycoside hydrolase family 15 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403165.1 protein_id gnl|my_center|LOCUS_26990 28206 26374 gene locus_tag LOCUS_27000 28206 26374 CDS product bifunctional alpha,alpha-trehalose-phosphate synthase (UDP-forming)/trehalose-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763077.1 protein_id gnl|my_center|LOCUS_27000 29185 29658 gene locus_tag LOCUS_27010 29185 29658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27010 29694 29885 gene locus_tag LOCUS_27020 29694 29885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27020 30333 32069 gene locus_tag LOCUS_27030 gene kdpA 30333 32069 CDS product potassium-transporting ATPase subunit KdpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108291.1 protein_id gnl|my_center|LOCUS_27030 32140 33744 gene locus_tag LOCUS_27040 gene kdpB 32140 33744 CDS product potassium-transporting ATPase subunit KdpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763738.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_27040 >Feature sequence056 2191 1709 gene locus_tag LOCUS_27050 2191 1709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_27050 2386 2745 gene locus_tag LOCUS_27060 2386 2745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27060 2976 4061 gene locus_tag LOCUS_27070 2976 4061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27070 4214 4924 gene locus_tag LOCUS_27080 4214 4924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27080 4890 5474 gene locus_tag LOCUS_27090 4890 5474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27090 6782 5574 gene locus_tag LOCUS_27100 6782 5574 CDS product hexokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108294.1 protein_id gnl|my_center|LOCUS_27100 6998 7171 gene locus_tag LOCUS_27110 6998 7171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27110 7866 7348 gene locus_tag LOCUS_27120 7866 7348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27120 8067 8684 gene locus_tag LOCUS_27130 8067 8684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27130 8691 8966 gene locus_tag LOCUS_27140 8691 8966 CDS product zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788894.1 protein_id gnl|my_center|LOCUS_27140 10016 8928 gene locus_tag LOCUS_27150 10016 8928 CDS product winged helix DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763966.1 protein_id gnl|my_center|LOCUS_27150 10128 10727 gene locus_tag LOCUS_27160 10128 10727 CDS product master DNA invertase Mpi family serine-type recombinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005680425.1 protein_id gnl|my_center|LOCUS_27160 11813 10737 gene locus_tag LOCUS_27170 gene corA 11813 10737 CDS product magnesium/cobalt transporter CorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760394.1 protein_id gnl|my_center|LOCUS_27170 14296 11828 gene locus_tag LOCUS_27180 14296 11828 CDS product endonuclease MutS2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109374.1 protein_id gnl|my_center|LOCUS_27180 15742 14312 gene locus_tag LOCUS_27190 15742 14312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27190 15959 16543 gene locus_tag LOCUS_27200 15959 16543 CDS product nucleotide exchange factor GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107672.1 protein_id gnl|my_center|LOCUS_27200 16574 17728 gene locus_tag LOCUS_27210 gene dnaJ 16574 17728 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202549.1 protein_id gnl|my_center|LOCUS_27210 17869 18441 gene locus_tag LOCUS_27220 17869 18441 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032555647.1 protein_id gnl|my_center|LOCUS_27220 19283 18438 gene locus_tag LOCUS_27230 19283 18438 CDS product histidinol-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107810.1 protein_id gnl|my_center|LOCUS_27230 20552 19362 gene locus_tag LOCUS_27240 gene kbl 20552 19362 CDS product glycine C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203088.1 protein_id gnl|my_center|LOCUS_27240 20731 21684 gene locus_tag LOCUS_27250 20731 21684 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762406.1 protein_id gnl|my_center|LOCUS_27250 22505 21774 gene locus_tag LOCUS_27260 gene trmD 22505 21774 CDS product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765722.1 protein_id gnl|my_center|LOCUS_27260 22703 25165 gene locus_tag LOCUS_27270 gene pheT 22703 25165 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107364.1 protein_id gnl|my_center|LOCUS_27270 25197 25928 gene locus_tag LOCUS_27280 25197 25928 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008768977.1 protein_id gnl|my_center|LOCUS_27280 26094 26807 gene locus_tag LOCUS_27290 26094 26807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009292634.1 protein_id gnl|my_center|LOCUS_27290 30164 26922 gene locus_tag LOCUS_27300 30164 26922 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201854.1 protein_id gnl|my_center|LOCUS_27300 30590 30689 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 30894 31361 gene locus_tag LOCUS_27310 30894 31361 CDS product DsbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765180.1 protein_id gnl|my_center|LOCUS_27310 31880 32887 gene locus_tag LOCUS_27320 31880 32887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27320 >Feature sequence057 168 2963 gene locus_tag LOCUS_27330 168 2963 CDS product glycoside hydrolase family 2 TIM barrel-domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202548.1 protein_id gnl|my_center|LOCUS_27330 4391 3480 gene locus_tag LOCUS_27340 4391 3480 CDS product ThuA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921645.1 protein_id gnl|my_center|LOCUS_27340 4831 4388 gene locus_tag LOCUS_27350 4831 4388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27350 4986 6230 gene locus_tag LOCUS_27360 4986 6230 CDS product family 20 glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679442.1 protein_id gnl|my_center|LOCUS_27360 6356 6919 gene locus_tag LOCUS_27370 6356 6919 CDS product sugar O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005818015.1 protein_id gnl|my_center|LOCUS_27370 7871 6933 gene locus_tag LOCUS_27380 7871 6933 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786279.1 protein_id gnl|my_center|LOCUS_27380 8054 7980 gene locus_tag LOCUS_t00290 8054 7980 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 8199 9512 gene locus_tag LOCUS_27390 8199 9512 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763512.1 protein_id gnl|my_center|LOCUS_27390 9633 10229 gene locus_tag LOCUS_27400 9633 10229 CDS product YqgE/AlgH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787276.1 protein_id gnl|my_center|LOCUS_27400 10736 10221 gene locus_tag LOCUS_27410 10736 10221 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787274.1 protein_id gnl|my_center|LOCUS_27410 11920 10754 gene locus_tag LOCUS_27420 11920 10754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27420 12597 11983 gene locus_tag LOCUS_27430 gene recR 12597 11983 CDS product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787270.1 protein_id gnl|my_center|LOCUS_27430 13913 12930 gene locus_tag LOCUS_27440 13913 12930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27440 14374 15207 gene locus_tag LOCUS_27450 14374 15207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27450 15209 16018 gene locus_tag LOCUS_27460 15209 16018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27460 16036 17037 gene locus_tag LOCUS_27470 16036 17037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27470 17389 19299 gene locus_tag LOCUS_27480 17389 19299 CDS product oligopeptide transporter, OPT family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763503.1 protein_id gnl|my_center|LOCUS_27480 19317 20630 gene locus_tag LOCUS_27490 19317 20630 CDS product SpoIID/LytB domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201993.1 protein_id gnl|my_center|LOCUS_27490 20836 23157 gene locus_tag LOCUS_27500 20836 23157 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202761.1 protein_id gnl|my_center|LOCUS_27500 23383 24321 gene locus_tag LOCUS_27510 23383 24321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27510 24363 25826 gene locus_tag LOCUS_27520 24363 25826 CDS product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008768517.1 protein_id gnl|my_center|LOCUS_27520 25871 26473 gene locus_tag LOCUS_27530 gene yihA 25871 26473 CDS product ribosome biogenesis GTP-binding protein YihA/YsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005794469.1 protein_id gnl|my_center|LOCUS_27530 26491 28371 gene locus_tag LOCUS_27540 26491 28371 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963528.1 protein_id gnl|my_center|LOCUS_27540 30701 28395 gene locus_tag LOCUS_27550 30701 28395 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769027.1 protein_id gnl|my_center|LOCUS_27550 >Feature sequence058 110 586 gene locus_tag LOCUS_27560 110 586 CDS product cytidine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816623.1 protein_id gnl|my_center|LOCUS_27560 2397 649 gene locus_tag LOCUS_27570 2397 649 CDS product phospho-sugar mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767964.1 protein_id gnl|my_center|LOCUS_27570 4220 2532 gene locus_tag LOCUS_27580 4220 2532 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767962.1 protein_id gnl|my_center|LOCUS_27580 4428 4715 gene locus_tag LOCUS_27590 4428 4715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27590 6797 5361 gene locus_tag LOCUS_27600 6797 5361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962820.1 protein_id gnl|my_center|LOCUS_27600 8456 6999 gene locus_tag LOCUS_27610 8456 6999 CDS product aminoacyl-histidine dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798834.1 protein_id gnl|my_center|LOCUS_27610 8604 8822 gene locus_tag LOCUS_27620 8604 8822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27620 8847 9452 gene locus_tag LOCUS_27630 8847 9452 CDS product OmpH family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962186.1 protein_id gnl|my_center|LOCUS_27630 9957 9634 gene locus_tag LOCUS_27640 9957 9634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27640 10263 9958 gene locus_tag LOCUS_27650 10263 9958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27650 10333 12093 gene locus_tag LOCUS_27660 10333 12093 CDS product DNA polymerase III subunit gamma/tau inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767911.1 protein_id gnl|my_center|LOCUS_27660 12185 13168 gene locus_tag LOCUS_27670 12185 13168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27670 14214 13231 gene locus_tag LOCUS_27680 14214 13231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27680 15064 14294 gene locus_tag LOCUS_27690 15064 14294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27690 17145 16306 gene locus_tag LOCUS_27700 gene nadC 17145 16306 CDS product carboxylating nicotinate-nucleotide diphosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786213.1 protein_id gnl|my_center|LOCUS_27700 17520 17149 gene locus_tag LOCUS_27710 17520 17149 CDS product DUF4783 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786212.1 protein_id gnl|my_center|LOCUS_27710 17609 18082 gene locus_tag LOCUS_27720 gene rlmH 17609 18082 CDS product 23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107863.1 protein_id gnl|my_center|LOCUS_27720 18509 18318 gene locus_tag LOCUS_27730 18509 18318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_27730 19595 18519 gene locus_tag LOCUS_27740 gene aroC 19595 18519 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766481.1 protein_id gnl|my_center|LOCUS_27740 20274 19699 gene locus_tag LOCUS_27750 20274 19699 CDS product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790721.1 protein_id gnl|my_center|LOCUS_27750 21501 20326 gene locus_tag LOCUS_27760 21501 20326 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795962.1 protein_id gnl|my_center|LOCUS_27760 22624 24459 gene locus_tag LOCUS_27770 gene ilvD 22624 24459 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203429.1 protein_id gnl|my_center|LOCUS_27770 24493 26196 gene locus_tag LOCUS_27780 gene ilvB 24493 26196 CDS product biosynthetic-type acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761034.1 protein_id gnl|my_center|LOCUS_27780 26212 26766 gene locus_tag LOCUS_27790 gene ilvN 26212 26766 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761035.1 protein_id gnl|my_center|LOCUS_27790 26773 27498 gene locus_tag LOCUS_27800 26773 27498 CDS product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203428.1 protein_id gnl|my_center|LOCUS_27800 27548 28591 gene locus_tag LOCUS_27810 gene ilvC 27548 28591 CDS product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761037.1 protein_id gnl|my_center|LOCUS_27810 29018 28677 gene locus_tag LOCUS_27820 29018 28677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27820 29221 28985 gene locus_tag LOCUS_27830 29221 28985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27830 >Feature sequence059 1112 54 gene locus_tag LOCUS_27840 1112 54 CDS product FecR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764521.1 protein_id gnl|my_center|LOCUS_27840 1356 1988 gene locus_tag LOCUS_27850 1356 1988 CDS product RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008768015.1 protein_id gnl|my_center|LOCUS_27850 2143 4938 gene locus_tag LOCUS_27860 2143 4938 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760893.1 protein_id gnl|my_center|LOCUS_27860 5239 6762 gene locus_tag LOCUS_27870 5239 6762 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790953.1 protein_id gnl|my_center|LOCUS_27870 6765 7496 gene locus_tag LOCUS_27880 6765 7496 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790952.1 protein_id gnl|my_center|LOCUS_27880 8959 7550 gene locus_tag LOCUS_27890 8959 7550 CDS product carbon starvation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767795.1 protein_id gnl|my_center|LOCUS_27890 9524 9075 gene locus_tag LOCUS_27900 9524 9075 CDS product GatB/YqeY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783995.1 protein_id gnl|my_center|LOCUS_27900 10908 9544 gene locus_tag LOCUS_27910 gene ftsZ 10908 9544 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783997.1 protein_id gnl|my_center|LOCUS_27910 12294 10942 gene locus_tag LOCUS_27920 gene ftsA 12294 10942 CDS product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783999.1 protein_id gnl|my_center|LOCUS_27920 13028 12300 gene locus_tag LOCUS_27930 13028 12300 CDS product cell division protein FtsQ/DivIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108836.1 protein_id gnl|my_center|LOCUS_27930 14413 13025 gene locus_tag LOCUS_27940 gene murC 14413 13025 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784002.1 protein_id gnl|my_center|LOCUS_27940 15525 14419 gene locus_tag LOCUS_27950 gene murG 15525 14419 CDS product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784003.1 protein_id gnl|my_center|LOCUS_27950 16829 15522 gene locus_tag LOCUS_27960 16829 15522 CDS product FtsW/RodA/SpoVE family cell cycle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784004.1 protein_id gnl|my_center|LOCUS_27960 18178 16841 gene locus_tag LOCUS_27970 gene murD 18178 16841 CDS product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010991956.1 protein_id gnl|my_center|LOCUS_27970 19441 18182 gene locus_tag LOCUS_27980 gene mraY 19441 18182 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964159.1 protein_id gnl|my_center|LOCUS_27980 20915 19455 gene locus_tag LOCUS_27990 20915 19455 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201929.1 protein_id gnl|my_center|LOCUS_27990 23119 20918 gene locus_tag LOCUS_28000 23119 20918 CDS product penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108840.1 protein_id gnl|my_center|LOCUS_28000 23485 23132 gene locus_tag LOCUS_28010 23485 23132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28010 24415 23498 gene locus_tag LOCUS_28020 gene rsmH 24415 23498 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784016.1 protein_id gnl|my_center|LOCUS_28020 24892 25716 gene locus_tag LOCUS_28030 24892 25716 CDS product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784029.1 protein_id gnl|my_center|LOCUS_28030 25729 26703 gene locus_tag LOCUS_28040 25729 26703 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784031.1 protein_id gnl|my_center|LOCUS_28040 27575 26808 gene locus_tag LOCUS_28050 27575 26808 CDS product YjbH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005800614.1 protein_id gnl|my_center|LOCUS_28050 27761 27600 gene locus_tag LOCUS_28060 27761 27600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28060 >Feature sequence060 2379 238 gene locus_tag LOCUS_28070 2379 238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28070 3283 2453 gene locus_tag LOCUS_28080 3283 2453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28080 3690 3301 gene locus_tag LOCUS_28090 3690 3301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28090 4746 3862 gene locus_tag LOCUS_28100 4746 3862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28100 5645 4767 gene locus_tag LOCUS_28110 5645 4767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28110 7923 5788 gene locus_tag LOCUS_28120 7923 5788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28120 8845 7907 gene locus_tag LOCUS_28130 8845 7907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28130 9845 9075 gene locus_tag LOCUS_28140 9845 9075 CDS product DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009039993.1 protein_id gnl|my_center|LOCUS_28140 12219 10036 gene locus_tag LOCUS_28150 12219 10036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28150 13133 12369 gene locus_tag LOCUS_28160 13133 12369 CDS product DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009039993.1 protein_id gnl|my_center|LOCUS_28160 13386 13604 gene locus_tag LOCUS_28170 13386 13604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28170 13690 14823 gene locus_tag LOCUS_28180 13690 14823 CDS product PDDEXK nuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108152.1 protein_id gnl|my_center|LOCUS_28180 14847 16679 gene locus_tag LOCUS_28190 14847 16679 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202429.1 protein_id gnl|my_center|LOCUS_28190 16833 17486 gene locus_tag LOCUS_28200 16833 17486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28200 17648 18265 gene locus_tag LOCUS_28210 17648 18265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28210 18611 18333 gene locus_tag LOCUS_28220 18611 18333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28220 18600 18812 gene locus_tag LOCUS_28230 18600 18812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28230 18881 20353 gene locus_tag LOCUS_28240 18881 20353 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107930.1 protein_id gnl|my_center|LOCUS_28240 20791 20429 gene locus_tag LOCUS_28250 20791 20429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28250 20921 21325 gene locus_tag LOCUS_28260 20921 21325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_28260 21326 24124 gene locus_tag LOCUS_28270 21326 24124 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405560.1 protein_id gnl|my_center|LOCUS_28270 24155 25675 gene locus_tag LOCUS_28280 24155 25675 CDS product SusD/RagB family nutrient-binding outer membrane lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405561.1 protein_id gnl|my_center|LOCUS_28280 25780 27288 gene locus_tag LOCUS_28290 25780 27288 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107930.1 protein_id gnl|my_center|LOCUS_28290 >Feature sequence061 108 1451 gene locus_tag LOCUS_28300 108 1451 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784703.1 protein_id gnl|my_center|LOCUS_28300 1651 2442 gene locus_tag LOCUS_28310 1651 2442 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034100725.1 protein_id gnl|my_center|LOCUS_28310 2462 3025 gene locus_tag LOCUS_28320 2462 3025 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762007.1 protein_id gnl|my_center|LOCUS_28320 3097 3318 gene locus_tag LOCUS_28330 3097 3318 CDS product DUF2795 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002558131.1 protein_id gnl|my_center|LOCUS_28330 3466 4413 gene locus_tag LOCUS_28340 3466 4413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28340 4417 5844 gene locus_tag LOCUS_28350 gene gldK 4417 5844 CDS product gliding motility lipoprotein GldK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964075.1 protein_id gnl|my_center|LOCUS_28350 5896 6987 gene locus_tag LOCUS_28360 5896 6987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28360 6994 8562 gene locus_tag LOCUS_28370 gene gldM 6994 8562 CDS product gliding motility protein GldM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964073.1 protein_id gnl|my_center|LOCUS_28370 8573 9667 gene locus_tag LOCUS_28380 8573 9667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28380 9717 10253 gene locus_tag LOCUS_28390 9717 10253 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000256461.1 protein_id gnl|my_center|LOCUS_28390 11504 10317 gene locus_tag LOCUS_28400 11504 10317 CDS product DUF418 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793345.1 protein_id gnl|my_center|LOCUS_28400 12469 11510 gene locus_tag LOCUS_28410 12469 11510 CDS product nitrilase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816316.1 protein_id gnl|my_center|LOCUS_28410 12565 13074 gene locus_tag LOCUS_28420 12565 13074 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048696696.1 protein_id gnl|my_center|LOCUS_28420 13071 13697 gene locus_tag LOCUS_28430 13071 13697 CDS product chloramphenicol acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787873.1 protein_id gnl|my_center|LOCUS_28430 13893 14153 gene locus_tag LOCUS_28440 13893 14153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797802.1 protein_id gnl|my_center|LOCUS_28440 15280 14222 gene locus_tag LOCUS_28450 15280 14222 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764054.1 protein_id gnl|my_center|LOCUS_28450 18771 15715 gene locus_tag LOCUS_28460 18771 15715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28460 21001 20492 gene locus_tag LOCUS_28470 21001 20492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28470 21436 22659 gene locus_tag LOCUS_28480 21436 22659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28480 22685 23824 gene locus_tag LOCUS_28490 22685 23824 CDS product PDDEXK nuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000445149.1 protein_id gnl|my_center|LOCUS_28490 24702 23953 gene locus_tag LOCUS_28500 24702 23953 CDS product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096592.1 protein_id gnl|my_center|LOCUS_28500 25178 25798 gene locus_tag LOCUS_28510 25178 25798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28510 26659 25940 gene locus_tag LOCUS_28520 26659 25940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28520 <27319 26664 gene locus_tag LOCUS_28530 <27319 26664 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005944378.1:relaxase/mobilization nuclease domain-containing protein >Feature sequence062 127 2187 gene locus_tag LOCUS_28540 127 2187 CDS product alpha-L-fucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_105100235.1 protein_id gnl|my_center|LOCUS_28540 5044 2273 gene locus_tag LOCUS_28550 5044 2273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28550 6350 5376 gene locus_tag LOCUS_28560 6350 5376 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122269.1 protein_id gnl|my_center|LOCUS_28560 8050 6368 gene locus_tag LOCUS_28570 8050 6368 CDS product carboxylesterase/lipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_084146450.1 protein_id gnl|my_center|LOCUS_28570 9602 8064 gene locus_tag LOCUS_28580 9602 8064 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767239.1 protein_id gnl|my_center|LOCUS_28580 12623 9660 gene locus_tag LOCUS_28590 12623 9660 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767240.1 protein_id gnl|my_center|LOCUS_28590 14106 12766 gene locus_tag LOCUS_28600 14106 12766 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922199.1 protein_id gnl|my_center|LOCUS_28600 14852 14133 gene locus_tag LOCUS_28610 14852 14133 CDS product DUF1080 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265727.1 protein_id gnl|my_center|LOCUS_28610 16154 15066 gene locus_tag LOCUS_28620 16154 15066 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763948.1 protein_id gnl|my_center|LOCUS_28620 16397 20359 gene locus_tag LOCUS_28630 16397 20359 CDS product hybrid sensor histidine kinase/response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108531.1 protein_id gnl|my_center|LOCUS_28630 20946 20278 gene locus_tag LOCUS_28640 20946 20278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28640 21120 22265 gene locus_tag LOCUS_28650 21120 22265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28650 22448 22374 gene locus_tag LOCUS_t00300 22448 22374 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 23494 22526 gene locus_tag LOCUS_28660 gene prfB 23494 22526 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161800204.1 protein_id gnl|my_center|LOCUS_28660 25519 23714 gene locus_tag LOCUS_28670 25519 23714 CDS product AMP-dependent synthetase/ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784128.1 protein_id gnl|my_center|LOCUS_28670 25707 26033 gene locus_tag LOCUS_28680 25707 26033 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788181.1 protein_id gnl|my_center|LOCUS_28680 26046 27158 gene locus_tag LOCUS_28690 26046 27158 CDS product PspC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765091.1 protein_id gnl|my_center|LOCUS_28690 >Feature sequence063 125 733 gene locus_tag LOCUS_28700 125 733 CDS product porin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108458.1 protein_id gnl|my_center|LOCUS_28700 821 3283 gene locus_tag LOCUS_28710 gene priA 821 3283 CDS product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203607.1 protein_id gnl|my_center|LOCUS_28710 3336 3821 gene locus_tag LOCUS_28720 3336 3821 CDS product low molecular weight protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765417.1 protein_id gnl|my_center|LOCUS_28720 4178 3837 gene locus_tag LOCUS_28730 4178 3837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28730 4419 4168 gene locus_tag LOCUS_28740 4419 4168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28740 6897 4762 gene locus_tag LOCUS_28750 6897 4762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28750 9576 6937 gene locus_tag LOCUS_28760 9576 6937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28760 9953 9786 gene locus_tag LOCUS_28770 9953 9786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28770 10269 9877 gene locus_tag LOCUS_28780 10269 9877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28780 10409 10636 gene locus_tag LOCUS_28790 10409 10636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28790 10789 11088 gene locus_tag LOCUS_28800 10789 11088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28800 13154 11115 gene locus_tag LOCUS_28810 13154 11115 CDS product HDIG domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791499.1 protein_id gnl|my_center|LOCUS_28810 13251 14768 gene locus_tag LOCUS_28820 gene gltX 13251 14768 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791502.1 protein_id gnl|my_center|LOCUS_28820 14846 16006 gene locus_tag LOCUS_28830 14846 16006 CDS product glycosyltransferase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203604.1 protein_id gnl|my_center|LOCUS_28830 17544 16141 gene locus_tag LOCUS_28840 17544 16141 CDS product C1 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005794507.1 protein_id gnl|my_center|LOCUS_28840 18690 17572 gene locus_tag LOCUS_28850 18690 17572 CDS product carbohydrate-binding family 9-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_072714630.1 protein_id gnl|my_center|LOCUS_28850 19920 18727 gene locus_tag LOCUS_28860 19920 18727 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_130543805.1 protein_id gnl|my_center|LOCUS_28860 20198 20013 gene locus_tag LOCUS_28870 20198 20013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28870 20760 20245 gene locus_tag LOCUS_28880 20760 20245 CDS product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765423.1 protein_id gnl|my_center|LOCUS_28880 22558 20771 gene locus_tag LOCUS_28890 22558 20771 CDS product aminopeptidase P family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765424.1 protein_id gnl|my_center|LOCUS_28890 23364 22603 gene locus_tag LOCUS_28900 23364 22603 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107770.1 protein_id gnl|my_center|LOCUS_28900 23718 24497 gene locus_tag LOCUS_28910 23718 24497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28910 24512 25549 gene locus_tag LOCUS_28920 gene mtnA 24512 25549 CDS product S-methyl-5-thioribose-1-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000392493.1 protein_id gnl|my_center|LOCUS_28920 25634 25825 gene locus_tag LOCUS_28930 gene rpsU 25634 25825 CDS product 30S ribosomal protein S21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005782152.1 protein_id gnl|my_center|LOCUS_28930 25899 26807 gene locus_tag LOCUS_28940 gene xerC 25899 26807 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005804122.1 protein_id gnl|my_center|LOCUS_28940 26797 27096 gene locus_tag LOCUS_28950 gene raiA 26797 27096 CDS product ribosome-associated translation inhibitor RaiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005782154.1 protein_id gnl|my_center|LOCUS_28950 >Feature sequence064 3368 480 gene locus_tag LOCUS_28960 3368 480 CDS product glycoside hydrolase family 38 C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766599.1 protein_id gnl|my_center|LOCUS_28960 4512 3370 gene locus_tag LOCUS_28970 4512 3370 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203242.1 protein_id gnl|my_center|LOCUS_28970 6853 4502 gene locus_tag LOCUS_28980 6853 4502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28980 7969 6872 gene locus_tag LOCUS_28990 7969 6872 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014548276.1 protein_id gnl|my_center|LOCUS_28990 9864 8119 gene locus_tag LOCUS_29000 9864 8119 CDS product class I mannose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706185.1 protein_id gnl|my_center|LOCUS_29000 11198 9897 gene locus_tag LOCUS_29010 11198 9897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29010 11301 12191 gene locus_tag LOCUS_29020 11301 12191 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005801276.1 protein_id gnl|my_center|LOCUS_29020 12279 13625 gene locus_tag LOCUS_29030 12279 13625 CDS product sodium/glutamate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454913.1 protein_id gnl|my_center|LOCUS_29030 15930 13612 gene locus_tag LOCUS_29040 15930 13612 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009195517.1 protein_id gnl|my_center|LOCUS_29040 18382 15998 gene locus_tag LOCUS_29050 18382 15998 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009195517.1 protein_id gnl|my_center|LOCUS_29050 21042 18688 gene locus_tag LOCUS_29060 21042 18688 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202706.1 protein_id gnl|my_center|LOCUS_29060 23392 21068 gene locus_tag LOCUS_29070 23392 21068 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202761.1 protein_id gnl|my_center|LOCUS_29070 24168 23488 gene locus_tag LOCUS_29080 24168 23488 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761370.1 protein_id gnl|my_center|LOCUS_29080 24854 24414 gene locus_tag LOCUS_29090 24854 24414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29090 25469 24882 gene locus_tag LOCUS_29100 25469 24882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29100 25966 25466 gene locus_tag LOCUS_29110 25966 25466 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786485.1 protein_id gnl|my_center|LOCUS_29110 27073 26192 gene locus_tag LOCUS_29120 27073 26192 CDS product TIM barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123560.1 protein_id gnl|my_center|LOCUS_29120 >Feature sequence065 250 705 gene locus_tag LOCUS_29130 250 705 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793753.1 protein_id gnl|my_center|LOCUS_29130 771 1556 gene locus_tag LOCUS_29140 771 1556 CDS product dihydroorotate dehydrogenase electron transfer subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793749.1 protein_id gnl|my_center|LOCUS_29140 1544 2461 gene locus_tag LOCUS_29150 1544 2461 CDS product dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787859.1 protein_id gnl|my_center|LOCUS_29150 3326 2565 gene locus_tag LOCUS_29160 3326 2565 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765510.1 protein_id gnl|my_center|LOCUS_29160 3473 4459 gene locus_tag LOCUS_29170 gene cas1 3473 4459 CDS product CRISPR-associated endonuclease Cas1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879371.1 protein_id gnl|my_center|LOCUS_29170 4462 5484 gene locus_tag LOCUS_29180 4462 5484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29180 5490 5978 gene locus_tag LOCUS_29190 5490 5978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29190 6587 7583 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtcagagaggtagttccattagaataaggattaagac 8131 8799 gene locus_tag LOCUS_29200 8131 8799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29200 8885 11434 gene locus_tag LOCUS_29210 gene cas10 8885 11434 CDS product type III-A CRISPR-associated protein Cas10/Csm1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052261170.1 protein_id gnl|my_center|LOCUS_29210 11452 11940 gene locus_tag LOCUS_29220 11452 11940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29220 11974 12627 gene locus_tag LOCUS_29230 gene csm3 11974 12627 CDS product type III-A CRISPR-associated RAMP protein Csm3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082356.1 protein_id gnl|my_center|LOCUS_29230 12630 13619 gene locus_tag LOCUS_29240 gene csm4 12630 13619 CDS product type III-A CRISPR-associated RAMP protein Csm4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546537.1 protein_id gnl|my_center|LOCUS_29240 13624 14727 gene locus_tag LOCUS_29250 gene csm5 13624 14727 CDS product type III-A CRISPR-associated RAMP protein Csm5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021931.1 protein_id gnl|my_center|LOCUS_29250 14739 15851 gene locus_tag LOCUS_29260 14739 15851 CDS product DUF1887 family CARF protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545976.1 protein_id gnl|my_center|LOCUS_29260 15853 16215 gene locus_tag LOCUS_29270 15853 16215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29270 16205 17644 gene locus_tag LOCUS_29280 16205 17644 CDS product ATP-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016362006.1 protein_id gnl|my_center|LOCUS_29280 17658 18362 gene locus_tag LOCUS_29290 17658 18362 CDS product MgtC/SapB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002677254.1 protein_id gnl|my_center|LOCUS_29290 18842 18372 gene locus_tag LOCUS_29300 18842 18372 CDS product C-GCAxxG-C-C family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793479.1 protein_id gnl|my_center|LOCUS_29300 19116 18829 gene locus_tag LOCUS_29310 19116 18829 CDS product Dabb family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760502.1 protein_id gnl|my_center|LOCUS_29310 20386 19160 gene locus_tag LOCUS_29320 gene serB 20386 19160 CDS product phosphoserine phosphatase SerB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793930.1 protein_id gnl|my_center|LOCUS_29320 20488 21081 gene locus_tag LOCUS_29330 20488 21081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787699.1 protein_id gnl|my_center|LOCUS_29330 23415 21106 gene locus_tag LOCUS_29340 23415 21106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29340 23868 23461 gene locus_tag LOCUS_29350 23868 23461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29350 24245 23877 gene locus_tag LOCUS_29360 24245 23877 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010538531.1 protein_id gnl|my_center|LOCUS_29360 24970 24242 gene locus_tag LOCUS_29370 24970 24242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29370 25372 25034 gene locus_tag LOCUS_29380 25372 25034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29380 26030 26530 gene locus_tag LOCUS_29390 26030 26530 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107474.1 protein_id gnl|my_center|LOCUS_29390 >Feature sequence066 192 1256 gene locus_tag LOCUS_29400 192 1256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29400 1268 1648 gene locus_tag LOCUS_29410 1268 1648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29410 1665 3578 gene locus_tag LOCUS_29420 1665 3578 CDS product nucleoside-diphosphate sugar epimerase/dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788730.1 protein_id gnl|my_center|LOCUS_29420 3853 5424 gene locus_tag LOCUS_29430 3853 5424 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107911.1 protein_id gnl|my_center|LOCUS_29430 6115 6972 gene locus_tag LOCUS_29440 6115 6972 CDS product phosphorylcholine transferase LicD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001061983.1 protein_id gnl|my_center|LOCUS_29440 6932 7972 gene locus_tag LOCUS_29450 6932 7972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29450 7972 8709 gene locus_tag LOCUS_29460 gene ispD 7972 8709 CDS product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389752.1 protein_id gnl|my_center|LOCUS_29460 8715 9722 gene locus_tag LOCUS_29470 8715 9722 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004184376.1 protein_id gnl|my_center|LOCUS_29470 9730 10848 gene locus_tag LOCUS_29480 9730 10848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29480 11046 12419 gene locus_tag LOCUS_29490 11046 12419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29490 12450 13886 gene locus_tag LOCUS_29500 12450 13886 CDS product oligosaccharide flippase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644570.1 protein_id gnl|my_center|LOCUS_29500 14182 15381 gene locus_tag LOCUS_29510 14182 15381 CDS product DegT/DnrJ/EryC1/StrS aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000609547.1 protein_id gnl|my_center|LOCUS_29510 15396 15983 gene locus_tag LOCUS_29520 15396 15983 CDS product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795339.1 protein_id gnl|my_center|LOCUS_29520 16179 17165 gene locus_tag LOCUS_29530 16179 17165 CDS product Rpn family recombination-promoting nuclease/putative transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764795.1 protein_id gnl|my_center|LOCUS_29530 19595 17271 gene locus_tag LOCUS_29540 19595 17271 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162303106.1 protein_id gnl|my_center|LOCUS_29540 20283 19702 gene locus_tag LOCUS_29550 20283 19702 CDS product LuxR C-terminal-related transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763753.1 protein_id gnl|my_center|LOCUS_29550 21000 20293 gene locus_tag LOCUS_29560 21000 20293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29560 21943 21005 gene locus_tag LOCUS_29570 21943 21005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29570 23338 21956 gene locus_tag LOCUS_29580 23338 21956 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122793.1 protein_id gnl|my_center|LOCUS_29580 24826 23357 gene locus_tag LOCUS_29590 24826 23357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29590 25210 25137 gene locus_tag LOCUS_t00310 25210 25137 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 25334 25513 gene locus_tag LOCUS_29600 25334 25513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29600 >Feature sequence067 1 936 gene locus_tag LOCUS_29610 1 936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29610 974 2257 gene locus_tag LOCUS_29620 974 2257 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817735.1 protein_id gnl|my_center|LOCUS_29620 2265 3050 gene locus_tag LOCUS_29630 2265 3050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29630 3072 3545 gene locus_tag LOCUS_29640 3072 3545 CDS product DUF456 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788959.1 protein_id gnl|my_center|LOCUS_29640 4856 3759 gene locus_tag LOCUS_29650 4856 3759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29650 5848 5084 gene locus_tag LOCUS_29660 gene yaaA 5848 5084 CDS product peroxide stress protein YaaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109003.1 protein_id gnl|my_center|LOCUS_29660 6000 6632 gene locus_tag LOCUS_29670 6000 6632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29670 6973 9561 gene locus_tag LOCUS_29680 gene clpB 6973 9561 CDS product ATP-dependent chaperone ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764749.1 protein_id gnl|my_center|LOCUS_29680 10483 10806 gene locus_tag LOCUS_29690 10483 10806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759609.1 protein_id gnl|my_center|LOCUS_29690 10892 11533 gene locus_tag LOCUS_29700 10892 11533 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838096.1 protein_id gnl|my_center|LOCUS_29700 11640 12701 gene locus_tag LOCUS_29710 11640 12701 CDS product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202685.1 protein_id gnl|my_center|LOCUS_29710 12810 13460 gene locus_tag LOCUS_29720 12810 13460 CDS product DUF4136 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784472.1 protein_id gnl|my_center|LOCUS_29720 13491 14111 gene locus_tag LOCUS_29730 13491 14111 CDS product porin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763636.1 protein_id gnl|my_center|LOCUS_29730 14816 14190 gene locus_tag LOCUS_29740 14816 14190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29740 15603 14797 gene locus_tag LOCUS_29750 15603 14797 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817720.1 protein_id gnl|my_center|LOCUS_29750 16416 15694 gene locus_tag LOCUS_29760 16416 15694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29760 17343 16438 gene locus_tag LOCUS_29770 17343 16438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29770 18228 17365 gene locus_tag LOCUS_29780 18228 17365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29780 18943 18245 gene locus_tag LOCUS_29790 18943 18245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29790 19292 19537 gene locus_tag LOCUS_29800 19292 19537 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787659.1 protein_id gnl|my_center|LOCUS_29800 19661 20857 gene locus_tag LOCUS_29810 19661 20857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201898.1 protein_id gnl|my_center|LOCUS_29810 23563 20957 gene locus_tag LOCUS_29820 23563 20957 CDS product glycoside hydrolase family 3 C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108580.1 protein_id gnl|my_center|LOCUS_29820 23766 24602 gene locus_tag LOCUS_29830 23766 24602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29830 24729 25484 gene locus_tag LOCUS_29840 24729 25484 CDS product NigD-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010992089.1 protein_id gnl|my_center|LOCUS_29840 25712 25629 gene locus_tag LOCUS_t00320 25712 25629 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence068 609 121 gene locus_tag LOCUS_29850 gene nuoE 609 121 CDS product NADH-quinone oxidoreductase subunit NuoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766748.1 protein_id gnl|my_center|LOCUS_29850 2403 613 gene locus_tag LOCUS_29860 2403 613 CDS product NADH-dependent [FeFe] hydrogenase, group A6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868906.1 protein_id gnl|my_center|LOCUS_29860 4208 2418 gene locus_tag LOCUS_29870 gene nuoF 4208 2418 CDS product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766746.1 protein_id gnl|my_center|LOCUS_29870 4634 4230 gene locus_tag LOCUS_29880 4634 4230 CDS product (2Fe-2S) ferredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868904.1 protein_id gnl|my_center|LOCUS_29880 5599 4703 gene locus_tag LOCUS_29890 5599 4703 CDS product serine acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762864.1 protein_id gnl|my_center|LOCUS_29890 7764 5602 gene locus_tag LOCUS_29900 7764 5602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29900 8712 7777 gene locus_tag LOCUS_29910 8712 7777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29910 10586 8775 gene locus_tag LOCUS_29920 10586 8775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29920 11413 10610 gene locus_tag LOCUS_29930 11413 10610 CDS product protein-serine/threonine phosphatase Stp1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000888486.1 protein_id gnl|my_center|LOCUS_29930 11941 11426 gene locus_tag LOCUS_29940 11941 11426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29940 12192 11938 gene locus_tag LOCUS_29950 12192 11938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29950 12988 12335 gene locus_tag LOCUS_29960 12988 12335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29960 13382 12993 gene locus_tag LOCUS_29970 13382 12993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29970 14535 13441 gene locus_tag LOCUS_29980 14535 13441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29980 17636 14916 gene locus_tag LOCUS_29990 gene ppdK 17636 14916 CDS product pyruvate, phosphate dikinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202911.1 protein_id gnl|my_center|LOCUS_29990 18264 19655 gene locus_tag LOCUS_30000 gene rlmD 18264 19655 CDS product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788070.1 protein_id gnl|my_center|LOCUS_30000 19668 21053 gene locus_tag LOCUS_30010 19668 21053 CDS product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005802904.1 protein_id gnl|my_center|LOCUS_30010 22003 21122 gene locus_tag LOCUS_30020 22003 21122 CDS product DUF3078 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107713.1 protein_id gnl|my_center|LOCUS_30020 22169 22402 gene locus_tag LOCUS_30030 22169 22402 CDS product YecH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763492.1 protein_id gnl|my_center|LOCUS_30030 22802 22623 gene locus_tag LOCUS_30040 22802 22623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30040 23264 23614 gene locus_tag LOCUS_30050 23264 23614 CDS product DUF1622 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787743.1 protein_id gnl|my_center|LOCUS_30050 24192 23971 gene locus_tag LOCUS_30060 24192 23971 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000152532.1 protein_id gnl|my_center|LOCUS_30060 24755 24195 gene locus_tag LOCUS_30070 24755 24195 CDS product DUF2975 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399412.1 protein_id gnl|my_center|LOCUS_30070 >Feature sequence069 160 963 gene locus_tag LOCUS_30080 160 963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30080 1114 1956 gene locus_tag LOCUS_30090 1114 1956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30090 2021 4618 gene locus_tag LOCUS_30100 2021 4618 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763956.1 protein_id gnl|my_center|LOCUS_30100 4622 5659 gene locus_tag LOCUS_30110 4622 5659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30110 5744 8503 gene locus_tag LOCUS_30120 5744 8503 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763956.1 protein_id gnl|my_center|LOCUS_30120 8508 9623 gene locus_tag LOCUS_30130 8508 9623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30130 10370 9576 gene locus_tag LOCUS_30140 10370 9576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30140 10496 11047 gene locus_tag LOCUS_30150 10496 11047 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786067.1 protein_id gnl|my_center|LOCUS_30150 11028 12416 gene locus_tag LOCUS_30160 11028 12416 CDS product outer membrane beta-barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766767.1 protein_id gnl|my_center|LOCUS_30160 12485 13699 gene locus_tag LOCUS_30170 12485 13699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30170 16082 13719 gene locus_tag LOCUS_30180 16082 13719 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107500.1 protein_id gnl|my_center|LOCUS_30180 16241 16816 gene locus_tag LOCUS_30190 16241 16816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30190 16835 17812 gene locus_tag LOCUS_30200 16835 17812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30200 18141 17809 gene locus_tag LOCUS_30210 18141 17809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30210 21156 18457 gene locus_tag LOCUS_30220 21156 18457 CDS product prolyl oligopeptidase family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117740.1 protein_id gnl|my_center|LOCUS_30220 21997 24909 gene locus_tag LOCUS_30230 21997 24909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30230 >Feature sequence070 2108 555 gene locus_tag LOCUS_30240 2108 555 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203677.1 protein_id gnl|my_center|LOCUS_30240 5626 2228 gene locus_tag LOCUS_30250 5626 2228 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103036562.1 protein_id gnl|my_center|LOCUS_30250 5738 5995 gene locus_tag LOCUS_30260 5738 5995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30260 6219 6947 gene locus_tag LOCUS_30270 6219 6947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30270 7354 7064 gene locus_tag LOCUS_30280 7354 7064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30280 8283 7453 gene locus_tag LOCUS_30290 8283 7453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30290 9843 8329 gene locus_tag LOCUS_30300 9843 8329 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763947.1 protein_id gnl|my_center|LOCUS_30300 11138 9873 gene locus_tag LOCUS_30310 11138 9873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30310 13344 11833 gene locus_tag LOCUS_30320 13344 11833 CDS product bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795889.1 protein_id gnl|my_center|LOCUS_30320 13468 14004 gene locus_tag LOCUS_30330 gene hpt 13468 14004 CDS product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760055.1 protein_id gnl|my_center|LOCUS_30330 14041 14613 gene locus_tag LOCUS_30340 14041 14613 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785533.1 protein_id gnl|my_center|LOCUS_30340 14629 15783 gene locus_tag LOCUS_30350 gene obgE 14629 15783 CDS product GTPase ObgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785536.1 protein_id gnl|my_center|LOCUS_30350 15755 16582 gene locus_tag LOCUS_30360 gene pgeF 15755 16582 CDS product peptidoglycan editing factor PgeF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109232.1 protein_id gnl|my_center|LOCUS_30360 16610 17299 gene locus_tag LOCUS_30370 16610 17299 CDS product phenylalanine--tRNA ligase beta subunit-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009291724.1 protein_id gnl|my_center|LOCUS_30370 17422 17622 gene locus_tag LOCUS_30380 17422 17622 CDS product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789734.1 protein_id gnl|my_center|LOCUS_30380 17773 18066 gene locus_tag LOCUS_30390 17773 18066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010993398.1 protein_id gnl|my_center|LOCUS_30390 18072 18362 gene locus_tag LOCUS_30400 18072 18362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30400 18539 20008 gene locus_tag LOCUS_30410 gene rny 18539 20008 CDS product ribonuclease Y inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760083.1 protein_id gnl|my_center|LOCUS_30410 21940 20072 gene locus_tag LOCUS_30420 21940 20072 CDS product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008661313.1 protein_id gnl|my_center|LOCUS_30420 23553 21937 gene locus_tag LOCUS_30430 23553 21937 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786690.1 protein_id gnl|my_center|LOCUS_30430 24472 23627 gene locus_tag LOCUS_30440 24472 23627 CDS product BRO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962647.1 protein_id gnl|my_center|LOCUS_30440 >Feature sequence071 875 138 gene locus_tag LOCUS_30450 875 138 CDS product MIP/aquaporin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003019891.1 protein_id gnl|my_center|LOCUS_30450 2519 1020 gene locus_tag LOCUS_30460 gene glpK 2519 1020 CDS product glycerol kinase GlpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004556718.1 protein_id gnl|my_center|LOCUS_30460 4117 2552 gene locus_tag LOCUS_30470 4117 2552 CDS product glycerol-3-phosphate dehydrogenase/oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943389.1 protein_id gnl|my_center|LOCUS_30470 6618 4348 gene locus_tag LOCUS_30480 6618 4348 CDS product transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107425.1 protein_id gnl|my_center|LOCUS_30480 7835 6780 gene locus_tag LOCUS_30490 7835 6780 CDS product YeiH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008659065.1 protein_id gnl|my_center|LOCUS_30490 8832 7945 gene locus_tag LOCUS_30500 8832 7945 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785776.1 protein_id gnl|my_center|LOCUS_30500 8914 9843 gene locus_tag LOCUS_30510 8914 9843 CDS product DUF5106 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107815.1 protein_id gnl|my_center|LOCUS_30510 9852 10649 gene locus_tag LOCUS_30520 9852 10649 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786103.1 protein_id gnl|my_center|LOCUS_30520 10886 11125 gene locus_tag LOCUS_30530 10886 11125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30530 11100 11360 gene locus_tag LOCUS_30540 11100 11360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_30540 11332 11667 gene locus_tag LOCUS_30550 11332 11667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_30550 11815 12381 gene locus_tag LOCUS_30560 11815 12381 CDS product bifunctional nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962505.1 protein_id gnl|my_center|LOCUS_30560 12378 13694 gene locus_tag LOCUS_30570 12378 13694 CDS product nucleoside transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036001.1 protein_id gnl|my_center|LOCUS_30570 13727 14431 gene locus_tag LOCUS_30580 13727 14431 CDS product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760001.1 protein_id gnl|my_center|LOCUS_30580 14541 15278 gene locus_tag LOCUS_30590 14541 15278 CDS product DUF1080 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118831743.1 protein_id gnl|my_center|LOCUS_30590 16674 15367 gene locus_tag LOCUS_30600 gene guaA 16674 15367 CDS product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764094.1 protein_id gnl|my_center|LOCUS_30600 18246 16726 gene locus_tag LOCUS_30610 gene guaA 18246 16726 CDS product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785252.1 protein_id gnl|my_center|LOCUS_30610 18459 18707 gene locus_tag LOCUS_30620 18459 18707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30620 19077 18766 gene locus_tag LOCUS_30630 19077 18766 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760436.1 protein_id gnl|my_center|LOCUS_30630 19439 19074 gene locus_tag LOCUS_30640 19439 19074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30640 20446 19580 gene locus_tag LOCUS_30650 20446 19580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_200810866.1 protein_id gnl|my_center|LOCUS_30650 21364 20603 gene locus_tag LOCUS_30660 21364 20603 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167121746.1 protein_id gnl|my_center|LOCUS_30660 22119 21367 gene locus_tag LOCUS_30670 22119 21367 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202410.1 protein_id gnl|my_center|LOCUS_30670 22778 22116 gene locus_tag LOCUS_30680 22778 22116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30680 23307 23235 gene locus_tag LOCUS_t00330 23307 23235 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence072 135 1793 gene locus_tag LOCUS_30690 135 1793 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796334.1 protein_id gnl|my_center|LOCUS_30690 2320 1940 gene locus_tag LOCUS_30700 2320 1940 CDS product GtrA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787805.1 protein_id gnl|my_center|LOCUS_30700 2416 2697 gene locus_tag LOCUS_30710 2416 2697 CDS product antibiotic biosynthesis monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762348.1 protein_id gnl|my_center|LOCUS_30710 4157 2811 gene locus_tag LOCUS_30720 4157 2811 CDS product citrate/2-methylcitrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790680.1 protein_id gnl|my_center|LOCUS_30720 5437 4160 gene locus_tag LOCUS_30730 gene icd 5437 4160 CDS product NADP-dependent isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203424.1 protein_id gnl|my_center|LOCUS_30730 7716 5461 gene locus_tag LOCUS_30740 7716 5461 CDS product aconitate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203425.1 protein_id gnl|my_center|LOCUS_30740 9630 7981 gene locus_tag LOCUS_30750 gene aspD 9630 7981 CDS product aspartate 4-decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202454.1 protein_id gnl|my_center|LOCUS_30750 11340 9643 gene locus_tag LOCUS_30760 gene aspT 11340 9643 CDS product aspartate-alanine antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107422.1 protein_id gnl|my_center|LOCUS_30760 11749 12669 gene locus_tag LOCUS_30770 11749 12669 CDS product sirohydrochlorin cobaltochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202902.1 protein_id gnl|my_center|LOCUS_30770 12756 15200 gene locus_tag LOCUS_30780 12756 15200 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202903.1 protein_id gnl|my_center|LOCUS_30780 15219 16682 gene locus_tag LOCUS_30790 15219 16682 CDS product PepSY-associated TM helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008768920.1 protein_id gnl|my_center|LOCUS_30790 16739 18151 gene locus_tag LOCUS_30800 gene cobJ 16739 18151 CDS product precorrin-3B C(17)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788019.1 protein_id gnl|my_center|LOCUS_30800 18148 19347 gene locus_tag LOCUS_30810 18148 19347 CDS product bifunctional cobalt-precorrin-7 (C(5))-methyltransferase/cobalt-precorrin-6B (C(15))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788021.1 protein_id gnl|my_center|LOCUS_30810 19497 21125 gene locus_tag LOCUS_30820 gene cobM 19497 21125 CDS product precorrin-4 C(11)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788023.1 protein_id gnl|my_center|LOCUS_30820 21125 22951 gene locus_tag LOCUS_30830 gene cbiD 21125 22951 CDS product cobalt-precorrin-5B (C(1))-methyltransferase CbiD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010993058.1 protein_id gnl|my_center|LOCUS_30830 >Feature sequence073 106 180 gene locus_tag LOCUS_t00340 106 180 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 223 297 gene locus_tag LOCUS_t00350 223 297 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 1686 340 gene locus_tag LOCUS_30840 1686 340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30840 2483 1686 gene locus_tag LOCUS_30850 2483 1686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30850 3208 2492 gene locus_tag LOCUS_30860 3208 2492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30860 3625 4383 gene locus_tag LOCUS_30870 gene trmB 3625 4383 CDS product tRNA (guanosine(46)-N7)-methyltransferase TrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032840567.1 protein_id gnl|my_center|LOCUS_30870 4411 5520 gene locus_tag LOCUS_30880 4411 5520 CDS product Mrp/NBP35 family ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791723.1 protein_id gnl|my_center|LOCUS_30880 6792 5638 gene locus_tag LOCUS_30890 6792 5638 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010992113.1 protein_id gnl|my_center|LOCUS_30890 8388 6892 gene locus_tag LOCUS_30900 gene hutH 8388 6892 CDS product histidine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797649.1 protein_id gnl|my_center|LOCUS_30900 9015 8392 gene locus_tag LOCUS_30910 9015 8392 CDS product cyclodeaminase/cyclohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203598.1 protein_id gnl|my_center|LOCUS_30910 10301 9051 gene locus_tag LOCUS_30920 gene hutI 10301 9051 CDS product imidazolonepropionase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108451.1 protein_id gnl|my_center|LOCUS_30920 11210 10305 gene locus_tag LOCUS_30930 gene ftcD 11210 10305 CDS product glutamate formimidoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765436.1 protein_id gnl|my_center|LOCUS_30930 13210 11207 gene locus_tag LOCUS_30940 13210 11207 CDS product urocanate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765435.1 protein_id gnl|my_center|LOCUS_30940 14408 13446 gene locus_tag LOCUS_30950 14408 13446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30950 16035 14824 gene locus_tag LOCUS_30960 16035 14824 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202157.1 protein_id gnl|my_center|LOCUS_30960 16765 16157 gene locus_tag LOCUS_30970 16765 16157 CDS product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202264.1 protein_id gnl|my_center|LOCUS_30970 17649 16771 gene locus_tag LOCUS_30980 17649 16771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30980 18230 17646 gene locus_tag LOCUS_30990 18230 17646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30990 19408 18239 gene locus_tag LOCUS_31000 19408 18239 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957841.1 protein_id gnl|my_center|LOCUS_31000 20315 19542 gene locus_tag LOCUS_31010 20315 19542 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257603.1 protein_id gnl|my_center|LOCUS_31010 21629 20337 gene locus_tag LOCUS_31020 21629 20337 CDS product ATP-grasp domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108800.1 protein_id gnl|my_center|LOCUS_31020 22419 21658 gene locus_tag LOCUS_31030 22419 21658 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066690.1 protein_id gnl|my_center|LOCUS_31030 >Feature sequence074 180 710 gene locus_tag LOCUS_31040 180 710 CDS product DUF4199 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202309.1 protein_id gnl|my_center|LOCUS_31040 732 1682 gene locus_tag LOCUS_31050 732 1682 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760322.1 protein_id gnl|my_center|LOCUS_31050 1679 2200 gene locus_tag LOCUS_31060 1679 2200 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007478802.1 protein_id gnl|my_center|LOCUS_31060 2202 2768 gene locus_tag LOCUS_31070 2202 2768 CDS product manganese efflux pump MntP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948910.1 protein_id gnl|my_center|LOCUS_31070 2813 4537 gene locus_tag LOCUS_31080 2813 4537 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966867.1 protein_id gnl|my_center|LOCUS_31080 4560 5591 gene locus_tag LOCUS_31090 4560 5591 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764710.1 protein_id gnl|my_center|LOCUS_31090 5600 5977 gene locus_tag LOCUS_31100 5600 5977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31100 6561 5980 gene locus_tag LOCUS_31110 6561 5980 CDS product Maf-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107938.1 protein_id gnl|my_center|LOCUS_31110 7120 6599 gene locus_tag LOCUS_31120 7120 6599 CDS product HAD-IIIA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767850.1 protein_id gnl|my_center|LOCUS_31120 7880 7113 gene locus_tag LOCUS_31130 7880 7113 CDS product DUF2520 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203221.1 protein_id gnl|my_center|LOCUS_31130 8437 7877 gene locus_tag LOCUS_31140 8437 7877 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767848.1 protein_id gnl|my_center|LOCUS_31140 8559 10970 gene locus_tag LOCUS_31150 8559 10970 CDS product carboxypeptidase-like regulatory domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963280.1 protein_id gnl|my_center|LOCUS_31150 11099 11509 gene locus_tag LOCUS_31160 gene mce 11099 11509 CDS product methylmalonyl-CoA epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002561104.1 protein_id gnl|my_center|LOCUS_31160 11546 13099 gene locus_tag LOCUS_31170 11546 13099 CDS product acyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005780626.1 protein_id gnl|my_center|LOCUS_31170 13115 14014 gene locus_tag LOCUS_31180 13115 14014 CDS product OadG family transporter subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789537.1 protein_id gnl|my_center|LOCUS_31180 14039 14470 gene locus_tag LOCUS_31190 14039 14470 CDS product biotin/lipoyl-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789540.1 protein_id gnl|my_center|LOCUS_31190 14475 15635 gene locus_tag LOCUS_31200 14475 15635 CDS product sodium ion-translocating decarboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107939.1 protein_id gnl|my_center|LOCUS_31200 16474 15758 gene locus_tag LOCUS_31210 gene tsaB 16474 15758 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766373.1 protein_id gnl|my_center|LOCUS_31210 16676 17536 gene locus_tag LOCUS_31220 16676 17536 CDS product YicC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761103.1 protein_id gnl|my_center|LOCUS_31220 17551 18117 gene locus_tag LOCUS_31230 gene gmk 17551 18117 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048695834.1 protein_id gnl|my_center|LOCUS_31230 18121 18300 gene locus_tag LOCUS_31240 18121 18300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31240 18309 18875 gene locus_tag LOCUS_31250 gene nadD 18309 18875 CDS product nicotinate (nicotinamide) nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797930.1 protein_id gnl|my_center|LOCUS_31250 19391 20506 gene locus_tag LOCUS_31260 19391 20506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31260 20526 21911 gene locus_tag LOCUS_31270 20526 21911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31270 >Feature sequence075 985 14 gene locus_tag LOCUS_31280 985 14 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784707.1 protein_id gnl|my_center|LOCUS_31280 1746 1312 gene locus_tag LOCUS_31290 1746 1312 CDS product DUF6078 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760904.1 protein_id gnl|my_center|LOCUS_31290 2269 5676 gene locus_tag LOCUS_31300 2269 5676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31300 8856 6196 gene locus_tag LOCUS_31310 8856 6196 CDS product transglutaminase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202271.1 protein_id gnl|my_center|LOCUS_31310 9077 10576 gene locus_tag LOCUS_31320 9077 10576 CDS product potassium/proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761361.1 protein_id gnl|my_center|LOCUS_31320 12501 10666 gene locus_tag LOCUS_31330 12501 10666 CDS product glycoside hydrolase family 127 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767027.1 protein_id gnl|my_center|LOCUS_31330 14836 12794 gene locus_tag LOCUS_31340 14836 12794 CDS product glycoside hydrolase family 127 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008658063.1 protein_id gnl|my_center|LOCUS_31340 16522 14894 gene locus_tag LOCUS_31350 16522 14894 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767239.1 protein_id gnl|my_center|LOCUS_31350 16937 16536 gene locus_tag LOCUS_31360 16937 16536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31360 17999 19549 gene locus_tag LOCUS_31370 17999 19549 CDS product PglZ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963211.1 protein_id gnl|my_center|LOCUS_31370 19625 20044 gene locus_tag LOCUS_31380 gene tsaE 19625 20044 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759702.1 protein_id gnl|my_center|LOCUS_31380 20049 20264 gene locus_tag LOCUS_31390 20049 20264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31390 20518 21402 gene locus_tag LOCUS_31400 20518 21402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31400 >Feature sequence076 1299 622 gene locus_tag LOCUS_31410 1299 622 CDS product porin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788195.1 protein_id gnl|my_center|LOCUS_31410 3113 1305 gene locus_tag LOCUS_31420 3113 1305 CDS product LysM peptidoglycan-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202945.1 protein_id gnl|my_center|LOCUS_31420 3218 4561 gene locus_tag LOCUS_31430 3218 4561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31430 4614 5519 gene locus_tag LOCUS_31440 4614 5519 CDS product lytic transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_055217507.1 protein_id gnl|my_center|LOCUS_31440 6595 5630 gene locus_tag LOCUS_31450 gene glsA 6595 5630 CDS product glutaminase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765205.1 protein_id gnl|my_center|LOCUS_31450 8110 6671 gene locus_tag LOCUS_31460 8110 6671 CDS product glutamate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784276.1 protein_id gnl|my_center|LOCUS_31460 8333 9559 gene locus_tag LOCUS_31470 8333 9559 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005801628.1 protein_id gnl|my_center|LOCUS_31470 9593 10507 gene locus_tag LOCUS_31480 9593 10507 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765200.1 protein_id gnl|my_center|LOCUS_31480 10541 10693 gene locus_tag LOCUS_31490 10541 10693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31490 11251 10745 gene locus_tag LOCUS_31500 11251 10745 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765089.1 protein_id gnl|my_center|LOCUS_31500 11448 12038 gene locus_tag LOCUS_31510 11448 12038 CDS product V-type ATP synthase subunit E family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788438.1 protein_id gnl|my_center|LOCUS_31510 12040 12918 gene locus_tag LOCUS_31520 12040 12918 CDS product DUF2764 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788436.1 protein_id gnl|my_center|LOCUS_31520 12922 14679 gene locus_tag LOCUS_31530 12922 14679 CDS product V-type ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010538526.1 protein_id gnl|my_center|LOCUS_31530 14687 16003 gene locus_tag LOCUS_31540 14687 16003 CDS product V-type ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788433.1 protein_id gnl|my_center|LOCUS_31540 16015 16638 gene locus_tag LOCUS_31550 16015 16638 CDS product V-type ATP synthase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788431.1 protein_id gnl|my_center|LOCUS_31550 16635 18455 gene locus_tag LOCUS_31560 16635 18455 CDS product V-type ATPase 116kDa subunit family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008660668.1 protein_id gnl|my_center|LOCUS_31560 18510 18965 gene locus_tag LOCUS_31570 18510 18965 CDS product V-type ATP synthase subunit K inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005675599.1 protein_id gnl|my_center|LOCUS_31570 19125 19490 gene locus_tag LOCUS_31580 19125 19490 CDS product BlaI/MecI/CopY family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769502.1 protein_id gnl|my_center|LOCUS_31580 19499 20968 gene locus_tag LOCUS_31590 19499 20968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31590 >Feature sequence077 113 28 gene locus_tag LOCUS_t00360 113 28 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 366 779 gene locus_tag LOCUS_31600 366 779 CDS product thioredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789107.1 protein_id gnl|my_center|LOCUS_31600 864 1196 gene locus_tag LOCUS_31610 864 1196 CDS product CGGC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018214298.1 protein_id gnl|my_center|LOCUS_31610 1827 1279 gene locus_tag LOCUS_31620 1827 1279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31620 2173 3810 gene locus_tag LOCUS_31630 2173 3810 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761073.1 protein_id gnl|my_center|LOCUS_31630 5288 3807 gene locus_tag LOCUS_31640 5288 3807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31640 5461 6072 gene locus_tag LOCUS_31650 5461 6072 CDS product trimeric intracellular cation channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005776695.1 protein_id gnl|my_center|LOCUS_31650 6095 7159 gene locus_tag LOCUS_31660 6095 7159 CDS product asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765045.1 protein_id gnl|my_center|LOCUS_31660 7209 8012 gene locus_tag LOCUS_31670 7209 8012 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787710.1 protein_id gnl|my_center|LOCUS_31670 8129 8202 gene locus_tag LOCUS_t00370 8129 8202 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 8217 8302 gene locus_tag LOCUS_t00380 8217 8302 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 8570 9181 gene locus_tag LOCUS_31680 8570 9181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31680 11251 9185 gene locus_tag LOCUS_31690 11251 9185 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784260.1 protein_id gnl|my_center|LOCUS_31690 11539 12828 gene locus_tag LOCUS_31700 11539 12828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31700 12880 14469 gene locus_tag LOCUS_31710 12880 14469 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760612.1 protein_id gnl|my_center|LOCUS_31710 14675 15268 gene locus_tag LOCUS_31720 14675 15268 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963245.1 protein_id gnl|my_center|LOCUS_31720 15368 15517 gene locus_tag LOCUS_31730 15368 15517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31730 15596 16246 gene locus_tag LOCUS_31740 gene rpe 15596 16246 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109031.1 protein_id gnl|my_center|LOCUS_31740 16508 17566 gene locus_tag LOCUS_31750 16508 17566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31750 17604 18653 gene locus_tag LOCUS_31760 17604 18653 CDS product DHH family phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760868.1 protein_id gnl|my_center|LOCUS_31760 18706 19299 gene locus_tag LOCUS_31770 18706 19299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31770 19296 20684 gene locus_tag LOCUS_31780 gene glmM 19296 20684 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791020.1 protein_id gnl|my_center|LOCUS_31780 >Feature sequence078 165 497 gene locus_tag LOCUS_31790 165 497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31790 707 507 gene locus_tag LOCUS_31800 707 507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31800 1079 759 gene locus_tag LOCUS_31810 1079 759 CDS product DUF4491 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797188.1 protein_id gnl|my_center|LOCUS_31810 1756 1373 gene locus_tag LOCUS_31820 gene secG 1756 1373 CDS product preprotein translocase subunit SecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785472.1 protein_id gnl|my_center|LOCUS_31820 2531 1764 gene locus_tag LOCUS_31830 2531 1764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785470.1 protein_id gnl|my_center|LOCUS_31830 3069 2533 gene locus_tag LOCUS_31840 3069 2533 CDS product LptE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008658877.1 protein_id gnl|my_center|LOCUS_31840 4264 3074 gene locus_tag LOCUS_31850 4264 3074 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785466.1 protein_id gnl|my_center|LOCUS_31850 5196 4369 gene locus_tag LOCUS_31860 5196 4369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31860 6087 5200 gene locus_tag LOCUS_31870 6087 5200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31870 6823 6095 gene locus_tag LOCUS_31880 gene efpI 6823 6095 CDS product EF-P-5 aminopentanone reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244676.1 protein_id gnl|my_center|LOCUS_31880 7302 6835 gene locus_tag LOCUS_31890 gene tagD 7302 6835 CDS product glycerol-3-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880882.1 protein_id gnl|my_center|LOCUS_31890 8581 7472 gene locus_tag LOCUS_31900 gene pdxA 8581 7472 CDS product 4-hydroxythreonine-4-phosphate dehydrogenase PdxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785465.1 protein_id gnl|my_center|LOCUS_31900 9668 8598 gene locus_tag LOCUS_31910 9668 8598 CDS product DUF4837 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785463.1 protein_id gnl|my_center|LOCUS_31910 10683 9652 gene locus_tag LOCUS_31920 gene rlmN 10683 9652 CDS product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202252.1 protein_id gnl|my_center|LOCUS_31920 12955 10820 gene locus_tag LOCUS_31930 12955 10820 CDS product SurA N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764533.1 protein_id gnl|my_center|LOCUS_31930 14248 13052 gene locus_tag LOCUS_31940 14248 13052 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795896.1 protein_id gnl|my_center|LOCUS_31940 14972 14307 gene locus_tag LOCUS_31950 gene lptC 14972 14307 CDS product LPS export ABC transporter periplasmic protein LptC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764532.1 protein_id gnl|my_center|LOCUS_31950 16339 14975 gene locus_tag LOCUS_31960 16339 14975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760038.1 protein_id gnl|my_center|LOCUS_31960 17708 16425 gene locus_tag LOCUS_31970 17708 16425 CDS product outer membrane protein transport protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760037.1 protein_id gnl|my_center|LOCUS_31970 18522 17695 gene locus_tag LOCUS_31980 18522 17695 CDS product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764531.1 protein_id gnl|my_center|LOCUS_31980 19252 19605 gene locus_tag LOCUS_31990 19252 19605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31990 >Feature sequence079 1600 227 gene locus_tag LOCUS_32000 1600 227 CDS product aminopeptidase P family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203671.1 protein_id gnl|my_center|LOCUS_32000 1713 2057 gene locus_tag LOCUS_32010 1713 2057 CDS product DRTGG domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869442.1 protein_id gnl|my_center|LOCUS_32010 2076 2501 gene locus_tag LOCUS_32020 2076 2501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32020 2505 3884 gene locus_tag LOCUS_32030 2505 3884 CDS product [Fe-Fe] hydrogenase large subunit C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583277.1 protein_id gnl|my_center|LOCUS_32030 3871 4215 gene locus_tag LOCUS_32040 3871 4215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32040 4212 4958 gene locus_tag LOCUS_32050 4212 4958 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583280.1 protein_id gnl|my_center|LOCUS_32050 4951 5484 gene locus_tag LOCUS_32060 4951 5484 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583282.1 protein_id gnl|my_center|LOCUS_32060 6938 5721 gene locus_tag LOCUS_32070 6938 5721 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787888.1 protein_id gnl|my_center|LOCUS_32070 9593 6981 gene locus_tag LOCUS_32080 gene gyrA 9593 6981 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765727.1 protein_id gnl|my_center|LOCUS_32080 9798 12356 gene locus_tag LOCUS_32090 9798 12356 CDS product ATP-dependent Clp protease ATP-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202860.1 protein_id gnl|my_center|LOCUS_32090 12579 12495 gene locus_tag LOCUS_t00390 12579 12495 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 12677 12590 gene locus_tag LOCUS_t00400 12677 12590 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 12765 12692 gene locus_tag LOCUS_t00410 12765 12692 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 13672 12845 gene locus_tag LOCUS_32100 13672 12845 CDS product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761225.1 protein_id gnl|my_center|LOCUS_32100 14940 13684 gene locus_tag LOCUS_32110 14940 13684 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878057.1 protein_id gnl|my_center|LOCUS_32110 16307 14952 gene locus_tag LOCUS_32120 16307 14952 CDS product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108128.1 protein_id gnl|my_center|LOCUS_32120 17535 16450 gene locus_tag LOCUS_32130 17535 16450 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790418.1 protein_id gnl|my_center|LOCUS_32130 17645 18424 gene locus_tag LOCUS_32140 17645 18424 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109289.1 protein_id gnl|my_center|LOCUS_32140 >Feature sequence080 83 595 gene locus_tag LOCUS_32150 83 595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32150 1348 644 gene locus_tag LOCUS_32160 1348 644 CDS product precorrin-2 C(20)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787514.1 protein_id gnl|my_center|LOCUS_32160 1677 2840 gene locus_tag LOCUS_32170 1677 2840 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202774.1 protein_id gnl|my_center|LOCUS_32170 2850 3887 gene locus_tag LOCUS_32180 2850 3887 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787518.1 protein_id gnl|my_center|LOCUS_32180 3889 4902 gene locus_tag LOCUS_32190 3889 4902 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202775.1 protein_id gnl|my_center|LOCUS_32190 5676 8003 gene locus_tag LOCUS_32200 5676 8003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32200 8481 9485 gene locus_tag LOCUS_32210 8481 9485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32210 9493 10854 gene locus_tag LOCUS_32220 9493 10854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32220 10998 12683 gene locus_tag LOCUS_32230 10998 12683 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005898122.1 protein_id gnl|my_center|LOCUS_32230 13231 15675 gene locus_tag LOCUS_32240 13231 15675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32240 15732 16499 gene locus_tag LOCUS_32250 15732 16499 CDS product DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009039993.1 protein_id gnl|my_center|LOCUS_32250 16624 18312 gene locus_tag LOCUS_32260 16624 18312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32260 >Feature sequence081 299 21 gene locus_tag LOCUS_32270 299 21 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32270 409 2076 gene locus_tag LOCUS_32280 409 2076 CDS product putative transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786793.1 protein_id gnl|my_center|LOCUS_32280 2160 5081 gene locus_tag LOCUS_32290 2160 5081 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173072481.1 protein_id gnl|my_center|LOCUS_32290 5116 5946 gene locus_tag LOCUS_32300 5116 5946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32300 6278 5991 gene locus_tag LOCUS_32310 6278 5991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32310 6908 7522 gene locus_tag LOCUS_32320 6908 7522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32320 7519 8406 gene locus_tag LOCUS_32330 7519 8406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32330 8426 9826 gene locus_tag LOCUS_32340 8426 9826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32340 10013 11350 gene locus_tag LOCUS_32350 10013 11350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162484911.1 protein_id gnl|my_center|LOCUS_32350 11363 11695 gene locus_tag LOCUS_32360 11363 11695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32360 11716 12435 gene locus_tag LOCUS_32370 11716 12435 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105161.1 protein_id gnl|my_center|LOCUS_32370 12493 13572 gene locus_tag LOCUS_32380 12493 13572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32380 15693 16748 gene locus_tag LOCUS_32390 15693 16748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32390 18060 16870 gene locus_tag LOCUS_32400 18060 16870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005802082.1 protein_id gnl|my_center|LOCUS_32400 >Feature sequence082 355 738 gene locus_tag LOCUS_32410 355 738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32410 850 2412 gene locus_tag LOCUS_32420 850 2412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32420 2687 3340 gene locus_tag LOCUS_32430 2687 3340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32430 3347 4594 gene locus_tag LOCUS_32440 gene ftsZ 3347 4594 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783997.1 protein_id gnl|my_center|LOCUS_32440 6251 4869 gene locus_tag LOCUS_32450 gene cdeA 6251 4869 CDS product multidrug efflux MATE transporter CdeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009902537.1 protein_id gnl|my_center|LOCUS_32450 6891 6328 gene locus_tag LOCUS_32460 6891 6328 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766588.1 protein_id gnl|my_center|LOCUS_32460 7211 8557 gene locus_tag LOCUS_32470 7211 8557 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762738.1 protein_id gnl|my_center|LOCUS_32470 8606 9955 gene locus_tag LOCUS_32480 8606 9955 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107402.1 protein_id gnl|my_center|LOCUS_32480 9945 11264 gene locus_tag LOCUS_32490 9945 11264 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107401.1 protein_id gnl|my_center|LOCUS_32490 11436 12689 gene locus_tag LOCUS_32500 11436 12689 CDS product Nramp family divalent metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032840969.1 protein_id gnl|my_center|LOCUS_32500 12742 14481 gene locus_tag LOCUS_32510 12742 14481 CDS product glutamine--tRNA ligase/YqeY domain fusion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107711.1 protein_id gnl|my_center|LOCUS_32510 14492 15949 gene locus_tag LOCUS_32520 14492 15949 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788591.1 protein_id gnl|my_center|LOCUS_32520 15967 16884 gene locus_tag LOCUS_32530 15967 16884 CDS product DUF368 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_057642364.1 protein_id gnl|my_center|LOCUS_32530 17218 18087 gene locus_tag LOCUS_32540 17218 18087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32540 >Feature sequence083 180 761 gene locus_tag LOCUS_32550 180 761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32550 823 1503 gene locus_tag LOCUS_32560 823 1503 CDS product queuosine precursor transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786205.1 protein_id gnl|my_center|LOCUS_32560 2143 1529 gene locus_tag LOCUS_32570 2143 1529 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763583.1 protein_id gnl|my_center|LOCUS_32570 3488 2145 gene locus_tag LOCUS_32580 3488 2145 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107690.1 protein_id gnl|my_center|LOCUS_32580 4277 3489 gene locus_tag LOCUS_32590 4277 3489 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010993119.1 protein_id gnl|my_center|LOCUS_32590 5074 4277 gene locus_tag LOCUS_32600 5074 4277 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005778456.1 protein_id gnl|my_center|LOCUS_32600 6475 5087 gene locus_tag LOCUS_32610 gene potA 6475 5087 CDS product polyamine ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762997.1 protein_id gnl|my_center|LOCUS_32610 8292 6793 gene locus_tag LOCUS_32620 8292 6793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32620 9746 8346 gene locus_tag LOCUS_32630 gene fumC 9746 8346 CDS product class II fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963718.1 protein_id gnl|my_center|LOCUS_32630 10829 9897 gene locus_tag LOCUS_32640 10829 9897 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001170714.1 protein_id gnl|my_center|LOCUS_32640 11215 10835 gene locus_tag LOCUS_32650 11215 10835 CDS product GtrA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787805.1 protein_id gnl|my_center|LOCUS_32650 11951 11202 gene locus_tag LOCUS_32660 11951 11202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32660 13042 12041 gene locus_tag LOCUS_32670 13042 12041 CDS product GRP family sugar transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108492.1 protein_id gnl|my_center|LOCUS_32670 14054 13050 gene locus_tag LOCUS_32680 14054 13050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32680 15623 14070 gene locus_tag LOCUS_32690 15623 14070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32690 16568 15645 gene locus_tag LOCUS_32700 gene rbsK 16568 15645 CDS product ribokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761960.1 protein_id gnl|my_center|LOCUS_32700 >Feature sequence084 888 100 gene locus_tag LOCUS_32710 888 100 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789184.1 protein_id gnl|my_center|LOCUS_32710 1469 894 gene locus_tag LOCUS_32720 1469 894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32720 2198 1617 gene locus_tag LOCUS_32730 2198 1617 CDS product indolepyruvate oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760706.1 protein_id gnl|my_center|LOCUS_32730 3796 2195 gene locus_tag LOCUS_32740 3796 2195 CDS product thiamine pyrophosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202519.1 protein_id gnl|my_center|LOCUS_32740 4950 3901 gene locus_tag LOCUS_32750 gene mltG 4950 3901 CDS product endolytic transglycosylase MltG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202520.1 protein_id gnl|my_center|LOCUS_32750 5089 5176 gene locus_tag LOCUS_t00420 5089 5176 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 5315 5932 gene locus_tag LOCUS_32760 gene mpi 5315 5932 CDS product serine-type multi-promoter DNA invertase Mpi inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788600.1 protein_id gnl|my_center|LOCUS_32760 8055 5995 gene locus_tag LOCUS_32770 8055 5995 CDS product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008770054.1 protein_id gnl|my_center|LOCUS_32770 8887 8135 gene locus_tag LOCUS_32780 gene hypB 8887 8135 CDS product hydrogenase nickel incorporation protein HypB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933458.1 protein_id gnl|my_center|LOCUS_32780 9264 8917 gene locus_tag LOCUS_32790 gene hypA 9264 8917 CDS product hydrogenase maturation nickel metallochaperone HypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933459.1 protein_id gnl|my_center|LOCUS_32790 11559 9277 gene locus_tag LOCUS_32800 gene hypF 11559 9277 CDS product carbamoyltransferase HypF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940975.1 protein_id gnl|my_center|LOCUS_32800 11683 11862 gene locus_tag LOCUS_32810 11683 11862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32810 11850 12929 gene locus_tag LOCUS_32820 gene hypD 11850 12929 CDS product hydrogenase formation protein HypD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258618.1 protein_id gnl|my_center|LOCUS_32820 12940 13989 gene locus_tag LOCUS_32830 gene hypE 12940 13989 CDS product hydrogenase expression/formation protein HypE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933452.1 protein_id gnl|my_center|LOCUS_32830 14009 15106 gene locus_tag LOCUS_32840 14009 15106 CDS product hydrogenase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388916.1 protein_id gnl|my_center|LOCUS_32840 15122 16843 gene locus_tag LOCUS_32850 15122 16843 CDS product nickel-dependent hydrogenase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944569.1 protein_id gnl|my_center|LOCUS_32850 16858 17595 gene locus_tag LOCUS_32860 gene cybH 16858 17595 CDS product Ni/Fe-hydrogenase, b-type cytochrome subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811165.1 protein_id gnl|my_center|LOCUS_32860 >Feature sequence085 199 978 gene locus_tag LOCUS_32870 199 978 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016269488.1 protein_id gnl|my_center|LOCUS_32870 966 1853 gene locus_tag LOCUS_32880 966 1853 CDS product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005775476.1 protein_id gnl|my_center|LOCUS_32880 1886 2560 gene locus_tag LOCUS_32890 1886 2560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32890 2605 4053 gene locus_tag LOCUS_32900 2605 4053 CDS product lytic transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764235.1 protein_id gnl|my_center|LOCUS_32900 4163 5179 gene locus_tag LOCUS_32910 4163 5179 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203638.1 protein_id gnl|my_center|LOCUS_32910 5186 5941 gene locus_tag LOCUS_32920 5186 5941 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791451.1 protein_id gnl|my_center|LOCUS_32920 6276 6659 gene locus_tag LOCUS_32930 6276 6659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32930 8057 6762 gene locus_tag LOCUS_32940 8057 6762 CDS product O-acetylhomoserine aminocarboxypropyltransferase/cysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763773.1 protein_id gnl|my_center|LOCUS_32940 8220 8690 gene locus_tag LOCUS_32950 8220 8690 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763774.1 protein_id gnl|my_center|LOCUS_32950 8788 11073 gene locus_tag LOCUS_32960 8788 11073 CDS product RelA/SpoT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796220.1 protein_id gnl|my_center|LOCUS_32960 12069 11119 gene locus_tag LOCUS_32970 12069 11119 CDS product calcium/sodium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783471.1 protein_id gnl|my_center|LOCUS_32970 12477 12076 gene locus_tag LOCUS_32980 12477 12076 CDS product DUF3127 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788752.1 protein_id gnl|my_center|LOCUS_32980 12913 12557 gene locus_tag LOCUS_32990 12913 12557 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784840.1 protein_id gnl|my_center|LOCUS_32990 13911 12928 gene locus_tag LOCUS_33000 13911 12928 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760911.1 protein_id gnl|my_center|LOCUS_33000 14010 16631 gene locus_tag LOCUS_33010 gene alaS 14010 16631 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109057.1 protein_id gnl|my_center|LOCUS_33010 16786 17847 gene locus_tag LOCUS_33020 gene aroB 16786 17847 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784805.1 protein_id gnl|my_center|LOCUS_33020 >Feature sequence086 479 2155 gene locus_tag LOCUS_33030 479 2155 CDS product DUF6057 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202172.1 protein_id gnl|my_center|LOCUS_33030 2152 3621 gene locus_tag LOCUS_33040 2152 3621 CDS product PD40 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813223.1 protein_id gnl|my_center|LOCUS_33040 3685 4611 gene locus_tag LOCUS_33050 3685 4611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33050 4608 5156 gene locus_tag LOCUS_33060 4608 5156 CDS product DUF4924 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786016.1 protein_id gnl|my_center|LOCUS_33060 5171 6034 gene locus_tag LOCUS_33070 gene rfbD 5171 6034 CDS product dTDP-4-dehydrorhamnose reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786018.1 protein_id gnl|my_center|LOCUS_33070 6064 7644 gene locus_tag LOCUS_33080 6064 7644 CDS product peptide chain release factor 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786020.1 protein_id gnl|my_center|LOCUS_33080 7646 8653 gene locus_tag LOCUS_33090 7646 8653 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785727.1 protein_id gnl|my_center|LOCUS_33090 9477 8785 gene locus_tag LOCUS_33100 9477 8785 CDS product YjjG family noncanonical pyrimidine nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108200.1 protein_id gnl|my_center|LOCUS_33100 10376 9477 gene locus_tag LOCUS_33110 10376 9477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784668.1 protein_id gnl|my_center|LOCUS_33110 11073 10369 gene locus_tag LOCUS_33120 gene rsmI 11073 10369 CDS product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108201.1 protein_id gnl|my_center|LOCUS_33120 11778 11083 gene locus_tag LOCUS_33130 11778 11083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33130 12970 11888 gene locus_tag LOCUS_33140 12970 11888 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764222.1 protein_id gnl|my_center|LOCUS_33140 13397 14032 gene locus_tag LOCUS_33150 13397 14032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784817.1 protein_id gnl|my_center|LOCUS_33150 14045 14869 gene locus_tag LOCUS_33160 14045 14869 CDS product DUF3822 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764221.1 protein_id gnl|my_center|LOCUS_33160 14860 15417 gene locus_tag LOCUS_33170 14860 15417 CDS product RsmD family RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760894.1 protein_id gnl|my_center|LOCUS_33170 16825 15389 gene locus_tag LOCUS_33180 gene cls 16825 15389 CDS product cardiolipin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796243.1 protein_id gnl|my_center|LOCUS_33180 >Feature sequence087 121 1014 gene locus_tag LOCUS_33190 121 1014 CDS product nitronate monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202434.1 protein_id gnl|my_center|LOCUS_33190 2266 1082 gene locus_tag LOCUS_33200 2266 1082 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790620.1 protein_id gnl|my_center|LOCUS_33200 5355 2272 gene locus_tag LOCUS_33210 5355 2272 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790618.1 protein_id gnl|my_center|LOCUS_33210 6573 5371 gene locus_tag LOCUS_33220 6573 5371 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008657461.1 protein_id gnl|my_center|LOCUS_33220 7056 6652 gene locus_tag LOCUS_33230 7056 6652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010992882.1 protein_id gnl|my_center|LOCUS_33230 7321 7127 gene locus_tag LOCUS_33240 7321 7127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33240 8253 7483 gene locus_tag LOCUS_33250 8253 7483 CDS product sulfide-dependent adenosine diphosphate thiazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061316.1 protein_id gnl|my_center|LOCUS_33250 8808 8560 gene locus_tag LOCUS_33260 8808 8560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33260 9538 8867 gene locus_tag LOCUS_33270 9538 8867 CDS product cytidylate kinase-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203450.1 protein_id gnl|my_center|LOCUS_33270 12105 9829 gene locus_tag LOCUS_33280 12105 9829 CDS product GH92 family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107968.1 protein_id gnl|my_center|LOCUS_33280 14493 12223 gene locus_tag LOCUS_33290 14493 12223 CDS product GH92 family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108964.1 protein_id gnl|my_center|LOCUS_33290 16818 14503 gene locus_tag LOCUS_33300 16818 14503 CDS product GH92 family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796237.1 protein_id gnl|my_center|LOCUS_33300 >Feature sequence088 621 163 gene locus_tag LOCUS_33310 621 163 CDS product RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796768.1 protein_id gnl|my_center|LOCUS_33310 960 3215 gene locus_tag LOCUS_33320 960 3215 CDS product inorganic phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766433.1 protein_id gnl|my_center|LOCUS_33320 4084 3302 gene locus_tag LOCUS_33330 4084 3302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33330 4947 4324 gene locus_tag LOCUS_33340 4947 4324 CDS product WbqC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108764.1 protein_id gnl|my_center|LOCUS_33340 5779 4949 gene locus_tag LOCUS_33350 gene lepB 5779 4949 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108765.1 protein_id gnl|my_center|LOCUS_33350 7226 5829 gene locus_tag LOCUS_33360 gene lepB 7226 5829 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108766.1 protein_id gnl|my_center|LOCUS_33360 7929 7243 gene locus_tag LOCUS_33370 gene dapB 7929 7243 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783772.1 protein_id gnl|my_center|LOCUS_33370 8036 9316 gene locus_tag LOCUS_33380 8036 9316 CDS product DUF2851 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769170.1 protein_id gnl|my_center|LOCUS_33380 9699 9559 gene locus_tag LOCUS_33390 9699 9559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33390 10482 9766 gene locus_tag LOCUS_33400 10482 9766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33400 10989 10792 gene locus_tag LOCUS_33410 10989 10792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33410 11400 13313 gene locus_tag LOCUS_33420 11400 13313 CDS product Ig-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796864.1 protein_id gnl|my_center|LOCUS_33420 13399 14121 gene locus_tag LOCUS_33430 13399 14121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33430 14766 14359 gene locus_tag LOCUS_33440 14766 14359 CDS product hotdog fold thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005779558.1 protein_id gnl|my_center|LOCUS_33440 16267 14792 gene locus_tag LOCUS_33450 gene cysS 16267 14792 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009291350.1 protein_id gnl|my_center|LOCUS_33450 >Feature sequence089 524 1126 gene locus_tag LOCUS_33460 524 1126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33460 1176 1406 gene locus_tag LOCUS_33470 1176 1406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33470 2727 1477 gene locus_tag LOCUS_33480 2727 1477 CDS product AmpG family muropeptide MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762567.1 protein_id gnl|my_center|LOCUS_33480 3533 2748 gene locus_tag LOCUS_33490 3533 2748 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766194.1 protein_id gnl|my_center|LOCUS_33490 4237 3689 gene locus_tag LOCUS_33500 4237 3689 CDS product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766193.1 protein_id gnl|my_center|LOCUS_33500 4530 4240 gene locus_tag LOCUS_33510 4530 4240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766192.1 protein_id gnl|my_center|LOCUS_33510 4659 6317 gene locus_tag LOCUS_33520 4659 6317 CDS product glycogen/starch synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107693.1 protein_id gnl|my_center|LOCUS_33520 6390 8960 gene locus_tag LOCUS_33530 6390 8960 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107692.1 protein_id gnl|my_center|LOCUS_33530 10556 9174 gene locus_tag LOCUS_33540 10556 9174 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107869.1 protein_id gnl|my_center|LOCUS_33540 10949 12073 gene locus_tag LOCUS_33550 10949 12073 CDS product esterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001346611.1 protein_id gnl|my_center|LOCUS_33550 12087 12965 gene locus_tag LOCUS_33560 12087 12965 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764904.1 protein_id gnl|my_center|LOCUS_33560 13049 13513 gene locus_tag LOCUS_33570 13049 13513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33570 13557 14546 gene locus_tag LOCUS_33580 13557 14546 CDS product fimbrillin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760153.1 protein_id gnl|my_center|LOCUS_33580 14634 15461 gene locus_tag LOCUS_33590 14634 15461 CDS product formamidopyrimidine-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108251.1 protein_id gnl|my_center|LOCUS_33590 16183 16109 gene locus_tag LOCUS_t00430 16183 16109 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence090 110 472 gene locus_tag LOCUS_33600 110 472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33600 450 1154 gene locus_tag LOCUS_33610 450 1154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33610 1216 2160 gene locus_tag LOCUS_33620 1216 2160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33620 2282 2701 gene locus_tag LOCUS_33630 2282 2701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33630 2813 3577 gene locus_tag LOCUS_33640 2813 3577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33640 3710 4813 gene locus_tag LOCUS_33650 3710 4813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33650 4830 5969 gene locus_tag LOCUS_33660 4830 5969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33660 5991 6887 gene locus_tag LOCUS_33670 5991 6887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33670 6936 7793 gene locus_tag LOCUS_33680 6936 7793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33680 7815 8780 gene locus_tag LOCUS_33690 7815 8780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33690 8798 9814 gene locus_tag LOCUS_33700 8798 9814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33700 9888 11027 gene locus_tag LOCUS_33710 9888 11027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33710 12185 11097 gene locus_tag LOCUS_33720 12185 11097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33720 15441 12292 gene locus_tag LOCUS_33730 15441 12292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33730 >Feature sequence091 131 1228 gene locus_tag LOCUS_33740 131 1228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33740 1242 1631 gene locus_tag LOCUS_33750 1242 1631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33750 1975 1628 gene locus_tag LOCUS_33760 1975 1628 CDS product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767830.1 protein_id gnl|my_center|LOCUS_33760 2699 2211 gene locus_tag LOCUS_33770 2699 2211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33770 2832 3263 gene locus_tag LOCUS_33780 2832 3263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33780 3398 3634 gene locus_tag LOCUS_33790 3398 3634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33790 3631 5565 gene locus_tag LOCUS_33800 3631 5565 CDS product nucleoside-diphosphate sugar epimerase/dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107228.1 protein_id gnl|my_center|LOCUS_33800 5666 7231 gene locus_tag LOCUS_33810 5666 7231 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107911.1 protein_id gnl|my_center|LOCUS_33810 7356 7649 gene locus_tag LOCUS_33820 7356 7649 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767829.1 protein_id gnl|my_center|LOCUS_33820 7630 8019 gene locus_tag LOCUS_33830 7630 8019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33830 8514 10115 gene locus_tag LOCUS_33840 8514 10115 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986975.1 protein_id gnl|my_center|LOCUS_33840 10135 11169 gene locus_tag LOCUS_33850 10135 11169 CDS product N-acetylneuraminate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986974.1 protein_id gnl|my_center|LOCUS_33850 14003 14494 gene locus_tag LOCUS_33860 14003 14494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33860 14430 15608 gene locus_tag LOCUS_33870 14430 15608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33870 >Feature sequence092 929 60 gene locus_tag LOCUS_33880 929 60 CDS product nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764707.1 protein_id gnl|my_center|LOCUS_33880 2012 1020 gene locus_tag LOCUS_33890 gene floA 2012 1020 CDS product flotillin-like protein FloA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760314.1 protein_id gnl|my_center|LOCUS_33890 2511 2023 gene locus_tag LOCUS_33900 2511 2023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33900 3908 2520 gene locus_tag LOCUS_33910 3908 2520 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202308.1 protein_id gnl|my_center|LOCUS_33910 4080 4826 gene locus_tag LOCUS_33920 4080 4826 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005801071.1 protein_id gnl|my_center|LOCUS_33920 4828 5199 gene locus_tag LOCUS_33930 4828 5199 CDS product DMT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760318.1 protein_id gnl|my_center|LOCUS_33930 6226 5327 gene locus_tag LOCUS_33940 gene miaA 6226 5327 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202192.1 protein_id gnl|my_center|LOCUS_33940 6786 6226 gene locus_tag LOCUS_33950 6786 6226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764414.1 protein_id gnl|my_center|LOCUS_33950 7025 7150 gene locus_tag LOCUS_33960 7025 7150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33960 8035 7250 gene locus_tag LOCUS_33970 gene lpxA 8035 7250 CDS product acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764415.1 protein_id gnl|my_center|LOCUS_33970 9438 8053 gene locus_tag LOCUS_33980 9438 8053 CDS product bifunctional UDP-3-O-[3-hydroxymyristoyl] N-acetylglucosamine deacetylase/3-hydroxyacyl-ACP dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759880.1 protein_id gnl|my_center|LOCUS_33980 10488 9445 gene locus_tag LOCUS_33990 gene lpxD 10488 9445 CDS product UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764416.1 protein_id gnl|my_center|LOCUS_33990 11420 10578 gene locus_tag LOCUS_34000 gene pyrF 11420 10578 CDS product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759883.1 protein_id gnl|my_center|LOCUS_34000 12562 11453 gene locus_tag LOCUS_34010 gene prfA 12562 11453 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759884.1 protein_id gnl|my_center|LOCUS_34010 13738 12572 gene locus_tag LOCUS_34020 13738 12572 CDS product AIR synthase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764417.1 protein_id gnl|my_center|LOCUS_34020 14693 13785 gene locus_tag LOCUS_34030 14693 13785 CDS product glucosaminidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786259.1 protein_id gnl|my_center|LOCUS_34030 15489 14767 gene locus_tag LOCUS_34040 15489 14767 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762145.1 protein_id gnl|my_center|LOCUS_34040 >Feature sequence093 510 3599 gene locus_tag LOCUS_34050 510 3599 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008658407.1 protein_id gnl|my_center|LOCUS_34050 3630 5237 gene locus_tag LOCUS_34060 3630 5237 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005801521.1 protein_id gnl|my_center|LOCUS_34060 5364 6329 gene locus_tag LOCUS_34070 5364 6329 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682158.1 protein_id gnl|my_center|LOCUS_34070 6368 8317 gene locus_tag LOCUS_34080 6368 8317 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108986.1 protein_id gnl|my_center|LOCUS_34080 8902 10068 gene locus_tag LOCUS_34090 gene nagA 8902 10068 CDS product N-acetylglucosamine-6-phosphate deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765558.1 protein_id gnl|my_center|LOCUS_34090 10081 11247 gene locus_tag LOCUS_34100 gene nagA 10081 11247 CDS product N-acetylglucosamine-6-phosphate deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788533.1 protein_id gnl|my_center|LOCUS_34100 11431 13416 gene locus_tag LOCUS_34110 11431 13416 CDS product glucosamine-6-phosphate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766195.1 protein_id gnl|my_center|LOCUS_34110 13575 14141 gene locus_tag LOCUS_34120 13575 14141 CDS product RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784829.1 protein_id gnl|my_center|LOCUS_34120 14195 15247 gene locus_tag LOCUS_34130 14195 15247 CDS product FecR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162303128.1 protein_id gnl|my_center|LOCUS_34130 >Feature sequence094 876 85 gene locus_tag LOCUS_34140 876 85 CDS product tyrosine-type DNA invertase cluster 3b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765099.1 protein_id gnl|my_center|LOCUS_34140 1386 1817 gene locus_tag LOCUS_34150 1386 1817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34150 1899 2321 gene locus_tag LOCUS_34160 gene mscL 1899 2321 CDS product large-conductance mechanosensitive channel protein MscL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785250.1 protein_id gnl|my_center|LOCUS_34160 2397 2618 gene locus_tag LOCUS_34170 2397 2618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34170 2773 3597 gene locus_tag LOCUS_34180 2773 3597 CDS product head GIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010956832.1 protein_id gnl|my_center|LOCUS_34180 5332 3617 gene locus_tag LOCUS_34190 5332 3617 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202063.1 protein_id gnl|my_center|LOCUS_34190 6799 5459 gene locus_tag LOCUS_34200 6799 5459 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796447.1 protein_id gnl|my_center|LOCUS_34200 7018 7797 gene locus_tag LOCUS_34210 7018 7797 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767392.1 protein_id gnl|my_center|LOCUS_34210 8704 8159 gene locus_tag LOCUS_34220 8704 8159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34220 10081 8858 gene locus_tag LOCUS_34230 gene fucP 10081 8858 CDS product L-fucose:H+ symporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703668.1 protein_id gnl|my_center|LOCUS_34230 10500 10090 gene locus_tag LOCUS_34240 10500 10090 CDS product L-rhamnose mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764989.1 protein_id gnl|my_center|LOCUS_34240 11110 10484 gene locus_tag LOCUS_34250 11110 10484 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886490.1 protein_id gnl|my_center|LOCUS_34250 11485 11913 gene locus_tag LOCUS_34260 11485 11913 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763145.1 protein_id gnl|my_center|LOCUS_34260 12001 12483 gene locus_tag LOCUS_34270 12001 12483 CDS product ferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762403.1 protein_id gnl|my_center|LOCUS_34270 13299 12565 gene locus_tag LOCUS_34280 13299 12565 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008661702.1 protein_id gnl|my_center|LOCUS_34280 14191 13331 gene locus_tag LOCUS_34290 14191 13331 CDS product glycine betaine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763297.1 protein_id gnl|my_center|LOCUS_34290 15086 14253 gene locus_tag LOCUS_34300 15086 14253 CDS product proline/glycine betaine ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763296.1 protein_id gnl|my_center|LOCUS_34300 >Feature sequence095 128 1861 gene locus_tag LOCUS_34310 gene lysS 128 1861 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759776.1 protein_id gnl|my_center|LOCUS_34310 896 905 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1874 2869 gene locus_tag LOCUS_34320 1874 2869 CDS product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759775.1 protein_id gnl|my_center|LOCUS_34320 2878 4221 gene locus_tag LOCUS_34330 2878 4221 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790898.1 protein_id gnl|my_center|LOCUS_34330 4588 4292 gene locus_tag LOCUS_34340 4588 4292 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003688640.1 protein_id gnl|my_center|LOCUS_34340 5154 5897 gene locus_tag LOCUS_34350 5154 5897 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798173.1 protein_id gnl|my_center|LOCUS_34350 6869 5967 gene locus_tag LOCUS_34360 6869 5967 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764604.1 protein_id gnl|my_center|LOCUS_34360 7025 8413 gene locus_tag LOCUS_34370 7025 8413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34370 9724 8468 gene locus_tag LOCUS_34380 9724 8468 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203542.1 protein_id gnl|my_center|LOCUS_34380 10915 9737 gene locus_tag LOCUS_34390 10915 9737 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791708.1 protein_id gnl|my_center|LOCUS_34390 11925 10912 gene locus_tag LOCUS_34400 11925 10912 CDS product HlyD family secretion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109013.1 protein_id gnl|my_center|LOCUS_34400 13293 11956 gene locus_tag LOCUS_34410 13293 11956 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791704.1 protein_id gnl|my_center|LOCUS_34410 14046 13453 gene locus_tag LOCUS_34420 14046 13453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34420 14954 14049 gene locus_tag LOCUS_34430 14954 14049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764168.1 protein_id gnl|my_center|LOCUS_34430 >Feature sequence096 168 1241 gene locus_tag LOCUS_34440 168 1241 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288289.1 protein_id gnl|my_center|LOCUS_34440 1250 2116 gene locus_tag LOCUS_34450 1250 2116 CDS product DUF3737 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764890.1 protein_id gnl|my_center|LOCUS_34450 2122 3288 gene locus_tag LOCUS_34460 2122 3288 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764891.1 protein_id gnl|my_center|LOCUS_34460 6489 3379 gene locus_tag LOCUS_34470 6489 3379 CDS product glycoside hydrolase family 2 TIM barrel-domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769174.1 protein_id gnl|my_center|LOCUS_34470 7659 6502 gene locus_tag LOCUS_34480 7659 6502 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521514.1 protein_id gnl|my_center|LOCUS_34480 7774 8178 gene locus_tag LOCUS_34490 7774 8178 CDS product HsmA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789172.1 protein_id gnl|my_center|LOCUS_34490 8387 10126 gene locus_tag LOCUS_34500 8387 10126 CDS product thiamine pyrophosphate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789735.1 protein_id gnl|my_center|LOCUS_34500 11234 10131 gene locus_tag LOCUS_34510 11234 10131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34510 11342 12823 gene locus_tag LOCUS_34520 gene proS 11342 12823 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107525.1 protein_id gnl|my_center|LOCUS_34520 14588 12921 gene locus_tag LOCUS_34530 14588 12921 CDS product formate--tetrahydrofolate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787533.1 protein_id gnl|my_center|LOCUS_34530 >Feature sequence097 258 668 gene locus_tag LOCUS_34540 258 668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34540 767 4111 gene locus_tag LOCUS_34550 767 4111 CDS product glycoside hydrolase family 2 TIM barrel-domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764442.1 protein_id gnl|my_center|LOCUS_34550 5196 4213 gene locus_tag LOCUS_34560 5196 4213 CDS product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762996.1 protein_id gnl|my_center|LOCUS_34560 5993 5217 gene locus_tag LOCUS_34570 5993 5217 CDS product EFR1 family ferrodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107264.1 protein_id gnl|my_center|LOCUS_34570 7339 6065 gene locus_tag LOCUS_34580 7339 6065 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109388.1 protein_id gnl|my_center|LOCUS_34580 10439 7368 gene locus_tag LOCUS_34590 10439 7368 CDS product CusA/CzcA family heavy metal efflux RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109387.1 protein_id gnl|my_center|LOCUS_34590 11597 10488 gene locus_tag LOCUS_34600 11597 10488 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_022471043.1 protein_id gnl|my_center|LOCUS_34600 12004 11654 gene locus_tag LOCUS_34610 12004 11654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34610 12174 13721 gene locus_tag LOCUS_34620 12174 13721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34620 13936 13862 gene locus_tag LOCUS_t00440 13936 13862 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence098 94 507 gene locus_tag LOCUS_34630 94 507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34630 1187 894 gene locus_tag LOCUS_34640 1187 894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34640 3763 1679 gene locus_tag LOCUS_34650 3763 1679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34650 5584 5282 gene locus_tag LOCUS_34660 5584 5282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34660 8626 5738 gene locus_tag LOCUS_34670 8626 5738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34670 10500 8641 gene locus_tag LOCUS_34680 10500 8641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34680 11298 10564 gene locus_tag LOCUS_34690 11298 10564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34690 12372 12031 gene locus_tag LOCUS_34700 12372 12031 CDS product DUF86 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020160.1 protein_id gnl|my_center|LOCUS_34700 12652 12356 gene locus_tag LOCUS_34710 12652 12356 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546611.1 protein_id gnl|my_center|LOCUS_34710 >Feature sequence099 587 1486 gene locus_tag LOCUS_34720 587 1486 CDS product Rpn family recombination-promoting nuclease/putative transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108099.1 protein_id gnl|my_center|LOCUS_34720 3287 1581 gene locus_tag LOCUS_34730 3287 1581 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201861.1 protein_id gnl|my_center|LOCUS_34730 3741 6926 gene locus_tag LOCUS_34740 3741 6926 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005821947.1 protein_id gnl|my_center|LOCUS_34740 7028 7225 gene locus_tag LOCUS_34750 7028 7225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34750 7791 7165 gene locus_tag LOCUS_34760 7791 7165 CDS product lysine exporter LysO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005803436.1 protein_id gnl|my_center|LOCUS_34760 8066 7788 gene locus_tag LOCUS_34770 8066 7788 CDS product LysO family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765593.1 protein_id gnl|my_center|LOCUS_34770 8783 8121 gene locus_tag LOCUS_34780 8783 8121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34780 9059 8802 gene locus_tag LOCUS_34790 9059 8802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34790 9292 11457 gene locus_tag LOCUS_34800 9292 11457 CDS product GH92 family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109053.1 protein_id gnl|my_center|LOCUS_34800 11552 11872 gene locus_tag LOCUS_34810 11552 11872 CDS product heavy metal-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005779329.1 protein_id gnl|my_center|LOCUS_34810 11881 12564 gene locus_tag LOCUS_34820 11881 12564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34820 >Feature sequence100 1450 275 gene locus_tag LOCUS_34830 1450 275 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765564.1 protein_id gnl|my_center|LOCUS_34830 2124 1447 gene locus_tag LOCUS_34840 2124 1447 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761359.1 protein_id gnl|my_center|LOCUS_34840 5415 2290 gene locus_tag LOCUS_34850 5415 2290 CDS product CusA/CzcA family heavy metal efflux RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765563.1 protein_id gnl|my_center|LOCUS_34850 6510 5425 gene locus_tag LOCUS_34860 6510 5425 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765562.1 protein_id gnl|my_center|LOCUS_34860 7786 6527 gene locus_tag LOCUS_34870 7786 6527 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107396.1 protein_id gnl|my_center|LOCUS_34870 8809 7877 gene locus_tag LOCUS_34880 8809 7877 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763529.1 protein_id gnl|my_center|LOCUS_34880 9281 8820 gene locus_tag LOCUS_34890 9281 8820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34890 10678 9299 gene locus_tag LOCUS_34900 10678 9299 CDS product cytochrome c peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767915.1 protein_id gnl|my_center|LOCUS_34900 11007 11594 gene locus_tag LOCUS_34910 11007 11594 CDS product LemA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764419.1 protein_id gnl|my_center|LOCUS_34910 >Feature sequence101 2172 817 gene locus_tag LOCUS_34920 2172 817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34920 3426 2176 gene locus_tag LOCUS_34930 3426 2176 CDS product TIGR04157 family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010993590.1 protein_id gnl|my_center|LOCUS_34930 4142 3456 gene locus_tag LOCUS_34940 4142 3456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34940 5392 4139 gene locus_tag LOCUS_34950 5392 4139 CDS product 6-bladed beta-propeller inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005801462.1 protein_id gnl|my_center|LOCUS_34950 6557 5403 gene locus_tag LOCUS_34960 6557 5403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34960 6922 6563 gene locus_tag LOCUS_34970 6922 6563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_34970 8006 6948 gene locus_tag LOCUS_34980 8006 6948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34980 8232 8092 gene locus_tag LOCUS_34990 8232 8092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34990 8772 8308 gene locus_tag LOCUS_35000 8772 8308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35000 9409 9041 gene locus_tag LOCUS_35010 9409 9041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35010 10325 9522 gene locus_tag LOCUS_35020 10325 9522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35020 11237 10401 gene locus_tag LOCUS_35030 11237 10401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_35030 >Feature sequence102 861 685 gene locus_tag LOCUS_35040 861 685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35040 1092 3920 gene locus_tag LOCUS_35050 1092 3920 CDS product xanthan lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201996.1 protein_id gnl|my_center|LOCUS_35050 3917 5377 gene locus_tag LOCUS_35060 3917 5377 CDS product glycosyltransferase family A protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201994.1 protein_id gnl|my_center|LOCUS_35060 5374 6324 gene locus_tag LOCUS_35070 5374 6324 CDS product DUF4922 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784241.1 protein_id gnl|my_center|LOCUS_35070 6337 8103 gene locus_tag LOCUS_35080 gene sppA 6337 8103 CDS product signal peptide peptidase SppA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203293.1 protein_id gnl|my_center|LOCUS_35080 8114 9223 gene locus_tag LOCUS_35090 gene lpxK 8114 9223 CDS product tetraacyldisaccharide 4'-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765467.1 protein_id gnl|my_center|LOCUS_35090 9231 10259 gene locus_tag LOCUS_35100 gene thiL 9231 10259 CDS product thiamine-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203294.1 protein_id gnl|my_center|LOCUS_35100 10540 10310 gene locus_tag LOCUS_35110 10540 10310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35110 11330 10533 gene locus_tag LOCUS_35120 11330 10533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35120 >Feature sequence103 3295 2534 gene locus_tag LOCUS_35130 3295 2534 CDS product DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009039993.1 protein_id gnl|my_center|LOCUS_35130 5807 4539 gene locus_tag LOCUS_35140 5807 4539 CDS product nucleotide sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963428.1 protein_id gnl|my_center|LOCUS_35140 6798 5824 gene locus_tag LOCUS_35150 6798 5824 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963429.1 protein_id gnl|my_center|LOCUS_35150 7536 6814 gene locus_tag LOCUS_35160 7536 6814 CDS product capsular polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963406.1 protein_id gnl|my_center|LOCUS_35160 9909 7537 gene locus_tag LOCUS_35170 9909 7537 CDS product polysaccharide biosynthesis tyrosine autokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009039946.1 protein_id gnl|my_center|LOCUS_35170 10718 9918 gene locus_tag LOCUS_35180 10718 9918 CDS product polysaccharide biosynthesis/export family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108518.1 protein_id gnl|my_center|LOCUS_35180 11316 10759 gene locus_tag LOCUS_35190 11316 10759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35190 >Feature sequence104 <1 908 gene locus_tag LOCUS_35200 <1 908 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005782155.1:elongation factor Tu 961 1034 gene locus_tag LOCUS_t00450 961 1034 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 1052 1246 gene locus_tag LOCUS_35210 gene secE 1052 1246 CDS product preprotein translocase subunit SecE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005782157.1 protein_id gnl|my_center|LOCUS_35210 1258 1800 gene locus_tag LOCUS_35220 gene nusG 1258 1800 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005782159.1 protein_id gnl|my_center|LOCUS_35220 1868 2311 gene locus_tag LOCUS_35230 gene rplK 1868 2311 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791514.1 protein_id gnl|my_center|LOCUS_35230 2327 3025 gene locus_tag LOCUS_35240 gene rplA 2327 3025 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005782161.1 protein_id gnl|my_center|LOCUS_35240 3040 3570 gene locus_tag LOCUS_35250 gene rplJ 3040 3570 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791518.1 protein_id gnl|my_center|LOCUS_35250 3621 3998 gene locus_tag LOCUS_35260 gene rplL 3621 3998 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005782165.1 protein_id gnl|my_center|LOCUS_35260 4253 7918 gene locus_tag LOCUS_35270 gene rpoB 4253 7918 CDS product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791521.1 protein_id gnl|my_center|LOCUS_35270 >Feature sequence105 <1 774 gene locus_tag LOCUS_35280 <1 774 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005790542.1:ribose 5-phosphate isomerase A 1510 764 gene locus_tag LOCUS_35290 1510 764 CDS product NADPH-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763940.1 protein_id gnl|my_center|LOCUS_35290 2803 1532 gene locus_tag LOCUS_35300 2803 1532 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763756.1 protein_id gnl|my_center|LOCUS_35300 2794 3912 gene locus_tag LOCUS_35310 2794 3912 CDS product DUF362 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082494.1 protein_id gnl|my_center|LOCUS_35310 3921 5303 gene locus_tag LOCUS_35320 gene mnmE 3921 5303 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109330.1 protein_id gnl|my_center|LOCUS_35320 5918 6481 gene locus_tag LOCUS_35330 5918 6481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35330 6566 7672 gene locus_tag LOCUS_35340 6566 7672 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109328.1 protein_id gnl|my_center|LOCUS_35340 7760 8125 gene locus_tag LOCUS_35350 7760 8125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004291423.1 protein_id gnl|my_center|LOCUS_35350 8610 9275 gene locus_tag LOCUS_35360 8610 9275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35360 10029 9277 gene locus_tag LOCUS_35370 10029 9277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35370 >Feature sequence106 94 912 gene locus_tag LOCUS_35380 94 912 CDS product alpha/beta hydrolase fold domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007334178.1 protein_id gnl|my_center|LOCUS_35380 961 2385 gene locus_tag LOCUS_35390 961 2385 CDS product glycoside hydrolase family 30 beta sandwich domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108760.1 protein_id gnl|my_center|LOCUS_35390 4173 2548 gene locus_tag LOCUS_35400 4173 2548 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203354.1 protein_id gnl|my_center|LOCUS_35400 5644 4178 gene locus_tag LOCUS_35410 5644 4178 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008657265.1 protein_id gnl|my_center|LOCUS_35410 9410 5664 gene locus_tag LOCUS_35420 9410 5664 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203355.1 protein_id gnl|my_center|LOCUS_35420 9887 9582 gene locus_tag LOCUS_35430 9887 9582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790349.1 protein_id gnl|my_center|LOCUS_35430 >Feature sequence107 3301 80 gene locus_tag LOCUS_35440 3301 80 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793715.1 protein_id gnl|my_center|LOCUS_35440 3719 4057 gene locus_tag LOCUS_35450 3719 4057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35450 4047 4670 gene locus_tag LOCUS_35460 4047 4670 CDS product lysine exporter LysO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005803436.1 protein_id gnl|my_center|LOCUS_35460 5549 4992 gene locus_tag LOCUS_35470 5549 4992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_35470 5765 5577 gene locus_tag LOCUS_35480 5765 5577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_35480 9053 6063 gene locus_tag LOCUS_35490 9053 6063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35490 >Feature sequence108 101 1306 gene locus_tag LOCUS_35500 101 1306 CDS product BamA/TamA family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202696.1 protein_id gnl|my_center|LOCUS_35500 1502 2350 gene locus_tag LOCUS_35510 gene thiD 1502 2350 CDS product bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202801.1 protein_id gnl|my_center|LOCUS_35510 2343 2939 gene locus_tag LOCUS_35520 2343 2939 CDS product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788060.1 protein_id gnl|my_center|LOCUS_35520 3026 3658 gene locus_tag LOCUS_35530 3026 3658 CDS product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008768961.1 protein_id gnl|my_center|LOCUS_35530 3670 5367 gene locus_tag LOCUS_35540 gene thiC 3670 5367 CDS product phosphomethylpyrimidine synthase ThiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815685.1 protein_id gnl|my_center|LOCUS_35540 6244 5408 gene locus_tag LOCUS_35550 6244 5408 CDS product patatin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767761.1 protein_id gnl|my_center|LOCUS_35550 7344 6346 gene locus_tag LOCUS_35560 7344 6346 CDS product 2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107870.1 protein_id gnl|my_center|LOCUS_35560 >Feature sequence109 1373 69 gene locus_tag LOCUS_35570 1373 69 CDS product HlyD family efflux transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203561.1 protein_id gnl|my_center|LOCUS_35570 3583 1391 gene locus_tag LOCUS_35580 3583 1391 CDS product peptidase domain-containing ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791796.1 protein_id gnl|my_center|LOCUS_35580 4754 3585 gene locus_tag LOCUS_35590 4754 3585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35590 6281 4779 gene locus_tag LOCUS_35600 6281 4779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35600 6586 6380 gene locus_tag LOCUS_35610 6586 6380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35610 8690 6714 gene locus_tag LOCUS_35620 8690 6714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35620 >Feature sequence110 877 188 gene locus_tag LOCUS_35630 877 188 CDS product galactosyltransferase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797451.1 protein_id gnl|my_center|LOCUS_35630 1544 930 gene locus_tag LOCUS_35640 1544 930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35640 1631 1798 gene locus_tag LOCUS_35650 1631 1798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35650 1989 1795 gene locus_tag LOCUS_35660 1989 1795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35660 2445 2083 gene locus_tag LOCUS_35670 2445 2083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35670 2923 2567 gene locus_tag LOCUS_35680 2923 2567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35680 4058 2943 gene locus_tag LOCUS_35690 4058 2943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35690 5866 4844 gene locus_tag LOCUS_35700 5866 4844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35700 7089 6298 gene locus_tag LOCUS_35710 7089 6298 CDS product galactosyltransferase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797451.1 protein_id gnl|my_center|LOCUS_35710 8123 7080 gene locus_tag LOCUS_35720 8123 7080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35720 8308 8129 gene locus_tag LOCUS_35730 8308 8129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35730 >Feature sequence111 238 1395 gene locus_tag LOCUS_35740 238 1395 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964438.1 protein_id gnl|my_center|LOCUS_35740 1484 2074 gene locus_tag LOCUS_35750 1484 2074 CDS product DUF177 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814383.1 protein_id gnl|my_center|LOCUS_35750 2087 2272 gene locus_tag LOCUS_35760 gene rpmF 2087 2272 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002562387.1 protein_id gnl|my_center|LOCUS_35760 2376 3380 gene locus_tag LOCUS_35770 2376 3380 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791878.1 protein_id gnl|my_center|LOCUS_35770 3361 4254 gene locus_tag LOCUS_35780 gene era 3361 4254 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760765.1 protein_id gnl|my_center|LOCUS_35780 4279 5592 gene locus_tag LOCUS_35790 gene der 4279 5592 CDS product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005782289.1 protein_id gnl|my_center|LOCUS_35790 5920 5645 gene locus_tag LOCUS_35800 5920 5645 CDS product type II toxin-antitoxin system YafQ family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002676650.1 protein_id gnl|my_center|LOCUS_35800 6126 5917 gene locus_tag LOCUS_35810 6126 5917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35810 7091 6240 gene locus_tag LOCUS_35820 7091 6240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35820 7749 8168 gene locus_tag LOCUS_35830 7749 8168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35830 >Feature sequence112 1512 112 gene locus_tag LOCUS_35840 1512 112 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073016.1 protein_id gnl|my_center|LOCUS_35840 3139 1613 gene locus_tag LOCUS_35850 3139 1613 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032555683.1 protein_id gnl|my_center|LOCUS_35850 4837 3146 gene locus_tag LOCUS_35860 4837 3146 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202211.1 protein_id gnl|my_center|LOCUS_35860 <8223 4852 gene locus_tag LOCUS_35870 <8223 4852 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011202212.1:TonB-dependent receptor >Feature sequence113 231 3503 gene locus_tag LOCUS_35880 231 3503 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404654.1 protein_id gnl|my_center|LOCUS_35880 3585 4790 gene locus_tag LOCUS_35890 3585 4790 CDS product ectonucleotide pyrophosphatase/phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787649.1 protein_id gnl|my_center|LOCUS_35890 5770 4922 gene locus_tag LOCUS_35900 5770 4922 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974123.1 protein_id gnl|my_center|LOCUS_35900 6091 5876 gene locus_tag LOCUS_35910 6091 5876 CDS product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789734.1 protein_id gnl|my_center|LOCUS_35910 7711 6218 gene locus_tag LOCUS_35920 7711 6218 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682348.1 protein_id gnl|my_center|LOCUS_35920 >Feature sequence114 27 3152 gene locus_tag LOCUS_35930 27 3152 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203657.1 protein_id gnl|my_center|LOCUS_35930 3157 4752 gene locus_tag LOCUS_35940 3157 4752 CDS product SusD/RagB family nutrient-binding outer membrane lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797527.1 protein_id gnl|my_center|LOCUS_35940 4842 5243 gene locus_tag LOCUS_35950 gene nikR 4842 5243 CDS product nickel-responsive transcriptional regulator NikR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250390.1 protein_id gnl|my_center|LOCUS_35950 5336 7207 gene locus_tag LOCUS_35960 5336 7207 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032555875.1 protein_id gnl|my_center|LOCUS_35960 >Feature sequence115 556 3729 gene locus_tag LOCUS_35970 556 3729 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813423.1 protein_id gnl|my_center|LOCUS_35970 3745 5274 gene locus_tag LOCUS_35980 3745 5274 CDS product SusD/RagB family nutrient-binding outer membrane lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784672.1 protein_id gnl|my_center|LOCUS_35980 6519 5365 gene locus_tag LOCUS_35990 6519 5365 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108198.1 protein_id gnl|my_center|LOCUS_35990 >Feature sequence116 <1 3081 gene locus_tag LOCUS_36000 <1 3081 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_185958394.1:TonB-dependent receptor 3109 4683 gene locus_tag LOCUS_36010 3109 4683 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796344.1 protein_id gnl|my_center|LOCUS_36010 5943 4750 gene locus_tag LOCUS_36020 5943 4750 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763756.1 protein_id gnl|my_center|LOCUS_36020 >Feature sequence117 959 27 gene locus_tag LOCUS_36030 959 27 CDS product tyrosine-type DNA invertase cluster 3b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766168.1 protein_id gnl|my_center|LOCUS_36030 3236 1077 gene locus_tag LOCUS_36040 3236 1077 CDS product M3 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203174.1 protein_id gnl|my_center|LOCUS_36040 5398 3278 gene locus_tag LOCUS_36050 5398 3278 CDS product M3 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203174.1 protein_id gnl|my_center|LOCUS_36050 5742 5563 gene locus_tag LOCUS_36060 5742 5563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36060 >Feature sequence118 270 7 gene locus_tag LOCUS_36070 270 7 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36070 2104 443 gene locus_tag LOCUS_36080 2104 443 CDS product SusD/RagB family nutrient-binding outer membrane lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784821.1 protein_id gnl|my_center|LOCUS_36080 5205 2134 gene locus_tag LOCUS_36090 5205 2134 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766148.1 protein_id gnl|my_center|LOCUS_36090 5898 5482 gene locus_tag LOCUS_36100 5898 5482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36100 >Feature sequence119 325 2184 gene locus_tag LOCUS_36110 gene mutA 325 2184 CDS product methylmalonyl-CoA mutase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108132.1 protein_id gnl|my_center|LOCUS_36110 2197 4344 gene locus_tag LOCUS_36120 gene scpA 2197 4344 CDS product methylmalonyl-CoA mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790883.1 protein_id gnl|my_center|LOCUS_36120 4474 5328 gene locus_tag LOCUS_36130 4474 5328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36130 >Feature sequence120 545 45 gene locus_tag LOCUS_36140 545 45 CDS product RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766886.1 protein_id gnl|my_center|LOCUS_36140 1747 695 gene locus_tag LOCUS_36150 gene trpS 1747 695 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546811.1 protein_id gnl|my_center|LOCUS_36150 2232 3173 gene locus_tag LOCUS_36160 2232 3173 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048693993.1 protein_id gnl|my_center|LOCUS_36160 3303 4565 gene locus_tag LOCUS_36170 3303 4565 CDS product DUF4933 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202703.1 protein_id gnl|my_center|LOCUS_36170 4596 5546 gene locus_tag LOCUS_36180 4596 5546 CDS product DUF4221 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203430.1 protein_id gnl|my_center|LOCUS_36180 >Feature sequence121 670 275 gene locus_tag LOCUS_36190 670 275 CDS product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763564.1 protein_id gnl|my_center|LOCUS_36190 1155 685 gene locus_tag LOCUS_36200 gene greA 1155 685 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791379.1 protein_id gnl|my_center|LOCUS_36200 2510 1353 gene locus_tag LOCUS_36210 2510 1353 CDS product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791376.1 protein_id gnl|my_center|LOCUS_36210 2714 4963 gene locus_tag LOCUS_36220 gene pnp 2714 4963 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791373.1 protein_id gnl|my_center|LOCUS_36220 >Feature sequence122 260 1579 gene locus_tag LOCUS_36230 260 1579 CDS product nucleotide sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107343.1 protein_id gnl|my_center|LOCUS_36230 1951 2826 gene locus_tag LOCUS_36240 1951 2826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36240 3098 4027 gene locus_tag LOCUS_36250 3098 4027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36250 4034 5053 gene locus_tag LOCUS_36260 4034 5053 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014568758.1 protein_id gnl|my_center|LOCUS_36260 >Feature sequence123 135 2561 gene locus_tag LOCUS_36270 135 2561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36270 2580 4310 gene locus_tag LOCUS_36280 2580 4310 CDS product bifunctional metallophosphatase/5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202604.1 protein_id gnl|my_center|LOCUS_36280 4775 4551 gene locus_tag LOCUS_36290 4775 4551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36290 >Feature sequence124 143 1399 gene locus_tag LOCUS_36300 143 1399 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007333793.1 protein_id gnl|my_center|LOCUS_36300 1412 4879 gene locus_tag LOCUS_36310 1412 4879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36310 >Feature sequence125 25 213 gene locus_tag LOCUS_36320 25 213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36320 438 2015 gene locus_tag LOCUS_36330 438 2015 CDS product Rne/Rng family ribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786352.1 protein_id gnl|my_center|LOCUS_36330 2217 4148 gene locus_tag LOCUS_36340 gene dnaK 2217 4148 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764765.1 protein_id gnl|my_center|LOCUS_36340 >Feature sequence126 3078 34 gene locus_tag LOCUS_36350 3078 34 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36350 >Feature sequence127 35 217 gene locus_tag LOCUS_36360 35 217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36360 229 3261 gene locus_tag LOCUS_36370 229 3261 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764017.1 protein_id gnl|my_center|LOCUS_36370 >Feature sequence128 1450 158 gene locus_tag LOCUS_36380 1450 158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36380 1861 2355 gene locus_tag LOCUS_36390 1861 2355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36390 >Feature sequence129 494 2293 gene locus_tag LOCUS_36400 494 2293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203361.1 protein_id gnl|my_center|LOCUS_36400