>Feature sequence001 1096 176 gene locus_tag LOCUS_00010 1096 176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00010 1941 1162 gene locus_tag LOCUS_00020 1941 1162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00020 2414 1929 gene locus_tag LOCUS_00030 2414 1929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00030 3109 2408 gene locus_tag LOCUS_00040 3109 2408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00040 4514 3093 gene locus_tag LOCUS_00050 4514 3093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00050 5019 4504 gene locus_tag LOCUS_00060 5019 4504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00060 6769 4979 gene locus_tag LOCUS_00070 6769 4979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00070 7474 6773 gene locus_tag LOCUS_00080 7474 6773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00080 7748 7488 gene locus_tag LOCUS_00090 7748 7488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00090 8088 8585 gene locus_tag LOCUS_00100 8088 8585 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813613.1 protein_id gnl|my_center|LOCUS_00100 8606 9502 gene locus_tag LOCUS_00110 8606 9502 CDS product anti-sigma-V factor rsiV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436661.1 protein_id gnl|my_center|LOCUS_00110 10018 9686 gene locus_tag LOCUS_00120 10018 9686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00120 10579 10923 gene locus_tag LOCUS_00130 gene tnpA 10579 10923 CDS product IS200/IS605 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008194358.1 protein_id gnl|my_center|LOCUS_00130 10937 12193 gene locus_tag LOCUS_00140 10937 12193 CDS product RNA-guided endonuclease TnpB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897221.1 protein_id gnl|my_center|LOCUS_00140 12523 13893 gene locus_tag LOCUS_00150 12523 13893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00150 13785 14198 gene locus_tag LOCUS_00160 13785 14198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00160 14823 14236 gene locus_tag LOCUS_00170 14823 14236 CDS product SOS response-associated peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071130048.1 protein_id gnl|my_center|LOCUS_00170 15154 14834 gene locus_tag LOCUS_00180 15154 14834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00180 16429 15167 gene locus_tag LOCUS_00190 16429 15167 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461660.1 protein_id gnl|my_center|LOCUS_00190 17279 16605 gene locus_tag LOCUS_00200 17279 16605 CDS product phosphoadenosine phosphosulfate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004056545.1 protein_id gnl|my_center|LOCUS_00200 17849 17469 gene locus_tag LOCUS_00210 17849 17469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00210 18066 17815 gene locus_tag LOCUS_00220 18066 17815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00220 18481 18044 gene locus_tag LOCUS_00230 gene ssb 18481 18044 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000934759.1 protein_id gnl|my_center|LOCUS_00230 19235 18507 gene locus_tag LOCUS_00240 19235 18507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00240 20123 19566 gene locus_tag LOCUS_00250 20123 19566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00250 22122 21091 gene locus_tag LOCUS_00260 22122 21091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00260 24571 23165 gene locus_tag LOCUS_00270 24571 23165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00270 25122 24877 gene locus_tag LOCUS_00280 25122 24877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00280 26205 25231 gene locus_tag LOCUS_00290 26205 25231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00290 27817 26831 gene locus_tag LOCUS_00300 27817 26831 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941783.1 protein_id gnl|my_center|LOCUS_00300 29511 27814 gene locus_tag LOCUS_00310 29511 27814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00310 30040 29804 gene locus_tag LOCUS_00320 30040 29804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00320 30594 30025 gene locus_tag LOCUS_00330 30594 30025 CDS product DUF3990 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390171.1 protein_id gnl|my_center|LOCUS_00330 30811 30587 gene locus_tag LOCUS_00340 30811 30587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00340 31354 31043 gene locus_tag LOCUS_00350 31354 31043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00350 34126 31511 gene locus_tag LOCUS_00360 34126 31511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00360 34965 34537 gene locus_tag LOCUS_00370 34965 34537 CDS product DUF1810 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391820.1 protein_id gnl|my_center|LOCUS_00370 35828 34986 gene locus_tag LOCUS_00380 35828 34986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00380 <37119 36453 gene locus_tag LOCUS_00390 <37119 36453 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002287525.1:IS200/IS605 family element RNA-guided endonuclease TnpB >Feature sequence002 54 875 gene locus_tag LOCUS_00400 54 875 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_061603534.1 protein_id gnl|my_center|LOCUS_00400 949 2109 gene locus_tag LOCUS_00410 949 2109 CDS product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004113569.1 protein_id gnl|my_center|LOCUS_00410 2164 3012 gene locus_tag LOCUS_00420 2164 3012 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015839.1 protein_id gnl|my_center|LOCUS_00420 3148 4536 gene locus_tag LOCUS_00430 3148 4536 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680439.1 protein_id gnl|my_center|LOCUS_00430 4549 4776 gene locus_tag LOCUS_00440 4549 4776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00440 4852 5067 gene locus_tag LOCUS_00450 4852 5067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00450 5088 5468 gene locus_tag LOCUS_00460 5088 5468 CDS product zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048257.1 protein_id gnl|my_center|LOCUS_00460 5522 6208 gene locus_tag LOCUS_00470 5522 6208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00470 6495 6229 gene locus_tag LOCUS_00480 6495 6229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00480 6724 6458 gene locus_tag LOCUS_00490 6724 6458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00490 6979 7953 gene locus_tag LOCUS_00500 gene bsh 6979 7953 CDS product choloylglycine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723950.1 protein_id gnl|my_center|LOCUS_00500 8196 9113 gene locus_tag LOCUS_00510 8196 9113 CDS product calcium/sodium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783471.1 protein_id gnl|my_center|LOCUS_00510 9196 10794 gene locus_tag LOCUS_00520 9196 10794 CDS product potassium/proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015673.1 protein_id gnl|my_center|LOCUS_00520 10912 11193 gene locus_tag LOCUS_00530 10912 11193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00530 11209 11721 gene locus_tag LOCUS_00540 11209 11721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00540 11741 13525 gene locus_tag LOCUS_00550 11741 13525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00550 13598 15430 gene locus_tag LOCUS_00560 gene flgK 13598 15430 CDS product flagellar hook-associated protein FlgK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957216.1 protein_id gnl|my_center|LOCUS_00560 15463 17019 gene locus_tag LOCUS_00570 15463 17019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00570 17135 17234 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 17255 17716 gene locus_tag LOCUS_00580 gene fliW 17255 17716 CDS product flagellar assembly protein FliW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082606.1 protein_id gnl|my_center|LOCUS_00580 17719 17937 gene locus_tag LOCUS_00590 gene csrA 17719 17937 CDS product carbon storage regulator CsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327053.1 protein_id gnl|my_center|LOCUS_00590 18048 18257 gene locus_tag LOCUS_00600 18048 18257 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681617.1 protein_id gnl|my_center|LOCUS_00600 18261 18596 gene locus_tag LOCUS_00610 18261 18596 CDS product HipA N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681615.1 protein_id gnl|my_center|LOCUS_00610 18593 19405 gene locus_tag LOCUS_00620 18593 19405 CDS product HipA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681613.1 note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_00620 19346 19355 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 19444 19569 gene locus_tag LOCUS_00630 19444 19569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00630 19741 20841 gene locus_tag LOCUS_00640 19741 20841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00640 21037 22410 gene locus_tag LOCUS_00650 21037 22410 CDS product sodium-dependent transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103018905.1 protein_id gnl|my_center|LOCUS_00650 22754 22434 gene locus_tag LOCUS_00660 22754 22434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00660 22914 23624 gene locus_tag LOCUS_00670 22914 23624 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813911.1 protein_id gnl|my_center|LOCUS_00670 23621 24958 gene locus_tag LOCUS_00680 23621 24958 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775459.1 protein_id gnl|my_center|LOCUS_00680 25194 28247 gene locus_tag LOCUS_00690 25194 28247 CDS product glycoside hydrolase family 3 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012028020.1 protein_id gnl|my_center|LOCUS_00690 28547 30250 gene locus_tag LOCUS_00700 28547 30250 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005898122.1 protein_id gnl|my_center|LOCUS_00700 30413 30985 gene locus_tag LOCUS_00710 30413 30985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00710 >Feature sequence003 1245 1898 gene locus_tag LOCUS_00720 gene spmA 1245 1898 CDS product spore maturation protein SpmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398980.1 protein_id gnl|my_center|LOCUS_00720 1958 3607 gene locus_tag LOCUS_00730 1958 3607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00730 3705 4229 gene locus_tag LOCUS_00740 3705 4229 CDS product spore maturation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947935.1 protein_id gnl|my_center|LOCUS_00740 4359 4433 gene locus_tag LOCUS_t00010 4359 4433 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 4599 5321 gene locus_tag LOCUS_00750 4599 5321 CDS product NAD-dependent protein deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963607.1 protein_id gnl|my_center|LOCUS_00750 5445 5636 gene locus_tag LOCUS_00760 5445 5636 CDS product DUF951 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025773685.1 protein_id gnl|my_center|LOCUS_00760 5555 5746 gene locus_tag LOCUS_00770 5555 5746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00770 5739 6029 gene locus_tag LOCUS_00780 gene rpsF 5739 6029 CDS product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048444.1 protein_id gnl|my_center|LOCUS_00780 6082 6519 gene locus_tag LOCUS_00790 gene ssb 6082 6519 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359348.1 protein_id gnl|my_center|LOCUS_00790 6541 6804 gene locus_tag LOCUS_00800 gene rpsR 6541 6804 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462317.1 protein_id gnl|my_center|LOCUS_00800 6964 8337 gene locus_tag LOCUS_00810 6964 8337 CDS product EmmdR/YeeO family multidrug/toxin efflux MATE transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989199.1 protein_id gnl|my_center|LOCUS_00810 8458 9165 gene locus_tag LOCUS_00820 8458 9165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00820 9257 11311 gene locus_tag LOCUS_00830 9257 11311 CDS product DHH family phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003397329.1 protein_id gnl|my_center|LOCUS_00830 11308 11754 gene locus_tag LOCUS_00840 gene rplI 11308 11754 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815187.1 protein_id gnl|my_center|LOCUS_00840 11765 13102 gene locus_tag LOCUS_00850 11765 13102 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966975.1 protein_id gnl|my_center|LOCUS_00850 13267 13887 gene locus_tag LOCUS_00860 13267 13887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00860 15367 14330 gene locus_tag LOCUS_00870 15367 14330 CDS product galactose mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120973.1 protein_id gnl|my_center|LOCUS_00870 15578 16630 gene locus_tag LOCUS_00880 15578 16630 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000557353.1 protein_id gnl|my_center|LOCUS_00880 16671 17129 gene locus_tag LOCUS_00890 16671 17129 CDS product low molecular weight protein arginine phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000697334.1 protein_id gnl|my_center|LOCUS_00890 17135 17764 gene locus_tag LOCUS_00900 gene upp 17135 17764 CDS product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815407.1 protein_id gnl|my_center|LOCUS_00900 17801 18286 gene locus_tag LOCUS_00910 17801 18286 CDS product cytidine/deoxycytidylate deaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032889952.1 protein_id gnl|my_center|LOCUS_00910 18328 18561 gene locus_tag LOCUS_00920 18328 18561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00920 18563 18988 gene locus_tag LOCUS_00930 18563 18988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00930 19014 19751 gene locus_tag LOCUS_00940 19014 19751 CDS product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003356899.1 protein_id gnl|my_center|LOCUS_00940 19768 20022 gene locus_tag LOCUS_00950 gene atpE 19768 20022 CDS product ATP synthase F0 subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902609.1 protein_id gnl|my_center|LOCUS_00950 20067 20591 gene locus_tag LOCUS_00960 20067 20591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00960 20579 21145 gene locus_tag LOCUS_00970 gene atpH 20579 21145 CDS product ATP synthase F1 subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142900.1 protein_id gnl|my_center|LOCUS_00970 21142 22650 gene locus_tag LOCUS_00980 gene atpA 21142 22650 CDS product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462231.1 protein_id gnl|my_center|LOCUS_00980 22670 23530 gene locus_tag LOCUS_00990 gene atpG 22670 23530 CDS product ATP synthase F1 subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437835.1 protein_id gnl|my_center|LOCUS_00990 23650 25041 gene locus_tag LOCUS_01000 gene atpD 23650 25041 CDS product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161587876.1 protein_id gnl|my_center|LOCUS_01000 25056 25466 gene locus_tag LOCUS_01010 gene atpC 25056 25466 CDS product F0F1 ATP synthase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000847211.1 protein_id gnl|my_center|LOCUS_01010 25579 26151 gene locus_tag LOCUS_01020 25579 26151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01020 26428 27780 gene locus_tag LOCUS_01030 26428 27780 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_094729231.1 protein_id gnl|my_center|LOCUS_01030 28669 27815 gene locus_tag LOCUS_01040 28669 27815 CDS product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963818.1 protein_id gnl|my_center|LOCUS_01040 28885 28984 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 29455 29820 gene locus_tag LOCUS_01050 29455 29820 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461083.1 protein_id gnl|my_center|LOCUS_01050 29822 30112 gene locus_tag LOCUS_01060 29822 30112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01060 >Feature sequence004 565 1632 gene locus_tag LOCUS_01070 gene rsmH 565 1632 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392354.1 protein_id gnl|my_center|LOCUS_01070 1726 2109 gene locus_tag LOCUS_01080 1726 2109 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016864.1 protein_id gnl|my_center|LOCUS_01080 2579 2163 gene locus_tag LOCUS_01090 2579 2163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01090 2584 2683 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3009 5114 gene locus_tag LOCUS_01100 3009 5114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01100 5195 5278 gene locus_tag LOCUS_t00020 5195 5278 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 5288 5373 gene locus_tag LOCUS_t00030 5288 5373 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 6501 5491 gene locus_tag LOCUS_01110 6501 5491 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393520.1 protein_id gnl|my_center|LOCUS_01110 6805 8301 gene locus_tag LOCUS_01120 gene malQ 6805 8301 CDS product 4-alpha-glucanotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002917858.1 protein_id gnl|my_center|LOCUS_01120 8369 9658 gene locus_tag LOCUS_01130 8369 9658 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013399406.1 protein_id gnl|my_center|LOCUS_01130 9769 11142 gene locus_tag LOCUS_01140 9769 11142 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004113788.1 protein_id gnl|my_center|LOCUS_01140 11142 12017 gene locus_tag LOCUS_01150 11142 12017 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004113786.1 protein_id gnl|my_center|LOCUS_01150 12256 13992 gene locus_tag LOCUS_01160 12256 13992 CDS product alpha-amylase family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906091.1 protein_id gnl|my_center|LOCUS_01160 14158 15888 gene locus_tag LOCUS_01170 14158 15888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01170 16614 15973 gene locus_tag LOCUS_01180 16614 15973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01180 16843 16773 gene locus_tag LOCUS_t00040 16843 16773 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 16919 16847 gene locus_tag LOCUS_t00050 16919 16847 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 19005 16984 gene locus_tag LOCUS_01190 19005 16984 CDS product amylo-alpha-1,6-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015909312.1 protein_id gnl|my_center|LOCUS_01190 19138 19635 gene locus_tag LOCUS_01200 19138 19635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01200 19691 20413 gene locus_tag LOCUS_01210 19691 20413 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429190.1 protein_id gnl|my_center|LOCUS_01210 20503 21420 gene locus_tag LOCUS_01220 20503 21420 CDS product SufD family Fe-S cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435793.1 protein_id gnl|my_center|LOCUS_01220 21510 22667 gene locus_tag LOCUS_01230 21510 22667 CDS product exonuclease SbcCD subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000765133.1 protein_id gnl|my_center|LOCUS_01230 22664 25456 gene locus_tag LOCUS_01240 22664 25456 CDS product SMC family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480361.1 protein_id gnl|my_center|LOCUS_01240 25604 26389 gene locus_tag LOCUS_01250 gene murI 25604 26389 CDS product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475984.1 protein_id gnl|my_center|LOCUS_01250 >Feature sequence005 1399 8 gene locus_tag LOCUS_01260 gene asnS 1399 8 CDS product asparagine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462263.1 protein_id gnl|my_center|LOCUS_01260 2709 1450 gene locus_tag LOCUS_01270 2709 1450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01270 2908 3429 gene locus_tag LOCUS_01280 2908 3429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01280 5701 3488 gene locus_tag LOCUS_01290 gene bglX 5701 3488 CDS product beta-glucosidase BglX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203679.1 protein_id gnl|my_center|LOCUS_01290 6306 5698 gene locus_tag LOCUS_01300 6306 5698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01300 7302 6388 gene locus_tag LOCUS_01310 7302 6388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01310 9047 7299 gene locus_tag LOCUS_01320 9047 7299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01320 9959 9057 gene locus_tag LOCUS_01330 9959 9057 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289655.1 protein_id gnl|my_center|LOCUS_01330 10891 9974 gene locus_tag LOCUS_01340 10891 9974 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009924790.1 protein_id gnl|my_center|LOCUS_01340 12463 10955 gene locus_tag LOCUS_01350 12463 10955 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003737090.1 protein_id gnl|my_center|LOCUS_01350 12981 12823 gene locus_tag LOCUS_01360 12981 12823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01360 14426 13161 gene locus_tag LOCUS_01370 14426 13161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01370 14977 14534 gene locus_tag LOCUS_01380 14977 14534 CDS product DUF1934 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393888.1 protein_id gnl|my_center|LOCUS_01380 15740 15102 gene locus_tag LOCUS_01390 gene spoIIR 15740 15102 CDS product stage II sporulation protein R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966181.1 protein_id gnl|my_center|LOCUS_01390 18231 16048 gene locus_tag LOCUS_01400 18231 16048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01400 19734 18241 gene locus_tag LOCUS_01410 19734 18241 CDS product spore germination protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071541476.1 protein_id gnl|my_center|LOCUS_01410 20779 20105 gene locus_tag LOCUS_01420 20779 20105 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009892132.1 protein_id gnl|my_center|LOCUS_01420 21673 20798 gene locus_tag LOCUS_01430 gene ispE 21673 20798 CDS product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000772104.1 protein_id gnl|my_center|LOCUS_01430 21937 22560 gene locus_tag LOCUS_01440 21937 22560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01440 22536 22545 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 23938 22655 gene locus_tag LOCUS_01450 23938 22655 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731178.1 protein_id gnl|my_center|LOCUS_01450 25377 24046 gene locus_tag LOCUS_01460 25377 24046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01460 >Feature sequence006 321 710 gene locus_tag LOCUS_01470 321 710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01470 697 1722 gene locus_tag LOCUS_01480 697 1722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01480 1761 2993 gene locus_tag LOCUS_01490 1761 2993 CDS product CpaF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261282.1 protein_id gnl|my_center|LOCUS_01490 2877 2976 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3059 3796 gene locus_tag LOCUS_01500 3059 3796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01500 3860 5107 gene locus_tag LOCUS_01510 3860 5107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01510 5230 5412 gene locus_tag LOCUS_01520 5230 5412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01520 5412 6962 gene locus_tag LOCUS_01530 5412 6962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01530 7135 7848 gene locus_tag LOCUS_01540 7135 7848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01540 7833 8255 gene locus_tag LOCUS_01550 7833 8255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01550 8271 8480 gene locus_tag LOCUS_01560 8271 8480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01560 8470 9597 gene locus_tag LOCUS_01570 8470 9597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01570 9895 9994 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 10019 10507 gene locus_tag LOCUS_01580 10019 10507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01580 10616 11605 gene locus_tag LOCUS_01590 10616 11605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01590 12239 11592 gene locus_tag LOCUS_01600 12239 11592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01600 12373 12795 gene locus_tag LOCUS_01610 12373 12795 CDS product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979519.1 protein_id gnl|my_center|LOCUS_01610 13946 12873 gene locus_tag LOCUS_01620 13946 12873 CDS product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987044.1 protein_id gnl|my_center|LOCUS_01620 14212 14517 gene locus_tag LOCUS_01630 14212 14517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01630 14647 15960 gene locus_tag LOCUS_01640 14647 15960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01640 16181 17107 gene locus_tag LOCUS_01650 16181 17107 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015666.1 protein_id gnl|my_center|LOCUS_01650 17244 18233 gene locus_tag LOCUS_01660 gene argF 17244 18233 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682235.1 protein_id gnl|my_center|LOCUS_01660 18308 19285 gene locus_tag LOCUS_01670 18308 19285 CDS product biotin--[acetyl-CoA-carboxylase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_196768282.1 protein_id gnl|my_center|LOCUS_01670 19317 19676 gene locus_tag LOCUS_01680 19317 19676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01680 19678 20472 gene locus_tag LOCUS_01690 19678 20472 CDS product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861999.1 protein_id gnl|my_center|LOCUS_01690 20550 21533 gene locus_tag LOCUS_01700 gene dusB 20550 21533 CDS product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434962.1 protein_id gnl|my_center|LOCUS_01700 21553 22128 gene locus_tag LOCUS_01710 21553 22128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01710 22233 22712 gene locus_tag LOCUS_01720 gene greA 22233 22712 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048372.1 protein_id gnl|my_center|LOCUS_01720 >Feature sequence007 257 266 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1193 336 gene locus_tag LOCUS_01730 1193 336 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434910.1 protein_id gnl|my_center|LOCUS_01730 2689 1250 gene locus_tag LOCUS_01740 2689 1250 CDS product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358530.1 protein_id gnl|my_center|LOCUS_01740 4060 2696 gene locus_tag LOCUS_01750 gene trkA 4060 2696 CDS product Trk system potassium transporter TrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948929.1 protein_id gnl|my_center|LOCUS_01750 4480 4797 gene locus_tag LOCUS_01760 gene rpsJ 4480 4797 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003156464.1 protein_id gnl|my_center|LOCUS_01760 4970 5653 gene locus_tag LOCUS_01770 gene rplC 4970 5653 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048354.1 protein_id gnl|my_center|LOCUS_01770 5683 6303 gene locus_tag LOCUS_01780 gene rplD 5683 6303 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357518.1 protein_id gnl|my_center|LOCUS_01780 6303 6602 gene locus_tag LOCUS_01790 gene rplW 6303 6602 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435681.1 protein_id gnl|my_center|LOCUS_01790 6664 7509 gene locus_tag LOCUS_01800 gene rplB 6664 7509 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003129965.1 protein_id gnl|my_center|LOCUS_01800 7598 7879 gene locus_tag LOCUS_01810 gene rpsS 7598 7879 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102083.1 protein_id gnl|my_center|LOCUS_01810 7909 8295 gene locus_tag LOCUS_01820 gene rplV 7909 8295 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081826.1 protein_id gnl|my_center|LOCUS_01820 8307 8963 gene locus_tag LOCUS_01830 gene rpsC 8307 8963 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003385450.1 protein_id gnl|my_center|LOCUS_01830 8966 9403 gene locus_tag LOCUS_01840 gene rplP 8966 9403 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810150.1 protein_id gnl|my_center|LOCUS_01840 9393 9602 gene locus_tag LOCUS_01850 gene rpmC 9393 9602 CDS product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288664.1 protein_id gnl|my_center|LOCUS_01850 9626 9883 gene locus_tag LOCUS_01860 gene rpsQ 9626 9883 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393928.1 protein_id gnl|my_center|LOCUS_01860 9902 10270 gene locus_tag LOCUS_01870 gene rplN 9902 10270 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000615912.1 protein_id gnl|my_center|LOCUS_01870 10283 10594 gene locus_tag LOCUS_01880 gene rplX 10283 10594 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919138.1 protein_id gnl|my_center|LOCUS_01880 10617 11156 gene locus_tag LOCUS_01890 gene rplE 10617 11156 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357534.1 protein_id gnl|my_center|LOCUS_01890 11172 11357 gene locus_tag LOCUS_01900 11172 11357 CDS product type Z 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421149.1 protein_id gnl|my_center|LOCUS_01900 11392 11796 gene locus_tag LOCUS_01910 gene rpsH 11392 11796 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003720937.1 protein_id gnl|my_center|LOCUS_01910 11909 12448 gene locus_tag LOCUS_01920 gene rplF 11909 12448 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435668.1 protein_id gnl|my_center|LOCUS_01920 12467 12835 gene locus_tag LOCUS_01930 gene rplR 12467 12835 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081803.1 protein_id gnl|my_center|LOCUS_01930 12853 13362 gene locus_tag LOCUS_01940 gene rpsE 12853 13362 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421138.1 protein_id gnl|my_center|LOCUS_01940 13376 13561 gene locus_tag LOCUS_01950 gene rpmD 13376 13561 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549042.1 protein_id gnl|my_center|LOCUS_01950 13587 14027 gene locus_tag LOCUS_01960 gene rplO 13587 14027 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966393.1 protein_id gnl|my_center|LOCUS_01960 14027 15358 gene locus_tag LOCUS_01970 gene secY 14027 15358 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393917.1 protein_id gnl|my_center|LOCUS_01970 15503 16147 gene locus_tag LOCUS_01980 15503 16147 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966391.1 protein_id gnl|my_center|LOCUS_01980 16150 16932 gene locus_tag LOCUS_01990 gene map 16150 16932 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013913605.1 protein_id gnl|my_center|LOCUS_01990 16953 17210 gene locus_tag LOCUS_02000 16953 17210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02000 17225 17443 gene locus_tag LOCUS_02010 gene infA 17225 17443 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356224.1 protein_id gnl|my_center|LOCUS_02010 18070 18438 gene locus_tag LOCUS_02020 gene rpsM 18070 18438 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869905.1 protein_id gnl|my_center|LOCUS_02020 18508 18900 gene locus_tag LOCUS_02030 gene rpsK 18508 18900 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421122.1 protein_id gnl|my_center|LOCUS_02030 18920 19513 gene locus_tag LOCUS_02040 gene rpsD 18920 19513 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903916.1 protein_id gnl|my_center|LOCUS_02040 19624 20583 gene locus_tag LOCUS_02050 19624 20583 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003225835.1 protein_id gnl|my_center|LOCUS_02050 20823 21359 gene locus_tag LOCUS_02060 gene rplQ 20823 21359 CDS product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723675.1 protein_id gnl|my_center|LOCUS_02060 21475 22200 gene locus_tag LOCUS_02070 21475 22200 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459494.1 protein_id gnl|my_center|LOCUS_02070 22202 23101 gene locus_tag LOCUS_02080 22202 23101 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015943877.1 protein_id gnl|my_center|LOCUS_02080 >Feature sequence008 705 866 gene locus_tag LOCUS_02090 705 866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02090 1006 1509 gene locus_tag LOCUS_02100 gene mraZ 1006 1509 CDS product division/cell wall cluster transcriptional repressor MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392353.1 protein_id gnl|my_center|LOCUS_02100 1565 2503 gene locus_tag LOCUS_02110 gene rsmH 1565 2503 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861627.1 protein_id gnl|my_center|LOCUS_02110 2507 3013 gene locus_tag LOCUS_02120 2507 3013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02120 3052 5148 gene locus_tag LOCUS_02130 3052 5148 CDS product stage V sporulation protein D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009893708.1 protein_id gnl|my_center|LOCUS_02130 5211 6926 gene locus_tag LOCUS_02140 5211 6926 CDS product stage V sporulation protein D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245048.1 protein_id gnl|my_center|LOCUS_02140 6991 7224 gene locus_tag LOCUS_02150 6991 7224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02150 7149 7158 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 7221 7949 gene locus_tag LOCUS_02160 7221 7949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02160 8119 8436 gene locus_tag LOCUS_02170 8119 8436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02170 8460 9344 gene locus_tag LOCUS_02180 8460 9344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02180 9399 10517 gene locus_tag LOCUS_02190 gene spoVE 9399 10517 CDS product stage V sporulation protein E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426995.1 protein_id gnl|my_center|LOCUS_02190 10520 11482 gene locus_tag LOCUS_02200 10520 11482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02200 11678 12865 gene locus_tag LOCUS_02210 gene ftsZ 11678 12865 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965000.1 protein_id gnl|my_center|LOCUS_02210 13089 13874 gene locus_tag LOCUS_02220 gene spoIIGA 13089 13874 CDS product sigma-E processing peptidase SpoIIGA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000261975.1 protein_id gnl|my_center|LOCUS_02220 13843 14583 gene locus_tag LOCUS_02230 gene sigE 13843 14583 CDS product RNA polymerase sporulation sigma factor SigE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025774280.1 protein_id gnl|my_center|LOCUS_02230 14733 16337 gene locus_tag LOCUS_02240 14733 16337 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948757.1 protein_id gnl|my_center|LOCUS_02240 17119 16340 gene locus_tag LOCUS_02250 gene sigG 17119 16340 CDS product RNA polymerase sporulation sigma factor SigG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986856.1 protein_id gnl|my_center|LOCUS_02250 17172 17663 gene locus_tag LOCUS_02260 17172 17663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02260 17751 18590 gene locus_tag LOCUS_02270 gene dapF 17751 18590 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583145.1 protein_id gnl|my_center|LOCUS_02270 >Feature sequence009 109 1059 gene locus_tag LOCUS_02280 109 1059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02280 1465 1127 gene locus_tag LOCUS_02290 1465 1127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02290 1844 1488 gene locus_tag LOCUS_02300 gene spoVAE 1844 1488 CDS product stage V sporulation protein AE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403640.1 protein_id gnl|my_center|LOCUS_02300 2901 1879 gene locus_tag LOCUS_02310 gene spoVAD 2901 1879 CDS product stage V sporulation protein AD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403641.1 protein_id gnl|my_center|LOCUS_02310 3162 2956 gene locus_tag LOCUS_02320 3162 2956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02320 3397 3732 gene locus_tag LOCUS_02330 3397 3732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02330 4021 5826 gene locus_tag LOCUS_02340 4021 5826 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966041.1 protein_id gnl|my_center|LOCUS_02340 5829 6137 gene locus_tag LOCUS_02350 5829 6137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02350 6098 7798 gene locus_tag LOCUS_02360 6098 7798 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583043.1 protein_id gnl|my_center|LOCUS_02360 7919 8077 gene locus_tag LOCUS_02370 7919 8077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02370 10853 8019 gene locus_tag LOCUS_02380 10853 8019 CDS product glycoside hydrolase family 3 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012028020.1 protein_id gnl|my_center|LOCUS_02380 10989 11903 gene locus_tag LOCUS_02390 10989 11903 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964760.1 protein_id gnl|my_center|LOCUS_02390 11973 12287 gene locus_tag LOCUS_02400 11973 12287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02400 13957 12278 gene locus_tag LOCUS_02410 13957 12278 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118827098.1 protein_id gnl|my_center|LOCUS_02410 15834 13954 gene locus_tag LOCUS_02420 gene msbA 15834 13954 CDS product lipid A export permease/ATP-binding protein MsbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942900.1 protein_id gnl|my_center|LOCUS_02420 16509 16057 gene locus_tag LOCUS_02430 16509 16057 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013363085.1 protein_id gnl|my_center|LOCUS_02430 18062 16842 gene locus_tag LOCUS_02440 18062 16842 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002610375.1 protein_id gnl|my_center|LOCUS_02440 18361 18167 gene locus_tag LOCUS_02450 18361 18167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02450 >Feature sequence010 1621 3318 gene locus_tag LOCUS_02460 1621 3318 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005898122.1 protein_id gnl|my_center|LOCUS_02460 3342 4931 gene locus_tag LOCUS_02470 3342 4931 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005898122.1 protein_id gnl|my_center|LOCUS_02470 4958 6373 gene locus_tag LOCUS_02480 4958 6373 CDS product DUF5716 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459253.1 protein_id gnl|my_center|LOCUS_02480 6399 7013 gene locus_tag LOCUS_02490 6399 7013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02490 6982 10230 gene locus_tag LOCUS_02500 6982 10230 CDS product SbcC/MukB-like Walker B domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459255.1 protein_id gnl|my_center|LOCUS_02500 10211 11437 gene locus_tag LOCUS_02510 10211 11437 CDS product DUF2220 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392028.1 protein_id gnl|my_center|LOCUS_02510 11450 12727 gene locus_tag LOCUS_02520 11450 12727 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016645.1 protein_id gnl|my_center|LOCUS_02520 12766 13182 gene locus_tag LOCUS_02530 12766 13182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02530 13170 14036 gene locus_tag LOCUS_02540 gene rsmA 13170 14036 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009892086.1 protein_id gnl|my_center|LOCUS_02540 14822 15502 gene locus_tag LOCUS_02550 14822 15502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02550 15605 16354 gene locus_tag LOCUS_02560 15605 16354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02560 >Feature sequence011 111 1079 gene locus_tag LOCUS_02570 111 1079 CDS product calcium/sodium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767297.1 protein_id gnl|my_center|LOCUS_02570 1214 2245 gene locus_tag LOCUS_02580 1214 2245 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804254.1 protein_id gnl|my_center|LOCUS_02580 2367 2771 gene locus_tag LOCUS_02590 2367 2771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02590 2992 3189 gene locus_tag LOCUS_02600 2992 3189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02600 3395 5392 gene locus_tag LOCUS_02610 gene metG 3395 5392 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966273.1 protein_id gnl|my_center|LOCUS_02610 5580 6260 gene locus_tag LOCUS_02620 5580 6260 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454566.1 protein_id gnl|my_center|LOCUS_02620 5808 5817 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 6277 8370 gene locus_tag LOCUS_02630 6277 8370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02630 8367 9008 gene locus_tag LOCUS_02640 8367 9008 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582846.1 protein_id gnl|my_center|LOCUS_02640 9174 11477 gene locus_tag LOCUS_02650 9174 11477 CDS product hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461677.1 protein_id gnl|my_center|LOCUS_02650 11618 12952 gene locus_tag LOCUS_02660 11618 12952 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_132377852.1 protein_id gnl|my_center|LOCUS_02660 13059 15662 gene locus_tag LOCUS_02670 13059 15662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02670 15721 17619 gene locus_tag LOCUS_02680 gene glgB 15721 17619 CDS product 1,4-alpha-glucan branching protein GlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141306.1 protein_id gnl|my_center|LOCUS_02680 >Feature sequence012 445 2685 gene locus_tag LOCUS_02690 gene gyrA 445 2685 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963336.1 protein_id gnl|my_center|LOCUS_02690 2714 4072 gene locus_tag LOCUS_02700 2714 4072 CDS product folylpolyglutamate synthase/dihydrofolate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009903674.1 protein_id gnl|my_center|LOCUS_02700 4149 4703 gene locus_tag LOCUS_02710 gene folE 4149 4703 CDS product GTP cyclohydrolase I FolE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000380915.1 protein_id gnl|my_center|LOCUS_02710 4729 5541 gene locus_tag LOCUS_02720 gene folP 4729 5541 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966209.1 protein_id gnl|my_center|LOCUS_02720 5574 6278 gene locus_tag LOCUS_02730 5574 6278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02730 6208 6468 gene locus_tag LOCUS_02740 6208 6468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02740 6245 6254 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 6470 7126 gene locus_tag LOCUS_02750 6470 7126 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963740.1 protein_id gnl|my_center|LOCUS_02750 7143 7916 gene locus_tag LOCUS_02760 7143 7916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02760 8013 8732 gene locus_tag LOCUS_02770 8013 8732 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948727.1 protein_id gnl|my_center|LOCUS_02770 8924 9592 gene locus_tag LOCUS_02780 8924 9592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02780 9641 10207 gene locus_tag LOCUS_02790 9641 10207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02790 10755 15353 gene locus_tag LOCUS_02800 gene gltB 10755 15353 CDS product glutamate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005807931.1 protein_id gnl|my_center|LOCUS_02800 15394 16887 gene locus_tag LOCUS_02810 15394 16887 CDS product glutamate synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932093.1 protein_id gnl|my_center|LOCUS_02810 >Feature sequence013 <1 1617 gene locus_tag LOCUS_02820 <1 1617 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003231918.1:proline--tRNA ligase 1618 3018 gene locus_tag LOCUS_02830 1618 3018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02830 3565 3664 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3730 4233 gene locus_tag LOCUS_02840 3730 4233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02840 4284 5984 gene locus_tag LOCUS_02850 4284 5984 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005898122.1 protein_id gnl|my_center|LOCUS_02850 6058 7644 gene locus_tag LOCUS_02860 6058 7644 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108010.1 protein_id gnl|my_center|LOCUS_02860 7648 8625 gene locus_tag LOCUS_02870 7648 8625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02870 8847 10241 gene locus_tag LOCUS_02880 8847 10241 CDS product nucleobase:cation symporter-2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009893433.1 protein_id gnl|my_center|LOCUS_02880 10437 11852 gene locus_tag LOCUS_02890 10437 11852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02890 11891 12487 gene locus_tag LOCUS_02900 11891 12487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02900 12513 15893 gene locus_tag LOCUS_02910 12513 15893 CDS product SbcC/MukB-like Walker B domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392027.1 protein_id gnl|my_center|LOCUS_02910 >Feature sequence014 157 1539 gene locus_tag LOCUS_02920 157 1539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02920 1543 2172 gene locus_tag LOCUS_02930 1543 2172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02930 2223 2322 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3984 2908 gene locus_tag LOCUS_02940 3984 2908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02940 4186 5643 gene locus_tag LOCUS_02950 4186 5643 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965635.1 protein_id gnl|my_center|LOCUS_02950 5675 6262 gene locus_tag LOCUS_02960 5675 6262 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963621.1 protein_id gnl|my_center|LOCUS_02960 6281 6721 gene locus_tag LOCUS_02970 6281 6721 CDS product YaaR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009966249.1 protein_id gnl|my_center|LOCUS_02970 6733 7722 gene locus_tag LOCUS_02980 6733 7722 CDS product DNA polymerase III subunit delta' C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435878.1 protein_id gnl|my_center|LOCUS_02980 7724 8632 gene locus_tag LOCUS_02990 7724 8632 CDS product stage 0 sporulation family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963624.1 protein_id gnl|my_center|LOCUS_02990 8655 9362 gene locus_tag LOCUS_03000 8655 9362 CDS product tRNA1(Val) (adenine(37)-N6)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435875.1 protein_id gnl|my_center|LOCUS_03000 9670 10425 gene locus_tag LOCUS_03010 gene lgt 9670 10425 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880125.1 protein_id gnl|my_center|LOCUS_03010 10549 11913 gene locus_tag LOCUS_03020 10549 11913 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861729.1 protein_id gnl|my_center|LOCUS_03020 12038 12883 gene locus_tag LOCUS_03030 gene rsmI 12038 12883 CDS product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963630.1 protein_id gnl|my_center|LOCUS_03030 12893 14140 gene locus_tag LOCUS_03040 12893 14140 CDS product CapA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000887601.1 protein_id gnl|my_center|LOCUS_03040 14300 14665 gene locus_tag LOCUS_03050 14300 14665 CDS product BlaI/MecI/CopY family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459275.1 protein_id gnl|my_center|LOCUS_03050 14668 15912 gene locus_tag LOCUS_03060 14668 15912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03060 15916 16446 gene locus_tag LOCUS_03070 15916 16446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03070 >Feature sequence015 1827 1156 gene locus_tag LOCUS_03080 1827 1156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03080 1880 1889 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2323 3216 gene locus_tag LOCUS_03090 2323 3216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03090 3106 3115 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3156 3458 gene locus_tag LOCUS_03100 3156 3458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03100 5308 3455 gene locus_tag LOCUS_03110 5308 3455 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003433862.1 protein_id gnl|my_center|LOCUS_03110 7472 5301 gene locus_tag LOCUS_03120 7472 5301 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003433859.1 protein_id gnl|my_center|LOCUS_03120 6572 6581 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 7935 7465 gene locus_tag LOCUS_03130 7935 7465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03130 8813 8061 gene locus_tag LOCUS_03140 gene aroD 8813 8061 CDS product type I 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897376.1 protein_id gnl|my_center|LOCUS_03140 9045 10076 gene locus_tag LOCUS_03150 9045 10076 CDS product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816655.1 protein_id gnl|my_center|LOCUS_03150 11245 10193 gene locus_tag LOCUS_03160 11245 10193 CDS product DUF5692 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948196.1 protein_id gnl|my_center|LOCUS_03160 12020 11562 gene locus_tag LOCUS_03170 12020 11562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03170 12835 12047 gene locus_tag LOCUS_03180 gene srtB 12835 12047 CDS product class B sortase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000095595.1 protein_id gnl|my_center|LOCUS_03180 13592 12963 gene locus_tag LOCUS_03190 13592 12963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03190 14262 13759 gene locus_tag LOCUS_03200 14262 13759 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246088.1 protein_id gnl|my_center|LOCUS_03200 14892 14284 gene locus_tag LOCUS_03210 14892 14284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03210 >Feature sequence016 81 608 gene locus_tag LOCUS_03220 81 608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03220 674 1213 gene locus_tag LOCUS_03230 674 1213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03230 1353 2039 gene locus_tag LOCUS_03240 1353 2039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03240 2528 2791 gene locus_tag LOCUS_03250 2528 2791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03250 2798 3412 gene locus_tag LOCUS_03260 2798 3412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03260 3673 3891 gene locus_tag LOCUS_03270 3673 3891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03270 4275 4042 gene locus_tag LOCUS_03280 4275 4042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03280 4524 4736 gene locus_tag LOCUS_03290 4524 4736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03290 4927 5250 gene locus_tag LOCUS_03300 4927 5250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03300 5569 5733 gene locus_tag LOCUS_03310 5569 5733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03310 5903 6325 gene locus_tag LOCUS_03320 5903 6325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03320 6334 6654 gene locus_tag LOCUS_03330 6334 6654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03330 6644 6811 gene locus_tag LOCUS_03340 6644 6811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03340 6804 7190 gene locus_tag LOCUS_03350 6804 7190 CDS product type II toxin-antitoxin system PemK/MazF family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963816.1 protein_id gnl|my_center|LOCUS_03350 7268 7516 gene locus_tag LOCUS_03360 7268 7516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03360 7676 9385 gene locus_tag LOCUS_03370 7676 9385 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_163066848.1 protein_id gnl|my_center|LOCUS_03370 9337 10980 gene locus_tag LOCUS_03380 9337 10980 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_163066848.1 protein_id gnl|my_center|LOCUS_03380 10980 12560 gene locus_tag LOCUS_03390 10980 12560 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775555.1 protein_id gnl|my_center|LOCUS_03390 12726 12965 gene locus_tag LOCUS_03400 12726 12965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03400 12984 13751 gene locus_tag LOCUS_03410 12984 13751 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202637.1 protein_id gnl|my_center|LOCUS_03410 13773 14636 gene locus_tag LOCUS_03420 13773 14636 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547312.1 protein_id gnl|my_center|LOCUS_03420 14638 15312 gene locus_tag LOCUS_03430 14638 15312 CDS product dihydrofolate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202734.1 protein_id gnl|my_center|LOCUS_03430 >Feature sequence017 <1 1187 gene locus_tag LOCUS_03440 <1 1187 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005814514.1:HAMP domain-containing sensor histidine kinase 2200 1697 gene locus_tag LOCUS_03450 2200 1697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03450 2395 3666 gene locus_tag LOCUS_03460 2395 3666 CDS product M18 family aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682090.1 protein_id gnl|my_center|LOCUS_03460 3719 4942 gene locus_tag LOCUS_03470 3719 4942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03470 5130 5969 gene locus_tag LOCUS_03480 5130 5969 CDS product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009890830.1 protein_id gnl|my_center|LOCUS_03480 5974 7272 gene locus_tag LOCUS_03490 5974 7272 CDS product folylpolyglutamate synthase/dihydrofolate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943004.1 protein_id gnl|my_center|LOCUS_03490 7531 8883 gene locus_tag LOCUS_03500 7531 8883 CDS product MBOAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461245.1 protein_id gnl|my_center|LOCUS_03500 8903 9829 gene locus_tag LOCUS_03510 8903 9829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03510 10542 9871 gene locus_tag LOCUS_03520 10542 9871 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_022619212.1 protein_id gnl|my_center|LOCUS_03520 10689 11399 gene locus_tag LOCUS_03530 10689 11399 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003433947.1 protein_id gnl|my_center|LOCUS_03530 11467 12420 gene locus_tag LOCUS_03540 11467 12420 CDS product L-lactate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963590.1 protein_id gnl|my_center|LOCUS_03540 12492 12854 gene locus_tag LOCUS_03550 12492 12854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03550 13018 15447 gene locus_tag LOCUS_03560 13018 15447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03560 >Feature sequence018 210 1196 gene locus_tag LOCUS_03570 210 1196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03570 1251 1925 gene locus_tag LOCUS_03580 1251 1925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03580 2258 3289 gene locus_tag LOCUS_03590 2258 3289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03590 3208 3525 gene locus_tag LOCUS_03600 3208 3525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03600 3538 3714 gene locus_tag LOCUS_03610 3538 3714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03610 3711 3989 gene locus_tag LOCUS_03620 3711 3989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03620 3976 4419 gene locus_tag LOCUS_03630 3976 4419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03630 4436 4657 gene locus_tag LOCUS_03640 4436 4657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03640 4723 5427 gene locus_tag LOCUS_03650 4723 5427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03650 5497 6561 gene locus_tag LOCUS_03660 5497 6561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03660 6582 6755 gene locus_tag LOCUS_03670 6582 6755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03670 7386 7559 gene locus_tag LOCUS_03680 7386 7559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03680 7637 7789 gene locus_tag LOCUS_03690 7637 7789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03690 7795 8121 gene locus_tag LOCUS_03700 7795 8121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03700 8123 8311 gene locus_tag LOCUS_03710 8123 8311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03710 8308 8694 gene locus_tag LOCUS_03720 8308 8694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03720 8711 8956 gene locus_tag LOCUS_03730 8711 8956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03730 8961 9713 gene locus_tag LOCUS_03740 8961 9713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03740 9713 10213 gene locus_tag LOCUS_03750 9713 10213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03750 10203 10622 gene locus_tag LOCUS_03760 10203 10622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03760 10703 11074 gene locus_tag LOCUS_03770 10703 11074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03770 11090 11221 gene locus_tag LOCUS_03780 11090 11221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03780 11218 11553 gene locus_tag LOCUS_03790 11218 11553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03790 11573 12286 gene locus_tag LOCUS_03800 11573 12286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004323442.1 protein_id gnl|my_center|LOCUS_03800 12298 12555 gene locus_tag LOCUS_03810 12298 12555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001246457.1 protein_id gnl|my_center|LOCUS_03810 12552 13358 gene locus_tag LOCUS_03820 12552 13358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03820 13359 13568 gene locus_tag LOCUS_03830 13359 13568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03830 13671 13949 gene locus_tag LOCUS_03840 13671 13949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03840 14031 14309 gene locus_tag LOCUS_03850 14031 14309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03850 14323 14736 gene locus_tag LOCUS_03860 14323 14736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03860 14748 14924 gene locus_tag LOCUS_03870 14748 14924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03870 14929 15258 gene locus_tag LOCUS_03880 14929 15258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03880 >Feature sequence019 1422 130 gene locus_tag LOCUS_03890 1422 130 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966804.1 protein_id gnl|my_center|LOCUS_03890 3114 1558 gene locus_tag LOCUS_03900 3114 1558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03900 3620 3102 gene locus_tag LOCUS_03910 3620 3102 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065644.1 protein_id gnl|my_center|LOCUS_03910 3804 3640 gene locus_tag LOCUS_03920 3804 3640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03920 4941 3847 gene locus_tag LOCUS_03930 4941 3847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03930 8637 5086 gene locus_tag LOCUS_03940 gene mfd 8637 5086 CDS product transcription-repair coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048383.1 protein_id gnl|my_center|LOCUS_03940 9287 8715 gene locus_tag LOCUS_03950 gene pth 9287 8715 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966493.1 protein_id gnl|my_center|LOCUS_03950 10076 9336 gene locus_tag LOCUS_03960 10076 9336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03960 10533 10267 gene locus_tag LOCUS_03970 gene spoVG 10533 10267 CDS product septation regulator SpoVG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359319.1 protein_id gnl|my_center|LOCUS_03970 11727 10609 gene locus_tag LOCUS_03980 gene glgD 11727 10609 CDS product glucose-1-phosphate adenylyltransferase subunit GlgD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082940.1 protein_id gnl|my_center|LOCUS_03980 13007 11724 gene locus_tag LOCUS_03990 13007 11724 CDS product glucose-1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082942.1 protein_id gnl|my_center|LOCUS_03990 13325 14704 gene locus_tag LOCUS_04000 gene murC 13325 14704 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048388.1 protein_id gnl|my_center|LOCUS_04000 >Feature sequence020 1861 44 gene locus_tag LOCUS_04010 1861 44 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04010 3656 1851 gene locus_tag LOCUS_04020 3656 1851 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682372.1 protein_id gnl|my_center|LOCUS_04020 4527 3799 gene locus_tag LOCUS_04030 4527 3799 CDS product GHKL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680890.1 protein_id gnl|my_center|LOCUS_04030 5270 4539 gene locus_tag LOCUS_04040 gene rgbR 5270 4539 CDS product two-component system response regulator RgbR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438019.1 protein_id gnl|my_center|LOCUS_04040 7150 5291 gene locus_tag LOCUS_04050 7150 5291 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005898122.1 protein_id gnl|my_center|LOCUS_04050 8179 7481 gene locus_tag LOCUS_04060 8179 7481 CDS product 5'-methylthioadenosine/adenosylhomocysteine nucleosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416187.1 protein_id gnl|my_center|LOCUS_04060 9531 8329 gene locus_tag LOCUS_04070 9531 8329 CDS product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816736.1 protein_id gnl|my_center|LOCUS_04070 10034 9591 gene locus_tag LOCUS_04080 10034 9591 CDS product ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811150.1 protein_id gnl|my_center|LOCUS_04080 11049 10219 gene locus_tag LOCUS_04090 11049 10219 CDS product TPM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002379689.1 protein_id gnl|my_center|LOCUS_04090 12161 11046 gene locus_tag LOCUS_04100 12161 11046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289233.1 protein_id gnl|my_center|LOCUS_04100 13444 12164 gene locus_tag LOCUS_04110 13444 12164 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003132414.1 protein_id gnl|my_center|LOCUS_04110 14214 13456 gene locus_tag LOCUS_04120 14214 13456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04120 <15150 14207 gene locus_tag LOCUS_04130 <15150 14207 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_177451831.1:peptide chain release factor 2 >Feature sequence021 1133 1393 gene locus_tag LOCUS_04140 1133 1393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04140 1172 1181 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2068 1580 gene locus_tag LOCUS_04150 2068 1580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04150 2617 3645 gene locus_tag LOCUS_04160 2617 3645 CDS product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816655.1 protein_id gnl|my_center|LOCUS_04160 4628 3891 gene locus_tag LOCUS_04170 4628 3891 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028020226.1 protein_id gnl|my_center|LOCUS_04170 5867 4869 gene locus_tag LOCUS_04180 5867 4869 CDS product SIS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002322451.1 protein_id gnl|my_center|LOCUS_04180 7643 5904 gene locus_tag LOCUS_04190 7643 5904 CDS product hydantoinase B/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870477.1 protein_id gnl|my_center|LOCUS_04190 9708 7645 gene locus_tag LOCUS_04200 9708 7645 CDS product hydantoinase/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162491196.1 protein_id gnl|my_center|LOCUS_04200 10713 9877 gene locus_tag LOCUS_04210 10713 9877 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970333.1 protein_id gnl|my_center|LOCUS_04210 11645 10743 gene locus_tag LOCUS_04220 11645 10743 CDS product fructoselysine 6-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966764.1 protein_id gnl|my_center|LOCUS_04220 12862 11774 gene locus_tag LOCUS_04230 12862 11774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04230 14208 12913 gene locus_tag LOCUS_04240 gene siaM 14208 12913 CDS product sialic acid TRAP transporter large permease SiaM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000233105.1 protein_id gnl|my_center|LOCUS_04240 14743 14201 gene locus_tag LOCUS_04250 14743 14201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04250 >Feature sequence022 36 1535 gene locus_tag LOCUS_04260 36 1535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04260 1489 2883 gene locus_tag LOCUS_04270 1489 2883 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000301254.1 protein_id gnl|my_center|LOCUS_04270 3838 2885 gene locus_tag LOCUS_04280 3838 2885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460981.1 protein_id gnl|my_center|LOCUS_04280 4812 3835 gene locus_tag LOCUS_04290 4812 3835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460980.1 protein_id gnl|my_center|LOCUS_04290 5201 4809 gene locus_tag LOCUS_04300 5201 4809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04300 5862 5161 gene locus_tag LOCUS_04310 5862 5161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_218149482.1 protein_id gnl|my_center|LOCUS_04310 7720 5840 gene locus_tag LOCUS_04320 7720 5840 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272533.1 protein_id gnl|my_center|LOCUS_04320 8235 7852 gene locus_tag LOCUS_04330 8235 7852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04330 8606 8926 gene locus_tag LOCUS_04340 8606 8926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04340 9012 9323 gene locus_tag LOCUS_04350 9012 9323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04350 9428 10297 gene locus_tag LOCUS_04360 9428 10297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04360 10575 12407 gene locus_tag LOCUS_04370 10575 12407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04370 12633 13190 gene locus_tag LOCUS_04380 12633 13190 CDS product biotin transporter BioY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963535.1 protein_id gnl|my_center|LOCUS_04380 13194 13877 gene locus_tag LOCUS_04390 gene bioD 13194 13877 CDS product dethiobiotin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986727.1 protein_id gnl|my_center|LOCUS_04390 >Feature sequence023 2545 854 gene locus_tag LOCUS_04400 2545 854 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964908.1 protein_id gnl|my_center|LOCUS_04400 3694 2759 gene locus_tag LOCUS_04410 gene tsf 3694 2759 CDS product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003424535.1 protein_id gnl|my_center|LOCUS_04410 4514 3774 gene locus_tag LOCUS_04420 gene rpsB 4514 3774 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460417.1 protein_id gnl|my_center|LOCUS_04420 5279 4686 gene locus_tag LOCUS_04430 5279 4686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04430 6034 5276 gene locus_tag LOCUS_04440 6034 5276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04440 6372 6046 gene locus_tag LOCUS_04450 6372 6046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04450 7145 6375 gene locus_tag LOCUS_04460 gene whiG 7145 6375 CDS product RNA polymerase sigma factor WhiG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000039671.1 protein_id gnl|my_center|LOCUS_04460 7435 7166 gene locus_tag LOCUS_04470 7435 7166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04470 7954 7469 gene locus_tag LOCUS_04480 7954 7469 CDS product chemotaxis protein CheD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071541375.1 protein_id gnl|my_center|LOCUS_04480 8593 7964 gene locus_tag LOCUS_04490 8593 7964 CDS product chemotaxis protein CheC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006874833.1 protein_id gnl|my_center|LOCUS_04490 9125 8664 gene locus_tag LOCUS_04500 9125 8664 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392262.1 protein_id gnl|my_center|LOCUS_04500 11239 9140 gene locus_tag LOCUS_04510 11239 9140 CDS product chemotaxis protein CheA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001192596.1 protein_id gnl|my_center|LOCUS_04510 12314 11241 gene locus_tag LOCUS_04520 12314 11241 CDS product chemotaxis response regulator protein-glutamate methylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249584.1 protein_id gnl|my_center|LOCUS_04520 13060 12314 gene locus_tag LOCUS_04530 13060 12314 CDS product flagellar brake domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986947.1 protein_id gnl|my_center|LOCUS_04530 13949 13074 gene locus_tag LOCUS_04540 13949 13074 CDS product MinD/ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965444.1 protein_id gnl|my_center|LOCUS_04540 <15037 13953 gene locus_tag LOCUS_04550 <15037 13953 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010965445.1:flagellar biosynthesis protein FlhF >Feature sequence024 282 461 gene locus_tag LOCUS_04560 282 461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04560 458 646 gene locus_tag LOCUS_04570 458 646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04570 1073 726 gene locus_tag LOCUS_04580 1073 726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04580 1955 1161 gene locus_tag LOCUS_04590 1955 1161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04590 2341 1958 gene locus_tag LOCUS_04600 2341 1958 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287076.1 protein_id gnl|my_center|LOCUS_04600 2796 2464 gene locus_tag LOCUS_04610 2796 2464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04610 3627 2866 gene locus_tag LOCUS_04620 3627 2866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04620 4458 3664 gene locus_tag LOCUS_04630 4458 3664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04630 4782 4582 gene locus_tag LOCUS_04640 4782 4582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04640 5515 4904 gene locus_tag LOCUS_04650 5515 4904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04650 6424 5522 gene locus_tag LOCUS_04660 6424 5522 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203586.1 protein_id gnl|my_center|LOCUS_04660 7114 6506 gene locus_tag LOCUS_04670 gene rfbC 7114 6506 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965628.1 protein_id gnl|my_center|LOCUS_04670 8044 7130 gene locus_tag LOCUS_04680 gene rfbD 8044 7130 CDS product dTDP-4-dehydrorhamnose reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476435.1 protein_id gnl|my_center|LOCUS_04680 9086 8067 gene locus_tag LOCUS_04690 gene rfbB 9086 8067 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461013.1 protein_id gnl|my_center|LOCUS_04690 10022 9126 gene locus_tag LOCUS_04700 gene rfbA 10022 9126 CDS product glucose-1-phosphate thymidylyltransferase RfbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002364387.1 protein_id gnl|my_center|LOCUS_04700 11427 10255 gene locus_tag LOCUS_04710 11427 10255 CDS product Coenzyme F420 hydrogenase/dehydrogenase, beta subunit C-terminal domain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107236.1 protein_id gnl|my_center|LOCUS_04710 12539 11424 gene locus_tag LOCUS_04720 12539 11424 CDS product polysaccharide pyruvyl transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143696.1 protein_id gnl|my_center|LOCUS_04720 13991 12582 gene locus_tag LOCUS_04730 13991 12582 CDS product oligosaccharide flippase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000091276.1 protein_id gnl|my_center|LOCUS_04730 14876 14121 gene locus_tag LOCUS_04740 14876 14121 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426509.1 protein_id gnl|my_center|LOCUS_04740 >Feature sequence025 2587 770 gene locus_tag LOCUS_04750 gene abc-f 2587 770 CDS product ABC-F type ribosomal protection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002195117.1 protein_id gnl|my_center|LOCUS_04750 2963 2709 gene locus_tag LOCUS_04760 2963 2709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04760 3718 3326 gene locus_tag LOCUS_04770 gene rpsI 3718 3326 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357662.1 protein_id gnl|my_center|LOCUS_04770 4164 3736 gene locus_tag LOCUS_04780 gene rplM 4164 3736 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210132.1 protein_id gnl|my_center|LOCUS_04780 5239 4487 gene locus_tag LOCUS_04790 gene truA 5239 4487 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966380.1 protein_id gnl|my_center|LOCUS_04790 6110 5298 gene locus_tag LOCUS_04800 6110 5298 CDS product energy-coupling factor transporter transmembrane protein EcfT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357319.1 protein_id gnl|my_center|LOCUS_04800 7000 6104 gene locus_tag LOCUS_04810 7000 6104 CDS product energy-coupling factor transporter ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435657.1 protein_id gnl|my_center|LOCUS_04810 7925 7071 gene locus_tag LOCUS_04820 7925 7071 CDS product energy-coupling factor transporter ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966383.1 protein_id gnl|my_center|LOCUS_04820 8433 7930 gene locus_tag LOCUS_04830 gene trmL 8433 7930 CDS product tRNA (uridine(34)/cytosine(34)/5-carboxymethylaminomethyluridine(34)-2'-O)-methyltransferase TrmL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429657.1 protein_id gnl|my_center|LOCUS_04830 9608 8433 gene locus_tag LOCUS_04840 9608 8433 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000808537.1 protein_id gnl|my_center|LOCUS_04840 10086 9610 gene locus_tag LOCUS_04850 10086 9610 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025774673.1 protein_id gnl|my_center|LOCUS_04850 11149 10160 gene locus_tag LOCUS_04860 11149 10160 CDS product AIR synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249983.1 protein_id gnl|my_center|LOCUS_04860 12737 11160 gene locus_tag LOCUS_04870 12737 11160 CDS product VanW family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948022.1 protein_id gnl|my_center|LOCUS_04870 13089 12931 gene locus_tag LOCUS_04880 13089 12931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04880 13088 13696 gene locus_tag LOCUS_04890 13088 13696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04890 14424 13699 gene locus_tag LOCUS_04900 14424 13699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04900 >Feature sequence026 789 28 gene locus_tag LOCUS_04910 789 28 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04910 2133 802 gene locus_tag LOCUS_04920 2133 802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04920 3441 2137 gene locus_tag LOCUS_04930 3441 2137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04930 5202 3454 gene locus_tag LOCUS_04940 5202 3454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04940 6182 5214 gene locus_tag LOCUS_04950 6182 5214 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002893621.1 protein_id gnl|my_center|LOCUS_04950 7760 6189 gene locus_tag LOCUS_04960 7760 6189 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921891.1 protein_id gnl|my_center|LOCUS_04960 10023 7837 gene locus_tag LOCUS_04970 10023 7837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04970 10337 10176 gene locus_tag LOCUS_04980 10337 10176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04980 12342 10663 gene locus_tag LOCUS_04990 12342 10663 CDS product M3 family oligoendopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000008577.1 protein_id gnl|my_center|LOCUS_04990 12452 12461 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 12471 12758 gene locus_tag LOCUS_05000 12471 12758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05000 13279 12779 gene locus_tag LOCUS_05010 13279 12779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05010 14209 13280 gene locus_tag LOCUS_05020 14209 13280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05020 >Feature sequence027 175 1203 gene locus_tag LOCUS_05030 175 1203 CDS product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693870.1 protein_id gnl|my_center|LOCUS_05030 1217 1810 gene locus_tag LOCUS_05040 1217 1810 CDS product TRAP transporter small permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967133.1 protein_id gnl|my_center|LOCUS_05040 1812 3092 gene locus_tag LOCUS_05050 1812 3092 CDS product TRAP transporter large permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974961.1 protein_id gnl|my_center|LOCUS_05050 3175 4251 gene locus_tag LOCUS_05060 gene uxuA 3175 4251 CDS product mannonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391968.1 protein_id gnl|my_center|LOCUS_05060 4248 5861 gene locus_tag LOCUS_05070 4248 5861 CDS product mannitol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_054937112.1 protein_id gnl|my_center|LOCUS_05070 6120 7112 gene locus_tag LOCUS_05080 6120 7112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05080 7311 10691 gene locus_tag LOCUS_05090 7311 10691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05090 10820 11362 gene locus_tag LOCUS_05100 10820 11362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05100 11438 11743 gene locus_tag LOCUS_05110 11438 11743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05110 12301 11729 gene locus_tag LOCUS_05120 12301 11729 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549678.1 protein_id gnl|my_center|LOCUS_05120 12567 13004 gene locus_tag LOCUS_05130 12567 13004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05130 >Feature sequence028 2977 395 gene locus_tag LOCUS_05140 gene clpB 2977 395 CDS product ATP-dependent chaperone ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000365401.1 protein_id gnl|my_center|LOCUS_05140 4033 3242 gene locus_tag LOCUS_05150 4033 3242 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011922420.1 protein_id gnl|my_center|LOCUS_05150 5507 4038 gene locus_tag LOCUS_05160 5507 4038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05160 6372 5638 gene locus_tag LOCUS_05170 gene sigF 6372 5638 CDS product RNA polymerase sporulation sigma factor SigF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000350729.1 protein_id gnl|my_center|LOCUS_05170 6810 6376 gene locus_tag LOCUS_05180 gene spoIIAB 6810 6376 CDS product anti-sigma F factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357714.1 protein_id gnl|my_center|LOCUS_05180 7140 6832 gene locus_tag LOCUS_05190 gene spoIIAA 7140 6832 CDS product anti-sigma F factor antagonist inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418414.1 protein_id gnl|my_center|LOCUS_05190 8657 7275 gene locus_tag LOCUS_05200 8657 7275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05200 8886 8704 gene locus_tag LOCUS_05210 8886 8704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05210 10527 9139 gene locus_tag LOCUS_05220 10527 9139 CDS product FapA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941180.1 protein_id gnl|my_center|LOCUS_05220 13372 10727 gene locus_tag LOCUS_05230 13372 10727 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861890.1 protein_id gnl|my_center|LOCUS_05230 >Feature sequence029 176 36 gene locus_tag LOCUS_05240 176 36 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05240 595 281 gene locus_tag LOCUS_05250 595 281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05250 2358 607 gene locus_tag LOCUS_05260 2358 607 CDS product type IV secretory system conjugative DNA transfer family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861117.1 protein_id gnl|my_center|LOCUS_05260 2639 2355 gene locus_tag LOCUS_05270 2639 2355 CDS product PcfB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920613.1 protein_id gnl|my_center|LOCUS_05270 2848 2675 gene locus_tag LOCUS_05280 2848 2675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05280 2698 2707 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3316 2888 gene locus_tag LOCUS_05290 3316 2888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05290 3644 3333 gene locus_tag LOCUS_05300 3644 3333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05300 4296 3655 gene locus_tag LOCUS_05310 4296 3655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05310 4865 4350 gene locus_tag LOCUS_05320 4865 4350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05320 5801 4875 gene locus_tag LOCUS_05330 5801 4875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05330 6585 5758 gene locus_tag LOCUS_05340 6585 5758 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355976.1 protein_id gnl|my_center|LOCUS_05340 7524 6592 gene locus_tag LOCUS_05350 7524 6592 CDS product DUF6017 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002368732.1 protein_id gnl|my_center|LOCUS_05350 7958 7701 gene locus_tag LOCUS_05360 7958 7701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05360 8292 8068 gene locus_tag LOCUS_05370 8292 8068 CDS product DUF5348 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002610290.1 protein_id gnl|my_center|LOCUS_05370 9728 8508 gene locus_tag LOCUS_05380 gene spoIVB 9728 8508 CDS product SpoIVB peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965372.1 protein_id gnl|my_center|LOCUS_05380 11565 9907 gene locus_tag LOCUS_05390 gene recN 11565 9907 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986438.1 protein_id gnl|my_center|LOCUS_05390 12070 11618 gene locus_tag LOCUS_05400 12070 11618 CDS product arginine repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965374.1 protein_id gnl|my_center|LOCUS_05400 12940 12101 gene locus_tag LOCUS_05410 12940 12101 CDS product NAD(+)/NADH kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393018.1 protein_id gnl|my_center|LOCUS_05410 >Feature sequence030 <1 642 gene locus_tag LOCUS_05420 <1 642 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003130140.1:N-acetylmannosamine-6-phosphate 2-epimerase 656 1537 gene locus_tag LOCUS_05430 656 1537 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017180.1 protein_id gnl|my_center|LOCUS_05430 1606 2250 gene locus_tag LOCUS_05440 1606 2250 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041170003.1 protein_id gnl|my_center|LOCUS_05440 2578 3840 gene locus_tag LOCUS_05450 2578 3840 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250265.1 protein_id gnl|my_center|LOCUS_05450 4108 3845 gene locus_tag LOCUS_05460 4108 3845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05460 5706 4213 gene locus_tag LOCUS_05470 5706 4213 CDS product Na+/H+ antiporter NhaC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262192.1 protein_id gnl|my_center|LOCUS_05470 6533 5928 gene locus_tag LOCUS_05480 6533 5928 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011181746.1 protein_id gnl|my_center|LOCUS_05480 6838 9387 gene locus_tag LOCUS_05490 6838 9387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05490 9384 12308 gene locus_tag LOCUS_05500 9384 12308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05500 12355 12364 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence031 496 4056 gene locus_tag LOCUS_05510 496 4056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05510 4165 4746 gene locus_tag LOCUS_05520 4165 4746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05520 5026 5253 gene locus_tag LOCUS_05530 5026 5253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05530 5234 6112 gene locus_tag LOCUS_05540 5234 6112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05540 6685 6164 gene locus_tag LOCUS_05550 6685 6164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05550 6956 7183 gene locus_tag LOCUS_05560 6956 7183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05560 7104 7730 gene locus_tag LOCUS_05570 7104 7730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05570 7838 8584 gene locus_tag LOCUS_05580 7838 8584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05580 8609 9793 gene locus_tag LOCUS_05590 8609 9793 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_068555034.1 protein_id gnl|my_center|LOCUS_05590 9955 10371 gene locus_tag LOCUS_05600 9955 10371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05600 10362 10736 gene locus_tag LOCUS_05610 10362 10736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05610 10763 10918 gene locus_tag LOCUS_05620 10763 10918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05620 10918 11217 gene locus_tag LOCUS_05630 10918 11217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_05630 11233 11640 gene locus_tag LOCUS_05640 11233 11640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05640 11585 12922 gene locus_tag LOCUS_05650 11585 12922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05650 >Feature sequence032 1050 97 gene locus_tag LOCUS_05660 1050 97 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05660 1517 1092 gene locus_tag LOCUS_05670 1517 1092 CDS product phage holin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000439566.1 protein_id gnl|my_center|LOCUS_05670 2990 1596 gene locus_tag LOCUS_05680 2990 1596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05680 4074 2956 gene locus_tag LOCUS_05690 4074 2956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05690 5240 4071 gene locus_tag LOCUS_05700 5240 4071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05700 6243 5290 gene locus_tag LOCUS_05710 6243 5290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05710 5315 5324 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 6618 6256 gene locus_tag LOCUS_05720 6618 6256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05720 6811 6620 gene locus_tag LOCUS_05730 6811 6620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05730 9522 6808 gene locus_tag LOCUS_05740 9522 6808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05740 10118 9666 gene locus_tag LOCUS_05750 10118 9666 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476513.1 protein_id gnl|my_center|LOCUS_05750 10394 10230 gene locus_tag LOCUS_05760 10394 10230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05760 10768 10391 gene locus_tag LOCUS_05770 10768 10391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05770 11396 10782 gene locus_tag LOCUS_05780 11396 10782 CDS product phage tail protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905720.1 protein_id gnl|my_center|LOCUS_05780 11717 11400 gene locus_tag LOCUS_05790 11717 11400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05790 12097 11714 gene locus_tag LOCUS_05800 12097 11714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05800 12431 12102 gene locus_tag LOCUS_05810 12431 12102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05810 12706 12431 gene locus_tag LOCUS_05820 12706 12431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05820 >Feature sequence033 976 137 gene locus_tag LOCUS_05830 976 137 CDS product DUF4300 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860938.1 protein_id gnl|my_center|LOCUS_05830 2037 1243 gene locus_tag LOCUS_05840 2037 1243 CDS product glycyl-radical enzyme activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000180537.1 protein_id gnl|my_center|LOCUS_05840 4585 2054 gene locus_tag LOCUS_05850 4585 2054 CDS product glycyl radical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388658.1 protein_id gnl|my_center|LOCUS_05850 5434 4652 gene locus_tag LOCUS_05860 gene rhaR 5434 4652 CDS product rhamnose catabolism operon transcriptional regulator RhaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009968057.1 protein_id gnl|my_center|LOCUS_05860 6006 5458 gene locus_tag LOCUS_05870 6006 5458 CDS product BMC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815271.1 protein_id gnl|my_center|LOCUS_05870 7359 6034 gene locus_tag LOCUS_05880 7359 6034 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810293.1 protein_id gnl|my_center|LOCUS_05880 7631 7362 gene locus_tag LOCUS_05890 7631 7362 CDS product EutN/CcmL family microcompartment protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810291.1 protein_id gnl|my_center|LOCUS_05890 8347 7700 gene locus_tag LOCUS_05900 8347 7700 CDS product phosphate propanoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392695.1 protein_id gnl|my_center|LOCUS_05900 8698 8420 gene locus_tag LOCUS_05910 gene eutM 8698 8420 CDS product ethanolamine utilization microcompartment protein EutM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005895463.1 protein_id gnl|my_center|LOCUS_05910 9080 8724 gene locus_tag LOCUS_05920 9080 8724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05920 9422 9141 gene locus_tag LOCUS_05930 gene pduA 9422 9141 CDS product propanediol utilization microcompartment protein PduA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001183614.1 protein_id gnl|my_center|LOCUS_05930 9812 9474 gene locus_tag LOCUS_05940 9812 9474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05940 11045 9834 gene locus_tag LOCUS_05950 11045 9834 CDS product galactitol-1-phosphate 5-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861508.1 protein_id gnl|my_center|LOCUS_05950 12455 11064 gene locus_tag LOCUS_05960 12455 11064 CDS product aldehyde dehydrogenase EutE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388669.1 protein_id gnl|my_center|LOCUS_05960 12925 12446 gene locus_tag LOCUS_05970 12925 12446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05970 >Feature sequence034 2272 953 gene locus_tag LOCUS_05980 2272 953 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963601.1 protein_id gnl|my_center|LOCUS_05980 3382 2534 gene locus_tag LOCUS_05990 3382 2534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05990 4993 3455 gene locus_tag LOCUS_06000 4993 3455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06000 5566 5006 gene locus_tag LOCUS_06010 5566 5006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06010 6411 5719 gene locus_tag LOCUS_06020 6411 5719 CDS product LrgB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963931.1 protein_id gnl|my_center|LOCUS_06020 6775 6416 gene locus_tag LOCUS_06030 6775 6416 CDS product CidA/LrgA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963932.1 protein_id gnl|my_center|LOCUS_06030 8151 6841 gene locus_tag LOCUS_06040 8151 6841 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965885.1 protein_id gnl|my_center|LOCUS_06040 8437 9336 gene locus_tag LOCUS_06050 8437 9336 CDS product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948024.1 protein_id gnl|my_center|LOCUS_06050 12067 9359 gene locus_tag LOCUS_06060 12067 9359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06060 >Feature sequence035 1733 579 gene locus_tag LOCUS_06070 1733 579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06070 2416 1721 gene locus_tag LOCUS_06080 2416 1721 CDS product TMEM165/GDT1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941521.1 protein_id gnl|my_center|LOCUS_06080 4005 2731 gene locus_tag LOCUS_06090 4005 2731 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877115.1 protein_id gnl|my_center|LOCUS_06090 4968 4009 gene locus_tag LOCUS_06100 4968 4009 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000008843.1 protein_id gnl|my_center|LOCUS_06100 6116 4968 gene locus_tag LOCUS_06110 6116 4968 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679664.1 protein_id gnl|my_center|LOCUS_06110 7395 6103 gene locus_tag LOCUS_06120 7395 6103 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002381361.1 protein_id gnl|my_center|LOCUS_06120 7474 7483 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 8778 7606 gene locus_tag LOCUS_06130 8778 7606 CDS product BMP family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669780.1 protein_id gnl|my_center|LOCUS_06130 9865 8792 gene locus_tag LOCUS_06140 gene mtnA 9865 8792 CDS product S-methyl-5-thioribose-1-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948892.1 protein_id gnl|my_center|LOCUS_06140 10730 9897 gene locus_tag LOCUS_06150 10730 9897 CDS product purine nucleoside phosphorylase I, inosine and guanosine-specific inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230447.1 protein_id gnl|my_center|LOCUS_06150 11343 10732 gene locus_tag LOCUS_06160 11343 10732 CDS product class II aldolase/adducin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460450.1 protein_id gnl|my_center|LOCUS_06160 12160 11348 gene locus_tag LOCUS_06170 12160 11348 CDS product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000919197.1 protein_id gnl|my_center|LOCUS_06170 >Feature sequence036 177 1043 gene locus_tag LOCUS_06180 177 1043 CDS product CD0415/CD1112 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002610323.1 protein_id gnl|my_center|LOCUS_06180 1062 1496 gene locus_tag LOCUS_06190 1062 1496 CDS product PrgI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861115.1 protein_id gnl|my_center|LOCUS_06190 1417 3843 gene locus_tag LOCUS_06200 1417 3843 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010773627.1 protein_id gnl|my_center|LOCUS_06200 3847 5568 gene locus_tag LOCUS_06210 3847 5568 CDS product CHAP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861112.1 protein_id gnl|my_center|LOCUS_06210 5582 5839 gene locus_tag LOCUS_06220 5582 5839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06220 5829 6533 gene locus_tag LOCUS_06230 5829 6533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06230 6603 8675 gene locus_tag LOCUS_06240 6603 8675 CDS product DNA topoisomerase 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002368714.1 protein_id gnl|my_center|LOCUS_06240 8672 9151 gene locus_tag LOCUS_06250 8672 9151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06250 9166 9774 gene locus_tag LOCUS_06260 9166 9774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06260 9771 9974 gene locus_tag LOCUS_06270 9771 9974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06270 10783 11133 gene locus_tag LOCUS_06280 10783 11133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06280 >Feature sequence037 1197 31 gene locus_tag LOCUS_06290 1197 31 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06290 2042 1209 gene locus_tag LOCUS_06300 2042 1209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06300 3287 2058 gene locus_tag LOCUS_06310 3287 2058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06310 6841 3314 gene locus_tag LOCUS_06320 6841 3314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06320 6927 8021 gene locus_tag LOCUS_06330 6927 8021 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861645.1 protein_id gnl|my_center|LOCUS_06330 8677 8024 gene locus_tag LOCUS_06340 8677 8024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06340 9762 8887 gene locus_tag LOCUS_06350 9762 8887 CDS product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000684725.1 protein_id gnl|my_center|LOCUS_06350 10248 9778 gene locus_tag LOCUS_06360 10248 9778 CDS product methylglyoxal synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964912.1 protein_id gnl|my_center|LOCUS_06360 10916 10380 gene locus_tag LOCUS_06370 10916 10380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06370 <12071 11074 gene locus_tag LOCUS_06380 <12071 11074 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003640986.1:chaperonin GroEL >Feature sequence038 245 1210 gene locus_tag LOCUS_06390 245 1210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06390 1240 2169 gene locus_tag LOCUS_06400 1240 2169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06400 2092 2101 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2198 2434 gene locus_tag LOCUS_06410 2198 2434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06410 2519 4771 gene locus_tag LOCUS_06420 2519 4771 CDS product glycoside hydrolase family 31 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254583.1 protein_id gnl|my_center|LOCUS_06420 4843 5355 gene locus_tag LOCUS_06430 4843 5355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06430 5540 8065 gene locus_tag LOCUS_06440 5540 8065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06440 8256 8510 gene locus_tag LOCUS_06450 8256 8510 CDS product HPr family phosphocarrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812598.1 protein_id gnl|my_center|LOCUS_06450 8536 9051 gene locus_tag LOCUS_06460 8536 9051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06460 10346 9168 gene locus_tag LOCUS_06470 10346 9168 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964137.1 protein_id gnl|my_center|LOCUS_06470 11404 10424 gene locus_tag LOCUS_06480 11404 10424 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435695.1 protein_id gnl|my_center|LOCUS_06480 >Feature sequence039 727 551 gene locus_tag LOCUS_06490 727 551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06490 1390 1399 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1411 2466 gene locus_tag LOCUS_06500 1411 2466 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107748.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06500 2605 2727 gene locus_tag LOCUS_06510 2605 2727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06510 2910 3359 gene locus_tag LOCUS_06520 2910 3359 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966557.1 protein_id gnl|my_center|LOCUS_06520 3352 4692 gene locus_tag LOCUS_06530 3352 4692 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107748.1 protein_id gnl|my_center|LOCUS_06530 4826 5353 gene locus_tag LOCUS_06540 4826 5353 CDS product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966606.1 protein_id gnl|my_center|LOCUS_06540 5399 6010 gene locus_tag LOCUS_06550 5399 6010 CDS product sugar O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254380.1 protein_id gnl|my_center|LOCUS_06550 6392 6937 gene locus_tag LOCUS_06560 6392 6937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06560 7057 7572 gene locus_tag LOCUS_06570 7057 7572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06570 7695 8852 gene locus_tag LOCUS_06580 7695 8852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06580 10190 8973 gene locus_tag LOCUS_06590 gene pepT 10190 8973 CDS product peptidase T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963798.1 protein_id gnl|my_center|LOCUS_06590 10358 10432 gene locus_tag LOCUS_t00060 10358 10432 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 10721 11167 gene locus_tag LOCUS_06600 10721 11167 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013363085.1 protein_id gnl|my_center|LOCUS_06600 >Feature sequence040 221 27 gene locus_tag LOCUS_06610 221 27 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06610 241 408 gene locus_tag LOCUS_06620 241 408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06620 574 2865 gene locus_tag LOCUS_06630 574 2865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06630 2990 3664 gene locus_tag LOCUS_06640 2990 3664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06640 3571 3864 gene locus_tag LOCUS_06650 3571 3864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06650 3926 4765 gene locus_tag LOCUS_06660 3926 4765 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814246.1 protein_id gnl|my_center|LOCUS_06660 4765 6393 gene locus_tag LOCUS_06670 4765 6393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06670 6404 7375 gene locus_tag LOCUS_06680 6404 7375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06680 7736 8974 gene locus_tag LOCUS_06690 7736 8974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06690 10046 9018 gene locus_tag LOCUS_06700 10046 9018 CDS product YeiH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011922574.1 protein_id gnl|my_center|LOCUS_06700 >Feature sequence041 1198 71 gene locus_tag LOCUS_06710 1198 71 CDS product DUF362 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082494.1 protein_id gnl|my_center|LOCUS_06710 3527 1452 gene locus_tag LOCUS_06720 3527 1452 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860870.1 protein_id gnl|my_center|LOCUS_06720 3957 3655 gene locus_tag LOCUS_06730 3957 3655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06730 5181 4138 gene locus_tag LOCUS_06740 5181 4138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06740 5414 5830 gene locus_tag LOCUS_06750 5414 5830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06750 5943 6065 gene locus_tag LOCUS_06760 5943 6065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06760 6072 6215 gene locus_tag LOCUS_06770 6072 6215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06770 6838 6341 gene locus_tag LOCUS_06780 gene spoVAC 6838 6341 CDS product stage V sporulation protein AC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965602.1 protein_id gnl|my_center|LOCUS_06780 7164 9266 gene locus_tag LOCUS_06790 7164 9266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06790 9620 9282 gene locus_tag LOCUS_06800 9620 9282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06800 10233 9805 gene locus_tag LOCUS_06810 10233 9805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06810 10870 10223 gene locus_tag LOCUS_06820 10870 10223 CDS product stage V sporulation protein AA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000438369.1 protein_id gnl|my_center|LOCUS_06820 11028 10867 gene locus_tag LOCUS_06830 11028 10867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06830 >Feature sequence042 768 112 gene locus_tag LOCUS_06840 768 112 CDS product DnaJ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003398976.1 protein_id gnl|my_center|LOCUS_06840 1656 781 gene locus_tag LOCUS_06850 1656 781 CDS product DUF5685 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435907.1 protein_id gnl|my_center|LOCUS_06850 2073 1678 gene locus_tag LOCUS_06860 2073 1678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643513.1 protein_id gnl|my_center|LOCUS_06860 3257 2175 gene locus_tag LOCUS_06870 3257 2175 CDS product type IV pilus twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861983.1 protein_id gnl|my_center|LOCUS_06870 5582 3900 gene locus_tag LOCUS_06880 5582 3900 CDS product nucleoside kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080960.1 protein_id gnl|my_center|LOCUS_06880 6516 5668 gene locus_tag LOCUS_06890 6516 5668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06890 8559 6604 gene locus_tag LOCUS_06900 8559 6604 CDS product fructose-1,6-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948262.1 protein_id gnl|my_center|LOCUS_06900 9300 8608 gene locus_tag LOCUS_06910 gene dapB 9300 8608 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048150.1 protein_id gnl|my_center|LOCUS_06910 9257 9266 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 10301 9414 gene locus_tag LOCUS_06920 gene dapA 10301 9414 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048149.1 protein_id gnl|my_center|LOCUS_06920 10464 10288 gene locus_tag LOCUS_06930 10464 10288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06930 <11252 10731 gene locus_tag LOCUS_06940 <11252 10731 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003422086.1:single-stranded DNA-binding protein >Feature sequence043 249 1841 gene locus_tag LOCUS_06950 249 1841 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966358.1 protein_id gnl|my_center|LOCUS_06950 1892 4582 gene locus_tag LOCUS_06960 gene mutS 1892 4582 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965142.1 protein_id gnl|my_center|LOCUS_06960 1912 1963 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 4622 6565 gene locus_tag LOCUS_06970 gene mutL 4622 6565 CDS product DNA mismatch repair endonuclease MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861409.1 protein_id gnl|my_center|LOCUS_06970 6571 7524 gene locus_tag LOCUS_06980 gene miaA 6571 7524 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986379.1 protein_id gnl|my_center|LOCUS_06980 7603 8901 gene locus_tag LOCUS_06990 7603 8901 CDS product methionine gamma-lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435270.1 protein_id gnl|my_center|LOCUS_06990 8962 9654 gene locus_tag LOCUS_07000 gene radC 8962 9654 CDS product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964554.1 protein_id gnl|my_center|LOCUS_07000 9654 10751 gene locus_tag LOCUS_07010 9654 10751 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403487.1 protein_id gnl|my_center|LOCUS_07010 >Feature sequence044 229 891 gene locus_tag LOCUS_07020 229 891 CDS product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966155.1 protein_id gnl|my_center|LOCUS_07020 940 1164 gene locus_tag LOCUS_07030 940 1164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07030 1184 1690 gene locus_tag LOCUS_07040 1184 1690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07040 1671 2174 gene locus_tag LOCUS_07050 gene atpH 1671 2174 CDS product ATP synthase F1 subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964546.1 protein_id gnl|my_center|LOCUS_07050 2179 3681 gene locus_tag LOCUS_07060 gene atpA 2179 3681 CDS product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966151.1 protein_id gnl|my_center|LOCUS_07060 3688 4581 gene locus_tag LOCUS_07070 gene atpG 3688 4581 CDS product ATP synthase F1 subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437835.1 protein_id gnl|my_center|LOCUS_07070 4594 5997 gene locus_tag LOCUS_07080 gene atpD 4594 5997 CDS product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393855.1 protein_id gnl|my_center|LOCUS_07080 6001 6423 gene locus_tag LOCUS_07090 6001 6423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07090 6866 7018 gene locus_tag LOCUS_07100 6866 7018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07100 7171 8964 gene locus_tag LOCUS_07110 7171 8964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07110 8952 9704 gene locus_tag LOCUS_07120 8952 9704 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002917245.1 protein_id gnl|my_center|LOCUS_07120 9688 10959 gene locus_tag LOCUS_07130 9688 10959 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254464.1 protein_id gnl|my_center|LOCUS_07130 >Feature sequence045 62 1513 gene locus_tag LOCUS_07140 62 1513 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109350.1 protein_id gnl|my_center|LOCUS_07140 1702 2502 gene locus_tag LOCUS_07150 1702 2502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123227.1 protein_id gnl|my_center|LOCUS_07150 2629 3180 gene locus_tag LOCUS_07160 2629 3180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07160 4009 4128 gene locus_tag LOCUS_07170 4009 4128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07170 4219 4482 gene locus_tag LOCUS_07180 4219 4482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07180 4778 5134 gene locus_tag LOCUS_07190 4778 5134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07190 5156 6190 gene locus_tag LOCUS_07200 5156 6190 CDS product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109299.1 protein_id gnl|my_center|LOCUS_07200 6216 7190 gene locus_tag LOCUS_07210 6216 7190 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012774928.1 protein_id gnl|my_center|LOCUS_07210 7194 7457 gene locus_tag LOCUS_07220 7194 7457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07220 7477 7599 gene locus_tag LOCUS_07230 7477 7599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07230 7768 9288 gene locus_tag LOCUS_07240 gene yfcC 7768 9288 CDS product putative basic amino acid antiporter YfcC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868954.1 protein_id gnl|my_center|LOCUS_07240 9375 10523 gene locus_tag LOCUS_07250 gene iadA 9375 10523 CDS product beta-aspartyl-peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287126.1 protein_id gnl|my_center|LOCUS_07250 >Feature sequence046 4379 2583 gene locus_tag LOCUS_07260 4379 2583 CDS product Na/Pi cotransporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009898459.1 protein_id gnl|my_center|LOCUS_07260 5978 4614 gene locus_tag LOCUS_07270 5978 4614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07270 7760 6060 gene locus_tag LOCUS_07280 gene pdcB 7760 6060 CDS product phosphodiesterase PdcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437448.1 protein_id gnl|my_center|LOCUS_07280 9544 7832 gene locus_tag LOCUS_07290 9544 7832 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003425090.1 protein_id gnl|my_center|LOCUS_07290 10417 9782 gene locus_tag LOCUS_07300 10417 9782 CDS product ribonuclease H family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009889235.1 protein_id gnl|my_center|LOCUS_07300 10796 10446 gene locus_tag LOCUS_07310 10796 10446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07310 >Feature sequence047 <1 860 gene locus_tag LOCUS_07320 <1 860 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011948191.1:helicase-exonuclease AddAB subunit AddB 814 957 gene locus_tag LOCUS_07330 814 957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07330 846 855 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 976 4827 gene locus_tag LOCUS_07340 gene addA 976 4827 CDS product helicase-exonuclease AddAB subunit AddA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861079.1 protein_id gnl|my_center|LOCUS_07340 1813 1822 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 4840 5466 gene locus_tag LOCUS_07350 4840 5466 CDS product Maf family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001226275.1 protein_id gnl|my_center|LOCUS_07350 5503 5766 gene locus_tag LOCUS_07360 5503 5766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07360 5911 7311 gene locus_tag LOCUS_07370 5911 7311 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393793.1 protein_id gnl|my_center|LOCUS_07370 7321 8313 gene locus_tag LOCUS_07380 7321 8313 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014519041.1 protein_id gnl|my_center|LOCUS_07380 8345 9685 gene locus_tag LOCUS_07390 8345 9685 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109290.1 protein_id gnl|my_center|LOCUS_07390 >Feature sequence048 <1 779 gene locus_tag LOCUS_07400 <1 779 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005791788.1:tryptophan--tRNA ligase 791 4303 gene locus_tag LOCUS_07410 791 4303 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963838.1 protein_id gnl|my_center|LOCUS_07410 4400 5374 gene locus_tag LOCUS_07420 gene pfkA 4400 5374 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357588.1 protein_id gnl|my_center|LOCUS_07420 5477 6295 gene locus_tag LOCUS_07430 5477 6295 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965655.1 protein_id gnl|my_center|LOCUS_07430 6310 6555 gene locus_tag LOCUS_07440 6310 6555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07440 6644 7165 gene locus_tag LOCUS_07450 6644 7165 CDS product transcription repressor NadR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947901.1 protein_id gnl|my_center|LOCUS_07450 7304 7963 gene locus_tag LOCUS_07460 7304 7963 CDS product GTP pyrophosphokinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966612.1 protein_id gnl|my_center|LOCUS_07460 7953 8804 gene locus_tag LOCUS_07470 7953 8804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07470 8666 8675 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 8731 9891 gene locus_tag LOCUS_07480 8731 9891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07480 >Feature sequence049 258 626 gene locus_tag LOCUS_07490 258 626 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000805188.1 protein_id gnl|my_center|LOCUS_07490 741 1616 gene locus_tag LOCUS_07500 741 1616 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000560921.1 protein_id gnl|my_center|LOCUS_07500 1619 2287 gene locus_tag LOCUS_07510 1619 2287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07510 2305 3006 gene locus_tag LOCUS_07520 2305 3006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07520 3117 4619 gene locus_tag LOCUS_07530 gene ypwA 3117 4619 CDS product carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398513.1 protein_id gnl|my_center|LOCUS_07530 4660 5301 gene locus_tag LOCUS_07540 4660 5301 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965791.1 protein_id gnl|my_center|LOCUS_07540 5323 6315 gene locus_tag LOCUS_07550 5323 6315 CDS product DHHA1 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680886.1 protein_id gnl|my_center|LOCUS_07550 6373 6525 gene locus_tag LOCUS_07560 6373 6525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07560 6608 6707 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 6708 9872 gene locus_tag LOCUS_07570 gene ileS 6708 9872 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986028.1 protein_id gnl|my_center|LOCUS_07570 >Feature sequence050 2367 628 gene locus_tag LOCUS_07580 2367 628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07580 3160 2393 gene locus_tag LOCUS_07590 3160 2393 CDS product energy-coupling factor transporter transmembrane component T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014635952.1 protein_id gnl|my_center|LOCUS_07590 3796 3194 gene locus_tag LOCUS_07600 3796 3194 CDS product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011922270.1 protein_id gnl|my_center|LOCUS_07600 4547 3810 gene locus_tag LOCUS_07610 4547 3810 CDS product nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011922794.1 protein_id gnl|my_center|LOCUS_07610 5570 4686 gene locus_tag LOCUS_07620 5570 4686 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009902199.1 protein_id gnl|my_center|LOCUS_07620 6558 5587 gene locus_tag LOCUS_07630 6558 5587 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895878.1 protein_id gnl|my_center|LOCUS_07630 8491 6551 gene locus_tag LOCUS_07640 8491 6551 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730244.1 protein_id gnl|my_center|LOCUS_07640 10110 8527 gene locus_tag LOCUS_07650 10110 8527 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454209.1 protein_id gnl|my_center|LOCUS_07650 >Feature sequence051 2946 1651 gene locus_tag LOCUS_07660 2946 1651 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392280.1 protein_id gnl|my_center|LOCUS_07660 4123 2966 gene locus_tag LOCUS_07670 4123 2966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07670 5757 4141 gene locus_tag LOCUS_07680 5757 4141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07680 4987 5086 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 6613 5777 gene locus_tag LOCUS_07690 6613 5777 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814246.1 protein_id gnl|my_center|LOCUS_07690 6634 6643 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 7582 6668 gene locus_tag LOCUS_07700 7582 6668 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814244.1 protein_id gnl|my_center|LOCUS_07700 10001 7569 gene locus_tag LOCUS_07710 10001 7569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07710 10097 10324 gene locus_tag LOCUS_07720 10097 10324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07720 >Feature sequence052 172 1776 gene locus_tag LOCUS_07730 gene pckA 172 1776 CDS product phosphoenolpyruvate carboxykinase (ATP) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761973.1 protein_id gnl|my_center|LOCUS_07730 1874 3163 gene locus_tag LOCUS_07740 1874 3163 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986630.1 protein_id gnl|my_center|LOCUS_07740 3834 3229 gene locus_tag LOCUS_07750 gene thrH 3834 3229 CDS product bifunctional phosphoserine phosphatase/homoserine phosphotransferase ThrH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002116438.1 protein_id gnl|my_center|LOCUS_07750 4825 3974 gene locus_tag LOCUS_07760 4825 3974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07760 6338 5001 gene locus_tag LOCUS_07770 6338 5001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07770 6676 7347 gene locus_tag LOCUS_07780 6676 7347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07780 7379 7478 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 9533 7524 gene locus_tag LOCUS_07790 9533 7524 CDS product FtsX-like permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459160.1 protein_id gnl|my_center|LOCUS_07790 10293 9523 gene locus_tag LOCUS_07800 10293 9523 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002899832.1 protein_id gnl|my_center|LOCUS_07800 >Feature sequence053 3719 1104 gene locus_tag LOCUS_07810 gene gyrA 3719 1104 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429305.1 protein_id gnl|my_center|LOCUS_07810 5791 3869 gene locus_tag LOCUS_07820 gene gyrB 5791 3869 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963335.1 protein_id gnl|my_center|LOCUS_07820 6925 5834 gene locus_tag LOCUS_07830 gene recF 6925 5834 CDS product DNA replication/repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359456.1 protein_id gnl|my_center|LOCUS_07830 7137 6922 gene locus_tag LOCUS_07840 7137 6922 CDS product RNA-binding S4 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071954.1 protein_id gnl|my_center|LOCUS_07840 8263 7151 gene locus_tag LOCUS_07850 gene dnaN 8263 7151 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963331.1 protein_id gnl|my_center|LOCUS_07850 9954 8599 gene locus_tag LOCUS_07860 gene dnaA 9954 8599 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947895.1 protein_id gnl|my_center|LOCUS_07860 >Feature sequence054 4341 5255 gene locus_tag LOCUS_07870 4341 5255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07870 5553 6794 gene locus_tag LOCUS_07880 5553 6794 CDS product BMP family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938366.1 protein_id gnl|my_center|LOCUS_07880 6922 8454 gene locus_tag LOCUS_07890 6922 8454 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393450.1 protein_id gnl|my_center|LOCUS_07890 8447 9553 gene locus_tag LOCUS_07900 8447 9553 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393449.1 protein_id gnl|my_center|LOCUS_07900 >Feature sequence055 50 808 gene locus_tag LOCUS_07910 50 808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07910 1212 2120 gene locus_tag LOCUS_07920 1212 2120 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964364.1 protein_id gnl|my_center|LOCUS_07920 2260 3534 gene locus_tag LOCUS_07930 2260 3534 CDS product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000433394.1 protein_id gnl|my_center|LOCUS_07930 3699 4301 gene locus_tag LOCUS_07940 3699 4301 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703622.1 protein_id gnl|my_center|LOCUS_07940 4298 4942 gene locus_tag LOCUS_07950 4298 4942 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703621.1 protein_id gnl|my_center|LOCUS_07950 5144 6409 gene locus_tag LOCUS_07960 5144 6409 CDS product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000433394.1 protein_id gnl|my_center|LOCUS_07960 6511 7410 gene locus_tag LOCUS_07970 gene ttdA 6511 7410 CDS product L(+)-tartrate dehydratase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000045349.1 protein_id gnl|my_center|LOCUS_07970 7410 8036 gene locus_tag LOCUS_07980 gene ttdB 7410 8036 CDS product L(+)-tartrate dehydratase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000162405.1 protein_id gnl|my_center|LOCUS_07980 8247 9284 gene locus_tag LOCUS_07990 8247 9284 CDS product LD-carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289537.1 protein_id gnl|my_center|LOCUS_07990 9906 9349 gene locus_tag LOCUS_08000 9906 9349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08000 >Feature sequence056 441 223 gene locus_tag LOCUS_08010 441 223 CDS product ferrous iron transport protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003360987.1 protein_id gnl|my_center|LOCUS_08010 742 530 gene locus_tag LOCUS_08020 742 530 CDS product FeoA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003360986.1 protein_id gnl|my_center|LOCUS_08020 3886 1001 gene locus_tag LOCUS_08030 3886 1001 CDS product glycoside hydrolase family 3 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012028020.1 protein_id gnl|my_center|LOCUS_08030 3931 3940 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 5656 4100 gene locus_tag LOCUS_08040 5656 4100 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000416108.1 protein_id gnl|my_center|LOCUS_08040 7540 5690 gene locus_tag LOCUS_08050 7540 5690 CDS product glycoside hydrolase family 2 TIM barrel-domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107432.1 protein_id gnl|my_center|LOCUS_08050 9101 7836 gene locus_tag LOCUS_08060 9101 7836 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775459.1 protein_id gnl|my_center|LOCUS_08060 9808 9104 gene locus_tag LOCUS_08070 9808 9104 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895627.1 protein_id gnl|my_center|LOCUS_08070 >Feature sequence057 20 1036 gene locus_tag LOCUS_08080 gene gap 20 1036 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003025408.1 protein_id gnl|my_center|LOCUS_08080 1414 2625 gene locus_tag LOCUS_08090 1414 2625 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964029.1 protein_id gnl|my_center|LOCUS_08090 2849 3598 gene locus_tag LOCUS_08100 gene tpiA 2849 3598 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700616.1 protein_id gnl|my_center|LOCUS_08100 3754 4101 gene locus_tag LOCUS_08110 3754 4101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08110 4711 4076 gene locus_tag LOCUS_08120 4711 4076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08120 4662 5144 gene locus_tag LOCUS_08130 4662 5144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08130 5119 5394 gene locus_tag LOCUS_08140 5119 5394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08140 5432 6715 gene locus_tag LOCUS_08150 5432 6715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08150 6906 7382 gene locus_tag LOCUS_08160 6906 7382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08160 7431 8993 gene locus_tag LOCUS_08170 7431 8993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08170 >Feature sequence058 80 310 gene locus_tag LOCUS_08180 80 310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08180 1589 408 gene locus_tag LOCUS_08190 gene thiI 1589 408 CDS product tRNA 4-thiouridine(8) synthase ThiI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860948.1 protein_id gnl|my_center|LOCUS_08190 2833 1643 gene locus_tag LOCUS_08200 2833 1643 CDS product cysteine desulfurase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966255.1 protein_id gnl|my_center|LOCUS_08200 3662 2868 gene locus_tag LOCUS_08210 3662 2868 CDS product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430913.1 protein_id gnl|my_center|LOCUS_08210 4615 3632 gene locus_tag LOCUS_08220 gene prmA 4615 3632 CDS product 50S ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003385115.1 protein_id gnl|my_center|LOCUS_08220 7577 4713 gene locus_tag LOCUS_08230 7577 4713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08230 8478 7717 gene locus_tag LOCUS_08240 8478 7717 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002943067.1 protein_id gnl|my_center|LOCUS_08240 <9966 8468 gene locus_tag LOCUS_08250 <9966 8468 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005903444.1:amino acid ABC transporter permease >Feature sequence059 431 859 gene locus_tag LOCUS_08260 431 859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08260 814 3081 gene locus_tag LOCUS_08270 gene mrfA 814 3081 CDS product ATP-dependent helicase MrfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246149.1 note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_08270 3078 3698 gene locus_tag LOCUS_08280 3078 3698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08280 3688 5913 gene locus_tag LOCUS_08290 gene pcrA 3688 5913 CDS product DNA helicase PcrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674369.1 protein_id gnl|my_center|LOCUS_08290 6091 7275 gene locus_tag LOCUS_08300 gene nifS 6091 7275 CDS product cysteine desulfurase NifS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861166.1 protein_id gnl|my_center|LOCUS_08300 7346 7789 gene locus_tag LOCUS_08310 gene nifU 7346 7789 CDS product Fe-S cluster assembly scaffold protein NifU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438275.1 protein_id gnl|my_center|LOCUS_08310 7974 8612 gene locus_tag LOCUS_08320 7974 8612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08320 8628 9791 gene locus_tag LOCUS_08330 8628 9791 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426667.1 protein_id gnl|my_center|LOCUS_08330 >Feature sequence060 3039 1291 gene locus_tag LOCUS_08340 3039 1291 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966684.1 protein_id gnl|my_center|LOCUS_08340 3161 3658 gene locus_tag LOCUS_08350 3161 3658 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007055872.1 protein_id gnl|my_center|LOCUS_08350 3935 6097 gene locus_tag LOCUS_08360 gene nrdD 3935 6097 CDS product anaerobic ribonucleoside-triphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095357.1 protein_id gnl|my_center|LOCUS_08360 6185 6703 gene locus_tag LOCUS_08370 gene nrdG 6185 6703 CDS product anaerobic ribonucleoside-triphosphate reductase activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905258.1 protein_id gnl|my_center|LOCUS_08370 6781 7032 gene locus_tag LOCUS_08380 6781 7032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08380 7043 8134 gene locus_tag LOCUS_08390 7043 8134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08390 8323 8195 gene locus_tag LOCUS_08400 8323 8195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08400 8525 9277 gene locus_tag LOCUS_08410 8525 9277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08410 9361 9495 gene locus_tag LOCUS_08420 9361 9495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08420 >Feature sequence061 521 1378 gene locus_tag LOCUS_08430 521 1378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08430 1344 1353 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1375 1557 gene locus_tag LOCUS_08440 1375 1557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08440 1614 2657 gene locus_tag LOCUS_08450 gene ispG 1614 2657 CDS product flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965103.1 protein_id gnl|my_center|LOCUS_08450 2660 7198 gene locus_tag LOCUS_08460 gene polC 2660 7198 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966712.1 protein_id gnl|my_center|LOCUS_08460 8306 7302 gene locus_tag LOCUS_08470 8306 7302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08470 8447 9598 gene locus_tag LOCUS_08480 gene pheA 8447 9598 CDS product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861347.1 protein_id gnl|my_center|LOCUS_08480 >Feature sequence062 269 108 gene locus_tag LOCUS_08490 269 108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08490 977 276 gene locus_tag LOCUS_08500 977 276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08500 2236 992 gene locus_tag LOCUS_08510 gene hemW 2236 992 CDS product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012099423.1 protein_id gnl|my_center|LOCUS_08510 4052 2241 gene locus_tag LOCUS_08520 gene lepA 4052 2241 CDS product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416556.1 protein_id gnl|my_center|LOCUS_08520 5779 4190 gene locus_tag LOCUS_08530 5779 4190 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000074814.1 protein_id gnl|my_center|LOCUS_08530 6714 5821 gene locus_tag LOCUS_08540 6714 5821 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867268.1 protein_id gnl|my_center|LOCUS_08540 7691 6729 gene locus_tag LOCUS_08550 7691 6729 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836213.1 protein_id gnl|my_center|LOCUS_08550 9320 7746 gene locus_tag LOCUS_08560 9320 7746 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017097.1 protein_id gnl|my_center|LOCUS_08560 >Feature sequence063 <1 506 gene locus_tag LOCUS_08570 <1 506 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011461074.1:ABC transporter permease 506 1336 gene locus_tag LOCUS_08580 506 1336 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808997.1 protein_id gnl|my_center|LOCUS_08580 1552 2433 gene locus_tag LOCUS_08590 1552 2433 CDS product sulfide/dihydroorotate dehydrogenase-like FAD/NAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009896496.1 protein_id gnl|my_center|LOCUS_08590 2500 3885 gene locus_tag LOCUS_08600 gene gltA 2500 3885 CDS product NADPH-dependent glutamate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986285.1 protein_id gnl|my_center|LOCUS_08600 4071 5156 gene locus_tag LOCUS_08610 4071 5156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08610 5239 5520 gene locus_tag LOCUS_08620 5239 5520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08620 5504 5513 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 5568 7613 gene locus_tag LOCUS_08630 5568 7613 CDS product cation-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002297196.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08630 8959 7610 gene locus_tag LOCUS_08640 8959 7610 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289277.1 protein_id gnl|my_center|LOCUS_08640 >Feature sequence064 1341 127 gene locus_tag LOCUS_08650 1341 127 CDS product LL-diaminopimelate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765060.1 protein_id gnl|my_center|LOCUS_08650 2148 1600 gene locus_tag LOCUS_08660 2148 1600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08660 3499 2168 gene locus_tag LOCUS_08670 gene glnA 3499 2168 CDS product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392808.1 protein_id gnl|my_center|LOCUS_08670 4312 3536 gene locus_tag LOCUS_08680 4312 3536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08680 4491 4270 gene locus_tag LOCUS_08690 4491 4270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08690 4677 6131 gene locus_tag LOCUS_08700 gene guaB 4677 6131 CDS product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965988.1 protein_id gnl|my_center|LOCUS_08700 6175 6600 gene locus_tag LOCUS_08710 6175 6600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08710 6505 6514 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 6563 7429 gene locus_tag LOCUS_08720 6563 7429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08720 8016 7426 gene locus_tag LOCUS_08730 8016 7426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08730 8473 8003 gene locus_tag LOCUS_08740 8473 8003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08740 8658 8449 gene locus_tag LOCUS_08750 8658 8449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08750 9151 8702 gene locus_tag LOCUS_08760 9151 8702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08760 >Feature sequence065 863 1756 gene locus_tag LOCUS_08770 863 1756 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966516.1 protein_id gnl|my_center|LOCUS_08770 2800 2899 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2909 3979 gene locus_tag LOCUS_08780 2909 3979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08780 4060 4914 gene locus_tag LOCUS_08790 4060 4914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08790 5013 7319 gene locus_tag LOCUS_08800 5013 7319 CDS product bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422921.1 protein_id gnl|my_center|LOCUS_08800 7366 7995 gene locus_tag LOCUS_08810 7366 7995 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000871236.1 protein_id gnl|my_center|LOCUS_08810 8120 8219 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 8241 9629 gene locus_tag LOCUS_08820 8241 9629 CDS product coproporphyrinogen III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021361993.1 protein_id gnl|my_center|LOCUS_08820 >Feature sequence066 <1 683 gene locus_tag LOCUS_08830 <1 683 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005812388.1:NADP-dependent isocitrate dehydrogenase 680 2611 gene locus_tag LOCUS_08840 680 2611 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966001.1 protein_id gnl|my_center|LOCUS_08840 2767 3408 gene locus_tag LOCUS_08850 2767 3408 CDS product redox-sensing transcriptional repressor Rex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420839.1 protein_id gnl|my_center|LOCUS_08850 3495 4994 gene locus_tag LOCUS_08860 3495 4994 CDS product NAD(P)H-hydrate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164924808.1 protein_id gnl|my_center|LOCUS_08860 5031 6203 gene locus_tag LOCUS_08870 gene alr 5031 6203 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071542276.1 protein_id gnl|my_center|LOCUS_08870 6313 6660 gene locus_tag LOCUS_08880 gene ndoA 6313 6660 CDS product type II toxin-antitoxin system endoribonuclease NdoA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000635963.1 protein_id gnl|my_center|LOCUS_08880 6735 7508 gene locus_tag LOCUS_08890 6735 7508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08890 7492 7501 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 7525 7767 gene locus_tag LOCUS_08900 7525 7767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08900 7861 8589 gene locus_tag LOCUS_08910 7861 8589 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048090.1 protein_id gnl|my_center|LOCUS_08910 >Feature sequence067 305 1204 gene locus_tag LOCUS_08920 gene argB 305 1204 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002864194.1 protein_id gnl|my_center|LOCUS_08920 1197 2381 gene locus_tag LOCUS_08930 1197 2381 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002864195.1 protein_id gnl|my_center|LOCUS_08930 2381 3568 gene locus_tag LOCUS_08940 2381 3568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08940 3695 4270 gene locus_tag LOCUS_08950 gene comEA 3695 4270 CDS product competence protein ComEA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398514.1 protein_id gnl|my_center|LOCUS_08950 4273 4965 gene locus_tag LOCUS_08960 gene yycF 4273 4965 CDS product response regulator YycF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003658889.1 protein_id gnl|my_center|LOCUS_08960 4981 6423 gene locus_tag LOCUS_08970 4981 6423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08970 6468 7427 gene locus_tag LOCUS_08980 6468 7427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08980 >Feature sequence068 1 186 gene locus_tag LOCUS_08990 1 186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08990 223 1269 gene locus_tag LOCUS_09000 gene siaP 223 1269 CDS product sialic acid TRAP transporter substrate-binding protein SiaP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694430.1 protein_id gnl|my_center|LOCUS_09000 1460 2272 gene locus_tag LOCUS_09010 1460 2272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09010 2312 4408 gene locus_tag LOCUS_09020 2312 4408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09020 4467 5000 gene locus_tag LOCUS_09030 4467 5000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09030 4981 5199 gene locus_tag LOCUS_09040 4981 5199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09040 5129 5746 gene locus_tag LOCUS_09050 5129 5746 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968046.1 protein_id gnl|my_center|LOCUS_09050 6018 6027 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 6079 6831 gene locus_tag LOCUS_09060 6079 6831 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357673.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09060 6875 7186 gene locus_tag LOCUS_09070 gene trxA 6875 7186 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830148.1 protein_id gnl|my_center|LOCUS_09070 7233 7661 gene locus_tag LOCUS_09080 gene ohrR 7233 7661 CDS product organic hydroperoxide resistance transcriptional regulator OhrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245653.1 protein_id gnl|my_center|LOCUS_09080 7778 8818 gene locus_tag LOCUS_09090 7778 8818 CDS product galactose mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201945.1 protein_id gnl|my_center|LOCUS_09090 9204 9353 gene locus_tag LOCUS_09100 9204 9353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09100 >Feature sequence069 1282 2289 gene locus_tag LOCUS_09110 gene fliG 1282 2289 CDS product flagellar motor switch protein FliG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231981.1 protein_id gnl|my_center|LOCUS_09110 2282 3073 gene locus_tag LOCUS_09120 gene fliH 2282 3073 CDS product flagellar assembly protein FliH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002668471.1 protein_id gnl|my_center|LOCUS_09120 3086 4396 gene locus_tag LOCUS_09130 gene fliI 3086 4396 CDS product flagellar protein export ATPase FliI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082899.1 protein_id gnl|my_center|LOCUS_09130 4410 4865 gene locus_tag LOCUS_09140 4410 4865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09140 4894 5757 gene locus_tag LOCUS_09150 4894 5757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09150 5837 7318 gene locus_tag LOCUS_09160 5837 7318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09160 7341 8405 gene locus_tag LOCUS_09170 7341 8405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09170 8132 8231 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 8398 8796 gene locus_tag LOCUS_09180 8398 8796 CDS product TIGR02530 family flagellar biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392299.1 protein_id gnl|my_center|LOCUS_09180 >Feature sequence070 746 336 gene locus_tag LOCUS_09190 746 336 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837640.1 protein_id gnl|my_center|LOCUS_09190 1463 993 gene locus_tag LOCUS_09200 1463 993 CDS product LURP-one-related family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002261892.1 protein_id gnl|my_center|LOCUS_09200 1525 1534 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3044 1560 gene locus_tag LOCUS_09210 3044 1560 CDS product C69 family dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009994262.1 protein_id gnl|my_center|LOCUS_09210 3413 3129 gene locus_tag LOCUS_09220 3413 3129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09220 3949 3467 gene locus_tag LOCUS_09230 3949 3467 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003385459.1 protein_id gnl|my_center|LOCUS_09230 4936 4019 gene locus_tag LOCUS_09240 4936 4019 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146572.1 protein_id gnl|my_center|LOCUS_09240 6930 4966 gene locus_tag LOCUS_09250 6930 4966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09250 8096 6954 gene locus_tag LOCUS_09260 8096 6954 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759897.1 protein_id gnl|my_center|LOCUS_09260 8810 8256 gene locus_tag LOCUS_09270 8810 8256 CDS product Fe-S-containing hydro-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012099538.1 protein_id gnl|my_center|LOCUS_09270 >Feature sequence071 329 72 gene locus_tag LOCUS_09280 329 72 CDS product TIGR03905 family TSCPD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788104.1 protein_id gnl|my_center|LOCUS_09280 994 452 gene locus_tag LOCUS_09290 994 452 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812610.1 protein_id gnl|my_center|LOCUS_09290 1358 3931 gene locus_tag LOCUS_09300 gene secA 1358 3931 CDS product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947996.1 protein_id gnl|my_center|LOCUS_09300 4154 6148 gene locus_tag LOCUS_09310 gene uvrB 4154 6148 CDS product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009891935.1 protein_id gnl|my_center|LOCUS_09310 6197 9037 gene locus_tag LOCUS_09320 gene uvrA 6197 9037 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401468.1 protein_id gnl|my_center|LOCUS_09320 >Feature sequence072 123 635 gene locus_tag LOCUS_09330 123 635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09330 1138 695 gene locus_tag LOCUS_09340 1138 695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09340 1371 1940 gene locus_tag LOCUS_09350 1371 1940 CDS product DJ-1/PfpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760842.1 protein_id gnl|my_center|LOCUS_09350 2323 2108 gene locus_tag LOCUS_09360 2323 2108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09360 2886 4607 gene locus_tag LOCUS_09370 2886 4607 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582943.1 protein_id gnl|my_center|LOCUS_09370 4720 6510 gene locus_tag LOCUS_09380 4720 6510 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582944.1 protein_id gnl|my_center|LOCUS_09380 6540 7103 gene locus_tag LOCUS_09390 6540 7103 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008634004.1 protein_id gnl|my_center|LOCUS_09390 7100 7834 gene locus_tag LOCUS_09400 7100 7834 CDS product carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680712.1 protein_id gnl|my_center|LOCUS_09400 8012 9157 gene locus_tag LOCUS_09410 gene fucO 8012 9157 CDS product lactaldehyde reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288246.1 protein_id gnl|my_center|LOCUS_09410 >Feature sequence073 <1 836 gene locus_tag LOCUS_09420 <1 836 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005176203.1:dTDP-4-amino-4,6-dideoxygalactose transaminase 836 1762 gene locus_tag LOCUS_09430 836 1762 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963518.1 protein_id gnl|my_center|LOCUS_09430 1769 2782 gene locus_tag LOCUS_09440 1769 2782 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005113113.1 protein_id gnl|my_center|LOCUS_09440 2779 3936 gene locus_tag LOCUS_09450 2779 3936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09450 3989 4279 gene locus_tag LOCUS_09460 3989 4279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09460 4281 4628 gene locus_tag LOCUS_09470 4281 4628 CDS product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001089868.1 protein_id gnl|my_center|LOCUS_09470 4679 5935 gene locus_tag LOCUS_09480 4679 5935 CDS product nucleotide sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288208.1 protein_id gnl|my_center|LOCUS_09480 5972 6916 gene locus_tag LOCUS_09490 5972 6916 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203586.1 protein_id gnl|my_center|LOCUS_09490 8586 7210 gene locus_tag LOCUS_09500 8586 7210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09500 9136 8498 gene locus_tag LOCUS_09510 9136 8498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09510 >Feature sequence074 3066 1249 gene locus_tag LOCUS_09520 3066 1249 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272760.1 protein_id gnl|my_center|LOCUS_09520 4727 3063 gene locus_tag LOCUS_09530 4727 3063 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357899.1 protein_id gnl|my_center|LOCUS_09530 5788 4952 gene locus_tag LOCUS_09540 5788 4952 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287754.1 protein_id gnl|my_center|LOCUS_09540 6774 5800 gene locus_tag LOCUS_09550 6774 5800 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227020.1 protein_id gnl|my_center|LOCUS_09550 8303 6903 gene locus_tag LOCUS_09560 8303 6903 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_067851071.1 protein_id gnl|my_center|LOCUS_09560 8894 8613 gene locus_tag LOCUS_09570 8894 8613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09570 8917 8926 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence075 221 230 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 409 248 gene locus_tag LOCUS_09580 409 248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09580 372 587 gene locus_tag LOCUS_09590 372 587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09590 819 589 gene locus_tag LOCUS_09600 819 589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09600 1252 1509 gene locus_tag LOCUS_09610 1252 1509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09610 4164 2806 gene locus_tag LOCUS_09620 gene gdhA 4164 2806 CDS product NADP-specific glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476262.1 protein_id gnl|my_center|LOCUS_09620 4966 4514 gene locus_tag LOCUS_09630 4966 4514 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072119.1 protein_id gnl|my_center|LOCUS_09630 5968 5003 gene locus_tag LOCUS_09640 5968 5003 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966841.1 protein_id gnl|my_center|LOCUS_09640 6077 5910 gene locus_tag LOCUS_09650 6077 5910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09650 7812 6040 gene locus_tag LOCUS_09660 7812 6040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09660 8288 7860 gene locus_tag LOCUS_09670 gene fabZ 8288 7860 CDS product 3-hydroxyacyl-ACP dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000447678.1 protein_id gnl|my_center|LOCUS_09670 9156 8299 gene locus_tag LOCUS_09680 9156 8299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09680 >Feature sequence076 989 726 gene locus_tag LOCUS_09690 989 726 CDS product HPr family phosphocarrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000949584.1 protein_id gnl|my_center|LOCUS_09690 2432 1083 gene locus_tag LOCUS_09700 gene glmM 2432 1083 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963806.1 protein_id gnl|my_center|LOCUS_09700 3812 2478 gene locus_tag LOCUS_09710 3812 2478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09710 4680 3778 gene locus_tag LOCUS_09720 gene cdaA 4680 3778 CDS product diadenylate cyclase CdaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420697.1 protein_id gnl|my_center|LOCUS_09720 5697 4696 gene locus_tag LOCUS_09730 5697 4696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09730 6183 5758 gene locus_tag LOCUS_09740 6183 5758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09740 6844 6437 gene locus_tag LOCUS_09750 6844 6437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09750 7567 6857 gene locus_tag LOCUS_09760 7567 6857 CDS product ComF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006995131.1 protein_id gnl|my_center|LOCUS_09760 7811 8854 gene locus_tag LOCUS_09770 7811 8854 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856994.1 protein_id gnl|my_center|LOCUS_09770 >Feature sequence077 1892 57 gene locus_tag LOCUS_09780 1892 57 CDS product ATP-dependent helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860946.1 protein_id gnl|my_center|LOCUS_09780 3357 1903 gene locus_tag LOCUS_09790 gene gltX 3357 1903 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964308.1 protein_id gnl|my_center|LOCUS_09790 3682 3518 gene locus_tag LOCUS_09800 3682 3518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09800 5688 3682 gene locus_tag LOCUS_09810 gene feoB 5688 3682 CDS product ferrous iron transport protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810412.1 protein_id gnl|my_center|LOCUS_09810 5921 5685 gene locus_tag LOCUS_09820 5921 5685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09820 6181 6390 gene locus_tag LOCUS_09830 6181 6390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09830 6387 6659 gene locus_tag LOCUS_09840 6387 6659 CDS product spore coat protein CotJB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454698.1 protein_id gnl|my_center|LOCUS_09840 6659 7273 gene locus_tag LOCUS_09850 6659 7273 CDS product manganese catalase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964647.1 protein_id gnl|my_center|LOCUS_09850 7407 7416 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 9013 7451 gene locus_tag LOCUS_09860 9013 7451 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003425090.1 protein_id gnl|my_center|LOCUS_09860 >Feature sequence078 <1 614 gene locus_tag LOCUS_09870 <1 614 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010964931.1:lactate utilization protein 1624 740 gene locus_tag LOCUS_09880 gene aguB 1624 740 CDS product N-carbamoylputrescine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001246756.1 protein_id gnl|my_center|LOCUS_09880 2808 1753 gene locus_tag LOCUS_09890 gene aguA 2808 1753 CDS product agmatine deiminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000969442.1 protein_id gnl|my_center|LOCUS_09890 4071 2938 gene locus_tag LOCUS_09900 gene nspC 4071 2938 CDS product carboxynorspermidine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000764364.1 protein_id gnl|my_center|LOCUS_09900 5450 4191 gene locus_tag LOCUS_09910 5450 4191 CDS product saccharopine dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000088780.1 protein_id gnl|my_center|LOCUS_09910 6443 5586 gene locus_tag LOCUS_09920 gene speE 6443 5586 CDS product polyamine aminopropyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000366713.1 protein_id gnl|my_center|LOCUS_09920 7951 6503 gene locus_tag LOCUS_09930 7951 6503 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000661024.1 protein_id gnl|my_center|LOCUS_09930 8756 8580 gene locus_tag LOCUS_09940 gene rpsU 8756 8580 CDS product 30S ribosomal protein S21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964600.1 protein_id gnl|my_center|LOCUS_09940 >Feature sequence079 2054 1233 gene locus_tag LOCUS_09950 2054 1233 CDS product BtpA/SgcQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728824.1 protein_id gnl|my_center|LOCUS_09950 2905 2069 gene locus_tag LOCUS_09960 gene frlC 2905 2069 CDS product fructoselysine 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000847821.1 protein_id gnl|my_center|LOCUS_09960 3771 2935 gene locus_tag LOCUS_09970 3771 2935 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970333.1 protein_id gnl|my_center|LOCUS_09970 5247 3880 gene locus_tag LOCUS_09980 5247 3880 CDS product sodium/glutamate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454913.1 protein_id gnl|my_center|LOCUS_09980 5689 5279 gene locus_tag LOCUS_09990 5689 5279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966763.1 protein_id gnl|my_center|LOCUS_09990 7058 6081 gene locus_tag LOCUS_10000 7058 6081 CDS product SIS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288613.1 protein_id gnl|my_center|LOCUS_10000 7955 7098 gene locus_tag LOCUS_10010 7955 7098 CDS product fructoselysine 6-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966764.1 protein_id gnl|my_center|LOCUS_10010 8949 8215 gene locus_tag LOCUS_10020 8949 8215 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028020226.1 protein_id gnl|my_center|LOCUS_10020 >Feature sequence080 506 688 gene locus_tag LOCUS_10030 506 688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10030 1434 964 gene locus_tag LOCUS_10040 1434 964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10040 2021 1686 gene locus_tag LOCUS_10050 2021 1686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10050 2487 2071 gene locus_tag LOCUS_10060 2487 2071 CDS product YjdF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047705.1 protein_id gnl|my_center|LOCUS_10060 3018 2704 gene locus_tag LOCUS_10070 3018 2704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10070 4402 3032 gene locus_tag LOCUS_10080 gene mobV 4402 3032 CDS product MobV family relaxase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000122833.1 protein_id gnl|my_center|LOCUS_10080 4757 4551 gene locus_tag LOCUS_10090 4757 4551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10090 5112 4885 gene locus_tag LOCUS_10100 5112 4885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10100 5864 5079 gene locus_tag LOCUS_10110 5864 5079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10110 5127 5136 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 6342 5965 gene locus_tag LOCUS_10120 6342 5965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10120 7424 6339 gene locus_tag LOCUS_10130 7424 6339 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047593.1 protein_id gnl|my_center|LOCUS_10130 7628 7440 gene locus_tag LOCUS_10140 7628 7440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003395994.1 protein_id gnl|my_center|LOCUS_10140 7865 8131 gene locus_tag LOCUS_10150 7865 8131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_10150 8138 8296 gene locus_tag LOCUS_10160 8138 8296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10160 8318 8896 gene locus_tag LOCUS_10170 8318 8896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10170 >Feature sequence081 559 53 gene locus_tag LOCUS_10180 559 53 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10180 777 956 gene locus_tag LOCUS_10190 777 956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000977378.1 protein_id gnl|my_center|LOCUS_10190 977 1984 gene locus_tag LOCUS_10200 977 1984 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047593.1 protein_id gnl|my_center|LOCUS_10200 2109 2384 gene locus_tag LOCUS_10210 2109 2384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10210 2381 3511 gene locus_tag LOCUS_10220 2381 3511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10220 3612 3845 gene locus_tag LOCUS_10230 3612 3845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10230 3920 4195 gene locus_tag LOCUS_10240 3920 4195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10240 4304 5617 gene locus_tag LOCUS_10250 gene mobV 4304 5617 CDS product MobV family relaxase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000122833.1 protein_id gnl|my_center|LOCUS_10250 5799 8477 gene locus_tag LOCUS_10260 5799 8477 CDS product DUF4116 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389523.1 protein_id gnl|my_center|LOCUS_10260 >Feature sequence082 187 672 gene locus_tag LOCUS_10270 187 672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10270 618 627 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 665 1306 gene locus_tag LOCUS_10280 665 1306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10280 1390 3066 gene locus_tag LOCUS_10290 gene ilvD 1390 3066 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393742.1 protein_id gnl|my_center|LOCUS_10290 3152 4840 gene locus_tag LOCUS_10300 gene ilvB 3152 4840 CDS product biosynthetic-type acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966446.1 protein_id gnl|my_center|LOCUS_10300 4840 5928 gene locus_tag LOCUS_10310 gene serC 4840 5928 CDS product 3-phosphoserine/phosphohydroxythreonine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462039.1 protein_id gnl|my_center|LOCUS_10310 5928 6281 gene locus_tag LOCUS_10320 5928 6281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10320 6235 7104 gene locus_tag LOCUS_10330 6235 7104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10330 6252 6261 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 7121 8011 gene locus_tag LOCUS_10340 gene mscS 7121 8011 CDS product small-conductance mechanosensitive channel MscS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482477.1 protein_id gnl|my_center|LOCUS_10340 7918 7927 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 8119 8322 gene locus_tag LOCUS_10350 8119 8322 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925387.1 protein_id gnl|my_center|LOCUS_10350 >Feature sequence083 807 124 gene locus_tag LOCUS_10360 807 124 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113853.1 protein_id gnl|my_center|LOCUS_10360 1798 860 gene locus_tag LOCUS_10370 1798 860 CDS product ROK family glucokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965901.1 protein_id gnl|my_center|LOCUS_10370 3620 1983 gene locus_tag LOCUS_10380 3620 1983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10380 4129 3557 gene locus_tag LOCUS_10390 4129 3557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10390 3685 3694 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 5252 4266 gene locus_tag LOCUS_10400 5252 4266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10400 6006 5401 gene locus_tag LOCUS_10410 6006 5401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10410 6140 6239 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 7960 6902 gene locus_tag LOCUS_10420 7960 6902 CDS product DNA repair exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545188.1 protein_id gnl|my_center|LOCUS_10420 8546 7998 gene locus_tag LOCUS_10430 gene spoVT 8546 7998 CDS product stage V sporulation protein T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966490.1 protein_id gnl|my_center|LOCUS_10430 >Feature sequence084 998 114 gene locus_tag LOCUS_10440 998 114 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435316.1 protein_id gnl|my_center|LOCUS_10440 1372 1716 gene locus_tag LOCUS_10450 1372 1716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10450 1672 1681 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1713 5156 gene locus_tag LOCUS_10460 1713 5156 CDS product phosphoribosylformylglycinamidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964962.1 protein_id gnl|my_center|LOCUS_10460 5344 6771 gene locus_tag LOCUS_10470 5344 6771 CDS product TldD/PmbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963552.1 protein_id gnl|my_center|LOCUS_10470 6787 8061 gene locus_tag LOCUS_10480 6787 8061 CDS product metallopeptidase TldD-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963553.1 protein_id gnl|my_center|LOCUS_10480 8224 8373 gene locus_tag LOCUS_10490 8224 8373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10490 >Feature sequence085 1417 632 gene locus_tag LOCUS_10500 gene rfbD 1417 632 CDS product dTDP-4-dehydrorhamnose reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242585.1 protein_id gnl|my_center|LOCUS_10500 1657 1487 gene locus_tag LOCUS_10510 1657 1487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10510 2004 1606 gene locus_tag LOCUS_10520 2004 1606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10520 1677 1686 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3206 2187 gene locus_tag LOCUS_10530 3206 2187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10530 5156 3309 gene locus_tag LOCUS_10540 5156 3309 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002671827.1 protein_id gnl|my_center|LOCUS_10540 6966 5137 gene locus_tag LOCUS_10550 6966 5137 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682372.1 protein_id gnl|my_center|LOCUS_10550 7736 7074 gene locus_tag LOCUS_10560 7736 7074 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389343.1 protein_id gnl|my_center|LOCUS_10560 8484 7789 gene locus_tag LOCUS_10570 8484 7789 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680891.1 protein_id gnl|my_center|LOCUS_10570 >Feature sequence086 3335 699 gene locus_tag LOCUS_10580 gene ppdK 3335 699 CDS product pyruvate, phosphate dikinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047993.1 protein_id gnl|my_center|LOCUS_10580 4943 3546 gene locus_tag LOCUS_10590 4943 3546 CDS product glycine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966472.1 protein_id gnl|my_center|LOCUS_10590 5810 5031 gene locus_tag LOCUS_10600 5810 5031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10600 6653 5871 gene locus_tag LOCUS_10610 gene recO 6653 5871 CDS product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230055.1 protein_id gnl|my_center|LOCUS_10610 6756 6592 gene locus_tag LOCUS_10620 6756 6592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10620 7745 6837 gene locus_tag LOCUS_10630 gene era 7745 6837 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416645.1 protein_id gnl|my_center|LOCUS_10630 <8530 7796 gene locus_tag LOCUS_10640 <8530 7796 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012048254.1:insulinase family protein >Feature sequence087 <1 525 gene locus_tag LOCUS_10650 <1 525 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011948300.1:AraC family transcriptional regulator 2242 587 gene locus_tag LOCUS_10660 2242 587 CDS product putative manganese-dependent inorganic diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047904.1 protein_id gnl|my_center|LOCUS_10660 3121 2258 gene locus_tag LOCUS_10670 3121 2258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10670 4829 3357 gene locus_tag LOCUS_10680 gene nagE 4829 3357 CDS product N-acetylglucosamine-specific PTS transporter subunit IIBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705424.1 protein_id gnl|my_center|LOCUS_10680 5412 4930 gene locus_tag LOCUS_10690 5412 4930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10690 6278 5445 gene locus_tag LOCUS_10700 6278 5445 CDS product PRD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948570.1 protein_id gnl|my_center|LOCUS_10700 6821 6564 gene locus_tag LOCUS_10710 6821 6564 CDS product HPr family phosphocarrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051543.1 protein_id gnl|my_center|LOCUS_10710 8461 6842 gene locus_tag LOCUS_10720 gene ptsP 8461 6842 CDS product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051542.1 protein_id gnl|my_center|LOCUS_10720 >Feature sequence088 191 862 gene locus_tag LOCUS_10730 191 862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10730 3432 931 gene locus_tag LOCUS_10740 3432 931 CDS product PBP1A family penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393212.1 protein_id gnl|my_center|LOCUS_10740 2263 2362 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3670 4320 gene locus_tag LOCUS_10750 3670 4320 CDS product YigZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357285.1 protein_id gnl|my_center|LOCUS_10750 4387 4459 gene locus_tag LOCUS_t00070 4387 4459 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 4613 5326 gene locus_tag LOCUS_10760 4613 5326 CDS product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393691.1 protein_id gnl|my_center|LOCUS_10760 5298 6167 gene locus_tag LOCUS_10770 5298 6167 CDS product S1-like domain-containing RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986367.1 protein_id gnl|my_center|LOCUS_10770 6172 6546 gene locus_tag LOCUS_10780 gene ridA 6172 6546 CDS product 2-iminobutanoate/2-iminopropanoate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704212.1 protein_id gnl|my_center|LOCUS_10780 6751 7962 gene locus_tag LOCUS_10790 6751 7962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10790 >Feature sequence089 1409 69 gene locus_tag LOCUS_10800 1409 69 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10800 430 439 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1891 2694 gene locus_tag LOCUS_10810 1891 2694 CDS product short-chain-enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965999.1 protein_id gnl|my_center|LOCUS_10810 4244 2901 gene locus_tag LOCUS_10820 gene vcrM 4244 2901 CDS product sodium-coupled multidrug efflux MATE transporter VcrM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000981941.1 protein_id gnl|my_center|LOCUS_10820 5142 4246 gene locus_tag LOCUS_10830 5142 4246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10830 6010 5201 gene locus_tag LOCUS_10840 6010 5201 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459577.1 protein_id gnl|my_center|LOCUS_10840 6800 6048 gene locus_tag LOCUS_10850 6800 6048 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015943967.1 protein_id gnl|my_center|LOCUS_10850 7284 8291 gene locus_tag LOCUS_10860 7284 8291 CDS product D-2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938705.1 protein_id gnl|my_center|LOCUS_10860 >Feature sequence090 1217 237 gene locus_tag LOCUS_10870 1217 237 CDS product lysylphosphatidylglycerol synthase transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288347.1 protein_id gnl|my_center|LOCUS_10870 2651 1254 gene locus_tag LOCUS_10880 2651 1254 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393287.1 protein_id gnl|my_center|LOCUS_10880 4547 2970 gene locus_tag LOCUS_10890 4547 2970 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012547588.1 protein_id gnl|my_center|LOCUS_10890 4829 5788 gene locus_tag LOCUS_10900 4829 5788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10900 5921 5781 gene locus_tag LOCUS_10910 5921 5781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10910 5927 6026 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 7827 6967 gene locus_tag LOCUS_10920 7827 6967 CDS product patatin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965720.1 protein_id gnl|my_center|LOCUS_10920 8364 7879 gene locus_tag LOCUS_10930 8364 7879 CDS product NfeD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971919.1 protein_id gnl|my_center|LOCUS_10930 >Feature sequence091 243 1715 gene locus_tag LOCUS_10940 243 1715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_10940 1728 2270 gene locus_tag LOCUS_10950 1728 2270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10950 2273 4024 gene locus_tag LOCUS_10960 2273 4024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10960 4263 4763 gene locus_tag LOCUS_10970 gene ilvN 4263 4763 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496411.1 protein_id gnl|my_center|LOCUS_10970 4901 5923 gene locus_tag LOCUS_10980 gene ilvC 4901 5923 CDS product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081338.1 protein_id gnl|my_center|LOCUS_10980 6160 6942 gene locus_tag LOCUS_10990 6160 6942 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965542.1 protein_id gnl|my_center|LOCUS_10990 7001 8188 gene locus_tag LOCUS_11000 7001 8188 CDS product DUF2974 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808364.1 protein_id gnl|my_center|LOCUS_11000 >Feature sequence092 195 1613 gene locus_tag LOCUS_11010 195 1613 CDS product undecaprenyl-phosphate glucose phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461019.1 protein_id gnl|my_center|LOCUS_11010 1627 2751 gene locus_tag LOCUS_11020 1627 2751 CDS product LCP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986984.1 protein_id gnl|my_center|LOCUS_11020 2752 3786 gene locus_tag LOCUS_11030 gene rfbN 2752 3786 CDS product O antigen biosynthesis rhamnosyltransferase RfbN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000705149.1 protein_id gnl|my_center|LOCUS_11030 3779 4756 gene locus_tag LOCUS_11040 3779 4756 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905676.1 protein_id gnl|my_center|LOCUS_11040 4767 6302 gene locus_tag LOCUS_11050 4767 6302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11050 6501 8231 gene locus_tag LOCUS_11060 6501 8231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11060 >Feature sequence093 38 649 gene locus_tag LOCUS_11070 38 649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11070 1621 638 gene locus_tag LOCUS_11080 1621 638 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949019.1 protein_id gnl|my_center|LOCUS_11080 2946 1642 gene locus_tag LOCUS_11090 2946 1642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11090 3628 2921 gene locus_tag LOCUS_11100 3628 2921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11100 4405 3692 gene locus_tag LOCUS_11110 4405 3692 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001234947.1 protein_id gnl|my_center|LOCUS_11110 5397 4510 gene locus_tag LOCUS_11120 5397 4510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11120 5728 6396 gene locus_tag LOCUS_11130 5728 6396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11130 6996 6388 gene locus_tag LOCUS_11140 6996 6388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11140 7494 7009 gene locus_tag LOCUS_11150 gene coaD 7494 7009 CDS product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583503.1 protein_id gnl|my_center|LOCUS_11150 8107 7553 gene locus_tag LOCUS_11160 gene rsmD 8107 7553 CDS product 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017073.1 protein_id gnl|my_center|LOCUS_11160 >Feature sequence094 935 306 gene locus_tag LOCUS_11170 935 306 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018305518.1 protein_id gnl|my_center|LOCUS_11170 1489 1334 gene locus_tag LOCUS_11180 1489 1334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_11180 3088 1598 gene locus_tag LOCUS_11190 3088 1598 CDS product energy-coupling factor ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462215.1 protein_id gnl|my_center|LOCUS_11190 3837 3100 gene locus_tag LOCUS_11200 3837 3100 CDS product energy-coupling factor transporter transmembrane component T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002676089.1 protein_id gnl|my_center|LOCUS_11200 4421 3837 gene locus_tag LOCUS_11210 4421 3837 CDS product MptD family putative ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680633.1 protein_id gnl|my_center|LOCUS_11210 4614 5603 gene locus_tag LOCUS_11220 4614 5603 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986747.1 protein_id gnl|my_center|LOCUS_11220 6462 5818 gene locus_tag LOCUS_11230 6462 5818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11230 7705 6464 gene locus_tag LOCUS_11240 7705 6464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11240 8034 7654 gene locus_tag LOCUS_11250 8034 7654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11250 >Feature sequence095 1191 133 gene locus_tag LOCUS_11260 1191 133 CDS product lactonase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000782251.1 protein_id gnl|my_center|LOCUS_11260 2488 1265 gene locus_tag LOCUS_11270 2488 1265 CDS product U32 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964994.1 protein_id gnl|my_center|LOCUS_11270 3151 2510 gene locus_tag LOCUS_11280 3151 2510 CDS product O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438166.1 protein_id gnl|my_center|LOCUS_11280 3627 3154 gene locus_tag LOCUS_11290 3627 3154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11290 3980 3636 gene locus_tag LOCUS_11300 3980 3636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11300 5679 4012 gene locus_tag LOCUS_11310 5679 4012 CDS product ribonuclease J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003385808.1 protein_id gnl|my_center|LOCUS_11310 6022 5774 gene locus_tag LOCUS_11320 6022 5774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11320 5870 5879 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 6260 6003 gene locus_tag LOCUS_11330 6260 6003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11330 6760 6323 gene locus_tag LOCUS_11340 gene ruvX 6760 6323 CDS product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810863.1 protein_id gnl|my_center|LOCUS_11340 7124 6852 gene locus_tag LOCUS_11350 7124 6852 CDS product IreB family regulatory phosphoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025772973.1 protein_id gnl|my_center|LOCUS_11350 <8322 7227 gene locus_tag LOCUS_11360 <8322 7227 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010964598.1:tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase MtaB >Feature sequence096 303 1760 gene locus_tag LOCUS_11370 303 1760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11370 1750 3276 gene locus_tag LOCUS_11380 1750 3276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11380 3373 4587 gene locus_tag LOCUS_11390 3373 4587 CDS product IS256 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_072530700.1 protein_id gnl|my_center|LOCUS_11390 4735 4932 gene locus_tag LOCUS_11400 4735 4932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11400 6191 4950 gene locus_tag LOCUS_11410 gene xylA 6191 4950 CDS product xylose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082185.1 protein_id gnl|my_center|LOCUS_11410 6764 6973 gene locus_tag LOCUS_11420 6764 6973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11420 7309 7058 gene locus_tag LOCUS_11430 7309 7058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11430 7562 7816 gene locus_tag LOCUS_11440 7562 7816 CDS product IS3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476589.1 protein_id gnl|my_center|LOCUS_11440 7813 8277 gene locus_tag LOCUS_11450 7813 8277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_11450 >Feature sequence097 296 57 gene locus_tag LOCUS_11460 296 57 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11460 543 304 gene locus_tag LOCUS_11470 543 304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11470 1133 546 gene locus_tag LOCUS_11480 1133 546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11480 1578 1156 gene locus_tag LOCUS_11490 gene ssb 1578 1156 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288368.1 protein_id gnl|my_center|LOCUS_11490 1922 1575 gene locus_tag LOCUS_11500 1922 1575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11500 2374 1916 gene locus_tag LOCUS_11510 2374 1916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11510 2856 2371 gene locus_tag LOCUS_11520 2856 2371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11520 3898 2849 gene locus_tag LOCUS_11530 3898 2849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11530 4392 3913 gene locus_tag LOCUS_11540 4392 3913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11540 5722 4394 gene locus_tag LOCUS_11550 5722 4394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11550 4584 4593 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 6070 5816 gene locus_tag LOCUS_11560 6070 5816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11560 6771 6076 gene locus_tag LOCUS_11570 6771 6076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11570 6994 6761 gene locus_tag LOCUS_11580 6994 6761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11580 7185 6994 gene locus_tag LOCUS_11590 7185 6994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11590 7412 7182 gene locus_tag LOCUS_11600 7412 7182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11600 <8288 7409 gene locus_tag LOCUS_11610 <8288 7409 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011861107.1:YodL domain-containing protein >Feature sequence098 86 952 gene locus_tag LOCUS_11620 86 952 CDS product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963818.1 protein_id gnl|my_center|LOCUS_11620 1120 2328 gene locus_tag LOCUS_11630 1120 2328 CDS product UDPGP type 1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121186.1 protein_id gnl|my_center|LOCUS_11630 2659 3777 gene locus_tag LOCUS_11640 gene mglB 2659 3777 CDS product galactose/glucose ABC transporter substrate-binding protein MglB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001036947.1 protein_id gnl|my_center|LOCUS_11640 4042 5550 gene locus_tag LOCUS_11650 gene mglA 4042 5550 CDS product galactose/methyl galactoside ABC transporter ATP-binding protein MglA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000255013.1 protein_id gnl|my_center|LOCUS_11650 5568 6557 gene locus_tag LOCUS_11660 gene mglC 5568 6557 CDS product galactose/methyl galactoside ABC transporter permease MglC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001275112.1 protein_id gnl|my_center|LOCUS_11660 6654 6965 gene locus_tag LOCUS_11670 6654 6965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11670 >Feature sequence099 1945 83 gene locus_tag LOCUS_11680 1945 83 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680024.1 protein_id gnl|my_center|LOCUS_11680 2695 2117 gene locus_tag LOCUS_11690 2695 2117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_11690 3067 2705 gene locus_tag LOCUS_11700 3067 2705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_11700 3106 3624 gene locus_tag LOCUS_11710 3106 3624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11710 5251 3632 gene locus_tag LOCUS_11720 gene ptsP 5251 3632 CDS product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051542.1 protein_id gnl|my_center|LOCUS_11720 5584 5327 gene locus_tag LOCUS_11730 5584 5327 CDS product HPr family phosphocarrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051543.1 protein_id gnl|my_center|LOCUS_11730 7516 5600 gene locus_tag LOCUS_11740 7516 5600 CDS product PTS fructose transporter subunit IIABC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897443.1 protein_id gnl|my_center|LOCUS_11740 <8196 7535 gene locus_tag LOCUS_11750 <8196 7535 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011986316.1:1-phosphofructokinase >Feature sequence100 2188 632 gene locus_tag LOCUS_11760 2188 632 CDS product glycoside hydrolase family 28 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963677.1 protein_id gnl|my_center|LOCUS_11760 3156 2293 gene locus_tag LOCUS_11770 3156 2293 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_174847567.1 protein_id gnl|my_center|LOCUS_11770 4098 3157 gene locus_tag LOCUS_11780 4098 3157 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098570.1 protein_id gnl|my_center|LOCUS_11780 5020 4124 gene locus_tag LOCUS_11790 5020 4124 CDS product glycoside hydrolase family 88 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286016.1 protein_id gnl|my_center|LOCUS_11790 6371 4992 gene locus_tag LOCUS_11800 6371 4992 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005170166.1 protein_id gnl|my_center|LOCUS_11800 7376 6576 gene locus_tag LOCUS_11810 7376 6576 CDS product gluconate 5-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965895.1 protein_id gnl|my_center|LOCUS_11810 <8195 7418 gene locus_tag LOCUS_11820 <8195 7418 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008763047.1:altronate dehydratase family protein >Feature sequence101 804 304 gene locus_tag LOCUS_11830 804 304 CDS product VanZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986971.1 protein_id gnl|my_center|LOCUS_11830 2107 821 gene locus_tag LOCUS_11840 2107 821 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963821.1 protein_id gnl|my_center|LOCUS_11840 3562 2348 gene locus_tag LOCUS_11850 3562 2348 CDS product peptidoglycan DD-metalloendopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391790.1 protein_id gnl|my_center|LOCUS_11850 4412 3567 gene locus_tag LOCUS_11860 gene ftsX 4412 3567 CDS product permease-like cell division protein FtsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732506.1 protein_id gnl|my_center|LOCUS_11860 5148 4465 gene locus_tag LOCUS_11870 gene ftsE 5148 4465 CDS product cell division ATP-binding protein FtsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357393.1 protein_id gnl|my_center|LOCUS_11870 6253 5165 gene locus_tag LOCUS_11880 6253 5165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11880 7356 6478 gene locus_tag LOCUS_11890 7356 6478 CDS product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430304.1 protein_id gnl|my_center|LOCUS_11890 8042 7362 gene locus_tag LOCUS_11900 8042 7362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11900 >Feature sequence102 563 572 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1778 855 gene locus_tag LOCUS_11910 1778 855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11910 2997 1765 gene locus_tag LOCUS_11920 2997 1765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11920 1872 1971 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 4368 3001 gene locus_tag LOCUS_11930 4368 3001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11930 4827 4420 gene locus_tag LOCUS_11940 4827 4420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11940 5077 4832 gene locus_tag LOCUS_11950 5077 4832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11950 4912 4921 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 6772 5141 gene locus_tag LOCUS_11960 6772 5141 CDS product DUF3794 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966186.1 protein_id gnl|my_center|LOCUS_11960 7123 6881 gene locus_tag LOCUS_11970 7123 6881 CDS product Veg family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003356889.1 protein_id gnl|my_center|LOCUS_11970 7759 7256 gene locus_tag LOCUS_11980 7759 7256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11980 >Feature sequence103 1289 72 gene locus_tag LOCUS_11990 1289 72 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986283.1 protein_id gnl|my_center|LOCUS_11990 2949 1471 gene locus_tag LOCUS_12000 2949 1471 CDS product DUF1846 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015055963.1 protein_id gnl|my_center|LOCUS_12000 4087 3134 gene locus_tag LOCUS_12010 4087 3134 CDS product DUF4428 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459959.1 protein_id gnl|my_center|LOCUS_12010 4625 4089 gene locus_tag LOCUS_12020 4625 4089 CDS product LemA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812910.1 protein_id gnl|my_center|LOCUS_12020 4815 4687 gene locus_tag LOCUS_12030 4815 4687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12030 5447 4812 gene locus_tag LOCUS_12040 5447 4812 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812913.1 protein_id gnl|my_center|LOCUS_12040 7271 5586 gene locus_tag LOCUS_12050 7271 5586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12050 <8009 7329 gene locus_tag LOCUS_12060 <8009 7329 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002895582.1:ATP-dependent Clp protease ATP-binding subunit ClpX >Feature sequence104 <1 579 gene locus_tag LOCUS_12070 <1 579 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011459580.1:pyridoxal phosphate-dependent aminotransferase 648 1706 gene locus_tag LOCUS_12080 gene hisC 648 1706 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949115.1 protein_id gnl|my_center|LOCUS_12080 1928 2233 gene locus_tag LOCUS_12090 1928 2233 CDS product YerC/YecD family TrpR-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003720075.1 protein_id gnl|my_center|LOCUS_12090 2937 2323 gene locus_tag LOCUS_12100 2937 2323 CDS product DUF1836 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964199.1 protein_id gnl|my_center|LOCUS_12100 3381 5651 gene locus_tag LOCUS_12110 gene pcrA 3381 5651 CDS product DNA helicase PcrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_225356248.1 protein_id gnl|my_center|LOCUS_12110 5861 6193 gene locus_tag LOCUS_12120 5861 6193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12120 6332 7828 gene locus_tag LOCUS_12130 gene rlmD 6332 7828 CDS product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964744.1 protein_id gnl|my_center|LOCUS_12130 >Feature sequence105 437 1759 gene locus_tag LOCUS_12140 gene rsmB 437 1759 CDS product 16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861607.1 protein_id gnl|my_center|LOCUS_12140 1796 2839 gene locus_tag LOCUS_12150 gene rlmN 1796 2839 CDS product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003431147.1 protein_id gnl|my_center|LOCUS_12150 2977 3723 gene locus_tag LOCUS_12160 2977 3723 CDS product Stp1/IreP family PP2C-type Ser/Thr phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101477.1 protein_id gnl|my_center|LOCUS_12160 3717 5846 gene locus_tag LOCUS_12170 gene pknB 3717 5846 CDS product Stk1 family PASTA domain-containing Ser/Thr kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986841.1 protein_id gnl|my_center|LOCUS_12170 5863 6741 gene locus_tag LOCUS_12180 gene rsgA 5863 6741 CDS product ribosome small subunit-dependent GTPase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001113935.1 protein_id gnl|my_center|LOCUS_12180 6808 7461 gene locus_tag LOCUS_12190 gene rpe 6808 7461 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965037.1 protein_id gnl|my_center|LOCUS_12190 >Feature sequence106 188 1966 gene locus_tag LOCUS_12200 188 1966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12200 2029 5325 gene locus_tag LOCUS_12210 2029 5325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12210 5322 6662 gene locus_tag LOCUS_12220 5322 6662 CDS product CCA tRNA nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016728782.1 protein_id gnl|my_center|LOCUS_12220 6728 7714 gene locus_tag LOCUS_12230 6728 7714 CDS product CotS family spore coat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047992.1 protein_id gnl|my_center|LOCUS_12230 >Feature sequence107 452 1390 gene locus_tag LOCUS_12240 452 1390 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775210.1 protein_id gnl|my_center|LOCUS_12240 1403 2299 gene locus_tag LOCUS_12250 1403 2299 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012027282.1 protein_id gnl|my_center|LOCUS_12250 2318 3052 gene locus_tag LOCUS_12260 2318 3052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12260 3076 3085 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3165 4034 gene locus_tag LOCUS_12270 3165 4034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12270 4051 5568 gene locus_tag LOCUS_12280 4051 5568 CDS product glycoside hydrolase family 32 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012028321.1 protein_id gnl|my_center|LOCUS_12280 5630 6586 gene locus_tag LOCUS_12290 5630 6586 CDS product carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439483.1 protein_id gnl|my_center|LOCUS_12290 7710 6616 gene locus_tag LOCUS_12300 gene tyrA 7710 6616 CDS product prephenate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001228138.1 protein_id gnl|my_center|LOCUS_12300 >Feature sequence108 596 2275 gene locus_tag LOCUS_12310 gene glpK 596 2275 CDS product glycerol kinase GlpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861192.1 protein_id gnl|my_center|LOCUS_12310 2110 2209 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2532 3593 gene locus_tag LOCUS_12320 gene carA 2532 3593 CDS product glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429883.1 protein_id gnl|my_center|LOCUS_12320 3657 6863 gene locus_tag LOCUS_12330 gene carB 3657 6863 CDS product carbamoyl-phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009892173.1 protein_id gnl|my_center|LOCUS_12330 7653 6982 gene locus_tag LOCUS_12340 7653 6982 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922646.1 protein_id gnl|my_center|LOCUS_12340 6997 7006 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence109 212 760 gene locus_tag LOCUS_12350 212 760 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002366315.1 protein_id gnl|my_center|LOCUS_12350 795 1661 gene locus_tag LOCUS_12360 795 1661 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_132283172.1 protein_id gnl|my_center|LOCUS_12360 1733 1742 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1763 2110 gene locus_tag LOCUS_12370 1763 2110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12370 2131 2331 gene locus_tag LOCUS_12380 2131 2331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12380 2484 2735 gene locus_tag LOCUS_12390 2484 2735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12390 3245 3469 gene locus_tag LOCUS_12400 3245 3469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12400 3430 3439 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3466 4176 gene locus_tag LOCUS_12410 3466 4176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12410 4188 4628 gene locus_tag LOCUS_12420 4188 4628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12420 5054 6052 gene locus_tag LOCUS_12430 5054 6052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12430 6062 6190 gene locus_tag LOCUS_12440 6062 6190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12440 6162 6701 gene locus_tag LOCUS_12450 6162 6701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12450 6706 7689 gene locus_tag LOCUS_12460 6706 7689 CDS product toprim domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011922442.1 protein_id gnl|my_center|LOCUS_12460 >Feature sequence110 1400 1080 gene locus_tag LOCUS_12470 gene cas2 1400 1080 CDS product CRISPR-associated endonuclease Cas2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_040666777.1 protein_id gnl|my_center|LOCUS_12470 2298 1393 gene locus_tag LOCUS_12480 gene cas1 2298 1393 CDS product type II CRISPR-associated endonuclease Cas1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963638.1 protein_id gnl|my_center|LOCUS_12480 5739 2317 gene locus_tag LOCUS_12490 5739 2317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12490 6596 6045 gene locus_tag LOCUS_12500 6596 6045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016399.1 protein_id gnl|my_center|LOCUS_12500 7694 6597 gene locus_tag LOCUS_12510 7694 6597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12510 >Feature sequence111 1692 568 gene locus_tag LOCUS_12520 1692 568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12520 2467 1901 gene locus_tag LOCUS_12530 2467 1901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12530 1907 1916 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3555 2545 gene locus_tag LOCUS_12540 3555 2545 CDS product GGGtGRT protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965854.1 protein_id gnl|my_center|LOCUS_12540 4266 3574 gene locus_tag LOCUS_12550 4266 3574 CDS product iron-sulfur cluster assembly scaffold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965855.1 protein_id gnl|my_center|LOCUS_12550 5116 4445 gene locus_tag LOCUS_12560 5116 4445 CDS product glucose-1-phosphate thymidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583981.1 protein_id gnl|my_center|LOCUS_12560 7046 5331 gene locus_tag LOCUS_12570 7046 5331 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003425090.1 protein_id gnl|my_center|LOCUS_12570 >Feature sequence112 212 691 gene locus_tag LOCUS_12580 212 691 CDS product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969554.1 protein_id gnl|my_center|LOCUS_12580 1433 666 gene locus_tag LOCUS_12590 1433 666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12590 1875 1438 gene locus_tag LOCUS_12600 1875 1438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12600 2162 2569 gene locus_tag LOCUS_12610 2162 2569 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009889129.1 protein_id gnl|my_center|LOCUS_12610 2628 3266 gene locus_tag LOCUS_12620 2628 3266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12620 4111 3296 gene locus_tag LOCUS_12630 4111 3296 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895974.1 protein_id gnl|my_center|LOCUS_12630 4330 5658 gene locus_tag LOCUS_12640 4330 5658 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861931.1 protein_id gnl|my_center|LOCUS_12640 5818 7329 gene locus_tag LOCUS_12650 5818 7329 CDS product flotillin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012027392.1 protein_id gnl|my_center|LOCUS_12650 >Feature sequence113 2827 506 gene locus_tag LOCUS_12660 gene lon 2827 506 CDS product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435613.1 protein_id gnl|my_center|LOCUS_12660 4156 2879 gene locus_tag LOCUS_12670 gene clpX 4156 2879 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392066.1 protein_id gnl|my_center|LOCUS_12670 4764 4183 gene locus_tag LOCUS_12680 gene clpP 4764 4183 CDS product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965928.1 protein_id gnl|my_center|LOCUS_12680 6429 5086 gene locus_tag LOCUS_12690 gene tig 6429 5086 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229611.1 protein_id gnl|my_center|LOCUS_12690 <7605 6617 gene locus_tag LOCUS_12700 <7605 6617 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002321621.1:FUSC family protein >Feature sequence114 <1 2653 gene locus_tag LOCUS_12710 <1 2653 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010965118.1:DNA translocase FtsK 2759 4429 gene locus_tag LOCUS_12720 2759 4429 CDS product formate--tetrahydrofolate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809743.1 protein_id gnl|my_center|LOCUS_12720 4468 5310 gene locus_tag LOCUS_12730 gene folD 4468 5310 CDS product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722487.1 protein_id gnl|my_center|LOCUS_12730 5338 6495 gene locus_tag LOCUS_12740 5338 6495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12740 7181 6600 gene locus_tag LOCUS_12750 7181 6600 CDS product xanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948106.1 protein_id gnl|my_center|LOCUS_12750 >Feature sequence115 401 1117 gene locus_tag LOCUS_12760 401 1117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12760 1619 1281 gene locus_tag LOCUS_12770 1619 1281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12770 1947 2117 gene locus_tag LOCUS_12780 1947 2117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12780 2086 2457 gene locus_tag LOCUS_12790 2086 2457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12790 2450 3571 gene locus_tag LOCUS_12800 2450 3571 CDS product DUF2800 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_144597911.1 protein_id gnl|my_center|LOCUS_12800 3584 4174 gene locus_tag LOCUS_12810 3584 4174 CDS product DUF2815 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002399690.1 protein_id gnl|my_center|LOCUS_12810 4245 4421 gene locus_tag LOCUS_12820 4245 4421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12820 4418 4594 gene locus_tag LOCUS_12830 4418 4594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12830 4671 6668 gene locus_tag LOCUS_12840 4671 6668 CDS product DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002399687.1 protein_id gnl|my_center|LOCUS_12840 7093 6755 gene locus_tag LOCUS_12850 7093 6755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12850 7302 7090 gene locus_tag LOCUS_12860 7302 7090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12860 >Feature sequence116 <1 7033 gene locus_tag LOCUS_12870 <1 7033 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_051754043.1:polymorphic toxin-type HINT domain-containing protein >Feature sequence117 1145 468 gene locus_tag LOCUS_12880 1145 468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12880 1252 1476 gene locus_tag LOCUS_12890 1252 1476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12890 2114 1533 gene locus_tag LOCUS_12900 2114 1533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12900 4280 2157 gene locus_tag LOCUS_12910 4280 2157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12910 5299 4280 gene locus_tag LOCUS_12920 5299 4280 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057313.1 protein_id gnl|my_center|LOCUS_12920 5982 6081 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 7386 6106 gene locus_tag LOCUS_12930 7386 6106 CDS product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401829.1 protein_id gnl|my_center|LOCUS_12930 >Feature sequence118 2017 1094 gene locus_tag LOCUS_12940 2017 1094 CDS product diacylglycerol kinase family lipid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227672.1 protein_id gnl|my_center|LOCUS_12940 3140 1995 gene locus_tag LOCUS_12950 3140 1995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12950 5113 3326 gene locus_tag LOCUS_12960 5113 3326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12960 5178 7025 gene locus_tag LOCUS_12970 gene asnB 5178 7025 CDS product asparagine synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000333979.1 protein_id gnl|my_center|LOCUS_12970 >Feature sequence119 3938 2577 gene locus_tag LOCUS_12980 3938 2577 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250416.1 protein_id gnl|my_center|LOCUS_12980 4546 4121 gene locus_tag LOCUS_12990 4546 4121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12990 4130 4139 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 5159 4512 gene locus_tag LOCUS_13000 5159 4512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13000 4565 4574 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 6802 5399 gene locus_tag LOCUS_13010 gene argH 6802 5399 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393767.1 protein_id gnl|my_center|LOCUS_13010 <7385 6830 gene locus_tag LOCUS_13020 <7385 6830 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010964885.1:epoxyqueuosine reductase QueH >Feature sequence120 545 384 gene locus_tag LOCUS_13030 545 384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13030 879 517 gene locus_tag LOCUS_13040 879 517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13040 2610 955 gene locus_tag LOCUS_13050 2610 955 CDS product polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003425909.1 protein_id gnl|my_center|LOCUS_13050 3127 2630 gene locus_tag LOCUS_13060 gene ybeY 3127 2630 CDS product rRNA maturation RNase YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047996.1 protein_id gnl|my_center|LOCUS_13060 4308 3124 gene locus_tag LOCUS_13070 4308 3124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13070 5310 4309 gene locus_tag LOCUS_13080 5310 4309 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861553.1 protein_id gnl|my_center|LOCUS_13080 6544 5297 gene locus_tag LOCUS_13090 gene yqfD 6544 5297 CDS product sporulation protein YqfD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000792498.1 protein_id gnl|my_center|LOCUS_13090 6825 6544 gene locus_tag LOCUS_13100 6825 6544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13100 7091 6834 gene locus_tag LOCUS_13110 7091 6834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13110 7109 7118 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence121 253 1128 gene locus_tag LOCUS_13120 253 1128 CDS product DUF368 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001183854.1 protein_id gnl|my_center|LOCUS_13120 1273 3045 gene locus_tag LOCUS_13130 1273 3045 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965689.1 protein_id gnl|my_center|LOCUS_13130 3046 4815 gene locus_tag LOCUS_13140 3046 4815 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965688.1 protein_id gnl|my_center|LOCUS_13140 5551 4841 gene locus_tag LOCUS_13150 5551 4841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13150 5869 7212 gene locus_tag LOCUS_13160 5869 7212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13160 >Feature sequence122 749 1345 gene locus_tag LOCUS_13170 gene recR 749 1345 CDS product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359478.1 protein_id gnl|my_center|LOCUS_13170 1370 2206 gene locus_tag LOCUS_13180 1370 2206 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005904393.1 protein_id gnl|my_center|LOCUS_13180 2194 3135 gene locus_tag LOCUS_13190 2194 3135 CDS product transketolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430702.1 protein_id gnl|my_center|LOCUS_13190 3342 4754 gene locus_tag LOCUS_13200 3342 4754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13200 4854 6050 gene locus_tag LOCUS_13210 4854 6050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13210 6060 6833 gene locus_tag LOCUS_13220 6060 6833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13220 >Feature sequence123 969 592 gene locus_tag LOCUS_13230 969 592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13230 2381 1194 gene locus_tag LOCUS_13240 gene tuf 2381 1194 CDS product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009887863.1 protein_id gnl|my_center|LOCUS_13240 4715 2598 gene locus_tag LOCUS_13250 gene fusA 4715 2598 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436178.1 protein_id gnl|my_center|LOCUS_13250 5291 4821 gene locus_tag LOCUS_13260 gene rpsG 5291 4821 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357613.1 protein_id gnl|my_center|LOCUS_13260 6009 5590 gene locus_tag LOCUS_13270 gene rpsL 6009 5590 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860632.1 protein_id gnl|my_center|LOCUS_13270 7157 6237 gene locus_tag LOCUS_13280 7157 6237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13280 >Feature sequence124 283 501 gene locus_tag LOCUS_13290 283 501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13290 1010 534 gene locus_tag LOCUS_13300 1010 534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13300 1488 1036 gene locus_tag LOCUS_13310 1488 1036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13310 1604 1703 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2419 2628 gene locus_tag LOCUS_13320 2419 2628 CDS product DUF1858 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014519083.1 protein_id gnl|my_center|LOCUS_13320 3492 2710 gene locus_tag LOCUS_13330 3492 2710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13330 3752 5080 gene locus_tag LOCUS_13340 3752 5080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13340 5281 5667 gene locus_tag LOCUS_13350 5281 5667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13350 5748 6575 gene locus_tag LOCUS_13360 5748 6575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13360 6623 6826 gene locus_tag LOCUS_13370 6623 6826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13370 >Feature sequence125 577 215 gene locus_tag LOCUS_13380 577 215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13380 1125 613 gene locus_tag LOCUS_13390 1125 613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13390 1499 1302 gene locus_tag LOCUS_13400 1499 1302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13400 1833 1492 gene locus_tag LOCUS_13410 1833 1492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13410 2345 1938 gene locus_tag LOCUS_13420 2345 1938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13420 2490 2589 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3232 3047 gene locus_tag LOCUS_13430 3232 3047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003395994.1 protein_id gnl|my_center|LOCUS_13430 3628 4176 gene locus_tag LOCUS_13440 3628 4176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13440 4195 4941 gene locus_tag LOCUS_13450 4195 4941 CDS product abortive infection family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000675717.1 protein_id gnl|my_center|LOCUS_13450 6565 5024 gene locus_tag LOCUS_13460 gene guaA 6565 5024 CDS product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965987.1 protein_id gnl|my_center|LOCUS_13460 >Feature sequence126 1379 441 gene locus_tag LOCUS_13470 1379 441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13470 3151 1397 gene locus_tag LOCUS_13480 gene recJ 3151 1397 CDS product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043943623.1 protein_id gnl|my_center|LOCUS_13480 3928 3191 gene locus_tag LOCUS_13490 gene truA 3928 3191 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001067314.1 protein_id gnl|my_center|LOCUS_13490 5337 4270 gene locus_tag LOCUS_13500 gene sleC 5337 4270 CDS product spore cortex-lytic germination protein SleC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003425119.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13500 <7162 5476 gene locus_tag LOCUS_13510 <7162 5476 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012048324.1:glutamine--fructose-6-phosphate transaminase (isomerizing) >Feature sequence127 1822 917 gene locus_tag LOCUS_13520 1822 917 CDS product chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403172.1 protein_id gnl|my_center|LOCUS_13520 2732 2049 gene locus_tag LOCUS_13530 2732 2049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13530 4255 2729 gene locus_tag LOCUS_13540 4255 2729 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965729.1 protein_id gnl|my_center|LOCUS_13540 4993 4310 gene locus_tag LOCUS_13550 4993 4310 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001044683.1 protein_id gnl|my_center|LOCUS_13550 6850 5039 gene locus_tag LOCUS_13560 6850 5039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13560 5796 5805 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence128 <1 668 gene locus_tag LOCUS_13570 <1 668 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012259030.1:4-alpha-glucanotransferase 891 1700 gene locus_tag LOCUS_13580 891 1700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13580 1405 1414 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1594 2940 gene locus_tag LOCUS_13590 1594 2940 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015727.1 protein_id gnl|my_center|LOCUS_13590 3320 3679 gene locus_tag LOCUS_13600 3320 3679 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005807902.1 protein_id gnl|my_center|LOCUS_13600 3699 3917 gene locus_tag LOCUS_13610 3699 3917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13610 3973 5889 gene locus_tag LOCUS_13620 3973 5889 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000796568.1 protein_id gnl|my_center|LOCUS_13620 >Feature sequence129 1120 386 gene locus_tag LOCUS_13630 1120 386 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028020226.1 protein_id gnl|my_center|LOCUS_13630 1414 2970 gene locus_tag LOCUS_13640 1414 2970 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024029827.1 protein_id gnl|my_center|LOCUS_13640 3001 3837 gene locus_tag LOCUS_13650 3001 3837 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966765.1 protein_id gnl|my_center|LOCUS_13650 3855 5270 gene locus_tag LOCUS_13660 3855 5270 CDS product YfcC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002298077.1 protein_id gnl|my_center|LOCUS_13660 5306 6268 gene locus_tag LOCUS_13670 5306 6268 CDS product SIS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288613.1 protein_id gnl|my_center|LOCUS_13670 >Feature sequence130 1798 254 gene locus_tag LOCUS_13680 1798 254 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837092.1 protein_id gnl|my_center|LOCUS_13680 2103 1978 gene locus_tag LOCUS_13690 2103 1978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13690 3087 2302 gene locus_tag LOCUS_13700 3087 2302 CDS product arginase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004295276.1 protein_id gnl|my_center|LOCUS_13700 3468 3115 gene locus_tag LOCUS_13710 3468 3115 CDS product arsenate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459556.1 protein_id gnl|my_center|LOCUS_13710 3914 3504 gene locus_tag LOCUS_13720 3914 3504 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644790.1 protein_id gnl|my_center|LOCUS_13720 4683 3937 gene locus_tag LOCUS_13730 4683 3937 CDS product nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012027810.1 protein_id gnl|my_center|LOCUS_13730 6073 5051 gene locus_tag LOCUS_13740 6073 5051 CDS product virulence RhuM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681769.1 protein_id gnl|my_center|LOCUS_13740 6420 6070 gene locus_tag LOCUS_13750 6420 6070 CDS product arsenate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760124.1 protein_id gnl|my_center|LOCUS_13750 >Feature sequence131 1720 341 gene locus_tag LOCUS_13760 1720 341 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582923.1 protein_id gnl|my_center|LOCUS_13760 2611 1994 gene locus_tag LOCUS_13770 2611 1994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13770 2625 2724 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 5999 3414 gene locus_tag LOCUS_13780 5999 3414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13780 6705 6019 gene locus_tag LOCUS_13790 6705 6019 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454566.1 protein_id gnl|my_center|LOCUS_13790 >Feature sequence132 454 1446 gene locus_tag LOCUS_13800 gene ruvB 454 1446 CDS product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426579.1 protein_id gnl|my_center|LOCUS_13800 1554 2060 gene locus_tag LOCUS_13810 1554 2060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13810 2133 4331 gene locus_tag LOCUS_13820 2133 4331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13820 4335 5729 gene locus_tag LOCUS_13830 4335 5729 CDS product FtsW/RodA/SpoVE family cell cycle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963827.1 protein_id gnl|my_center|LOCUS_13830 5647 6162 gene locus_tag LOCUS_13840 5647 6162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13840 >Feature sequence133 1098 79 gene locus_tag LOCUS_13850 gene ansA 1098 79 CDS product asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000722312.1 protein_id gnl|my_center|LOCUS_13850 2229 1189 gene locus_tag LOCUS_13860 2229 1189 CDS product low specificity L-threonine aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966690.1 protein_id gnl|my_center|LOCUS_13860 4082 2226 gene locus_tag LOCUS_13870 4082 2226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13870 4991 4140 gene locus_tag LOCUS_13880 gene yqeB 4991 4140 CDS product selenium-dependent molybdenum cofactor biosynthesis protein YqeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437839.1 protein_id gnl|my_center|LOCUS_13880 5645 5004 gene locus_tag LOCUS_13890 gene yedF 5645 5004 CDS product sulfurtransferase-like selenium metabolism protein YedF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462046.1 protein_id gnl|my_center|LOCUS_13890 6726 5707 gene locus_tag LOCUS_13900 gene selD 6726 5707 CDS product selenide, water dikinase SelD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462047.1 protein_id gnl|my_center|LOCUS_13900 >Feature sequence134 213 971 gene locus_tag LOCUS_13910 213 971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13910 1148 1330 gene locus_tag LOCUS_13920 1148 1330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13920 1452 2690 gene locus_tag LOCUS_13930 1452 2690 CDS product aminopeptidase P family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948284.1 protein_id gnl|my_center|LOCUS_13930 3037 4428 gene locus_tag LOCUS_13940 gene mgtE 3037 4428 CDS product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001829287.1 protein_id gnl|my_center|LOCUS_13940 4545 5663 gene locus_tag LOCUS_13950 4545 5663 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964797.1 protein_id gnl|my_center|LOCUS_13950 5692 6261 gene locus_tag LOCUS_13960 5692 6261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13960 >Feature sequence135 319 582 gene locus_tag LOCUS_13970 319 582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13970 330 339 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1771 629 gene locus_tag LOCUS_13980 gene nagA 1771 629 CDS product N-acetylglucosamine-6-phosphate deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001292242.1 protein_id gnl|my_center|LOCUS_13980 2543 1986 gene locus_tag LOCUS_13990 gene efp 2543 1986 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393047.1 protein_id gnl|my_center|LOCUS_13990 3130 2687 gene locus_tag LOCUS_14000 gene rpiB 3130 2687 CDS product ribose 5-phosphate isomerase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721856.1 protein_id gnl|my_center|LOCUS_14000 3687 3178 gene locus_tag LOCUS_14010 3687 3178 CDS product YqeG family HAD IIIA-type phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583237.1 protein_id gnl|my_center|LOCUS_14010 4167 3760 gene locus_tag LOCUS_14020 4167 3760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14020 4721 4269 gene locus_tag LOCUS_14030 gene nrdR 4721 4269 CDS product transcriptional regulator NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723246.1 protein_id gnl|my_center|LOCUS_14030 5998 4832 gene locus_tag LOCUS_14040 5998 4832 CDS product FprA family A-type flavoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987112.1 protein_id gnl|my_center|LOCUS_14040 6774 6112 gene locus_tag LOCUS_14050 6774 6112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14050 >Feature sequence136 2690 1572 gene locus_tag LOCUS_14060 2690 1572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14060 3094 2690 gene locus_tag LOCUS_14070 3094 2690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14070 4141 3104 gene locus_tag LOCUS_14080 4141 3104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14080 4193 4202 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 5638 4205 gene locus_tag LOCUS_14090 5638 4205 CDS product relaxase/mobilization nuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_102364993.1 protein_id gnl|my_center|LOCUS_14090 4459 4468 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 5897 5625 gene locus_tag LOCUS_14100 5897 5625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14100 6492 5962 gene locus_tag LOCUS_14110 6492 5962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14110 >Feature sequence137 3 542 gene locus_tag LOCUS_14120 3 542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14120 597 2045 gene locus_tag LOCUS_14130 597 2045 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000891874.1 protein_id gnl|my_center|LOCUS_14130 3358 2126 gene locus_tag LOCUS_14140 3358 2126 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393768.1 protein_id gnl|my_center|LOCUS_14140 3789 4844 gene locus_tag LOCUS_14150 gene argC 3789 4844 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851634.1 protein_id gnl|my_center|LOCUS_14150 4946 5407 gene locus_tag LOCUS_14160 4946 5407 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851934.1 protein_id gnl|my_center|LOCUS_14160 >Feature sequence138 570 1244 gene locus_tag LOCUS_14170 gene sfsA 570 1244 CDS product DNA/RNA nuclease SfsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461735.1 protein_id gnl|my_center|LOCUS_14170 1274 1864 gene locus_tag LOCUS_14180 1274 1864 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434301.1 protein_id gnl|my_center|LOCUS_14180 1920 2351 gene locus_tag LOCUS_14190 1920 2351 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986725.1 protein_id gnl|my_center|LOCUS_14190 2490 3404 gene locus_tag LOCUS_14200 2490 3404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005807791.1 protein_id gnl|my_center|LOCUS_14200 3585 4346 gene locus_tag LOCUS_14210 3585 4346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14210 4365 5120 gene locus_tag LOCUS_14220 4365 5120 CDS product TraX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986406.1 protein_id gnl|my_center|LOCUS_14220 5170 5658 gene locus_tag LOCUS_14230 5170 5658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14230 5597 5929 gene locus_tag LOCUS_14240 5597 5929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14240 <6639 5961 gene locus_tag LOCUS_14250 <6639 5961 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003439092.1:amidohydrolase >Feature sequence139 2474 882 gene locus_tag LOCUS_14260 gene hcp 2474 882 CDS product hydroxylamine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003433949.1 protein_id gnl|my_center|LOCUS_14260 3937 2633 gene locus_tag LOCUS_14270 3937 2633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14270 4101 4895 gene locus_tag LOCUS_14280 4101 4895 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965542.1 protein_id gnl|my_center|LOCUS_14280 6409 4919 gene locus_tag LOCUS_14290 6409 4919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14290 >Feature sequence140 117 359 gene locus_tag LOCUS_14300 117 359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14300 377 667 gene locus_tag LOCUS_14310 377 667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14310 1733 717 gene locus_tag LOCUS_14320 1733 717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14320 1917 2645 gene locus_tag LOCUS_14330 1917 2645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14330 2823 4619 gene locus_tag LOCUS_14340 2823 4619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14340 >Feature sequence141 1 333 gene locus_tag LOCUS_14350 1 333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14350 468 1712 gene locus_tag LOCUS_14360 468 1712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14360 1671 1680 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1694 2110 gene locus_tag LOCUS_14370 1694 2110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_14370 2254 3591 gene locus_tag LOCUS_14380 2254 3591 CDS product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461353.1 protein_id gnl|my_center|LOCUS_14380 3606 4253 gene locus_tag LOCUS_14390 3606 4253 CDS product TrkA family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809652.1 protein_id gnl|my_center|LOCUS_14390 4442 5629 gene locus_tag LOCUS_14400 4442 5629 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815048.1 protein_id gnl|my_center|LOCUS_14400 5645 6586 gene locus_tag LOCUS_14410 5645 6586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14410 >Feature sequence142 63 1055 gene locus_tag LOCUS_14420 63 1055 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013363756.1 protein_id gnl|my_center|LOCUS_14420 1443 1138 gene locus_tag LOCUS_14430 1443 1138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14430 1980 1468 gene locus_tag LOCUS_14440 1980 1468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14440 2267 1980 gene locus_tag LOCUS_14450 2267 1980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14450 2669 2427 gene locus_tag LOCUS_14460 2669 2427 CDS product RNA-binding S4 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003709726.1 protein_id gnl|my_center|LOCUS_14460 3092 2817 gene locus_tag LOCUS_14470 3092 2817 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814866.1 protein_id gnl|my_center|LOCUS_14470 4864 3182 gene locus_tag LOCUS_14480 4864 3182 CDS product phospho-sugar mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965634.1 protein_id gnl|my_center|LOCUS_14480 3187 3286 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 6355 5117 gene locus_tag LOCUS_14490 6355 5117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14490 >Feature sequence143 41 1588 gene locus_tag LOCUS_14500 41 1588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14500 1753 2556 gene locus_tag LOCUS_14510 1753 2556 CDS product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003817462.1 protein_id gnl|my_center|LOCUS_14510 2602 3252 gene locus_tag LOCUS_14520 2602 3252 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430270.1 protein_id gnl|my_center|LOCUS_14520 3293 4054 gene locus_tag LOCUS_14530 3293 4054 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815786.1 protein_id gnl|my_center|LOCUS_14530 4232 5089 gene locus_tag LOCUS_14540 gene rfbD 4232 5089 CDS product dTDP-4-dehydrorhamnose reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000664653.1 protein_id gnl|my_center|LOCUS_14540 5079 6362 gene locus_tag LOCUS_14550 5079 6362 CDS product dicarboxylate/amino acid:cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072045.1 protein_id gnl|my_center|LOCUS_14550 >Feature sequence144 <1 1307 gene locus_tag LOCUS_14560 <1 1307 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005898122.1:AAA family ATPase 1446 2024 gene locus_tag LOCUS_14570 1446 2024 CDS product HDIG domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948351.1 protein_id gnl|my_center|LOCUS_14570 2911 2063 gene locus_tag LOCUS_14580 2911 2063 CDS product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459581.1 protein_id gnl|my_center|LOCUS_14580 3640 4014 gene locus_tag LOCUS_14590 3640 4014 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814465.1 protein_id gnl|my_center|LOCUS_14590 4135 4485 gene locus_tag LOCUS_14600 4135 4485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14600 4466 4475 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 4482 4976 gene locus_tag LOCUS_14610 4482 4976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14610 4976 5623 gene locus_tag LOCUS_14620 4976 5623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14620 5744 6427 gene locus_tag LOCUS_14630 5744 6427 CDS product DNA alkylation repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678782.1 protein_id gnl|my_center|LOCUS_14630 >Feature sequence145 470 1723 gene locus_tag LOCUS_14640 470 1723 CDS product DUF4317 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964047.1 protein_id gnl|my_center|LOCUS_14640 1842 2429 gene locus_tag LOCUS_14650 1842 2429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14650 3176 2676 gene locus_tag LOCUS_14660 3176 2676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14660 4546 3521 gene locus_tag LOCUS_14670 4546 3521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14670 4861 5883 gene locus_tag LOCUS_14680 4861 5883 CDS product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082562.1 protein_id gnl|my_center|LOCUS_14680 >Feature sequence146 348 968 gene locus_tag LOCUS_14690 348 968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14690 2355 1000 gene locus_tag LOCUS_14700 2355 1000 CDS product sodium-dependent transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020940.1 protein_id gnl|my_center|LOCUS_14700 2589 2452 gene locus_tag LOCUS_14710 2589 2452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14710 4184 2724 gene locus_tag LOCUS_14720 4184 2724 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680556.1 protein_id gnl|my_center|LOCUS_14720 2763 2862 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 5934 4339 gene locus_tag LOCUS_14730 5934 4339 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437464.1 protein_id gnl|my_center|LOCUS_14730 >Feature sequence147 654 2375 gene locus_tag LOCUS_14740 gene ilvB 654 2375 CDS product biosynthetic-type acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458814.1 protein_id gnl|my_center|LOCUS_14740 2388 2906 gene locus_tag LOCUS_14750 gene ilvN 2388 2906 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006862451.1 protein_id gnl|my_center|LOCUS_14750 3077 3982 gene locus_tag LOCUS_14760 3077 3982 CDS product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583216.1 protein_id gnl|my_center|LOCUS_14760 5195 4065 gene locus_tag LOCUS_14770 5195 4065 CDS product alanine--glyoxylate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986549.1 protein_id gnl|my_center|LOCUS_14770 5800 5252 gene locus_tag LOCUS_14780 5800 5252 CDS product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861585.1 protein_id gnl|my_center|LOCUS_14780 5971 5980 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 6038 6187 gene locus_tag LOCUS_14790 6038 6187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14790 >Feature sequence148 <1 2685 gene locus_tag LOCUS_14800 <1 2685 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164925492.1:pullulanase 4854 2773 gene locus_tag LOCUS_14810 4854 2773 CDS product beta-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254470.1 protein_id gnl|my_center|LOCUS_14810 5163 6230 gene locus_tag LOCUS_14820 5163 6230 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549214.1 protein_id gnl|my_center|LOCUS_14820 >Feature sequence149 608 282 gene locus_tag LOCUS_14830 608 282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14830 898 743 gene locus_tag LOCUS_14840 898 743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14840 977 1570 gene locus_tag LOCUS_14850 977 1570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14850 3032 1788 gene locus_tag LOCUS_14860 3032 1788 CDS product IS256-like element ISSod18 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071025.1 protein_id gnl|my_center|LOCUS_14860 5428 3266 gene locus_tag LOCUS_14870 5428 3266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14870 6227 5412 gene locus_tag LOCUS_14880 6227 5412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14880 >Feature sequence150 437 871 gene locus_tag LOCUS_14890 437 871 CDS product Mini-ribonuclease 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356056.1 protein_id gnl|my_center|LOCUS_14890 940 1581 gene locus_tag LOCUS_14900 gene rlmB 940 1581 CDS product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000200237.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14900 1534 1543 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1781 2431 gene locus_tag LOCUS_14910 gene sigH 1781 2431 CDS product RNA polymerase sporulation sigma factor SigH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009966312.1 protein_id gnl|my_center|LOCUS_14910 2791 2863 gene locus_tag LOCUS_t00080 2791 2863 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 3022 3699 gene locus_tag LOCUS_14920 3022 3699 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861605.1 protein_id gnl|my_center|LOCUS_14920 3663 3672 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3715 5832 gene locus_tag LOCUS_14930 3715 5832 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861604.1 protein_id gnl|my_center|LOCUS_14930 >Feature sequence151 78 2789 gene locus_tag LOCUS_14940 78 2789 CDS product TetM/TetW/TetO/TetS family tetracycline resistance ribosomal protection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814361.1 protein_id gnl|my_center|LOCUS_14940 2844 4220 gene locus_tag LOCUS_14950 2844 4220 CDS product RsmB/NOP family class I SAM-dependent RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436985.1 protein_id gnl|my_center|LOCUS_14950 4213 5568 gene locus_tag LOCUS_14960 4213 5568 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001036258.1 protein_id gnl|my_center|LOCUS_14960 5578 6261 gene locus_tag LOCUS_14970 5578 6261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14970 >Feature sequence152 179 1027 gene locus_tag LOCUS_14980 179 1027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14980 1057 3243 gene locus_tag LOCUS_14990 1057 3243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14990 3361 4761 gene locus_tag LOCUS_15000 gene rhaB 3361 4761 CDS product rhamnulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476556.1 protein_id gnl|my_center|LOCUS_15000 4837 6093 gene locus_tag LOCUS_15010 gene rhaA 4837 6093 CDS product L-rhamnose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244294.1 protein_id gnl|my_center|LOCUS_15010 >Feature sequence153 202 2598 gene locus_tag LOCUS_15020 202 2598 CDS product glycoside hydrolase family 3 C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775403.1 protein_id gnl|my_center|LOCUS_15020 2721 3302 gene locus_tag LOCUS_15030 2721 3302 CDS product GTP pyrophosphokinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966612.1 protein_id gnl|my_center|LOCUS_15030 3384 4172 gene locus_tag LOCUS_15040 3384 4172 CDS product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047983.1 protein_id gnl|my_center|LOCUS_15040 4217 5251 gene locus_tag LOCUS_15050 4217 5251 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965544.1 protein_id gnl|my_center|LOCUS_15050 >Feature sequence154 836 2104 gene locus_tag LOCUS_15060 836 2104 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007785170.1 protein_id gnl|my_center|LOCUS_15060 2120 2836 gene locus_tag LOCUS_15070 gene rgbR 2120 2836 CDS product two-component system response regulator RgbR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438019.1 protein_id gnl|my_center|LOCUS_15070 3345 2842 gene locus_tag LOCUS_15080 3345 2842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15080 4636 3347 gene locus_tag LOCUS_15090 4636 3347 CDS product O-acetylhomoserine aminocarboxypropyltransferase/cysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790318.1 protein_id gnl|my_center|LOCUS_15090 4916 6295 gene locus_tag LOCUS_15100 4916 6295 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814295.1 protein_id gnl|my_center|LOCUS_15100 >Feature sequence155 15 611 gene locus_tag LOCUS_15110 15 611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15110 1905 616 gene locus_tag LOCUS_15120 1905 616 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861133.1 protein_id gnl|my_center|LOCUS_15120 2240 3433 gene locus_tag LOCUS_15130 2240 3433 CDS product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438096.1 protein_id gnl|my_center|LOCUS_15130 3633 4157 gene locus_tag LOCUS_15140 3633 4157 CDS product DUF177 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545391.1 protein_id gnl|my_center|LOCUS_15140 4162 4341 gene locus_tag LOCUS_15150 gene rpmF 4162 4341 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830121.1 protein_id gnl|my_center|LOCUS_15150 4499 5152 gene locus_tag LOCUS_15160 4499 5152 CDS product YesL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009994403.1 protein_id gnl|my_center|LOCUS_15160 >Feature sequence156 1064 438 gene locus_tag LOCUS_15170 1064 438 CDS product cytidylate kinase-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766580.1 protein_id gnl|my_center|LOCUS_15170 1864 1154 gene locus_tag LOCUS_15180 1864 1154 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902265.1 protein_id gnl|my_center|LOCUS_15180 2635 1877 gene locus_tag LOCUS_15190 2635 1877 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018211990.1 protein_id gnl|my_center|LOCUS_15190 3713 2637 gene locus_tag LOCUS_15200 3713 2637 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815200.1 protein_id gnl|my_center|LOCUS_15200 4604 3723 gene locus_tag LOCUS_15210 4604 3723 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815198.1 protein_id gnl|my_center|LOCUS_15210 5999 4797 gene locus_tag LOCUS_15220 5999 4797 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815196.1 protein_id gnl|my_center|LOCUS_15220 >Feature sequence157 1730 939 gene locus_tag LOCUS_15230 1730 939 CDS product Fe-S cluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869100.1 protein_id gnl|my_center|LOCUS_15230 2340 1744 gene locus_tag LOCUS_15240 gene rsxA 2340 1744 CDS product electron transport complex subunit RsxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005904083.1 protein_id gnl|my_center|LOCUS_15240 3074 2355 gene locus_tag LOCUS_15250 3074 2355 CDS product electron transport complex subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948148.1 protein_id gnl|my_center|LOCUS_15250 3682 3074 gene locus_tag LOCUS_15260 3682 3074 CDS product RnfABCDGE type electron transport complex subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869097.1 protein_id gnl|my_center|LOCUS_15260 4567 3686 gene locus_tag LOCUS_15270 4567 3686 CDS product RnfABCDGE type electron transport complex subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948146.1 protein_id gnl|my_center|LOCUS_15270 6019 4700 gene locus_tag LOCUS_15280 gene rsxC 6019 4700 CDS product electron transport complex subunit RsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948145.1 protein_id gnl|my_center|LOCUS_15280 >Feature sequence158 1898 654 gene locus_tag LOCUS_15290 1898 654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15290 3017 1932 gene locus_tag LOCUS_15300 3017 1932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15300 4281 3385 gene locus_tag LOCUS_15310 4281 3385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15310 5498 4236 gene locus_tag LOCUS_15320 5498 4236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15320 4287 4386 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence159 <1 1030 gene locus_tag LOCUS_15330 <1 1030 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004455016.1:MFS transporter 1086 1847 gene locus_tag LOCUS_15340 gene aroD 1086 1847 CDS product type I 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897376.1 protein_id gnl|my_center|LOCUS_15340 1962 2942 gene locus_tag LOCUS_15350 1962 2942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15350 2948 4252 gene locus_tag LOCUS_15360 2948 4252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15360 4441 5088 gene locus_tag LOCUS_15370 4441 5088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15370 >Feature sequence160 1965 1660 gene locus_tag LOCUS_15380 1965 1660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15380 2745 2155 gene locus_tag LOCUS_15390 2745 2155 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461649.1 protein_id gnl|my_center|LOCUS_15390 2993 3002 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3427 3011 gene locus_tag LOCUS_15400 3427 3011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15400 3620 3444 gene locus_tag LOCUS_15410 3620 3444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15410 3466 3475 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 4808 3786 gene locus_tag LOCUS_15420 4808 3786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15420 5860 4847 gene locus_tag LOCUS_15430 5860 4847 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014636535.1 protein_id gnl|my_center|LOCUS_15430 >Feature sequence161 115 342 gene locus_tag LOCUS_15440 115 342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15440 449 895 gene locus_tag LOCUS_15450 449 895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15450 895 1047 gene locus_tag LOCUS_15460 895 1047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15460 1034 2833 gene locus_tag LOCUS_15470 1034 2833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15470 2865 3605 gene locus_tag LOCUS_15480 2865 3605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15480 3606 3935 gene locus_tag LOCUS_15490 3606 3935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15490 4072 4416 gene locus_tag LOCUS_15500 4072 4416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15500 4426 4932 gene locus_tag LOCUS_15510 4426 4932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15510 5011 5253 gene locus_tag LOCUS_15520 5011 5253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15520 5261 5494 gene locus_tag LOCUS_15530 5261 5494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15530 5616 5987 gene locus_tag LOCUS_15540 5616 5987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15540 >Feature sequence162 1377 259 gene locus_tag LOCUS_15550 1377 259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15550 1786 1616 gene locus_tag LOCUS_15560 1786 1616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15560 3293 1737 gene locus_tag LOCUS_15570 3293 1737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15570 5117 3561 gene locus_tag LOCUS_15580 5117 3561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15580 5951 5172 gene locus_tag LOCUS_15590 5951 5172 CDS product TraX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002895510.1 protein_id gnl|my_center|LOCUS_15590 >Feature sequence163 2039 1461 gene locus_tag LOCUS_15600 2039 1461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15600 2834 2268 gene locus_tag LOCUS_15610 gene dhaS 2834 2268 CDS product dihydroxyacetone kinase transcriptional activator DhaS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000204281.1 protein_id gnl|my_center|LOCUS_15610 3912 2848 gene locus_tag LOCUS_15620 3912 2848 CDS product HD-GYP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963600.1 protein_id gnl|my_center|LOCUS_15620 4192 3962 gene locus_tag LOCUS_15630 4192 3962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15630 4317 5915 gene locus_tag LOCUS_15640 4317 5915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15640 >Feature sequence164 1649 1658 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 4959 3907 gene locus_tag LOCUS_15650 4959 3907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15650 5902 4964 gene locus_tag LOCUS_15660 5902 4964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15660 >Feature sequence165 93 674 gene locus_tag LOCUS_15670 93 674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15670 764 1531 gene locus_tag LOCUS_15680 764 1531 CDS product dihydroorotate dehydrogenase electron transfer subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016380.1 protein_id gnl|my_center|LOCUS_15680 1531 2436 gene locus_tag LOCUS_15690 1531 2436 CDS product dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942399.1 protein_id gnl|my_center|LOCUS_15690 2500 3180 gene locus_tag LOCUS_15700 gene pyrE 2500 3180 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963356.1 protein_id gnl|my_center|LOCUS_15700 3167 3679 gene locus_tag LOCUS_15710 3167 3679 CDS product VanZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987071.1 protein_id gnl|my_center|LOCUS_15710 3754 4089 gene locus_tag LOCUS_15720 3754 4089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15720 >Feature sequence166 587 108 gene locus_tag LOCUS_15730 587 108 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989714.1 protein_id gnl|my_center|LOCUS_15730 1183 584 gene locus_tag LOCUS_15740 1183 584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15740 2252 1188 gene locus_tag LOCUS_15750 2252 1188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15750 3970 2264 gene locus_tag LOCUS_15760 3970 2264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15760 5135 3987 gene locus_tag LOCUS_15770 5135 3987 CDS product class I SAM-dependent RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003423769.1 protein_id gnl|my_center|LOCUS_15770 5543 5241 gene locus_tag LOCUS_15780 5543 5241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15780 5818 5645 gene locus_tag LOCUS_15790 5818 5645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15790 >Feature sequence167 1564 191 gene locus_tag LOCUS_15800 1564 191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15800 2082 1588 gene locus_tag LOCUS_15810 2082 1588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15810 3507 2131 gene locus_tag LOCUS_15820 3507 2131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15820 3670 3491 gene locus_tag LOCUS_15830 3670 3491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15830 3843 3709 gene locus_tag LOCUS_15840 3843 3709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15840 5840 3972 gene locus_tag LOCUS_15850 5840 3972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15850 >Feature sequence168 67 870 gene locus_tag LOCUS_15860 67 870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15860 901 1974 gene locus_tag LOCUS_15870 901 1974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15870 1261 1360 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1979 2410 gene locus_tag LOCUS_15880 1979 2410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15880 2414 2854 gene locus_tag LOCUS_15890 2414 2854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15890 2847 5177 gene locus_tag LOCUS_15900 2847 5177 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010773627.1 protein_id gnl|my_center|LOCUS_15900 5177 5527 gene locus_tag LOCUS_15910 5177 5527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15910 >Feature sequence169 1038 670 gene locus_tag LOCUS_15920 1038 670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15920 770 779 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3161 1182 gene locus_tag LOCUS_15930 3161 1182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15930 4035 3136 gene locus_tag LOCUS_15940 4035 3136 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003385582.1 protein_id gnl|my_center|LOCUS_15940 4406 4032 gene locus_tag LOCUS_15950 4406 4032 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000548042.1 protein_id gnl|my_center|LOCUS_15950 5600 4566 gene locus_tag LOCUS_15960 5600 4566 CDS product M42 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680378.1 protein_id gnl|my_center|LOCUS_15960 >Feature sequence170 484 107 gene locus_tag LOCUS_15970 484 107 CDS product YdcP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861923.1 protein_id gnl|my_center|LOCUS_15970 820 506 gene locus_tag LOCUS_15980 820 506 CDS product YdcP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002578441.1 protein_id gnl|my_center|LOCUS_15980 2137 1688 gene locus_tag LOCUS_15990 2137 1688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15990 2320 2514 gene locus_tag LOCUS_16000 2320 2514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16000 2517 3629 gene locus_tag LOCUS_16010 2517 3629 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047593.1 protein_id gnl|my_center|LOCUS_16010 3619 3939 gene locus_tag LOCUS_16020 3619 3939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16020 4065 5150 gene locus_tag LOCUS_16030 4065 5150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16030 5219 5458 gene locus_tag LOCUS_16040 5219 5458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16040 5649 5873 gene locus_tag LOCUS_16050 5649 5873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16050 >Feature sequence171 627 160 gene locus_tag LOCUS_16060 627 160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16060 922 593 gene locus_tag LOCUS_16070 922 593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16070 1571 1056 gene locus_tag LOCUS_16080 1571 1056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16080 2068 1625 gene locus_tag LOCUS_16090 2068 1625 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_124797437.1 protein_id gnl|my_center|LOCUS_16090 2552 2148 gene locus_tag LOCUS_16100 2552 2148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16100 2683 2552 gene locus_tag LOCUS_16110 2683 2552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16110 2947 2717 gene locus_tag LOCUS_16120 2947 2717 CDS product type II toxin-antitoxin system RelB/DinJ family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002665927.1 protein_id gnl|my_center|LOCUS_16120 5368 3434 gene locus_tag LOCUS_16130 5368 3434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16130 >Feature sequence172 795 292 gene locus_tag LOCUS_16140 gene sigM 795 292 CDS product RNA polymerase sigma factor SigM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003224177.1 protein_id gnl|my_center|LOCUS_16140 1827 943 gene locus_tag LOCUS_16150 1827 943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16150 2381 1824 gene locus_tag LOCUS_16160 2381 1824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16160 3656 2559 gene locus_tag LOCUS_16170 3656 2559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16170 4503 3718 gene locus_tag LOCUS_16180 4503 3718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16180 5294 4437 gene locus_tag LOCUS_16190 5294 4437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16190 4506 4515 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 5861 5316 gene locus_tag LOCUS_16200 5861 5316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16200 >Feature sequence173 544 308 gene locus_tag LOCUS_16210 544 308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16210 674 1066 gene locus_tag LOCUS_16220 674 1066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16220 1107 1439 gene locus_tag LOCUS_16230 1107 1439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16230 1618 2535 gene locus_tag LOCUS_16240 1618 2535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16240 2532 2822 gene locus_tag LOCUS_16250 2532 2822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16250 2977 3528 gene locus_tag LOCUS_16260 2977 3528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16260 3876 4220 gene locus_tag LOCUS_16270 3876 4220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16270 4250 4894 gene locus_tag LOCUS_16280 4250 4894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16280 4897 5853 gene locus_tag LOCUS_16290 4897 5853 CDS product amidoligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458834.1 protein_id gnl|my_center|LOCUS_16290 >Feature sequence174 74 835 gene locus_tag LOCUS_16300 74 835 CDS product DUF4866 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009930717.1 protein_id gnl|my_center|LOCUS_16300 822 2162 gene locus_tag LOCUS_16310 822 2162 CDS product threonine/serine exporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547031.1 protein_id gnl|my_center|LOCUS_16310 2460 2182 gene locus_tag LOCUS_16320 2460 2182 CDS product DUF2325 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009890712.1 protein_id gnl|my_center|LOCUS_16320 2923 2492 gene locus_tag LOCUS_16330 2923 2492 CDS product flavodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009902921.1 protein_id gnl|my_center|LOCUS_16330 3626 3036 gene locus_tag LOCUS_16340 3626 3036 CDS product DUF3793 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681044.1 protein_id gnl|my_center|LOCUS_16340 5081 3735 gene locus_tag LOCUS_16350 5081 3735 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001036258.1 protein_id gnl|my_center|LOCUS_16350 5547 5098 gene locus_tag LOCUS_16360 5547 5098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16360 5838 5614 gene locus_tag LOCUS_16370 5838 5614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16370 >Feature sequence175 1 828 gene locus_tag LOCUS_16380 1 828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16380 833 1630 gene locus_tag LOCUS_16390 833 1630 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048403.1 protein_id gnl|my_center|LOCUS_16390 1784 2068 gene locus_tag LOCUS_16400 1784 2068 CDS product ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812009.1 protein_id gnl|my_center|LOCUS_16400 2084 3448 gene locus_tag LOCUS_16410 2084 3448 CDS product PFL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815306.1 protein_id gnl|my_center|LOCUS_16410 3695 4408 gene locus_tag LOCUS_16420 3695 4408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16420 4459 5637 gene locus_tag LOCUS_16430 4459 5637 CDS product phosphoribosylaminoimidazolecarboxamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765038.1 protein_id gnl|my_center|LOCUS_16430 >Feature sequence176 3 3293 gene locus_tag LOCUS_16440 3 3293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_106895171.1 protein_id gnl|my_center|LOCUS_16440 3346 4518 gene locus_tag LOCUS_16450 3346 4518 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016395.1 protein_id gnl|my_center|LOCUS_16450 >Feature sequence177 51 209 gene locus_tag LOCUS_16460 51 209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16460 1302 370 gene locus_tag LOCUS_16470 gene metA 1302 370 CDS product homoserine O-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001121536.1 protein_id gnl|my_center|LOCUS_16470 3353 1389 gene locus_tag LOCUS_16480 gene ligA 3353 1389 CDS product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861898.1 protein_id gnl|my_center|LOCUS_16480 2832 2841 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 4142 3360 gene locus_tag LOCUS_16490 gene rluF 4142 3360 CDS product 23S rRNA pseudouridine(2604) synthase RluF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000936374.1 protein_id gnl|my_center|LOCUS_16490 5533 4256 gene locus_tag LOCUS_16500 5533 4256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16500 5824 5751 gene locus_tag LOCUS_t00090 5824 5751 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence178 1708 653 gene locus_tag LOCUS_16510 1708 653 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003562759.1 protein_id gnl|my_center|LOCUS_16510 2365 2018 gene locus_tag LOCUS_16520 2365 2018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16520 3016 2486 gene locus_tag LOCUS_16530 gene raiA 3016 2486 CDS product ribosome-associated translation inhibitor RaiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966132.1 protein_id gnl|my_center|LOCUS_16530 4956 3214 gene locus_tag LOCUS_16540 4956 3214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16540 5408 5172 gene locus_tag LOCUS_16550 5408 5172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16550 >Feature sequence179 1133 120 gene locus_tag LOCUS_16560 1133 120 CDS product deoxyguanosinetriphosphate triphosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392159.1 protein_id gnl|my_center|LOCUS_16560 2641 1271 gene locus_tag LOCUS_16570 gene radA 2641 1271 CDS product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399687.1 protein_id gnl|my_center|LOCUS_16570 3112 2702 gene locus_tag LOCUS_16580 3112 2702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16580 5696 3240 gene locus_tag LOCUS_16590 gene clpC 5696 3240 CDS product ATP-dependent protease ATP-binding subunit ClpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000971183.1 protein_id gnl|my_center|LOCUS_16590 >Feature sequence180 222 1424 gene locus_tag LOCUS_16600 222 1424 CDS product D-alanyl-D-alanine carboxypeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047683.1 protein_id gnl|my_center|LOCUS_16600 1551 2987 gene locus_tag LOCUS_16610 1551 2987 CDS product acyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203341.1 protein_id gnl|my_center|LOCUS_16610 3000 3767 gene locus_tag LOCUS_16620 3000 3767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16620 3831 4202 gene locus_tag LOCUS_16630 3831 4202 CDS product biotin/lipoyl-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_149793471.1 protein_id gnl|my_center|LOCUS_16630 4221 4625 gene locus_tag LOCUS_16640 4221 4625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16640 4519 5361 gene locus_tag LOCUS_16650 4519 5361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16650 4522 4531 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence181 2343 136 gene locus_tag LOCUS_16660 2343 136 CDS product ATP-dependent RecD-like DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947993.1 protein_id gnl|my_center|LOCUS_16660 2876 2514 gene locus_tag LOCUS_16670 2876 2514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16670 3724 2909 gene locus_tag LOCUS_16680 gene flgG 3724 2909 CDS product flagellar basal-body rod protein FlgG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943676.1 protein_id gnl|my_center|LOCUS_16680 4548 3754 gene locus_tag LOCUS_16690 4548 3754 CDS product flagellar basal-body rod protein FlgG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965439.1 protein_id gnl|my_center|LOCUS_16690 5635 4640 gene locus_tag LOCUS_16700 5635 4640 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420729.1 protein_id gnl|my_center|LOCUS_16700 >Feature sequence182 <1 836 gene locus_tag LOCUS_16710 <1 836 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000814831.1:phosphate ABC transporter permease subunit PstC 844 1725 gene locus_tag LOCUS_16720 gene pstA 844 1725 CDS product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000427927.1 protein_id gnl|my_center|LOCUS_16720 1815 2567 gene locus_tag LOCUS_16730 gene pstB 1815 2567 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000041121.1 protein_id gnl|my_center|LOCUS_16730 2592 3248 gene locus_tag LOCUS_16740 gene phoU 2592 3248 CDS product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986850.1 protein_id gnl|my_center|LOCUS_16740 3419 5179 gene locus_tag LOCUS_16750 3419 5179 CDS product Na/Pi cotransporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430205.1 protein_id gnl|my_center|LOCUS_16750 >Feature sequence183 233 598 gene locus_tag LOCUS_16760 233 598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16760 598 2241 gene locus_tag LOCUS_16770 598 2241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16770 2360 4153 gene locus_tag LOCUS_16780 2360 4153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16780 4347 4586 gene locus_tag LOCUS_16790 4347 4586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013399633.1 protein_id gnl|my_center|LOCUS_16790 4599 4967 gene locus_tag LOCUS_16800 4599 4967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004114894.1 protein_id gnl|my_center|LOCUS_16800 5059 5268 gene locus_tag LOCUS_16810 5059 5268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16810 5362 5532 gene locus_tag LOCUS_16820 5362 5532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16820 >Feature sequence184 676 215 gene locus_tag LOCUS_16830 676 215 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948329.1 protein_id gnl|my_center|LOCUS_16830 1014 1577 gene locus_tag LOCUS_16840 1014 1577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16840 2480 1632 gene locus_tag LOCUS_16850 2480 1632 CDS product Mrp/NBP35 family ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680483.1 protein_id gnl|my_center|LOCUS_16850 2754 3260 gene locus_tag LOCUS_16860 2754 3260 CDS product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436147.1 protein_id gnl|my_center|LOCUS_16860 3947 3354 gene locus_tag LOCUS_16870 3947 3354 CDS product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002984543.1 protein_id gnl|my_center|LOCUS_16870 5357 4104 gene locus_tag LOCUS_16880 5357 4104 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_139310338.1 protein_id gnl|my_center|LOCUS_16880 >Feature sequence185 121 648 gene locus_tag LOCUS_16890 121 648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16890 983 2554 gene locus_tag LOCUS_16900 983 2554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16900 3950 2628 gene locus_tag LOCUS_16910 3950 2628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16910 4112 5308 gene locus_tag LOCUS_16920 4112 5308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16920 >Feature sequence186 1161 118 gene locus_tag LOCUS_16930 1161 118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16930 1277 2032 gene locus_tag LOCUS_16940 1277 2032 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009891672.1 protein_id gnl|my_center|LOCUS_16940 2095 2964 gene locus_tag LOCUS_16950 gene hslO 2095 2964 CDS product Hsp33 family molecular chaperone HslO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048141.1 protein_id gnl|my_center|LOCUS_16950 2964 4886 gene locus_tag LOCUS_16960 2964 4886 CDS product NAD(+) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203175.1 protein_id gnl|my_center|LOCUS_16960 >Feature sequence187 4555 995 gene locus_tag LOCUS_16970 gene smc 4555 995 CDS product chromosome segregation protein SMC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047863.1 protein_id gnl|my_center|LOCUS_16970 5269 4577 gene locus_tag LOCUS_16980 gene rnc 5269 4577 CDS product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428341.1 protein_id gnl|my_center|LOCUS_16980 5654 5421 gene locus_tag LOCUS_16990 gene acpP 5654 5421 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003362599.1 protein_id gnl|my_center|LOCUS_16990 >Feature sequence188 597 265 gene locus_tag LOCUS_17000 gene mobC 597 265 CDS product plasmid mobilization relaxosome protein MobC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002368707.1 protein_id gnl|my_center|LOCUS_17000 <5696 597 gene locus_tag LOCUS_17010 <5696 597 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010774229.1:DEAD/DEAH box helicase family protein >Feature sequence189 <1 596 gene locus_tag LOCUS_17020 <1 596 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011016570.1:ATP-binding protein 1753 677 gene locus_tag LOCUS_17030 gene prfA 1753 677 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421389.1 protein_id gnl|my_center|LOCUS_17030 2709 1882 gene locus_tag LOCUS_17040 gene prmC 2709 1882 CDS product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437849.1 protein_id gnl|my_center|LOCUS_17040 3647 2727 gene locus_tag LOCUS_17050 3647 2727 CDS product DUF1385 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947980.1 protein_id gnl|my_center|LOCUS_17050 3973 3770 gene locus_tag LOCUS_17060 gene rpmE 3973 3770 CDS product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003151132.1 protein_id gnl|my_center|LOCUS_17060 5595 4174 gene locus_tag LOCUS_17070 gene rho 5595 4174 CDS product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966173.1 protein_id gnl|my_center|LOCUS_17070 >Feature sequence190 2 718 gene locus_tag LOCUS_17080 2 718 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964843.1 protein_id gnl|my_center|LOCUS_17080 733 3240 gene locus_tag LOCUS_17090 733 3240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17090 4612 3287 gene locus_tag LOCUS_17100 4612 3287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17100 5419 4745 gene locus_tag LOCUS_17110 5419 4745 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015943969.1 protein_id gnl|my_center|LOCUS_17110 >Feature sequence191 177 1070 gene locus_tag LOCUS_17120 gene whiA 177 1070 CDS product DNA-binding protein WhiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357358.1 protein_id gnl|my_center|LOCUS_17120 1089 1340 gene locus_tag LOCUS_17130 1089 1340 CDS product HPr family phosphocarrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003219835.1 protein_id gnl|my_center|LOCUS_17130 1372 2277 gene locus_tag LOCUS_17140 1372 2277 CDS product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233894.1 protein_id gnl|my_center|LOCUS_17140 2466 3332 gene locus_tag LOCUS_17150 gene fba 2466 3332 CDS product class II fructose-1,6-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964145.1 protein_id gnl|my_center|LOCUS_17150 3509 5629 gene locus_tag LOCUS_17160 3509 5629 CDS product glutamine synthetase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461804.1 protein_id gnl|my_center|LOCUS_17160 >Feature sequence192 826 2010 gene locus_tag LOCUS_17170 826 2010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17170 2632 2120 gene locus_tag LOCUS_17180 gene thiW 2632 2120 CDS product energy coupling factor transporter S component ThiW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001829480.1 protein_id gnl|my_center|LOCUS_17180 3827 2643 gene locus_tag LOCUS_17190 gene cytX 3827 2643 CDS product putative hydroxymethylpyrimidine transporter CytX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003705129.1 protein_id gnl|my_center|LOCUS_17190 4624 3824 gene locus_tag LOCUS_17200 gene thiD 4624 3824 CDS product bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966376.1 protein_id gnl|my_center|LOCUS_17200 5380 4745 gene locus_tag LOCUS_17210 gene thiE 5380 4745 CDS product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963817.1 protein_id gnl|my_center|LOCUS_17210 >Feature sequence193 617 174 gene locus_tag LOCUS_17220 617 174 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704963.1 protein_id gnl|my_center|LOCUS_17220 873 736 gene locus_tag LOCUS_17230 873 736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17230 1982 1122 gene locus_tag LOCUS_17240 gene araQ 1982 1122 CDS product arabinose ABC transporter permease AraQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229508.1 protein_id gnl|my_center|LOCUS_17240 2923 2009 gene locus_tag LOCUS_17250 2923 2009 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582885.1 protein_id gnl|my_center|LOCUS_17250 4509 3103 gene locus_tag LOCUS_17260 4509 3103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17260 5582 4557 gene locus_tag LOCUS_17270 gene malR 5582 4557 CDS product maltose operon transcriptional repressor MalR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000219042.1 protein_id gnl|my_center|LOCUS_17270 >Feature sequence194 <1 1103 gene locus_tag LOCUS_17280 <1 1103 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010973334.1:MYG1 family protein 1141 1833 gene locus_tag LOCUS_17290 1141 1833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17290 1800 1809 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1856 2503 gene locus_tag LOCUS_17300 1856 2503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17300 2519 3274 gene locus_tag LOCUS_17310 2519 3274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17310 3280 4038 gene locus_tag LOCUS_17320 3280 4038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17320 4025 4543 gene locus_tag LOCUS_17330 4025 4543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17330 4540 5514 gene locus_tag LOCUS_17340 4540 5514 CDS product PEP phosphonomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002901609.1 protein_id gnl|my_center|LOCUS_17340 >Feature sequence195 1 447 gene locus_tag LOCUS_17350 1 447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17350 471 794 gene locus_tag LOCUS_17360 471 794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17360 727 736 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 906 1886 gene locus_tag LOCUS_17370 gene fliM 906 1886 CDS product flagellar motor switch protein FliM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026183958.1 protein_id gnl|my_center|LOCUS_17370 1889 3028 gene locus_tag LOCUS_17380 gene fliY 1889 3028 CDS product flagellar motor switch phosphatase FliY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231962.1 protein_id gnl|my_center|LOCUS_17380 3058 3417 gene locus_tag LOCUS_17390 3058 3417 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965516.1 protein_id gnl|my_center|LOCUS_17390 3419 3811 gene locus_tag LOCUS_17400 3419 3811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17400 3821 4669 gene locus_tag LOCUS_17410 3821 4669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17410 4691 4963 gene locus_tag LOCUS_17420 gene fliQ 4691 4963 CDS product flagellar biosynthesis protein FliQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003220888.1 protein_id gnl|my_center|LOCUS_17420 >Feature sequence196 462 1850 gene locus_tag LOCUS_17430 462 1850 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000672121.1 protein_id gnl|my_center|LOCUS_17430 1958 2866 gene locus_tag LOCUS_17440 1958 2866 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003052879.1 protein_id gnl|my_center|LOCUS_17440 2883 3818 gene locus_tag LOCUS_17450 2883 3818 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001192007.1 protein_id gnl|my_center|LOCUS_17450 3892 4821 gene locus_tag LOCUS_17460 3892 4821 CDS product N-acetylneuraminate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000654136.1 protein_id gnl|my_center|LOCUS_17460 4968 5414 gene locus_tag LOCUS_17470 gene nanQ 4968 5414 CDS product N-acetylneuraminate anomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261399.1 protein_id gnl|my_center|LOCUS_17470 >Feature sequence197 315 1259 gene locus_tag LOCUS_17480 315 1259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17480 3511 1280 gene locus_tag LOCUS_17490 3511 1280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17490 5424 3508 gene locus_tag LOCUS_17500 gene typA 5424 3508 CDS product translational GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986883.1 protein_id gnl|my_center|LOCUS_17500 >Feature sequence198 <1 691 gene locus_tag LOCUS_17510 <1 691 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010965377.1:1-deoxy-D-xylulose-5-phosphate synthase 737 1540 gene locus_tag LOCUS_17520 737 1540 CDS product TlyA family rRNA (cytidine-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438136.1 protein_id gnl|my_center|LOCUS_17520 1521 2402 gene locus_tag LOCUS_17530 1521 2402 CDS product NAD(+)/NADH kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393018.1 protein_id gnl|my_center|LOCUS_17530 2431 2883 gene locus_tag LOCUS_17540 2431 2883 CDS product arginine repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965374.1 protein_id gnl|my_center|LOCUS_17540 2919 4598 gene locus_tag LOCUS_17550 gene recN 2919 4598 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009896126.1 protein_id gnl|my_center|LOCUS_17550 >Feature sequence199 694 470 gene locus_tag LOCUS_17560 694 470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17560 615 830 gene locus_tag LOCUS_17570 615 830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17570 1065 916 gene locus_tag LOCUS_17580 1065 916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17580 1171 1503 gene locus_tag LOCUS_17590 1171 1503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17590 1551 1838 gene locus_tag LOCUS_17600 1551 1838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17600 3209 1896 gene locus_tag LOCUS_17610 3209 1896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17610 3473 3228 gene locus_tag LOCUS_17620 3473 3228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17620 5310 3364 gene locus_tag LOCUS_17630 gene fusA 5310 3364 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201627021.1 protein_id gnl|my_center|LOCUS_17630 >Feature sequence200 570 1001 gene locus_tag LOCUS_17640 570 1001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17640 1285 1908 gene locus_tag LOCUS_17650 1285 1908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17650 1803 1812 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1857 2141 gene locus_tag LOCUS_17660 1857 2141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17660 2474 2247 gene locus_tag LOCUS_17670 2474 2247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17670 2603 3250 gene locus_tag LOCUS_17680 2603 3250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17680 3053 3062 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 4186 3239 gene locus_tag LOCUS_17690 4186 3239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17690 4921 4238 gene locus_tag LOCUS_17700 4921 4238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17700 5329 4940 gene locus_tag LOCUS_17710 5329 4940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17710 >Feature sequence201 976 1353 gene locus_tag LOCUS_17720 976 1353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17720 1311 1514 gene locus_tag LOCUS_17730 1311 1514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17730 1511 2182 gene locus_tag LOCUS_17740 1511 2182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17740 2186 2548 gene locus_tag LOCUS_17750 2186 2548 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860652.1 protein_id gnl|my_center|LOCUS_17750 2576 2947 gene locus_tag LOCUS_17760 2576 2947 CDS product ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861394.1 protein_id gnl|my_center|LOCUS_17760 3392 3922 gene locus_tag LOCUS_17770 3392 3922 CDS product cysteine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814019.1 protein_id gnl|my_center|LOCUS_17770 3971 4744 gene locus_tag LOCUS_17780 3971 4744 CDS product copper homeostasis protein CutC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203367.1 protein_id gnl|my_center|LOCUS_17780 4791 5072 gene locus_tag LOCUS_17790 4791 5072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17790 >Feature sequence202 1896 886 gene locus_tag LOCUS_17800 1896 886 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393756.1 protein_id gnl|my_center|LOCUS_17800 2844 1972 gene locus_tag LOCUS_17810 2844 1972 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068636.1 protein_id gnl|my_center|LOCUS_17810 3686 2844 gene locus_tag LOCUS_17820 3686 2844 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004112931.1 protein_id gnl|my_center|LOCUS_17820 5198 3774 gene locus_tag LOCUS_17830 5198 3774 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013583013.1 protein_id gnl|my_center|LOCUS_17830 >Feature sequence203 1067 462 gene locus_tag LOCUS_17840 gene plsY 1067 462 CDS product glycerol-3-phosphate 1-O-acyltransferase PlsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010494164.1 protein_id gnl|my_center|LOCUS_17840 2198 1080 gene locus_tag LOCUS_17850 2198 1080 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947974.1 protein_id gnl|my_center|LOCUS_17850 2306 2737 gene locus_tag LOCUS_17860 2306 2737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17860 2800 3402 gene locus_tag LOCUS_17870 2800 3402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17870 3450 5051 gene locus_tag LOCUS_17880 3450 5051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17880 5122 5253 gene locus_tag LOCUS_17890 5122 5253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17890 >Feature sequence204 616 1824 gene locus_tag LOCUS_17900 gene pncB 616 1824 CDS product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192078.1 protein_id gnl|my_center|LOCUS_17900 1843 2622 gene locus_tag LOCUS_17910 gene udp 1843 2622 CDS product uridine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001182060.1 protein_id gnl|my_center|LOCUS_17910 2663 3889 gene locus_tag LOCUS_17920 gene deoB 2663 3889 CDS product phosphopentomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001046067.1 protein_id gnl|my_center|LOCUS_17920 4046 4696 gene locus_tag LOCUS_17930 gene deoC 4046 4696 CDS product deoxyribose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000453154.1 protein_id gnl|my_center|LOCUS_17930 >Feature sequence205 398 249 gene locus_tag LOCUS_17940 398 249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17940 1547 582 gene locus_tag LOCUS_17950 1547 582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17950 2920 1544 gene locus_tag LOCUS_17960 2920 1544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17960 3830 2988 gene locus_tag LOCUS_17970 3830 2988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17970 4587 3934 gene locus_tag LOCUS_17980 4587 3934 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932569.1 protein_id gnl|my_center|LOCUS_17980 5039 4599 gene locus_tag LOCUS_17990 5039 4599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17990 >Feature sequence206 1806 193 gene locus_tag LOCUS_18000 1806 193 CDS product mannitol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_054937112.1 protein_id gnl|my_center|LOCUS_18000 2875 1793 gene locus_tag LOCUS_18010 gene uxuA 2875 1793 CDS product mannonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082566.1 protein_id gnl|my_center|LOCUS_18010 3182 4060 gene locus_tag LOCUS_18020 3182 4060 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964642.1 protein_id gnl|my_center|LOCUS_18020 4135 4680 gene locus_tag LOCUS_18030 gene ispF 4135 4680 CDS product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003425513.1 protein_id gnl|my_center|LOCUS_18030 >Feature sequence207 2030 384 gene locus_tag LOCUS_18040 2030 384 CDS product SulP family inorganic anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_129256806.1 protein_id gnl|my_center|LOCUS_18040 2296 2727 gene locus_tag LOCUS_18050 2296 2727 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419409.1 protein_id gnl|my_center|LOCUS_18050 3041 4831 gene locus_tag LOCUS_18060 3041 4831 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461751.1 protein_id gnl|my_center|LOCUS_18060 4791 4800 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 4878 5033 gene locus_tag LOCUS_18070 4878 5033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18070 >Feature sequence208 1620 277 gene locus_tag LOCUS_18080 1620 277 CDS product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_081360963.1 protein_id gnl|my_center|LOCUS_18080 2942 1890 gene locus_tag LOCUS_18090 2942 1890 CDS product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816655.1 protein_id gnl|my_center|LOCUS_18090 4607 3126 gene locus_tag LOCUS_18100 4607 3126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18100 4920 4845 gene locus_tag LOCUS_t00100 4920 4845 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 5016 4942 gene locus_tag LOCUS_t00110 5016 4942 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence209 832 92 gene locus_tag LOCUS_18110 832 92 CDS product copper homeostasis protein CutC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002674428.1 protein_id gnl|my_center|LOCUS_18110 4605 1060 gene locus_tag LOCUS_18120 gene nifJ 4605 1060 CDS product pyruvate:ferredoxin (flavodoxin) oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987043.1 protein_id gnl|my_center|LOCUS_18120 >Feature sequence210 3202 2519 gene locus_tag LOCUS_18130 gene cwlD 3202 2519 CDS product N-acetylmuramoyl-L-alanine amidase CwlD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048347.1 protein_id gnl|my_center|LOCUS_18130 5068 3332 gene locus_tag LOCUS_18140 5068 3332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18140 >Feature sequence211 369 61 gene locus_tag LOCUS_18150 369 61 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18150 524 348 gene locus_tag LOCUS_18160 524 348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18160 986 663 gene locus_tag LOCUS_18170 986 663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18170 1871 1068 gene locus_tag LOCUS_18180 1871 1068 CDS product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038090.1 protein_id gnl|my_center|LOCUS_18180 2638 1892 gene locus_tag LOCUS_18190 2638 1892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18190 3622 2645 gene locus_tag LOCUS_18200 3622 2645 CDS product DUF3991 and toprim domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002368706.1 protein_id gnl|my_center|LOCUS_18200 4782 3622 gene locus_tag LOCUS_18210 gene metK 4782 3622 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229102.1 protein_id gnl|my_center|LOCUS_18210 >Feature sequence212 2333 216 gene locus_tag LOCUS_18220 gene htpG 2333 216 CDS product molecular chaperone HtpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435963.1 protein_id gnl|my_center|LOCUS_18220 >Feature sequence213 762 133 gene locus_tag LOCUS_18230 762 133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18230 4862 762 gene locus_tag LOCUS_18240 4862 762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18240 >Feature sequence214 823 1143 gene locus_tag LOCUS_18250 823 1143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18250 1246 1533 gene locus_tag LOCUS_18260 1246 1533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18260 1588 1791 gene locus_tag LOCUS_18270 1588 1791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18270 1923 1932 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2429 2178 gene locus_tag LOCUS_18280 2429 2178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18280 3476 2961 gene locus_tag LOCUS_18290 3476 2961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18290 4177 3524 gene locus_tag LOCUS_18300 4177 3524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18300 4516 4199 gene locus_tag LOCUS_18310 4516 4199 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476650.1 protein_id gnl|my_center|LOCUS_18310 >Feature sequence215 524 63 gene locus_tag LOCUS_18320 524 63 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18320 1750 524 gene locus_tag LOCUS_18330 gene tyrS 1750 524 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048264.1 protein_id gnl|my_center|LOCUS_18330 3738 2272 gene locus_tag LOCUS_18340 3738 2272 CDS product alpha-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860825.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18340 3988 3725 gene locus_tag LOCUS_18350 3988 3725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18350 3749 3758 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence216 1380 1036 gene locus_tag LOCUS_18360 1380 1036 CDS product putative DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000891062.1 protein_id gnl|my_center|LOCUS_18360 1666 1514 gene locus_tag LOCUS_18370 1666 1514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18370 3040 1682 gene locus_tag LOCUS_18380 3040 1682 CDS product NCS2 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496463.1 protein_id gnl|my_center|LOCUS_18380 3649 3125 gene locus_tag LOCUS_18390 3649 3125 CDS product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426450.1 protein_id gnl|my_center|LOCUS_18390 <4925 3740 gene locus_tag LOCUS_18400 <4925 3740 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011017132.1:threonine ammonia-lyase >Feature sequence217 269 646 gene locus_tag LOCUS_18410 269 646 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359271.1 protein_id gnl|my_center|LOCUS_18410 650 1537 gene locus_tag LOCUS_18420 650 1537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18420 3159 1666 gene locus_tag LOCUS_18430 gene thrC 3159 1666 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964317.1 protein_id gnl|my_center|LOCUS_18430 4873 3230 gene locus_tag LOCUS_18440 4873 3230 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963863.1 protein_id gnl|my_center|LOCUS_18440 >Feature sequence218 968 102 gene locus_tag LOCUS_18450 968 102 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861239.1 protein_id gnl|my_center|LOCUS_18450 1158 1012 gene locus_tag LOCUS_18460 1158 1012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18460 1853 1227 gene locus_tag LOCUS_18470 1853 1227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18470 2072 2725 gene locus_tag LOCUS_18480 gene rr06 2072 2725 CDS product two-component system response regulator RR06 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001024075.1 protein_id gnl|my_center|LOCUS_18480 2796 4160 gene locus_tag LOCUS_18490 gene vncS 2796 4160 CDS product sensor histidine kinase VncS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000831343.1 protein_id gnl|my_center|LOCUS_18490 >Feature sequence219 237 2192 gene locus_tag LOCUS_18500 237 2192 CDS product bifunctional UDP-sugar hydrolase/5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878377.1 protein_id gnl|my_center|LOCUS_18500 2277 3050 gene locus_tag LOCUS_18510 2277 3050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18510 3207 3374 gene locus_tag LOCUS_18520 3207 3374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18520 3510 3609 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3652 4545 gene locus_tag LOCUS_18530 3652 4545 CDS product DUF438 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393430.1 protein_id gnl|my_center|LOCUS_18530 4665 4546 gene locus_tag LOCUS_18540 4665 4546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18540 >Feature sequence220 1971 808 gene locus_tag LOCUS_18550 gene lsrB 1971 808 CDS product autoinducer 2 ABC transporter substrate-binding protein LsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000823631.1 protein_id gnl|my_center|LOCUS_18550 3071 2031 gene locus_tag LOCUS_18560 3071 2031 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000878507.1 protein_id gnl|my_center|LOCUS_18560 4090 3071 gene locus_tag LOCUS_18570 4090 3071 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000682144.1 protein_id gnl|my_center|LOCUS_18570 <4825 4087 gene locus_tag LOCUS_18580 <4825 4087 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000426491.1:sugar ABC transporter ATP-binding protein >Feature sequence221 2176 176 gene locus_tag LOCUS_18590 2176 176 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989492.1 protein_id gnl|my_center|LOCUS_18590 2344 2353 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2430 3917 gene locus_tag LOCUS_18600 2430 3917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18600 >Feature sequence222 605 48 gene locus_tag LOCUS_18610 605 48 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18610 1044 1193 gene locus_tag LOCUS_18620 1044 1193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18620 2229 2777 gene locus_tag LOCUS_18630 2229 2777 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050754228.1 protein_id gnl|my_center|LOCUS_18630 3569 2826 gene locus_tag LOCUS_18640 3569 2826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18640 4788 3619 gene locus_tag LOCUS_18650 4788 3619 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000856534.1 protein_id gnl|my_center|LOCUS_18650 >Feature sequence223 1555 893 gene locus_tag LOCUS_18660 gene nth 1555 893 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583053.1 protein_id gnl|my_center|LOCUS_18660 3651 1624 gene locus_tag LOCUS_18670 3651 1624 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002379727.1 protein_id gnl|my_center|LOCUS_18670 4661 3654 gene locus_tag LOCUS_18680 4661 3654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18680 >Feature sequence224 231 902 gene locus_tag LOCUS_18690 231 902 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948592.1 protein_id gnl|my_center|LOCUS_18690 922 1980 gene locus_tag LOCUS_18700 922 1980 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928176.1 protein_id gnl|my_center|LOCUS_18700 2029 2541 gene locus_tag LOCUS_18710 2029 2541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18710 2710 3723 gene locus_tag LOCUS_18720 2710 3723 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198871.1 protein_id gnl|my_center|LOCUS_18720 3769 4593 gene locus_tag LOCUS_18730 3769 4593 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731440.1 protein_id gnl|my_center|LOCUS_18730 >Feature sequence225 4299 2317 gene locus_tag LOCUS_18740 4299 2317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18740 >Feature sequence226 1817 54 gene locus_tag LOCUS_18750 gene aspS 1817 54 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029239.1 protein_id gnl|my_center|LOCUS_18750 3305 2046 gene locus_tag LOCUS_18760 gene hisS 3305 2046 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964121.1 protein_id gnl|my_center|LOCUS_18760 3901 3491 gene locus_tag LOCUS_18770 3901 3491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18770 4633 4352 gene locus_tag LOCUS_18780 4633 4352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18780 >Feature sequence227 1345 149 gene locus_tag LOCUS_18790 1345 149 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083240.1 protein_id gnl|my_center|LOCUS_18790 1405 1504 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1994 1656 gene locus_tag LOCUS_18800 1994 1656 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461711.1 protein_id gnl|my_center|LOCUS_18800 4398 2278 gene locus_tag LOCUS_18810 4398 2278 CDS product glutamine synthetase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812354.1 protein_id gnl|my_center|LOCUS_18810 >Feature sequence228 2424 967 gene locus_tag LOCUS_18820 gene gatA 2424 967 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393505.1 protein_id gnl|my_center|LOCUS_18820 2771 2478 gene locus_tag LOCUS_18830 gene gatC 2771 2478 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544984.1 protein_id gnl|my_center|LOCUS_18830 4132 2801 gene locus_tag LOCUS_18840 gene aspS 4132 2801 CDS product aspartate--tRNA(Asn) ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887698.1 protein_id gnl|my_center|LOCUS_18840 >Feature sequence229 180 401 gene locus_tag LOCUS_18850 180 401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18850 462 893 gene locus_tag LOCUS_18860 462 893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_18860 890 2164 gene locus_tag LOCUS_18870 890 2164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18870 >Feature sequence230 1211 294 gene locus_tag LOCUS_18880 1211 294 CDS product ribonuclease Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014518928.1 protein_id gnl|my_center|LOCUS_18880 1681 1244 gene locus_tag LOCUS_18890 gene rimI 1681 1244 CDS product ribosomal protein S18-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817348.1 protein_id gnl|my_center|LOCUS_18890 2385 1678 gene locus_tag LOCUS_18900 gene tsaB 2385 1678 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048262.1 protein_id gnl|my_center|LOCUS_18900 2843 2406 gene locus_tag LOCUS_18910 gene tsaE 2843 2406 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234079.1 protein_id gnl|my_center|LOCUS_18910 3362 2871 gene locus_tag LOCUS_18920 3362 2871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18920 4180 3557 gene locus_tag LOCUS_18930 4180 3557 CDS product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966126.1 protein_id gnl|my_center|LOCUS_18930 >Feature sequence231 138 2009 gene locus_tag LOCUS_18940 gene uvrC 138 2009 CDS product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963830.1 protein_id gnl|my_center|LOCUS_18940 2102 3148 gene locus_tag LOCUS_18950 gene hprK 2102 3148 CDS product HPr(Ser) kinase/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416935.1 protein_id gnl|my_center|LOCUS_18950 3031 3130 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3194 4585 gene locus_tag LOCUS_18960 3194 4585 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986917.1 protein_id gnl|my_center|LOCUS_18960 >Feature sequence232 1028 117 gene locus_tag LOCUS_18970 1028 117 CDS product MetQ/NlpA family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004112601.1 protein_id gnl|my_center|LOCUS_18970 1720 1061 gene locus_tag LOCUS_18980 1720 1061 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964303.1 protein_id gnl|my_center|LOCUS_18980 2753 1710 gene locus_tag LOCUS_18990 2753 1710 CDS product methionine ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356639.1 protein_id gnl|my_center|LOCUS_18990 4077 3172 gene locus_tag LOCUS_19000 4077 3172 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263217.1 protein_id gnl|my_center|LOCUS_19000 4451 4110 gene locus_tag LOCUS_19010 4451 4110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19010 4703 4473 gene locus_tag LOCUS_19020 4703 4473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19020 >Feature sequence233 <1 2547 gene locus_tag LOCUS_19030 <1 2547 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000412819.1:DNA polymerase I 2599 3195 gene locus_tag LOCUS_19040 gene coaE 2599 3195 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941181.1 protein_id gnl|my_center|LOCUS_19040 >Feature sequence234 1756 71 gene locus_tag LOCUS_19050 1756 71 CDS product carbon starvation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948291.1 protein_id gnl|my_center|LOCUS_19050 2522 2283 gene locus_tag LOCUS_19060 2522 2283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19060 2797 3633 gene locus_tag LOCUS_19070 2797 3633 CDS product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244896.1 protein_id gnl|my_center|LOCUS_19070 3184 3193 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3724 4215 gene locus_tag LOCUS_19080 3724 4215 CDS product dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723427.1 protein_id gnl|my_center|LOCUS_19080 >Feature sequence235 584 138 gene locus_tag LOCUS_19090 584 138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19090 1608 598 gene locus_tag LOCUS_19100 1608 598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19100 2008 1829 gene locus_tag LOCUS_19110 2008 1829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19110 2668 3090 gene locus_tag LOCUS_19120 2668 3090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19120 3631 3374 gene locus_tag LOCUS_19130 3631 3374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19130 4105 3728 gene locus_tag LOCUS_19140 4105 3728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19140 4547 4131 gene locus_tag LOCUS_19150 4547 4131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19150 >Feature sequence236 112 1560 gene locus_tag LOCUS_19160 112 1560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19160 1577 2830 gene locus_tag LOCUS_19170 1577 2830 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392196.1 protein_id gnl|my_center|LOCUS_19170 2805 4031 gene locus_tag LOCUS_19180 2805 4031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19180 >Feature sequence237 39 1430 gene locus_tag LOCUS_19190 39 1430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19190 1458 2153 gene locus_tag LOCUS_19200 1458 2153 CDS product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003360698.1 protein_id gnl|my_center|LOCUS_19200 2218 2730 gene locus_tag LOCUS_19210 2218 2730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19210 2742 3491 gene locus_tag LOCUS_19220 2742 3491 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476135.1 protein_id gnl|my_center|LOCUS_19220 3507 4607 gene locus_tag LOCUS_19230 gene aroB 3507 4607 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009893310.1 protein_id gnl|my_center|LOCUS_19230 >Feature sequence238 198 1319 gene locus_tag LOCUS_19240 198 1319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19240 1477 1743 gene locus_tag LOCUS_19250 gene rpsO 1477 1743 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392569.1 protein_id gnl|my_center|LOCUS_19250 1963 4056 gene locus_tag LOCUS_19260 gene pnp 1963 4056 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438316.1 protein_id gnl|my_center|LOCUS_19260 >Feature sequence239 744 457 gene locus_tag LOCUS_19270 744 457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19270 1139 708 gene locus_tag LOCUS_19280 1139 708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19280 730 739 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2461 1214 gene locus_tag LOCUS_19290 2461 1214 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965154.1 protein_id gnl|my_center|LOCUS_19290 3386 2454 gene locus_tag LOCUS_19300 3386 2454 CDS product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358959.1 protein_id gnl|my_center|LOCUS_19300 <4553 3544 gene locus_tag LOCUS_19310 <4553 3544 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002355994.1:oxaloacetate decarboxylase subunit alpha >Feature sequence240 <1 696 gene locus_tag LOCUS_19320 <1 696 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002296505.1:DNA/RNA non-specific endonuclease 662 1396 gene locus_tag LOCUS_19330 662 1396 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461790.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_19330 1558 2802 gene locus_tag LOCUS_19340 1558 2802 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461646.1 protein_id gnl|my_center|LOCUS_19340 2814 3548 gene locus_tag LOCUS_19350 2814 3548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19350 3637 3783 gene locus_tag LOCUS_19360 3637 3783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19360 >Feature sequence241 2723 1311 gene locus_tag LOCUS_19370 2723 1311 CDS product melibiose:sodium transporter MelB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679112.1 protein_id gnl|my_center|LOCUS_19370 4248 2758 gene locus_tag LOCUS_19380 4248 2758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19380 >Feature sequence242 <1 1448 gene locus_tag LOCUS_19390 <1 1448 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010965637.1:endonuclease MutS2 1531 2232 gene locus_tag LOCUS_19400 1531 2232 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359320.1 protein_id gnl|my_center|LOCUS_19400 2233 3645 gene locus_tag LOCUS_19410 2233 3645 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966495.1 protein_id gnl|my_center|LOCUS_19410 4238 3726 gene locus_tag LOCUS_19420 4238 3726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19420 4501 4238 gene locus_tag LOCUS_19430 4501 4238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19430 >Feature sequence243 416 159 gene locus_tag LOCUS_19440 416 159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19440 1197 403 gene locus_tag LOCUS_19450 1197 403 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940782.1 protein_id gnl|my_center|LOCUS_19450 2635 1241 gene locus_tag LOCUS_19460 gene rhaB 2635 1241 CDS product rhamnulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288250.1 protein_id gnl|my_center|LOCUS_19460 3084 2650 gene locus_tag LOCUS_19470 3084 2650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19470 3613 3173 gene locus_tag LOCUS_19480 3613 3173 CDS product RbsD/FucU domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009993892.1 protein_id gnl|my_center|LOCUS_19480 4471 3836 gene locus_tag LOCUS_19490 4471 3836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19490 >Feature sequence244 4344 3640 gene locus_tag LOCUS_19500 4344 3640 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_171779440.1 protein_id gnl|my_center|LOCUS_19500 >Feature sequence245 737 1009 gene locus_tag LOCUS_19510 737 1009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19510 1198 1419 gene locus_tag LOCUS_19520 1198 1419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19520 1517 2668 gene locus_tag LOCUS_19530 1517 2668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19530 2681 3199 gene locus_tag LOCUS_19540 2681 3199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19540 4176 3547 gene locus_tag LOCUS_19550 gene upp 4176 3547 CDS product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003699935.1 protein_id gnl|my_center|LOCUS_19550 >Feature sequence246 <1 2059 gene locus_tag LOCUS_19560 <1 2059 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011948706.1:ferrous iron transport protein B 2130 2261 gene locus_tag LOCUS_19570 2130 2261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19570 2312 2614 gene locus_tag LOCUS_19580 2312 2614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19580 3568 2738 gene locus_tag LOCUS_19590 3568 2738 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811658.1 protein_id gnl|my_center|LOCUS_19590 >Feature sequence247 71 1108 gene locus_tag LOCUS_19600 71 1108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19600 624 633 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1125 1499 gene locus_tag LOCUS_19610 gene rbfA 1125 1499 CDS product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000776437.1 protein_id gnl|my_center|LOCUS_19610 1502 2449 gene locus_tag LOCUS_19620 1502 2449 CDS product bifunctional oligoribonuclease/PAP phosphatase NrnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053104374.1 protein_id gnl|my_center|LOCUS_19620 2476 3411 gene locus_tag LOCUS_19630 gene truB 2476 3411 CDS product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986789.1 protein_id gnl|my_center|LOCUS_19630 3408 4331 gene locus_tag LOCUS_19640 3408 4331 CDS product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438310.1 protein_id gnl|my_center|LOCUS_19640 >Feature sequence248 2211 1891 gene locus_tag LOCUS_19650 2211 1891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19650 2473 2198 gene locus_tag LOCUS_19660 2473 2198 CDS product YlxR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419469.1 protein_id gnl|my_center|LOCUS_19660 3647 2490 gene locus_tag LOCUS_19670 gene nusA 3647 2490 CDS product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460395.1 protein_id gnl|my_center|LOCUS_19670 4151 3684 gene locus_tag LOCUS_19680 gene rimP 4151 3684 CDS product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288499.1 protein_id gnl|my_center|LOCUS_19680 >Feature sequence249 210 1949 gene locus_tag LOCUS_19690 210 1949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19690 1971 3464 gene locus_tag LOCUS_19700 1971 3464 CDS product MBOAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048068.1 protein_id gnl|my_center|LOCUS_19700 >Feature sequence250 3016 599 gene locus_tag LOCUS_19710 gene pheT 3016 599 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357703.1 protein_id gnl|my_center|LOCUS_19710 4076 3054 gene locus_tag LOCUS_19720 gene pheS 4076 3054 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942166.1 protein_id gnl|my_center|LOCUS_19720 >Feature sequence251 2138 549 gene locus_tag LOCUS_19730 2138 549 CDS product cobyric acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437761.1 protein_id gnl|my_center|LOCUS_19730 3253 2126 gene locus_tag LOCUS_19740 3253 2126 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439823.1 protein_id gnl|my_center|LOCUS_19740 2600 2609 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 4317 3340 gene locus_tag LOCUS_19750 4317 3340 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682008.1 protein_id gnl|my_center|LOCUS_19750 >Feature sequence252 92 1315 gene locus_tag LOCUS_19760 92 1315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19760 >Feature sequence253 2307 970 gene locus_tag LOCUS_19770 2307 970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19770 3430 2324 gene locus_tag LOCUS_19780 3430 2324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19780 <4363 3471 gene locus_tag LOCUS_19790 <4363 3471 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010966626.1:MATE family efflux transporter >Feature sequence254 1111 140 gene locus_tag LOCUS_19800 1111 140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19800 2448 1216 gene locus_tag LOCUS_19810 2448 1216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19810 3132 2449 gene locus_tag LOCUS_19820 3132 2449 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986462.1 protein_id gnl|my_center|LOCUS_19820 4058 3147 gene locus_tag LOCUS_19830 4058 3147 CDS product DUF975 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949104.1 protein_id gnl|my_center|LOCUS_19830 >Feature sequence255 382 2454 gene locus_tag LOCUS_19840 382 2454 CDS product DNA topoisomerase 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861108.1 protein_id gnl|my_center|LOCUS_19840 >Feature sequence256 1682 150 gene locus_tag LOCUS_19850 1682 150 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012028506.1 protein_id gnl|my_center|LOCUS_19850 2002 2925 gene locus_tag LOCUS_19860 2002 2925 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009924790.1 protein_id gnl|my_center|LOCUS_19860 2943 3827 gene locus_tag LOCUS_19870 2943 3827 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003727964.1 protein_id gnl|my_center|LOCUS_19870 >Feature sequence257 <1 1726 gene locus_tag LOCUS_19880 <1 1726 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005461246.1:N,N'-diacetylchitobiose phosphorylase >Feature sequence258 575 249 gene locus_tag LOCUS_19890 575 249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19890 1660 647 gene locus_tag LOCUS_19900 1660 647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19900 2465 1686 gene locus_tag LOCUS_19910 2465 1686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19910 2756 2490 gene locus_tag LOCUS_19920 2756 2490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19920 3711 2821 gene locus_tag LOCUS_19930 3711 2821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19930 4111 3896 gene locus_tag LOCUS_19940 4111 3896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19940 >Feature sequence259 787 149 gene locus_tag LOCUS_19950 787 149 CDS product RpiB/LacA/LacB family sugar-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965894.1 protein_id gnl|my_center|LOCUS_19950 1696 836 gene locus_tag LOCUS_19960 gene kduI 1696 836 CDS product 5-dehydro-4-deoxy-D-glucuronate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098576.1 protein_id gnl|my_center|LOCUS_19960 3141 1723 gene locus_tag LOCUS_19970 gene uxaC 3141 1723 CDS product glucuronate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964011.1 protein_id gnl|my_center|LOCUS_19970 4177 3161 gene locus_tag LOCUS_19980 gene ccpA 4177 3161 CDS product catabolite control protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003564050.1 protein_id gnl|my_center|LOCUS_19980 >Feature sequence260 1277 2131 gene locus_tag LOCUS_19990 1277 2131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19990 2128 3096 gene locus_tag LOCUS_20000 2128 3096 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053138.1 protein_id gnl|my_center|LOCUS_20000 3086 4123 gene locus_tag LOCUS_20010 3086 4123 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003321939.1 protein_id gnl|my_center|LOCUS_20010 >Feature sequence261 4145 945 gene locus_tag LOCUS_20020 4145 945 CDS product type I restriction endonuclease subunit R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103421.1 protein_id gnl|my_center|LOCUS_20020 >Feature sequence262 1479 991 gene locus_tag LOCUS_20030 1479 991 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986315.1 protein_id gnl|my_center|LOCUS_20030 1492 1591 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1792 3060 gene locus_tag LOCUS_20040 gene larC 1792 3060 CDS product nickel pincer cofactor biosynthesis protein LarC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583893.1 protein_id gnl|my_center|LOCUS_20040 4003 3149 gene locus_tag LOCUS_20050 gene xerD 4003 3149 CDS product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393010.1 protein_id gnl|my_center|LOCUS_20050 >Feature sequence263 297 1226 gene locus_tag LOCUS_20060 297 1226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20060 1231 1650 gene locus_tag LOCUS_20070 1231 1650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20070 1778 1981 gene locus_tag LOCUS_20080 1778 1981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20080 2002 2175 gene locus_tag LOCUS_20090 2002 2175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20090 2189 2587 gene locus_tag LOCUS_20100 2189 2587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20100 2601 2993 gene locus_tag LOCUS_20110 2601 2993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20110 2986 3867 gene locus_tag LOCUS_20120 2986 3867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20120 >Feature sequence264 504 85 gene locus_tag LOCUS_20130 504 85 CDS product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004309783.1 protein_id gnl|my_center|LOCUS_20130 1482 520 gene locus_tag LOCUS_20140 1482 520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20140 1788 3065 gene locus_tag LOCUS_20150 1788 3065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20150 2549 2558 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 4172 3096 gene locus_tag LOCUS_20160 4172 3096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20160 >Feature sequence265 121 1488 gene locus_tag LOCUS_20170 121 1488 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066177.1 protein_id gnl|my_center|LOCUS_20170 1502 2089 gene locus_tag LOCUS_20180 1502 2089 CDS product cytidylate kinase-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435157.1 protein_id gnl|my_center|LOCUS_20180 2698 2180 gene locus_tag LOCUS_20190 2698 2180 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434191.1 protein_id gnl|my_center|LOCUS_20190 4022 2799 gene locus_tag LOCUS_20200 4022 2799 CDS product HD-GYP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965827.1 protein_id gnl|my_center|LOCUS_20200 >Feature sequence266 446 99 gene locus_tag LOCUS_20210 446 99 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005806128.1 protein_id gnl|my_center|LOCUS_20210 2075 591 gene locus_tag LOCUS_20220 2075 591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20220 2495 3964 gene locus_tag LOCUS_20230 2495 3964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20230 >Feature sequence267 842 1081 gene locus_tag LOCUS_20240 842 1081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20240 1182 3275 gene locus_tag LOCUS_20250 gene rnr 1182 3275 CDS product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964034.1 protein_id gnl|my_center|LOCUS_20250 2436 2445 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3367 3834 gene locus_tag LOCUS_20260 gene smpB 3367 3834 CDS product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815658.1 protein_id gnl|my_center|LOCUS_20260 >Feature sequence268 1807 860 gene locus_tag LOCUS_20270 1807 860 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949052.1 protein_id gnl|my_center|LOCUS_20270 3162 1870 gene locus_tag LOCUS_20280 3162 1870 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814884.1 protein_id gnl|my_center|LOCUS_20280 3586 3191 gene locus_tag LOCUS_20290 3586 3191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20290 >Feature sequence269 647 3298 gene locus_tag LOCUS_20300 647 3298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20300 3970 3293 gene locus_tag LOCUS_20310 gene tsaA 3970 3293 CDS product tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459538.1 protein_id gnl|my_center|LOCUS_20310 >Feature sequence270 1138 161 gene locus_tag LOCUS_20320 gene bsh 1138 161 CDS product choloylglycine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723950.1 protein_id gnl|my_center|LOCUS_20320 1831 1445 gene locus_tag LOCUS_20330 1831 1445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20330 2449 1832 gene locus_tag LOCUS_20340 2449 1832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_20340 3217 2504 gene locus_tag LOCUS_20350 3217 2504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20350 >Feature sequence271 43 1104 gene locus_tag LOCUS_20360 43 1104 CDS product pectinesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966644.1 protein_id gnl|my_center|LOCUS_20360 1311 1463 gene locus_tag LOCUS_20370 1311 1463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20370 3112 1541 gene locus_tag LOCUS_20380 3112 1541 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005898122.1 protein_id gnl|my_center|LOCUS_20380 3431 3249 gene locus_tag LOCUS_20390 3431 3249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20390 3602 3438 gene locus_tag LOCUS_20400 3602 3438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20400 4068 3613 gene locus_tag LOCUS_20410 4068 3613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20410 3662 3671 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence272 888 121 gene locus_tag LOCUS_20420 888 121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20420 2810 873 gene locus_tag LOCUS_20430 2810 873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20430 >Feature sequence273 75 1103 gene locus_tag LOCUS_20440 75 1103 CDS product alcohol dehydrogenase catalytic domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582778.1 protein_id gnl|my_center|LOCUS_20440 1113 1505 gene locus_tag LOCUS_20450 1113 1505 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289210.1 protein_id gnl|my_center|LOCUS_20450 1524 2888 gene locus_tag LOCUS_20460 1524 2888 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242688.1 protein_id gnl|my_center|LOCUS_20460 2872 3846 gene locus_tag LOCUS_20470 2872 3846 CDS product carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009968826.1 protein_id gnl|my_center|LOCUS_20470 3902 4066 gene locus_tag LOCUS_20480 3902 4066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20480 >Feature sequence274 223 1104 gene locus_tag LOCUS_20490 223 1104 CDS product aldose 1-epimerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767778.1 protein_id gnl|my_center|LOCUS_20490 1222 1614 gene locus_tag LOCUS_20500 1222 1614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20500 1691 1831 gene locus_tag LOCUS_20510 gene scfA 1691 1831 CDS product six-cysteine ranthipeptide SCIFF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009891067.1 protein_id gnl|my_center|LOCUS_20510 1967 3343 gene locus_tag LOCUS_20520 gene scfB 1967 3343 CDS product thioether cross-link-forming SCIFF peptide maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861666.1 protein_id gnl|my_center|LOCUS_20520 >Feature sequence275 1395 343 gene locus_tag LOCUS_20530 gene pta 1395 343 CDS product phosphate acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130342.1 protein_id gnl|my_center|LOCUS_20530 1960 1469 gene locus_tag LOCUS_20540 1960 1469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20540 2876 2403 gene locus_tag LOCUS_20550 gene tadA 2876 2403 CDS product tRNA adenosine(34) deaminase TadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001832295.1 protein_id gnl|my_center|LOCUS_20550 3038 3628 gene locus_tag LOCUS_20560 3038 3628 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003163971.1 protein_id gnl|my_center|LOCUS_20560 >Feature sequence276 483 995 gene locus_tag LOCUS_20570 483 995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20570 2911 1112 gene locus_tag LOCUS_20580 gene fucI 2911 1112 CDS product L-fucose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107686.1 protein_id gnl|my_center|LOCUS_20580 3051 3902 gene locus_tag LOCUS_20590 3051 3902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20590 >Feature sequence277 146 1933 gene locus_tag LOCUS_20600 gene argS 146 1933 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003020254.1 protein_id gnl|my_center|LOCUS_20600 2153 3028 gene locus_tag LOCUS_20610 gene spoIIIAA 2153 3028 CDS product stage III sporulation protein AA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230226.1 protein_id gnl|my_center|LOCUS_20610 3022 3540 gene locus_tag LOCUS_20620 3022 3540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20620 3574 3768 gene locus_tag LOCUS_20630 gene spoIIIAC 3574 3768 CDS product stage III sporulation protein AC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888937.1 protein_id gnl|my_center|LOCUS_20630 >Feature sequence278 <1 891 gene locus_tag LOCUS_20640 <1 891 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003230230.1:stage III sporulation protein AE 911 1471 gene locus_tag LOCUS_20650 911 1471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20650 1464 2045 gene locus_tag LOCUS_20660 1464 2045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20660 2061 2825 gene locus_tag LOCUS_20670 2061 2825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20670 >Feature sequence279 1678 62 gene locus_tag LOCUS_20680 gene guaA 1678 62 CDS product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048241.1 protein_id gnl|my_center|LOCUS_20680 2348 1839 gene locus_tag LOCUS_20690 2348 1839 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001103118.1 protein_id gnl|my_center|LOCUS_20690 3868 3353 gene locus_tag LOCUS_20700 3868 3353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20700 >Feature sequence280 804 172 gene locus_tag LOCUS_20710 804 172 CDS product ThuA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583636.1 protein_id gnl|my_center|LOCUS_20710 1114 950 gene locus_tag LOCUS_20720 1114 950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20720 1488 1111 gene locus_tag LOCUS_20730 1488 1111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20730 1813 1502 gene locus_tag LOCUS_20740 1813 1502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20740 1892 3883 gene locus_tag LOCUS_20750 1892 3883 CDS product DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002399687.1 protein_id gnl|my_center|LOCUS_20750 >Feature sequence281 <1 1493 gene locus_tag LOCUS_20760 <1 1493 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015944693.1:protein translocase subunit SecDF 1575 1856 gene locus_tag LOCUS_20770 1575 1856 CDS product DUF1294 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000871355.1 protein_id gnl|my_center|LOCUS_20770 1971 3209 gene locus_tag LOCUS_20780 gene glyA 1971 3209 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001981400.1 protein_id gnl|my_center|LOCUS_20780 3887 3381 gene locus_tag LOCUS_20790 3887 3381 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861543.1 protein_id gnl|my_center|LOCUS_20790 >Feature sequence282 75 341 gene locus_tag LOCUS_20800 75 341 CDS product type II toxin-antitoxin system RelB/DinJ family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004113434.1 protein_id gnl|my_center|LOCUS_20800 380 601 gene locus_tag LOCUS_20810 380 601 CDS product Txe/YoeB family addiction module toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464459.1 protein_id gnl|my_center|LOCUS_20810 2424 1195 gene locus_tag LOCUS_20820 2424 1195 CDS product FprA family A-type flavoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903248.1 protein_id gnl|my_center|LOCUS_20820 <3997 2524 gene locus_tag LOCUS_20830 <3997 2524 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005903247.1:acyl-CoA dehydrogenase family protein >Feature sequence283 1051 470 gene locus_tag LOCUS_20840 1051 470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20840 1565 1176 gene locus_tag LOCUS_20850 1565 1176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20850 1872 1636 gene locus_tag LOCUS_20860 1872 1636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20860 3212 1887 gene locus_tag LOCUS_20870 3212 1887 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009925931.1 protein_id gnl|my_center|LOCUS_20870 3679 3257 gene locus_tag LOCUS_20880 3679 3257 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640626.1 protein_id gnl|my_center|LOCUS_20880 >Feature sequence284 1576 221 gene locus_tag LOCUS_20890 1576 221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20890 2204 1839 gene locus_tag LOCUS_20900 2204 1839 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435155.1 protein_id gnl|my_center|LOCUS_20900 2784 2416 gene locus_tag LOCUS_20910 2784 2416 CDS product MmcQ/YjbR family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244448.1 protein_id gnl|my_center|LOCUS_20910 3885 2938 gene locus_tag LOCUS_20920 3885 2938 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109323.1 protein_id gnl|my_center|LOCUS_20920 >Feature sequence285 302 1366 gene locus_tag LOCUS_20930 302 1366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20930 2255 1386 gene locus_tag LOCUS_20940 gene sdaAA 2255 1386 CDS product L-serine ammonia-lyase, iron-sulfur-dependent, subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548060.1 protein_id gnl|my_center|LOCUS_20940 2947 2276 gene locus_tag LOCUS_20950 gene sdaAB 2947 2276 CDS product L-serine ammonia-lyase, iron-sulfur-dependent subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000877446.1 protein_id gnl|my_center|LOCUS_20950 >Feature sequence286 1963 500 gene locus_tag LOCUS_20960 gene tilS 1963 500 CDS product tRNA lysidine(34) synthetase TilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434952.1 protein_id gnl|my_center|LOCUS_20960 3808 1964 gene locus_tag LOCUS_20970 3808 1964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20970 >Feature sequence287 321 1253 gene locus_tag LOCUS_20980 321 1253 CDS product ketopantoate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814023.1 protein_id gnl|my_center|LOCUS_20980 2022 1651 gene locus_tag LOCUS_20990 2022 1651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20990 2835 2287 gene locus_tag LOCUS_21000 2835 2287 CDS product Fe-S-containing hydro-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012099538.1 protein_id gnl|my_center|LOCUS_21000 3846 3004 gene locus_tag LOCUS_21010 3846 3004 CDS product fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048346.1 protein_id gnl|my_center|LOCUS_21010 >Feature sequence288 2001 211 gene locus_tag LOCUS_21020 2001 211 CDS product aminopeptidase P family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897431.1 protein_id gnl|my_center|LOCUS_21020 2561 2094 gene locus_tag LOCUS_21030 2561 2094 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289317.1 protein_id gnl|my_center|LOCUS_21030 3225 2845 gene locus_tag LOCUS_21040 3225 2845 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459934.1 protein_id gnl|my_center|LOCUS_21040 <3976 3291 gene locus_tag LOCUS_21050 <3976 3291 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011101465.1:YfhO family protein >Feature sequence289 404 45 gene locus_tag LOCUS_21060 404 45 CDS product TnpV protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948358.1 protein_id gnl|my_center|LOCUS_21060 1571 1203 gene locus_tag LOCUS_21070 1571 1203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21070 1786 1568 gene locus_tag LOCUS_21080 1786 1568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21080 2706 1816 gene locus_tag LOCUS_21090 2706 1816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21090 <3958 2754 gene locus_tag LOCUS_21100 <3958 2754 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011458832.1:peptidoglycan DD-metalloendopeptidase family protein >Feature sequence290 15 821 gene locus_tag LOCUS_21110 15 821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21110 814 1878 gene locus_tag LOCUS_21120 814 1878 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226242.1 protein_id gnl|my_center|LOCUS_21120 1878 2906 gene locus_tag LOCUS_21130 gene yjfF 1878 2906 CDS product sugar ABC transporter permease YjfF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226243.1 protein_id gnl|my_center|LOCUS_21130 <3952 3009 gene locus_tag LOCUS_21140 <3952 3009 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015613409.1:helix-turn-helix domain-containing protein >Feature sequence291 800 390 gene locus_tag LOCUS_21150 800 390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21150 1834 995 gene locus_tag LOCUS_21160 1834 995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21160 2136 3443 gene locus_tag LOCUS_21170 2136 3443 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068386.1 protein_id gnl|my_center|LOCUS_21170 3504 3704 gene locus_tag LOCUS_21180 3504 3704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21180 3697 3932 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gggtgtagttcccggttattacttggtatgttataatt >Feature sequence292 612 55 gene locus_tag LOCUS_21190 612 55 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21190 963 658 gene locus_tag LOCUS_21200 963 658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21200 2163 1069 gene locus_tag LOCUS_21210 2163 1069 CDS product DUF6017 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002368732.1 protein_id gnl|my_center|LOCUS_21210 3054 2188 gene locus_tag LOCUS_21220 3054 2188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21220 3850 3044 gene locus_tag LOCUS_21230 gene soj 3850 3044 CDS product sporulation initiation inhibitor protein Soj inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000516114.1 protein_id gnl|my_center|LOCUS_21230 >Feature sequence293 264 194 gene locus_tag LOCUS_t00120 264 194 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 1347 412 gene locus_tag LOCUS_21240 gene cysK 1347 412 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108620.1 protein_id gnl|my_center|LOCUS_21240 3019 1817 gene locus_tag LOCUS_21250 3019 1817 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948998.1 protein_id gnl|my_center|LOCUS_21250 >Feature sequence294 307 513 gene locus_tag LOCUS_21260 307 513 CDS product alpha/beta-type small acid-soluble spore protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965662.1 protein_id gnl|my_center|LOCUS_21260 1841 615 gene locus_tag LOCUS_21270 1841 615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_21270 2068 1829 gene locus_tag LOCUS_21280 2068 1829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21280 1891 1900 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2670 2056 gene locus_tag LOCUS_21290 2670 2056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_21290 <3941 2689 gene locus_tag LOCUS_21300 <3941 2689 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004440884.1:DAK2 domain-containing protein 2728 2737 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence295 2454 946 gene locus_tag LOCUS_21310 2454 946 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680067.1 protein_id gnl|my_center|LOCUS_21310 3823 2540 gene locus_tag LOCUS_21320 3823 2540 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002674469.1 protein_id gnl|my_center|LOCUS_21320 >Feature sequence296 1188 700 gene locus_tag LOCUS_21330 gene leuD 1188 700 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437092.1 protein_id gnl|my_center|LOCUS_21330 2575 1313 gene locus_tag LOCUS_21340 gene leuC 2575 1313 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966450.1 protein_id gnl|my_center|LOCUS_21340 2961 3812 gene locus_tag LOCUS_21350 2961 3812 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462306.1 protein_id gnl|my_center|LOCUS_21350 3308 3317 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence297 296 1162 gene locus_tag LOCUS_21360 gene metF 296 1162 CDS product methylenetetrahydrofolate reductase [NAD(P)H] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949153.1 protein_id gnl|my_center|LOCUS_21360 1413 2039 gene locus_tag LOCUS_21370 1413 2039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21370 2062 2865 gene locus_tag LOCUS_21380 2062 2865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21380 >Feature sequence298 1038 196 gene locus_tag LOCUS_21390 1038 196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_21390 2036 1011 gene locus_tag LOCUS_21400 2036 1011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_21400 1043 1052 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2281 3687 gene locus_tag LOCUS_21410 2281 3687 CDS product solute carrier family 23 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080841.1 protein_id gnl|my_center|LOCUS_21410 >Feature sequence299 1458 133 gene locus_tag LOCUS_21420 1458 133 CDS product serpin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810397.1 protein_id gnl|my_center|LOCUS_21420 2119 2883 gene locus_tag LOCUS_21430 2119 2883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21430 >Feature sequence300 121 1200 gene locus_tag LOCUS_21440 gene hisC 121 1200 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897361.1 protein_id gnl|my_center|LOCUS_21440 1397 2209 gene locus_tag LOCUS_21450 gene proC 1397 2209 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000360723.1 protein_id gnl|my_center|LOCUS_21450 2306 3616 gene locus_tag LOCUS_21460 2306 3616 CDS product alpha-amylase family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965974.1 protein_id gnl|my_center|LOCUS_21460 >Feature sequence301 1235 2515 gene locus_tag LOCUS_21470 1235 2515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21470 2548 3498 gene locus_tag LOCUS_21480 2548 3498 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941783.1 protein_id gnl|my_center|LOCUS_21480 >Feature sequence302 53 1345 gene locus_tag LOCUS_21490 53 1345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21490 2544 1387 gene locus_tag LOCUS_21500 2544 1387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21500 >Feature sequence303 433 1881 gene locus_tag LOCUS_21510 gene purF 433 1881 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047942.1 protein_id gnl|my_center|LOCUS_21510 1931 3382 gene locus_tag LOCUS_21520 gene purB 1931 3382 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986778.1 protein_id gnl|my_center|LOCUS_21520 >Feature sequence304 <1 753 gene locus_tag LOCUS_21530 <1 753 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011104542.1:VapE family protein 1020 1184 gene locus_tag LOCUS_21540 1020 1184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21540 1297 1743 gene locus_tag LOCUS_21550 1297 1743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21550 1897 2796 gene locus_tag LOCUS_21560 1897 2796 CDS product dipeptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000108438.1 protein_id gnl|my_center|LOCUS_21560 >Feature sequence305 360 163 gene locus_tag LOCUS_21570 360 163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21570 404 727 gene locus_tag LOCUS_21580 404 727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21580 1795 1226 gene locus_tag LOCUS_21590 1795 1226 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003699994.1 protein_id gnl|my_center|LOCUS_21590 2374 1871 gene locus_tag LOCUS_21600 2374 1871 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005807782.1 protein_id gnl|my_center|LOCUS_21600 2614 3360 gene locus_tag LOCUS_21610 2614 3360 CDS product AzlC family ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011174109.1 protein_id gnl|my_center|LOCUS_21610 3390 3695 gene locus_tag LOCUS_21620 3390 3695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21620 >Feature sequence306 424 1044 gene locus_tag LOCUS_21630 gene hypB 424 1044 CDS product hydrogenase nickel incorporation protein HypB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003356857.1 protein_id gnl|my_center|LOCUS_21630 1017 1026 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence307 1550 663 gene locus_tag LOCUS_21640 1550 663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21640 1834 1586 gene locus_tag LOCUS_21650 1834 1586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21650 1612 1621 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2103 1870 gene locus_tag LOCUS_21660 2103 1870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21660 3412 2096 gene locus_tag LOCUS_21670 3412 2096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21670 2120 2129 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence308 2542 911 gene locus_tag LOCUS_21680 2542 911 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288004.1 protein_id gnl|my_center|LOCUS_21680 3623 2544 gene locus_tag LOCUS_21690 3623 2544 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877170.1 protein_id gnl|my_center|LOCUS_21690 >Feature sequence309 2895 667 gene locus_tag LOCUS_21700 gene pflB 2895 667 CDS product formate C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000195485.1 protein_id gnl|my_center|LOCUS_21700 >Feature sequence310 335 66 gene locus_tag LOCUS_21710 335 66 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_21710 918 322 gene locus_tag LOCUS_21720 918 322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21720 2912 1173 gene locus_tag LOCUS_21730 2912 1173 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680643.1 protein_id gnl|my_center|LOCUS_21730 <3704 2914 gene locus_tag LOCUS_21740 <3704 2914 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011836805.1:ABC transporter ATP-binding protein >Feature sequence311 162 740 gene locus_tag LOCUS_21750 162 740 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459363.1 protein_id gnl|my_center|LOCUS_21750 1667 735 gene locus_tag LOCUS_21760 1667 735 CDS product tRNA-dihydrouridine synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948398.1 protein_id gnl|my_center|LOCUS_21760 1119 1128 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3083 1683 gene locus_tag LOCUS_21770 3083 1683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21770 3560 3198 gene locus_tag LOCUS_21780 3560 3198 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963919.1 protein_id gnl|my_center|LOCUS_21780 >Feature sequence312 54 893 gene locus_tag LOCUS_21790 54 893 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080850.1 protein_id gnl|my_center|LOCUS_21790 897 2456 gene locus_tag LOCUS_21800 897 2456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21800 902 911 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2416 2425 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2426 2896 gene locus_tag LOCUS_21810 2426 2896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21810 >Feature sequence313 1 1326 gene locus_tag LOCUS_21820 1 1326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21820 1864 1385 gene locus_tag LOCUS_21830 1864 1385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21830 2260 2138 gene locus_tag LOCUS_21840 2260 2138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21840 2754 2524 gene locus_tag LOCUS_21850 2754 2524 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002985621.1 protein_id gnl|my_center|LOCUS_21850 3242 2931 gene locus_tag LOCUS_21860 3242 2931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21860 3457 3209 gene locus_tag LOCUS_21870 3457 3209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21870 >Feature sequence314 930 124 gene locus_tag LOCUS_21880 930 124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21880 356 365 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3488 930 gene locus_tag LOCUS_21890 3488 930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21890 >Feature sequence315 402 920 gene locus_tag LOCUS_21900 402 920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21900 >Feature sequence316 398 517 gene locus_tag LOCUS_21910 398 517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21910 751 1161 gene locus_tag LOCUS_21920 751 1161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21920 1175 1624 gene locus_tag LOCUS_21930 1175 1624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21930 1593 2345 gene locus_tag LOCUS_21940 1593 2345 CDS product phage antirepressor KilAC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922216.1 protein_id gnl|my_center|LOCUS_21940 2416 2907 gene locus_tag LOCUS_21950 2416 2907 CDS product PcfB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002368727.1 protein_id gnl|my_center|LOCUS_21950 >Feature sequence317 193 993 gene locus_tag LOCUS_21960 gene frlD 193 993 CDS product fructoselysine 6-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000853346.1 protein_id gnl|my_center|LOCUS_21960 1027 1884 gene locus_tag LOCUS_21970 1027 1884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21970 1299 1308 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1874 2305 gene locus_tag LOCUS_21980 1874 2305 CDS product secondary thiamine-phosphate synthase enzyme YjbQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881282.1 protein_id gnl|my_center|LOCUS_21980 3085 3222 gene locus_tag LOCUS_21990 3085 3222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21990 >Feature sequence318 2322 952 gene locus_tag LOCUS_22000 2322 952 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964890.1 protein_id gnl|my_center|LOCUS_22000 3032 2319 gene locus_tag LOCUS_22010 3032 2319 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948727.1 protein_id gnl|my_center|LOCUS_22010 3385 3146 gene locus_tag LOCUS_22020 3385 3146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22020 >Feature sequence319 1522 593 gene locus_tag LOCUS_22030 gene fabK 1522 593 CDS product enoyl-[acyl-carrier-protein] reductase FabK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966839.1 protein_id gnl|my_center|LOCUS_22030 1792 1559 gene locus_tag LOCUS_22040 gene acpP 1792 1559 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881114.1 protein_id gnl|my_center|LOCUS_22040 2052 2318 gene locus_tag LOCUS_22050 2052 2318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22050 2706 3389 gene locus_tag LOCUS_22060 gene thiT 2706 3389 CDS product energy-coupled thiamine transporter ThiT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966211.1 protein_id gnl|my_center|LOCUS_22060 >Feature sequence320 397 1953 gene locus_tag LOCUS_22070 gene istA 397 1953 CDS product IS21 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015262274.1 protein_id gnl|my_center|LOCUS_22070 1966 2742 gene locus_tag LOCUS_22080 gene istB 1966 2742 CDS product IS21-like element ISRel16 family helper ATPase IstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007539334.1 protein_id gnl|my_center|LOCUS_22080 2848 3054 gene locus_tag LOCUS_22090 2848 3054 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860747.1 protein_id gnl|my_center|LOCUS_22090 >Feature sequence321 1501 1061 gene locus_tag LOCUS_22100 gene tnpA 1501 1061 CDS product IS200/IS605-like element ISEfa4 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287522.1 protein_id gnl|my_center|LOCUS_22100 2832 1858 gene locus_tag LOCUS_22110 2832 1858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22110 3311 2829 gene locus_tag LOCUS_22120 3311 2829 CDS product YaiI/YqxD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966110.1 protein_id gnl|my_center|LOCUS_22120 >Feature sequence322 621 764 gene locus_tag LOCUS_22130 621 764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22130 812 1264 gene locus_tag LOCUS_22140 812 1264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22140 1591 3393 gene locus_tag LOCUS_22150 gene pepF 1591 3393 CDS product oligoendopeptidase F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000003348.1 protein_id gnl|my_center|LOCUS_22150 >Feature sequence323 512 1357 gene locus_tag LOCUS_22160 gene pdaA 512 1357 CDS product delta-lactam-biosynthetic de-N-acetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438596.1 protein_id gnl|my_center|LOCUS_22160 >Feature sequence324 <1 603 gene locus_tag LOCUS_22170 <1 603 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011461303.1:vancomycin resistance response regulator transcription factor VanR-I 620 1129 gene locus_tag LOCUS_22180 gene vanZ1 620 1129 CDS product glycopeptide resistance protein VanZ1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009889012.1 protein_id gnl|my_center|LOCUS_22180 1143 2207 gene locus_tag LOCUS_22190 1143 2207 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_080510927.1 protein_id gnl|my_center|LOCUS_22190 2348 3235 gene locus_tag LOCUS_22200 2348 3235 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459749.1 protein_id gnl|my_center|LOCUS_22200 >Feature sequence325 570 307 gene locus_tag LOCUS_22210 570 307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22210 895 2655 gene locus_tag LOCUS_22220 895 2655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22220 2858 2733 gene locus_tag LOCUS_22230 2858 2733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22230 3026 3316 gene locus_tag LOCUS_22240 3026 3316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22240 >Feature sequence326 206 1534 gene locus_tag LOCUS_22250 206 1534 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436703.1 protein_id gnl|my_center|LOCUS_22250 3219 1528 gene locus_tag LOCUS_22260 gene pdcB 3219 1528 CDS product phosphodiesterase PdcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437448.1 protein_id gnl|my_center|LOCUS_22260 >Feature sequence327 1028 687 gene locus_tag LOCUS_22270 1028 687 CDS product YraN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707590.1 protein_id gnl|my_center|LOCUS_22270 1464 1159 gene locus_tag LOCUS_22280 1464 1159 CDS product EscU/YscU/HrcU family type III secretion system export apparatus switch protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392518.1 protein_id gnl|my_center|LOCUS_22280 3394 1499 gene locus_tag LOCUS_22290 3394 1499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22290 >Feature sequence328 233 1456 gene locus_tag LOCUS_22300 233 1456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22300 247 256 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1538 2062 gene locus_tag LOCUS_22310 1538 2062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22310 2195 3427 gene locus_tag LOCUS_22320 2195 3427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22320 >Feature sequence329 92 499 gene locus_tag LOCUS_22330 92 499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272162.1 protein_id gnl|my_center|LOCUS_22330 646 837 gene locus_tag LOCUS_22340 646 837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22340 867 1658 gene locus_tag LOCUS_22350 867 1658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22350 >Feature sequence330 276 755 gene locus_tag LOCUS_22360 gene ybaK 276 755 CDS product Cys-tRNA(Pro) deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437064.1 protein_id gnl|my_center|LOCUS_22360 1745 843 gene locus_tag LOCUS_22370 1745 843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22370 2669 1977 gene locus_tag LOCUS_22380 2669 1977 CDS product YjjG family noncanonical pyrimidine nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289749.1 protein_id gnl|my_center|LOCUS_22380 3397 2687 gene locus_tag LOCUS_22390 3397 2687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22390 >Feature sequence331 360 767 gene locus_tag LOCUS_22400 360 767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22400 841 1218 gene locus_tag LOCUS_22410 841 1218 CDS product Asp23/Gls24 family envelope stress response protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393032.1 protein_id gnl|my_center|LOCUS_22410 1337 1729 gene locus_tag LOCUS_22420 gene nusB 1337 1729 CDS product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358828.1 protein_id gnl|my_center|LOCUS_22420 1726 2931 gene locus_tag LOCUS_22430 gene xseA 1726 2931 CDS product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358983.1 protein_id gnl|my_center|LOCUS_22430 2924 3148 gene locus_tag LOCUS_22440 2924 3148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22440 >Feature sequence332 1526 588 gene locus_tag LOCUS_22450 1526 588 CDS product acyl-CoA thioester hydrolase/BAAT C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680020.1 protein_id gnl|my_center|LOCUS_22450 2346 1546 gene locus_tag LOCUS_22460 2346 1546 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023395.1 protein_id gnl|my_center|LOCUS_22460 2997 2524 gene locus_tag LOCUS_22470 2997 2524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22470 3107 2952 gene locus_tag LOCUS_22480 3107 2952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22480 >Feature sequence333 147 25 gene locus_tag LOCUS_22490 147 25 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22490 359 165 gene locus_tag LOCUS_22500 359 165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22500 513 313 gene locus_tag LOCUS_22510 513 313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22510 867 610 gene locus_tag LOCUS_22520 867 610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22520 1462 1220 gene locus_tag LOCUS_22530 1462 1220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22530 2772 1483 gene locus_tag LOCUS_22540 2772 1483 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461101.1 protein_id gnl|my_center|LOCUS_22540 >Feature sequence334 224 1357 gene locus_tag LOCUS_22550 gene flhB 224 1357 CDS product flagellar biosynthesis protein FlhB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870058.1 protein_id gnl|my_center|LOCUS_22550 >Feature sequence335 662 249 gene locus_tag LOCUS_22560 662 249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22560 2321 771 gene locus_tag LOCUS_22570 2321 771 CDS product DNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013363706.1 protein_id gnl|my_center|LOCUS_22570 2738 3376 gene locus_tag LOCUS_22580 2738 3376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22580 >Feature sequence336 2299 1436 gene locus_tag LOCUS_22590 2299 1436 CDS product alpha/beta hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861491.1 protein_id gnl|my_center|LOCUS_22590 3344 2301 gene locus_tag LOCUS_22600 3344 2301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22600 >Feature sequence337 <1 883 gene locus_tag LOCUS_22610 <1 883 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012256266.1:family 1 glycosylhydrolase 909 2120 gene locus_tag LOCUS_22620 909 2120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22620 3112 2153 gene locus_tag LOCUS_22630 3112 2153 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296705.1 protein_id gnl|my_center|LOCUS_22630 3351 3109 gene locus_tag LOCUS_22640 3351 3109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22640 >Feature sequence338 701 381 gene locus_tag LOCUS_22650 701 381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22650 1074 724 gene locus_tag LOCUS_22660 1074 724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22660 1641 1204 gene locus_tag LOCUS_22670 1641 1204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22670 2824 2126 gene locus_tag LOCUS_22680 2824 2126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22680 3270 2818 gene locus_tag LOCUS_22690 3270 2818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22690 >Feature sequence339 87 407 gene locus_tag LOCUS_22700 87 407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22700 590 1105 gene locus_tag LOCUS_22710 590 1105 CDS product cysteine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814019.1 protein_id gnl|my_center|LOCUS_22710 3140 1479 gene locus_tag LOCUS_22720 3140 1479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22720 >Feature sequence340 760 38 gene locus_tag LOCUS_22730 760 38 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860947.1 protein_id gnl|my_center|LOCUS_22730 2243 753 gene locus_tag LOCUS_22740 2243 753 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000649908.1 protein_id gnl|my_center|LOCUS_22740 3054 2419 gene locus_tag LOCUS_22750 3054 2419 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731199.1 protein_id gnl|my_center|LOCUS_22750 >Feature sequence341 >Feature sequence342 365 1042 gene locus_tag LOCUS_22760 365 1042 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732773.1 protein_id gnl|my_center|LOCUS_22760 1382 2164 gene locus_tag LOCUS_22770 1382 2164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22770 >Feature sequence343 2750 306 gene locus_tag LOCUS_22780 2750 306 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082399.1 protein_id gnl|my_center|LOCUS_22780 >Feature sequence344 88 978 gene locus_tag LOCUS_22790 88 978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22790 999 1151 gene locus_tag LOCUS_22800 999 1151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22800 1171 2676 gene locus_tag LOCUS_22810 1171 2676 CDS product class I SAM-dependent DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932358.1 protein_id gnl|my_center|LOCUS_22810 >Feature sequence345 2572 1490 gene locus_tag LOCUS_22820 2572 1490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22820 <3272 2696 gene locus_tag LOCUS_22830 <3272 2696 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010966512.1:sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC >Feature sequence346 2121 505 gene locus_tag LOCUS_22840 2121 505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22840 2596 2465 gene locus_tag LOCUS_22850 2596 2465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22850 <3272 2626 gene locus_tag LOCUS_22860 <3272 2626 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005901682.1:cobyrinate a,c-diamide synthase >Feature sequence347 1878 109 gene locus_tag LOCUS_22870 1878 109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22870 2626 1865 gene locus_tag LOCUS_22880 2626 1865 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000855645.1 protein_id gnl|my_center|LOCUS_22880 3244 3062 gene locus_tag LOCUS_22890 3244 3062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22890 >Feature sequence348 1337 687 gene locus_tag LOCUS_22900 1337 687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22900 1826 1353 gene locus_tag LOCUS_22910 gene ribE 1826 1353 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454467.1 protein_id gnl|my_center|LOCUS_22910 3074 1857 gene locus_tag LOCUS_22920 3074 1857 CDS product bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000456640.1 protein_id gnl|my_center|LOCUS_22920 >Feature sequence349 1168 713 gene locus_tag LOCUS_22930 1168 713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22930 1785 1432 gene locus_tag LOCUS_22940 1785 1432 CDS product HNH endonuclease signature motif containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140048.1 protein_id gnl|my_center|LOCUS_22940 >Feature sequence350 178 20 gene locus_tag LOCUS_22950 178 20 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22950 1118 363 gene locus_tag LOCUS_22960 1118 363 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815292.1 protein_id gnl|my_center|LOCUS_22960 2416 1109 gene locus_tag LOCUS_22970 2416 1109 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877115.1 protein_id gnl|my_center|LOCUS_22970 <3201 2567 gene locus_tag LOCUS_22980 <3201 2567 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011392832.1:stage IV sporulation protein A >Feature sequence351 <1 555 gene locus_tag LOCUS_22990 <1 555 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011268142.1:glycogen debranching protein GlgX 915 562 gene locus_tag LOCUS_23000 915 562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23000 1762 1031 gene locus_tag LOCUS_23010 1762 1031 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965914.1 protein_id gnl|my_center|LOCUS_23010 2076 1759 gene locus_tag LOCUS_23020 2076 1759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23020 2388 2314 gene locus_tag LOCUS_t00130 2388 2314 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence352 736 50 gene locus_tag LOCUS_23030 736 50 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015943969.1 protein_id gnl|my_center|LOCUS_23030 2581 797 gene locus_tag LOCUS_23040 2581 797 CDS product carbohydrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814523.1 protein_id gnl|my_center|LOCUS_23040 3182 2571 gene locus_tag LOCUS_23050 3182 2571 CDS product DUF4956 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814522.1 protein_id gnl|my_center|LOCUS_23050 >Feature sequence353 481 128 gene locus_tag LOCUS_23060 gene rplS 481 128 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003362586.1 protein_id gnl|my_center|LOCUS_23060 838 605 gene locus_tag LOCUS_23070 838 605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23070 1651 911 gene locus_tag LOCUS_23080 gene trmD 1651 911 CDS product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438222.1 protein_id gnl|my_center|LOCUS_23080 2178 1657 gene locus_tag LOCUS_23090 gene rimM 2178 1657 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003384687.1 protein_id gnl|my_center|LOCUS_23090 2496 2266 gene locus_tag LOCUS_23100 2496 2266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23100 2760 2515 gene locus_tag LOCUS_23110 gene rpsP 2760 2515 CDS product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000268750.1 protein_id gnl|my_center|LOCUS_23110 >Feature sequence354 3030 28 gene locus_tag LOCUS_23120 3030 28 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23120 >Feature sequence355 410 36 gene locus_tag LOCUS_23130 410 36 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23130 719 558 gene locus_tag LOCUS_23140 719 558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23140 <3155 1598 gene locus_tag LOCUS_23150 <3155 1598 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010966478.1:ATP-dependent zinc metalloprotease FtsH >Feature sequence356 <1 1213 gene locus_tag LOCUS_23160 <1 1213 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003971803.1:glycogen debranching protein GlgX 1226 1840 gene locus_tag LOCUS_23170 1226 1840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23170 2731 1835 gene locus_tag LOCUS_23180 2731 1835 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001079106.1 protein_id gnl|my_center|LOCUS_23180 >Feature sequence357 1617 664 gene locus_tag LOCUS_23190 1617 664 CDS product beta-galactosidase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102183.1 protein_id gnl|my_center|LOCUS_23190 2056 1601 gene locus_tag LOCUS_23200 2056 1601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_23200 3128 2208 gene locus_tag LOCUS_23210 3128 2208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_23210 2232 2241 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence358 92 1369 gene locus_tag LOCUS_23220 gene nagZ 92 1369 CDS product beta-N-acetylhexosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813606.1 protein_id gnl|my_center|LOCUS_23220 1518 1721 gene locus_tag LOCUS_23230 1518 1721 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003423148.1 protein_id gnl|my_center|LOCUS_23230 2014 2142 gene locus_tag LOCUS_23240 2014 2142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23240 2256 3023 gene locus_tag LOCUS_23250 2256 3023 CDS product polyphosphate polymerase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814520.1 protein_id gnl|my_center|LOCUS_23250 >Feature sequence359 1385 531 gene locus_tag LOCUS_23260 gene dapF 1385 531 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941199.1 protein_id gnl|my_center|LOCUS_23260 2680 1463 gene locus_tag LOCUS_23270 2680 1463 CDS product PLP-dependent aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963712.1 protein_id gnl|my_center|LOCUS_23270 2656 2665 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence360 1958 183 gene locus_tag LOCUS_23280 gene thrS 1958 183 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000435143.1 protein_id gnl|my_center|LOCUS_23280 2864 2364 gene locus_tag LOCUS_23290 2864 2364 CDS product SEC-C metal-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359469.1 protein_id gnl|my_center|LOCUS_23290 >Feature sequence361 16 921 gene locus_tag LOCUS_23300 16 921 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939388.1 protein_id gnl|my_center|LOCUS_23300 1399 1878 gene locus_tag LOCUS_23310 1399 1878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23310 1875 3026 gene locus_tag LOCUS_23320 1875 3026 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870392.1 protein_id gnl|my_center|LOCUS_23320 >Feature sequence362 1413 547 gene locus_tag LOCUS_23330 gene ylqF 1413 547 CDS product ribosome biogenesis GTPase YlqF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000236704.1 protein_id gnl|my_center|LOCUS_23330 2013 1432 gene locus_tag LOCUS_23340 gene lepB 2013 1432 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047862.1 protein_id gnl|my_center|LOCUS_23340 2984 2136 gene locus_tag LOCUS_23350 2984 2136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23350 >Feature sequence363 1570 455 gene locus_tag LOCUS_23360 1570 455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23360 2810 1584 gene locus_tag LOCUS_23370 2810 1584 CDS product CapA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000854536.1 protein_id gnl|my_center|LOCUS_23370 >Feature sequence364 74 1045 gene locus_tag LOCUS_23380 74 1045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23380 1063 2091 gene locus_tag LOCUS_23390 1063 2091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23390 2119 2442 gene locus_tag LOCUS_23400 2119 2442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23400 2447 2938 gene locus_tag LOCUS_23410 2447 2938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23410 >Feature sequence365 433 442 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 485 2425 gene locus_tag LOCUS_23420 485 2425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23420 1264 1273 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence366 533 931 gene locus_tag LOCUS_23430 533 931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23430 909 1649 gene locus_tag LOCUS_23440 909 1649 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895627.1 protein_id gnl|my_center|LOCUS_23440 >Feature sequence367 1713 1081 gene locus_tag LOCUS_23450 gene purN 1713 1081 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964703.1 protein_id gnl|my_center|LOCUS_23450 2732 1707 gene locus_tag LOCUS_23460 gene purM 2732 1707 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001262435.1 protein_id gnl|my_center|LOCUS_23460 >Feature sequence368 287 748 gene locus_tag LOCUS_23470 287 748 CDS product 2Fe-2S iron-sulfur cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434060.1 protein_id gnl|my_center|LOCUS_23470 >Feature sequence369 84 422 gene locus_tag LOCUS_23480 84 422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23480 437 1645 gene locus_tag LOCUS_23490 437 1645 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_108806778.1 protein_id gnl|my_center|LOCUS_23490 1857 1982 gene locus_tag LOCUS_23500 1857 1982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23500 1998 2831 gene locus_tag LOCUS_23510 1998 2831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23510 >Feature sequence370 >Feature sequence371 458 880 gene locus_tag LOCUS_23520 458 880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23520 1029 2330 gene locus_tag LOCUS_23530 1029 2330 CDS product O-acetylhomoserine aminocarboxypropyltransferase/cysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763773.1 protein_id gnl|my_center|LOCUS_23530 2502 2882 gene locus_tag LOCUS_23540 2502 2882 CDS product BlaI/MecI/CopY family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002933016.1 protein_id gnl|my_center|LOCUS_23540 >Feature sequence372 234 2036 gene locus_tag LOCUS_23550 gene dnaG 234 2036 CDS product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964611.1 protein_id gnl|my_center|LOCUS_23550 >Feature sequence373 1136 429 gene locus_tag LOCUS_23560 1136 429 CDS product VTT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272454.1 protein_id gnl|my_center|LOCUS_23560 1521 1099 gene locus_tag LOCUS_23570 1521 1099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23570 1787 1626 gene locus_tag LOCUS_23580 1787 1626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23580 2818 1949 gene locus_tag LOCUS_23590 2818 1949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23590 >Feature sequence374 307 134 gene locus_tag LOCUS_23600 307 134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23600 422 604 gene locus_tag LOCUS_23610 422 604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23610 1164 619 gene locus_tag LOCUS_23620 1164 619 CDS product SprT family zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946141.1 protein_id gnl|my_center|LOCUS_23620 900 909 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2186 1197 gene locus_tag LOCUS_23630 2186 1197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23630 >Feature sequence375 >Feature sequence376 133 1524 gene locus_tag LOCUS_23640 133 1524 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986115.1 protein_id gnl|my_center|LOCUS_23640 1527 2189 gene locus_tag LOCUS_23650 1527 2189 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391621.1 protein_id gnl|my_center|LOCUS_23650 >Feature sequence377 2 916 gene locus_tag LOCUS_23660 2 916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23660 1270 1103 gene locus_tag LOCUS_23670 1270 1103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23670 1403 1200 gene locus_tag LOCUS_23680 1403 1200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23680 1490 1499 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2785 1709 gene locus_tag LOCUS_23690 2785 1709 CDS product IS256-like element ISSod18 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071025.1 protein_id gnl|my_center|LOCUS_23690 >Feature sequence378 1288 266 gene locus_tag LOCUS_23700 1288 266 CDS product molybdopterin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948644.1 protein_id gnl|my_center|LOCUS_23700 2595 1300 gene locus_tag LOCUS_23710 2595 1300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23710 >Feature sequence379 <1 1250 gene locus_tag LOCUS_23720 <1 1250 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005814149.1:RNA degradosome polyphosphate kinase 308 317 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1296 2108 gene locus_tag LOCUS_23730 1296 2108 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101369.1 protein_id gnl|my_center|LOCUS_23730 <2811 2148 gene locus_tag LOCUS_23740 <2811 2148 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010937958.1:PHP domain-containing protein >Feature sequence380 <2770 1454 gene locus_tag LOCUS_23750 <2770 1454 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013389475.1:1,3-beta-galactosyl-N-acetylhexosamine phosphorylase >Feature sequence381 2749 1808 gene locus_tag LOCUS_23760 2749 1808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23760 >Feature sequence382 1137 574 gene locus_tag LOCUS_23770 1137 574 CDS product biotin transporter BioY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986729.1 protein_id gnl|my_center|LOCUS_23770 2253 1261 gene locus_tag LOCUS_23780 2253 1261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23780 >Feature sequence383 <1 786 gene locus_tag LOCUS_23790 <1 786 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010964165.1:MATE family efflux transporter 2481 862 gene locus_tag LOCUS_23800 2481 862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23800 >Feature sequence384 2372 84 gene locus_tag LOCUS_23810 2372 84 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23810 >Feature sequence385 32 814 gene locus_tag LOCUS_23820 gene codY 32 814 CDS product GTP-sensing pleiotropic transcriptional regulator CodY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438268.1 protein_id gnl|my_center|LOCUS_23820 882 1028 gene locus_tag LOCUS_23830 882 1028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23830 1057 1452 gene locus_tag LOCUS_23840 gene flgB 1057 1452 CDS product flagellar basal body rod protein FlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081560.1 protein_id gnl|my_center|LOCUS_23840 1482 1922 gene locus_tag LOCUS_23850 gene flgC 1482 1922 CDS product flagellar basal body rod protein FlgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392290.1 protein_id gnl|my_center|LOCUS_23850 1957 2268 gene locus_tag LOCUS_23860 1957 2268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23860 >Feature sequence386 252 1790 gene locus_tag LOCUS_23870 gene istA 252 1790 CDS product IS21 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015262274.1 protein_id gnl|my_center|LOCUS_23870 1797 2573 gene locus_tag LOCUS_23880 gene istB 1797 2573 CDS product IS21-like element ISFK1 family helper ATPase IstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090937.1 protein_id gnl|my_center|LOCUS_23880 >Feature sequence387 817 485 gene locus_tag LOCUS_23890 817 485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_23890 <2714 732 gene locus_tag LOCUS_23900 <2714 732 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001126116.1:carbamoyl-phosphate synthase large subunit note possible pseudo, frameshifted 805 814 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence388 341 928 gene locus_tag LOCUS_23910 gene hisB 341 928 CDS product imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964256.1 protein_id gnl|my_center|LOCUS_23910 1035 2318 gene locus_tag LOCUS_23920 1035 2318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23920 >Feature sequence389 >Feature sequence390 <1 526 gene locus_tag LOCUS_23930 <1 526 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003437164.1:glycoside hydrolase family 13 protein 1441 632 gene locus_tag LOCUS_23940 1441 632 CDS product methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430012.1 protein_id gnl|my_center|LOCUS_23940 >Feature sequence391 391 242 gene locus_tag LOCUS_23950 391 242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23950 911 459 gene locus_tag LOCUS_23960 911 459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23960 480 489 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1296 1174 gene locus_tag LOCUS_23970 1296 1174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23970 <2689 1362 gene locus_tag LOCUS_23980 <2689 1362 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011948061.1:PTS transporter subunit EIIC >Feature sequence392 219 989 gene locus_tag LOCUS_23990 219 989 CDS product serine/threonine-protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963364.1 protein_id gnl|my_center|LOCUS_23990 >Feature sequence393 218 538 gene locus_tag LOCUS_24000 gene trxA 218 538 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392444.1 protein_id gnl|my_center|LOCUS_24000 814 1866 gene locus_tag LOCUS_24010 gene recA 814 1866 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812939.1 protein_id gnl|my_center|LOCUS_24010 1869 2480 gene locus_tag LOCUS_24020 1869 2480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24020 >Feature sequence394 1297 2415 gene locus_tag LOCUS_24030 1297 2415 CDS product HD-GYP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966912.1 protein_id gnl|my_center|LOCUS_24030 >Feature sequence395 92 409 gene locus_tag LOCUS_24040 92 409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24040 719 2563 gene locus_tag LOCUS_24050 719 2563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24050 >Feature sequence396 686 240 gene locus_tag LOCUS_24060 686 240 CDS product NusG domain II-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004469742.1 protein_id gnl|my_center|LOCUS_24060 1818 763 gene locus_tag LOCUS_24070 1818 763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24070 2054 1878 gene locus_tag LOCUS_24080 2054 1878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24080 2607 2182 gene locus_tag LOCUS_24090 2607 2182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24090 >Feature sequence397 147 926 gene locus_tag LOCUS_24100 147 926 CDS product threonine/serine exporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965563.1 protein_id gnl|my_center|LOCUS_24100 923 1366 gene locus_tag LOCUS_24110 923 1366 CDS product threonine/serine exporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965564.1 protein_id gnl|my_center|LOCUS_24110 <2630 1380 gene locus_tag LOCUS_24120 <2630 1380 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011460031.1:ABC-F family ATP-binding cassette domain-containing protein >Feature sequence398 <1 716 gene locus_tag LOCUS_24130 <1 716 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003357980.1:molecular chaperone DnaK 879 2063 gene locus_tag LOCUS_24140 gene dnaJ 879 2063 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048002.1 protein_id gnl|my_center|LOCUS_24140 2604 2200 gene locus_tag LOCUS_24150 2604 2200 CDS product S-ribosylhomocysteine lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966225.1 protein_id gnl|my_center|LOCUS_24150 >Feature sequence399 <1 1682 gene locus_tag LOCUS_24160 <1 1682 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002356857.1:sensor histidine kinase 515 524 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence400 <1 711 gene locus_tag LOCUS_24170 <1 711 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011101871.1:alpha/beta hydrolase-fold protein 779 1729 gene locus_tag LOCUS_24180 779 1729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24180 >Feature sequence401 40 771 gene locus_tag LOCUS_24190 40 771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24190 1161 1325 gene locus_tag LOCUS_24200 1161 1325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24200 1772 2461 gene locus_tag LOCUS_24210 1772 2461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_24210 >Feature sequence402 1664 867 gene locus_tag LOCUS_24220 gene spo0A 1664 867 CDS product sporulation transcription factor Spo0A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965371.1 protein_id gnl|my_center|LOCUS_24220 <2578 1829 gene locus_tag LOCUS_24230 <2578 1829 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010965372.1:SpoIVB peptidase >Feature sequence403 952 260 gene locus_tag LOCUS_24240 gene rplA 952 260 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357362.1 protein_id gnl|my_center|LOCUS_24240 1435 1010 gene locus_tag LOCUS_24250 gene rplK 1435 1010 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421189.1 protein_id gnl|my_center|LOCUS_24250 2008 1493 gene locus_tag LOCUS_24260 gene nusG 2008 1493 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966426.1 protein_id gnl|my_center|LOCUS_24260 2230 2036 gene locus_tag LOCUS_24270 2230 2036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24270 2405 2256 gene locus_tag LOCUS_24280 gene rpmG 2405 2256 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421192.1 protein_id gnl|my_center|LOCUS_24280 >Feature sequence404 1258 1665 gene locus_tag LOCUS_24290 1258 1665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24290 1687 1950 gene locus_tag LOCUS_24300 1687 1950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24300 1923 1932 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence405 1621 1094 gene locus_tag LOCUS_24310 1621 1094 CDS product nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902348.1 protein_id gnl|my_center|LOCUS_24310 <2542 1708 gene locus_tag LOCUS_24320 <2542 1708 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007051743.1:ATP-binding protein >Feature sequence406 611 399 gene locus_tag LOCUS_24330 611 399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24330 1470 772 gene locus_tag LOCUS_24340 1470 772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24340 2019 1534 gene locus_tag LOCUS_24350 2019 1534 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966865.1 protein_id gnl|my_center|LOCUS_24350 >Feature sequence407 2028 1279 gene locus_tag LOCUS_24360 2028 1279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24360 >Feature sequence408 166 636 gene locus_tag LOCUS_24370 166 636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24370 1867 734 gene locus_tag LOCUS_24380 1867 734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24380 >Feature sequence409 2211 1747 gene locus_tag LOCUS_24390 2211 1747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24390 >Feature sequence410 >Feature sequence411 58 1617 gene locus_tag LOCUS_24400 gene galT 58 1617 CDS product UDP-glucose--hexose-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966244.1 protein_id gnl|my_center|LOCUS_24400 >Feature sequence412 1835 714 gene locus_tag LOCUS_24410 1835 714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_24410 2394 1729 gene locus_tag LOCUS_24420 2394 1729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_24420 >Feature sequence413 <1 689 gene locus_tag LOCUS_24430 <1 689 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010965537.1:glycogen synthase GlgA 772 1467 gene locus_tag LOCUS_24440 gene tepA 772 1467 CDS product translocation-enhancing protein TepA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000139806.1 protein_id gnl|my_center|LOCUS_24440 >Feature sequence414 1133 90 gene locus_tag LOCUS_24450 gene mglB 1133 90 CDS product galactose/glucose ABC transporter substrate-binding protein MglB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001036947.1 protein_id gnl|my_center|LOCUS_24450 2163 1186 gene locus_tag LOCUS_24460 2163 1186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24460 >Feature sequence415 1894 263 gene locus_tag LOCUS_24470 1894 263 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000031832.1 protein_id gnl|my_center|LOCUS_24470 2156 1926 gene locus_tag LOCUS_24480 2156 1926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24480 >Feature sequence416 >Feature sequence417 190 1962 gene locus_tag LOCUS_24490 gene pyk 190 1962 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436250.1 protein_id gnl|my_center|LOCUS_24490 >Feature sequence418 1835 309 gene locus_tag LOCUS_24500 1835 309 CDS product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941157.1 protein_id gnl|my_center|LOCUS_24500 >Feature sequence419 305 117 gene locus_tag LOCUS_24510 305 117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24510 754 374 gene locus_tag LOCUS_24520 754 374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24520 1272 799 gene locus_tag LOCUS_24530 1272 799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24530 921 930 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1716 2366 gene locus_tag LOCUS_24540 1716 2366 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009892161.1 protein_id gnl|my_center|LOCUS_24540 >Feature sequence420 930 319 gene locus_tag LOCUS_24550 930 319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24550 362 371 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1534 1112 gene locus_tag LOCUS_24560 1534 1112 CDS product LysM peptidoglycan-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007056652.1 protein_id gnl|my_center|LOCUS_24560 1786 2334 gene locus_tag LOCUS_24570 gene lexA 1786 2334 CDS product transcriptional repressor LexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003238209.1 protein_id gnl|my_center|LOCUS_24570 2123 2132 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence421 645 929 gene locus_tag LOCUS_24580 645 929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24580 1127 1789 gene locus_tag LOCUS_24590 1127 1789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24590 2066 2353 gene locus_tag LOCUS_24600 2066 2353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24600 >Feature sequence422 <2371 102 gene locus_tag LOCUS_24610 <2371 102 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011986302.1:SNF2 helicase associated domain-containing protein >Feature sequence423 161 1636 gene locus_tag LOCUS_24620 161 1636 CDS product tagaturonate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964014.1 protein_id gnl|my_center|LOCUS_24620 1076 1085 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence424 1051 311 gene locus_tag LOCUS_24630 1051 311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_24630 1269 1069 gene locus_tag LOCUS_24640 1269 1069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24640 1093 1102 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends <2365 1444 gene locus_tag LOCUS_24650 <2365 1444 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011030754.1:extracellular solute-binding protein >Feature sequence425 942 2027 gene locus_tag LOCUS_24660 942 2027 CDS product HD-GYP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966912.1 protein_id gnl|my_center|LOCUS_24660 >Feature sequence426 559 1404 gene locus_tag LOCUS_24670 559 1404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24670 >Feature sequence427 1403 2089 gene locus_tag LOCUS_24680 1403 2089 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000713769.1 protein_id gnl|my_center|LOCUS_24680 >Feature sequence428 398 739 gene locus_tag LOCUS_24690 398 739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24690 406 415 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 749 1558 gene locus_tag LOCUS_24700 749 1558 CDS product alpha/beta hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861491.1 protein_id gnl|my_center|LOCUS_24700 >Feature sequence429 <2317 909 gene locus_tag LOCUS_24710 <2317 909 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_021779462.1:SpoIID/LytB domain-containing protein >Feature sequence430 602 611 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 647 1213 gene locus_tag LOCUS_24720 647 1213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24720 1363 2244 gene locus_tag LOCUS_24730 1363 2244 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339520.1 protein_id gnl|my_center|LOCUS_24730 1410 1419 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence431 107 1867 gene locus_tag LOCUS_24740 107 1867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_24740 1749 1758 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence432 1136 1450 gene locus_tag LOCUS_24750 1136 1450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24750 1365 1886 gene locus_tag LOCUS_24760 1365 1886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24760 1852 2106 gene locus_tag LOCUS_24770 1852 2106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24770 >Feature sequence433 1 210 gene locus_tag LOCUS_24780 1 210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24780 259 885 gene locus_tag LOCUS_24790 259 885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24790 >Feature sequence434 40 459 gene locus_tag LOCUS_24800 40 459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24800 452 964 gene locus_tag LOCUS_24810 452 964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24810 984 2054 gene locus_tag LOCUS_24820 984 2054 CDS product type IV pilus twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861983.1 protein_id gnl|my_center|LOCUS_24820 >Feature sequence435 499 110 gene locus_tag LOCUS_24830 499 110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_24830 1322 426 gene locus_tag LOCUS_24840 1322 426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_24840 463 472 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2209 1319 gene locus_tag LOCUS_24850 2209 1319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24850 >Feature sequence436 130 2103 gene locus_tag LOCUS_24860 130 2103 CDS product oleate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262036.1 protein_id gnl|my_center|LOCUS_24860 >Feature sequence437 <1 578 gene locus_tag LOCUS_24870 <1 578 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003424535.1:translation elongation factor Ts 1411 2043 gene locus_tag LOCUS_24880 1411 2043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24880 >Feature sequence438 609 328 gene locus_tag LOCUS_24890 609 328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24890 350 359 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence439 <2187 1088 gene locus_tag LOCUS_24900 <2187 1088 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013227076.1:discoidin domain-containing protein >Feature sequence440 314 844 gene locus_tag LOCUS_24910 314 844 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459747.1 protein_id gnl|my_center|LOCUS_24910 841 1611 gene locus_tag LOCUS_24920 841 1611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24920 >Feature sequence441 1056 493 gene locus_tag LOCUS_24930 1056 493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24930 1343 1792 gene locus_tag LOCUS_24940 1343 1792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24940 >Feature sequence442 16 675 gene locus_tag LOCUS_24950 16 675 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272759.1 protein_id gnl|my_center|LOCUS_24950 656 1330 gene locus_tag LOCUS_24960 656 1330 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001154147.1 protein_id gnl|my_center|LOCUS_24960 1337 2098 gene locus_tag LOCUS_24970 1337 2098 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000005008.1 protein_id gnl|my_center|LOCUS_24970 >Feature sequence443 121 786 gene locus_tag LOCUS_24980 121 786 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020493338.1 protein_id gnl|my_center|LOCUS_24980 >Feature sequence444 55 2034 gene locus_tag LOCUS_24990 55 2034 CDS product polyphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000421678.1 protein_id gnl|my_center|LOCUS_24990 >Feature sequence445 673 1587 gene locus_tag LOCUS_25000 673 1587 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582885.1 protein_id gnl|my_center|LOCUS_25000 >Feature sequence446 265 1266 gene locus_tag LOCUS_25010 gene moaA 265 1266 CDS product GTP 3',8-cyclase MoaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002371204.1 protein_id gnl|my_center|LOCUS_25010 >Feature sequence447 141 1049 gene locus_tag LOCUS_25020 141 1049 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002917171.1 protein_id gnl|my_center|LOCUS_25020 1139 1723 gene locus_tag LOCUS_25030 gene eamB 1139 1723 CDS product cysteine/O-acetylserine transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000189206.1 protein_id gnl|my_center|LOCUS_25030 1762 2001 gene locus_tag LOCUS_25040 1762 2001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_25040 1941 2123 gene locus_tag LOCUS_25050 1941 2123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25050 >Feature sequence448 1764 892 gene locus_tag LOCUS_25060 1764 892 CDS product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942733.1 protein_id gnl|my_center|LOCUS_25060 >Feature sequence449 331 1698 gene locus_tag LOCUS_25070 331 1698 CDS product citrate/2-methylcitrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005807856.1 protein_id gnl|my_center|LOCUS_25070 2076 1786 gene locus_tag LOCUS_25080 2076 1786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25080 >Feature sequence450 <1 725 gene locus_tag LOCUS_25090 <1 725 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001086430.1:AraC family transcriptional regulator 1229 735 gene locus_tag LOCUS_25100 1229 735 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021299043.1 protein_id gnl|my_center|LOCUS_25100 1743 1294 gene locus_tag LOCUS_25110 gene lspA 1743 1294 CDS product signal peptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529575.1 protein_id gnl|my_center|LOCUS_25110 >Feature sequence451 1887 982 gene locus_tag LOCUS_25120 1887 982 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963403.1 protein_id gnl|my_center|LOCUS_25120 >Feature sequence452 805 1947 gene locus_tag LOCUS_25130 gene nifS 805 1947 CDS product cysteine desulfurase NifS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065651.1 protein_id gnl|my_center|LOCUS_25130 >Feature sequence453 1736 132 gene locus_tag LOCUS_25140 1736 132 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966175.1 protein_id gnl|my_center|LOCUS_25140 >Feature sequence454 209 87 gene locus_tag LOCUS_25150 209 87 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25150 481 1677 gene locus_tag LOCUS_25160 481 1677 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228075.1 protein_id gnl|my_center|LOCUS_25160 1634 1783 gene locus_tag LOCUS_25170 1634 1783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25170 1820 1975 gene locus_tag LOCUS_25180 1820 1975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25180 >Feature sequence455 <1 1389 gene locus_tag LOCUS_25190 <1 1389 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010964979.1:ATP-dependent DNA helicase <2046 1483 gene locus_tag LOCUS_25200 <2046 1483 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011948925.1:DegV family protein >Feature sequence456 <1 525 gene locus_tag LOCUS_25210 <1 525 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003058809.1:S24 family peptidase 582 782 gene locus_tag LOCUS_25220 gene cylR2 582 782 CDS product cytolysin regulator CylR2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002370931.1 protein_id gnl|my_center|LOCUS_25220 1274 840 gene locus_tag LOCUS_25230 1274 840 CDS product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020418.1 protein_id gnl|my_center|LOCUS_25230 1645 1271 gene locus_tag LOCUS_25240 1645 1271 CDS product MmcQ/YjbR family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104332.1 protein_id gnl|my_center|LOCUS_25240 >Feature sequence457 1307 372 gene locus_tag LOCUS_25250 1307 372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25250 <1959 1451 gene locus_tag LOCUS_25260 <1959 1451 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010989371.1:alpha-glucosidase >Feature sequence458 789 535 gene locus_tag LOCUS_25270 789 535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25270 587 596 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 959 1507 gene locus_tag LOCUS_25280 959 1507 CDS product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948224.1 protein_id gnl|my_center|LOCUS_25280 >Feature sequence459 944 636 gene locus_tag LOCUS_25290 944 636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25290 1913 993 gene locus_tag LOCUS_25300 1913 993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25300 >Feature sequence460 1490 48 gene locus_tag LOCUS_25310 gene miaB 1490 48 CDS product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435252.1 protein_id gnl|my_center|LOCUS_25310 >Feature sequence461 1643 384 gene locus_tag LOCUS_25320 1643 384 CDS product voltage-gated chloride channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005416818.1 protein_id gnl|my_center|LOCUS_25320 >Feature sequence462 266 1444 gene locus_tag LOCUS_25330 266 1444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_25330 1318 1327 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1423 1602 gene locus_tag LOCUS_25340 1423 1602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25340 >Feature sequence463 <1 1098 gene locus_tag LOCUS_25350 <1 1098 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014636419.1:alkaline phosphatase family protein >Feature sequence464 170 397 gene locus_tag LOCUS_25360 170 397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25360 369 935 gene locus_tag LOCUS_25370 369 935 CDS product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393630.1 protein_id gnl|my_center|LOCUS_25370 >Feature sequence465 1295 9 gene locus_tag LOCUS_25380 gene aroA 1295 9 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005171024.1 protein_id gnl|my_center|LOCUS_25380 >Feature sequence466 1697 120 gene locus_tag LOCUS_25390 1697 120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25390 >Feature sequence467 945 346 gene locus_tag LOCUS_25400 945 346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25400 504 513 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends <1844 1111 gene locus_tag LOCUS_25410 <1844 1111 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002209103.1:rhamnulose-1-phosphate aldolase >Feature sequence468 371 928 gene locus_tag LOCUS_25420 371 928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25420 >Feature sequence469 127 1647 gene locus_tag LOCUS_25430 127 1647 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014636508.1 protein_id gnl|my_center|LOCUS_25430 >Feature sequence470 27 761 gene locus_tag LOCUS_25440 27 761 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948182.1 protein_id gnl|my_center|LOCUS_25440 <1730 863 gene locus_tag LOCUS_25450 <1730 863 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000595957.1:UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase >Feature sequence471 1594 665 gene locus_tag LOCUS_25460 1594 665 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812720.1 protein_id gnl|my_center|LOCUS_25460 >Feature sequence472 99 440 gene locus_tag LOCUS_25470 99 440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25470 483 1253 gene locus_tag LOCUS_25480 483 1253 CDS product TraX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986406.1 protein_id gnl|my_center|LOCUS_25480 1634 1287 gene locus_tag LOCUS_25490 1634 1287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25490 >Feature sequence473 1098 493 gene locus_tag LOCUS_25500 gene hisH 1098 493 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949113.1 protein_id gnl|my_center|LOCUS_25500 >Feature sequence474 >Feature sequence475 76 699 gene locus_tag LOCUS_25510 76 699 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804777.1 protein_id gnl|my_center|LOCUS_25510 >Feature sequence476 1342 23 gene locus_tag LOCUS_25520 1342 23 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25520 >Feature sequence477 >Feature sequence478 927 88 gene locus_tag LOCUS_25530 927 88 CDS product recombinase RecT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047894.1 protein_id gnl|my_center|LOCUS_25530 1153 938 gene locus_tag LOCUS_25540 1153 938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25540 1439 1146 gene locus_tag LOCUS_25550 1439 1146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25550 >Feature sequence479 286 1158 gene locus_tag LOCUS_25560 gene modA 286 1158 CDS product molybdate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002382290.1 protein_id gnl|my_center|LOCUS_25560 >Feature sequence480 <1 719 gene locus_tag LOCUS_25570 <1 719 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003427022.1:redox-regulated ATPase YchF 770 1024 gene locus_tag LOCUS_25580 770 1024 CDS product YlmC/YmxH family sporulation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392374.1 protein_id gnl|my_center|LOCUS_25580 >Feature sequence481 907 206 gene locus_tag LOCUS_25590 gene sdhB 907 206 CDS product succinate dehydrogenase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830165.1 protein_id gnl|my_center|LOCUS_25590 1410 913 gene locus_tag LOCUS_25600 1410 913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25600 >Feature sequence482 >Feature sequence483 911 180 gene locus_tag LOCUS_25610 911 180 CDS product S24 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922199.1 protein_id gnl|my_center|LOCUS_25610 >Feature sequence484 <1 1145 gene locus_tag LOCUS_25620 <1 1145 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012546465.1:acetylornithine transaminase >Feature sequence485 67 279 gene locus_tag LOCUS_25630 67 279 CDS product DUF378 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948188.1 protein_id gnl|my_center|LOCUS_25630 784 362 gene locus_tag LOCUS_25640 784 362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048265.1 protein_id gnl|my_center|LOCUS_25640 <1411 883 gene locus_tag LOCUS_25650 <1411 883 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_187296528.1:D-alanyl-D-alanine carboxypeptidase family protein >Feature sequence486 715 371 gene locus_tag LOCUS_25660 715 371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_25660 968 669 gene locus_tag LOCUS_25670 968 669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25670 1327 965 gene locus_tag LOCUS_25680 1327 965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25680 978 987 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence487 >Feature sequence488 877 656 gene locus_tag LOCUS_25690 877 656 CDS product Maff2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002610321.1 protein_id gnl|my_center|LOCUS_25690