>Feature sequence001 243 1016 gene locus_tag LOCUS_00010 243 1016 CDS product TSUP family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681078.1 protein_id gnl|my_center|LOCUS_00010 1114 1374 gene locus_tag LOCUS_00020 1114 1374 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_129080272.1 protein_id gnl|my_center|LOCUS_00020 1387 1602 gene locus_tag LOCUS_00030 1387 1602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00030 2514 1660 gene locus_tag LOCUS_00040 2514 1660 CDS product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948024.1 protein_id gnl|my_center|LOCUS_00040 2770 3183 gene locus_tag LOCUS_00050 2770 3183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00050 3180 3668 gene locus_tag LOCUS_00060 gene tadA 3180 3668 CDS product tRNA adenosine(34) deaminase TadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000439010.1 protein_id gnl|my_center|LOCUS_00060 3914 4819 gene locus_tag LOCUS_00070 3914 4819 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897780.1 protein_id gnl|my_center|LOCUS_00070 4899 6284 gene locus_tag LOCUS_00080 4899 6284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00080 7677 6358 gene locus_tag LOCUS_00090 7677 6358 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068386.1 protein_id gnl|my_center|LOCUS_00090 7912 8580 gene locus_tag LOCUS_00100 7912 8580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00100 8776 9033 gene locus_tag LOCUS_00110 8776 9033 CDS product HPr family phosphocarrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051543.1 protein_id gnl|my_center|LOCUS_00110 9118 10764 gene locus_tag LOCUS_00120 gene ptsP 9118 10764 CDS product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051542.1 protein_id gnl|my_center|LOCUS_00120 10996 12183 gene locus_tag LOCUS_00130 10996 12183 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426667.1 protein_id gnl|my_center|LOCUS_00130 12211 13395 gene locus_tag LOCUS_00140 12211 13395 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811798.1 protein_id gnl|my_center|LOCUS_00140 13476 14687 gene locus_tag LOCUS_00150 13476 14687 CDS product NADP-dependent isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812388.1 protein_id gnl|my_center|LOCUS_00150 14795 16570 gene locus_tag LOCUS_00160 14795 16570 CDS product glycoside hydrolase family 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679450.1 protein_id gnl|my_center|LOCUS_00160 17863 16751 gene locus_tag LOCUS_00170 17863 16751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00170 21500 18039 gene locus_tag LOCUS_00180 gene mfd 21500 18039 CDS product transcription-repair coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243453.1 protein_id gnl|my_center|LOCUS_00180 22317 21739 gene locus_tag LOCUS_00190 gene pth 22317 21739 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966493.1 protein_id gnl|my_center|LOCUS_00190 23249 22494 gene locus_tag LOCUS_00200 23249 22494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00200 23627 26293 gene locus_tag LOCUS_00210 gene ppdK 23627 26293 CDS product pyruvate, phosphate dikinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047993.1 protein_id gnl|my_center|LOCUS_00210 26437 27066 gene locus_tag LOCUS_00220 26437 27066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00220 27068 27553 gene locus_tag LOCUS_00230 27068 27553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00230 27812 28399 gene locus_tag LOCUS_00240 27812 28399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00240 28386 30098 gene locus_tag LOCUS_00250 28386 30098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00250 30167 30313 gene locus_tag LOCUS_00260 30167 30313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00260 30398 32137 gene locus_tag LOCUS_00270 30398 32137 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861938.1 protein_id gnl|my_center|LOCUS_00270 32153 32311 gene locus_tag LOCUS_00280 32153 32311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00280 32593 33528 gene locus_tag LOCUS_00290 32593 33528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00290 33540 33878 gene locus_tag LOCUS_00300 33540 33878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00300 33875 34807 gene locus_tag LOCUS_00310 33875 34807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00310 34870 35586 gene locus_tag LOCUS_00320 34870 35586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00320 35599 35937 gene locus_tag LOCUS_00330 35599 35937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00330 35952 36305 gene locus_tag LOCUS_00340 35952 36305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00340 36546 37256 gene locus_tag LOCUS_00350 36546 37256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00350 38065 37523 gene locus_tag LOCUS_00360 38065 37523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00360 38462 38070 gene locus_tag LOCUS_00370 38462 38070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00370 39142 38462 gene locus_tag LOCUS_00380 39142 38462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00380 39492 39322 gene locus_tag LOCUS_00390 39492 39322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00390 40279 39584 gene locus_tag LOCUS_00400 40279 39584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00400 40665 40279 gene locus_tag LOCUS_00410 40665 40279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00410 40878 42713 gene locus_tag LOCUS_00420 40878 42713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00420 42715 44067 gene locus_tag LOCUS_00430 42715 44067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00430 44057 47023 gene locus_tag LOCUS_00440 44057 47023 CDS product type I restriction endonuclease subunit R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114402.1 protein_id gnl|my_center|LOCUS_00440 47133 48431 gene locus_tag LOCUS_00450 47133 48431 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968626.1 protein_id gnl|my_center|LOCUS_00450 48428 49123 gene locus_tag LOCUS_00460 48428 49123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00460 49439 50839 gene locus_tag LOCUS_00470 49439 50839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00470 50836 51483 gene locus_tag LOCUS_00480 50836 51483 CDS product DUF4194 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015942934.1 protein_id gnl|my_center|LOCUS_00480 51434 54817 gene locus_tag LOCUS_00490 51434 54817 CDS product SbcC/MukB-like Walker B domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392027.1 protein_id gnl|my_center|LOCUS_00490 54777 56015 gene locus_tag LOCUS_00500 54777 56015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00500 56949 56218 gene locus_tag LOCUS_00510 56949 56218 CDS product IS3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000866395.1 protein_id gnl|my_center|LOCUS_00510 57419 57063 gene locus_tag LOCUS_00520 57419 57063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00520 57489 57941 gene locus_tag LOCUS_00530 57489 57941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00530 58038 58892 gene locus_tag LOCUS_00540 58038 58892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00540 59320 60957 gene locus_tag LOCUS_00550 59320 60957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00550 61657 64422 gene locus_tag LOCUS_00560 61657 64422 CDS product CRISPR-associated helicase/endonuclease Cas3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674070.1 protein_id gnl|my_center|LOCUS_00560 64409 66052 gene locus_tag LOCUS_00570 64409 66052 CDS product type I-E CRISPR-associated protein Cse1/CasA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009994024.1 protein_id gnl|my_center|LOCUS_00570 66049 66672 gene locus_tag LOCUS_00580 gene casB 66049 66672 CDS product type I-E CRISPR-associated protein Cse2/CasB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003586648.1 protein_id gnl|my_center|LOCUS_00580 66674 67747 gene locus_tag LOCUS_00590 gene cas7e 66674 67747 CDS product type I-E CRISPR-associated protein Cas7/Cse4/CasC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004138505.1 protein_id gnl|my_center|LOCUS_00590 67750 68436 gene locus_tag LOCUS_00600 67750 68436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00600 68443 69084 gene locus_tag LOCUS_00610 gene cas6e 68443 69084 CDS product type I-E CRISPR-associated protein Cas6/Cse3/CasE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674074.1 protein_id gnl|my_center|LOCUS_00610 69094 70158 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq cttttccccgcctgcgcgggggtgatcc 70202 71386 gene locus_tag LOCUS_00620 70202 71386 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000902186.1 protein_id gnl|my_center|LOCUS_00620 71373 71888 gene locus_tag LOCUS_00630 gene crr 71373 71888 CDS product PTS glucose transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003861316.1 protein_id gnl|my_center|LOCUS_00630 72060 73406 gene locus_tag LOCUS_00640 72060 73406 CDS product dicarboxylate/amino acid:cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387350.1 protein_id gnl|my_center|LOCUS_00640 73745 74728 gene locus_tag LOCUS_00650 73745 74728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00650 75890 74850 gene locus_tag LOCUS_00660 75890 74850 CDS product YeiH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003356366.1 protein_id gnl|my_center|LOCUS_00660 76780 75986 gene locus_tag LOCUS_00670 76780 75986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00670 77893 76793 gene locus_tag LOCUS_00680 77893 76793 CDS product TFIIB-type zinc ribbon-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944368.1 protein_id gnl|my_center|LOCUS_00680 79197 77908 gene locus_tag LOCUS_00690 79197 77908 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002675942.1 protein_id gnl|my_center|LOCUS_00690 79677 80192 gene locus_tag LOCUS_00700 gene thiW 79677 80192 CDS product energy coupling factor transporter S component ThiW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000842277.1 protein_id gnl|my_center|LOCUS_00700 80205 81026 gene locus_tag LOCUS_00710 gene thiM 80205 81026 CDS product hydroxyethylthiazole kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966377.1 protein_id gnl|my_center|LOCUS_00710 81013 81651 gene locus_tag LOCUS_00720 gene thiE 81013 81651 CDS product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963817.1 protein_id gnl|my_center|LOCUS_00720 81855 83165 gene locus_tag LOCUS_00730 gene thiC 81855 83165 CDS product phosphomethylpyrimidine synthase ThiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966296.1 protein_id gnl|my_center|LOCUS_00730 83343 84164 gene locus_tag LOCUS_00740 83343 84164 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108784.1 protein_id gnl|my_center|LOCUS_00740 84182 85186 gene locus_tag LOCUS_00750 84182 85186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00750 85326 85928 gene locus_tag LOCUS_00760 85326 85928 CDS product TVP38/TMEM64 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000347516.1 protein_id gnl|my_center|LOCUS_00760 86352 87749 gene locus_tag LOCUS_00770 gene cysS 86352 87749 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895184.1 protein_id gnl|my_center|LOCUS_00770 87880 88833 gene locus_tag LOCUS_00780 87880 88833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00780 89658 88906 gene locus_tag LOCUS_00790 89658 88906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00790 90605 89766 gene locus_tag LOCUS_00800 90605 89766 CDS product DUF5685 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435907.1 protein_id gnl|my_center|LOCUS_00800 91004 90609 gene locus_tag LOCUS_00810 91004 90609 CDS product Zn-finger containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964917.1 protein_id gnl|my_center|LOCUS_00810 93560 91155 gene locus_tag LOCUS_00820 93560 91155 CDS product glycoside hydrolase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014527693.1 protein_id gnl|my_center|LOCUS_00820 94094 93723 gene locus_tag LOCUS_00830 94094 93723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00830 94663 94307 gene locus_tag LOCUS_00840 94663 94307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00840 95456 94836 gene locus_tag LOCUS_00850 95456 94836 CDS product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966613.1 protein_id gnl|my_center|LOCUS_00850 95653 96222 gene locus_tag LOCUS_00860 gene rsmD 95653 96222 CDS product 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009933092.1 protein_id gnl|my_center|LOCUS_00860 96219 96680 gene locus_tag LOCUS_00870 96219 96680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00870 96955 97923 gene locus_tag LOCUS_00880 gene rsmH 96955 97923 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965431.1 protein_id gnl|my_center|LOCUS_00880 97962 98450 gene locus_tag LOCUS_00890 97962 98450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00890 98511 101066 gene locus_tag LOCUS_00900 98511 101066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00900 101081 102445 gene locus_tag LOCUS_00910 101081 102445 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272578.1 protein_id gnl|my_center|LOCUS_00910 102455 103492 gene locus_tag LOCUS_00920 102455 103492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00920 103506 104780 gene locus_tag LOCUS_00930 gene spoVE 103506 104780 CDS product stage V sporulation protein E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460697.1 protein_id gnl|my_center|LOCUS_00930 104793 105920 gene locus_tag LOCUS_00940 gene murG 104793 105920 CDS product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011110342.1 protein_id gnl|my_center|LOCUS_00940 105957 107585 gene locus_tag LOCUS_00950 105957 107585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00950 107601 109079 gene locus_tag LOCUS_00960 107601 109079 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965428.1 protein_id gnl|my_center|LOCUS_00960 110465 109146 gene locus_tag LOCUS_00970 110465 109146 CDS product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681109.1 protein_id gnl|my_center|LOCUS_00970 111200 110475 gene locus_tag LOCUS_00980 111200 110475 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461351.1 protein_id gnl|my_center|LOCUS_00980 112266 111190 gene locus_tag LOCUS_00990 112266 111190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00990 112496 113881 gene locus_tag LOCUS_01000 gene glmM 112496 113881 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000521476.1 protein_id gnl|my_center|LOCUS_01000 113907 114341 gene locus_tag LOCUS_01010 113907 114341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01010 114353 114634 gene locus_tag LOCUS_01020 114353 114634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01020 116521 114710 gene locus_tag LOCUS_01030 gene lepA 116521 114710 CDS product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229999.1 protein_id gnl|my_center|LOCUS_01030 117749 116544 gene locus_tag LOCUS_01040 gene alr 117749 116544 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963814.1 protein_id gnl|my_center|LOCUS_01040 118530 117730 gene locus_tag LOCUS_01050 118530 117730 CDS product tRNA 2-thiocytidine(32) synthetase TtcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435803.1 protein_id gnl|my_center|LOCUS_01050 119096 118527 gene locus_tag LOCUS_01060 119096 118527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01060 119384 119812 gene locus_tag LOCUS_01070 gene rplM 119384 119812 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421107.1 protein_id gnl|my_center|LOCUS_01070 119830 120228 gene locus_tag LOCUS_01080 gene rpsI 119830 120228 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357662.1 protein_id gnl|my_center|LOCUS_01080 120578 121408 gene locus_tag LOCUS_01090 120578 121408 CDS product phage antirepressor KilAC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922216.1 protein_id gnl|my_center|LOCUS_01090 121405 121572 gene locus_tag LOCUS_01100 121405 121572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01100 121553 122227 gene locus_tag LOCUS_01110 121553 122227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01110 122224 123069 gene locus_tag LOCUS_01120 122224 123069 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047835.1 protein_id gnl|my_center|LOCUS_01120 123066 123212 gene locus_tag LOCUS_01130 123066 123212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01130 123229 124056 gene locus_tag LOCUS_01140 123229 124056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01140 124073 124576 gene locus_tag LOCUS_01150 124073 124576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01150 124587 125222 gene locus_tag LOCUS_01160 124587 125222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01160 125241 125723 gene locus_tag LOCUS_01170 125241 125723 CDS product PcfB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002368727.1 protein_id gnl|my_center|LOCUS_01170 125720 127477 gene locus_tag LOCUS_01180 125720 127477 CDS product type IV secretory system conjugative DNA transfer family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861117.1 protein_id gnl|my_center|LOCUS_01180 127684 127899 gene locus_tag LOCUS_01190 127684 127899 CDS product Maff2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002610321.1 protein_id gnl|my_center|LOCUS_01190 128083 128298 gene locus_tag LOCUS_01200 128083 128298 CDS product Maff2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002610321.1 protein_id gnl|my_center|LOCUS_01200 128605 129471 gene locus_tag LOCUS_01210 128605 129471 CDS product CD0415/CD1112 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002610323.1 protein_id gnl|my_center|LOCUS_01210 129490 129882 gene locus_tag LOCUS_01220 129490 129882 CDS product PrgI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861115.1 protein_id gnl|my_center|LOCUS_01220 129902 132289 gene locus_tag LOCUS_01230 129902 132289 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010773627.1 protein_id gnl|my_center|LOCUS_01230 132293 134062 gene locus_tag LOCUS_01240 132293 134062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01240 134098 134358 gene locus_tag LOCUS_01250 134098 134358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01250 134346 135509 gene locus_tag LOCUS_01260 134346 135509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01260 136038 137534 gene locus_tag LOCUS_01270 136038 137534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01270 137875 139953 gene locus_tag LOCUS_01280 137875 139953 CDS product DNA topoisomerase 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002368714.1 protein_id gnl|my_center|LOCUS_01280 139950 140837 gene locus_tag LOCUS_01290 139950 140837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01290 140834 141142 gene locus_tag LOCUS_01300 140834 141142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01300 141129 141722 gene locus_tag LOCUS_01310 141129 141722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01310 141723 141929 gene locus_tag LOCUS_01320 141723 141929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01320 142729 143076 gene locus_tag LOCUS_01330 142729 143076 CDS product TnpV protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001140406.1 protein_id gnl|my_center|LOCUS_01330 143082 149315 gene locus_tag LOCUS_01340 143082 149315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01340 149312 149644 gene locus_tag LOCUS_01350 gene mobC 149312 149644 CDS product plasmid mobilization relaxosome protein MobC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002368707.1 protein_id gnl|my_center|LOCUS_01350 149799 150104 gene locus_tag LOCUS_01360 149799 150104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01360 150121 150390 gene locus_tag LOCUS_01370 150121 150390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01370 150451 151917 gene locus_tag LOCUS_01380 150451 151917 CDS product relaxase/mobilization nuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002368703.1 protein_id gnl|my_center|LOCUS_01380 152241 152468 gene locus_tag LOCUS_01390 152241 152468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01390 152449 153057 gene locus_tag LOCUS_01400 152449 153057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01400 153059 153634 gene locus_tag LOCUS_01410 153059 153634 CDS product DUF1788 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272229.1 protein_id gnl|my_center|LOCUS_01410 153653 157306 gene locus_tag LOCUS_01420 gene brxC 153653 157306 CDS product BREX system P-loop protein BrxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065383.1 protein_id gnl|my_center|LOCUS_01420 157327 160959 gene locus_tag LOCUS_01430 gene pglX 157327 160959 CDS product BREX-1 system adenine-specific DNA-methyltransferase PglX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022345.1 protein_id gnl|my_center|LOCUS_01430 160981 161463 gene locus_tag LOCUS_01440 160981 161463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01440 161460 161699 gene locus_tag LOCUS_01450 161460 161699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01450 161703 161924 gene locus_tag LOCUS_01460 161703 161924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01460 161979 164501 gene locus_tag LOCUS_01470 gene pglZ 161979 164501 CDS product BREX-1 system phosphatase PglZ type A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022339.1 protein_id gnl|my_center|LOCUS_01470 164525 166645 gene locus_tag LOCUS_01480 gene brxL 164525 166645 CDS product protease Lon-related BREX system protein BrxL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459233.1 protein_id gnl|my_center|LOCUS_01480 166673 167233 gene locus_tag LOCUS_01490 166673 167233 CDS product SLATT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039060.1 protein_id gnl|my_center|LOCUS_01490 167245 168054 gene locus_tag LOCUS_01500 167245 168054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01500 >Feature sequence002 2172 661 gene locus_tag LOCUS_01510 gene lysS 2172 661 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001288202.1 protein_id gnl|my_center|LOCUS_01510 2677 2192 gene locus_tag LOCUS_01520 gene greA 2677 2192 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048372.1 protein_id gnl|my_center|LOCUS_01520 2884 2696 gene locus_tag LOCUS_01530 2884 2696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01530 2917 4218 gene locus_tag LOCUS_01540 2917 4218 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986630.1 protein_id gnl|my_center|LOCUS_01540 5111 4266 gene locus_tag LOCUS_01550 5111 4266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01550 5239 6354 gene locus_tag LOCUS_01560 gene ugpC 5239 6354 CDS product sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966512.1 protein_id gnl|my_center|LOCUS_01560 6469 6765 gene locus_tag LOCUS_01570 6469 6765 CDS product putative quinol monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002285944.1 protein_id gnl|my_center|LOCUS_01570 7704 6838 gene locus_tag LOCUS_01580 7704 6838 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227021.1 protein_id gnl|my_center|LOCUS_01580 8681 7704 gene locus_tag LOCUS_01590 8681 7704 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582885.1 protein_id gnl|my_center|LOCUS_01590 10233 8794 gene locus_tag LOCUS_01600 10233 8794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01600 11328 10318 gene locus_tag LOCUS_01610 11328 10318 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393520.1 protein_id gnl|my_center|LOCUS_01610 11752 14187 gene locus_tag LOCUS_01620 11752 14187 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082399.1 protein_id gnl|my_center|LOCUS_01620 15047 14271 gene locus_tag LOCUS_01630 15047 14271 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002984187.1 protein_id gnl|my_center|LOCUS_01630 15801 15037 gene locus_tag LOCUS_01640 15801 15037 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903444.1 protein_id gnl|my_center|LOCUS_01640 16746 15910 gene locus_tag LOCUS_01650 16746 15910 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001038474.1 protein_id gnl|my_center|LOCUS_01650 17494 17036 gene locus_tag LOCUS_01660 17494 17036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_01660 18285 17491 gene locus_tag LOCUS_01670 18285 17491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_01670 20324 18420 gene locus_tag LOCUS_01680 20324 18420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01680 22429 20330 gene locus_tag LOCUS_01690 22429 20330 CDS product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930970.1 protein_id gnl|my_center|LOCUS_01690 22679 23272 gene locus_tag LOCUS_01700 22679 23272 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048232.1 protein_id gnl|my_center|LOCUS_01700 23415 23490 gene locus_tag LOCUS_t00010 23415 23490 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 24002 23649 gene locus_tag LOCUS_01710 24002 23649 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791443.1 protein_id gnl|my_center|LOCUS_01710 24148 24480 gene locus_tag LOCUS_01720 24148 24480 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007056318.1 protein_id gnl|my_center|LOCUS_01720 24935 25372 gene locus_tag LOCUS_01730 24935 25372 CDS product radical SAM mobile pair system MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679434.1 protein_id gnl|my_center|LOCUS_01730 25369 26058 gene locus_tag LOCUS_01740 25369 26058 CDS product radical SAM mobile pair protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679436.1 protein_id gnl|my_center|LOCUS_01740 26046 26954 gene locus_tag LOCUS_01750 26046 26954 CDS product radical SAM mobile pair protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679438.1 protein_id gnl|my_center|LOCUS_01750 27061 27504 gene locus_tag LOCUS_01760 27061 27504 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_124797437.1 protein_id gnl|my_center|LOCUS_01760 28707 27763 gene locus_tag LOCUS_01770 28707 27763 CDS product bile acid:sodium symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002244055.1 protein_id gnl|my_center|LOCUS_01770 29945 30259 gene locus_tag LOCUS_01780 29945 30259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01780 31717 30347 gene locus_tag LOCUS_01790 31717 30347 CDS product NCS2 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357375.1 protein_id gnl|my_center|LOCUS_01790 33792 32092 gene locus_tag LOCUS_01800 33792 32092 CDS product M3 family oligoendopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000008568.1 protein_id gnl|my_center|LOCUS_01800 34028 34255 gene locus_tag LOCUS_01810 gene acpP 34028 34255 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583309.1 protein_id gnl|my_center|LOCUS_01810 34267 35139 gene locus_tag LOCUS_01820 gene accD 34267 35139 CDS product acetyl-CoA carboxylase, carboxyltransferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000942856.1 protein_id gnl|my_center|LOCUS_01820 35136 36089 gene locus_tag LOCUS_01830 gene accA 35136 36089 CDS product acetyl-CoA carboxylase carboxyl transferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229417.1 protein_id gnl|my_center|LOCUS_01830 36086 37030 gene locus_tag LOCUS_01840 36086 37030 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225817.1 protein_id gnl|my_center|LOCUS_01840 37209 38144 gene locus_tag LOCUS_01850 37209 38144 CDS product nitronate monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009931899.1 protein_id gnl|my_center|LOCUS_01850 38168 39205 gene locus_tag LOCUS_01860 38168 39205 CDS product nitronate monooxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966843.1 protein_id gnl|my_center|LOCUS_01860 39202 40134 gene locus_tag LOCUS_01870 gene fabD 39202 40134 CDS product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356280.1 protein_id gnl|my_center|LOCUS_01870 40131 40880 gene locus_tag LOCUS_01880 gene fabG 40131 40880 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460500.1 protein_id gnl|my_center|LOCUS_01880 40896 42134 gene locus_tag LOCUS_01890 gene fabF 40896 42134 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966836.1 protein_id gnl|my_center|LOCUS_01890 42138 42614 gene locus_tag LOCUS_01900 gene fabZ 42138 42614 CDS product 3-hydroxyacyl-ACP dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257317.1 protein_id gnl|my_center|LOCUS_01900 44026 42920 gene locus_tag LOCUS_01910 44026 42920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01910 44850 44128 gene locus_tag LOCUS_01920 44850 44128 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989414.1 protein_id gnl|my_center|LOCUS_01920 46205 44850 gene locus_tag LOCUS_01930 46205 44850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01930 46894 46205 gene locus_tag LOCUS_01940 46894 46205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01940 48763 46898 gene locus_tag LOCUS_01950 48763 46898 CDS product KAP family P-loop domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010884100.1 protein_id gnl|my_center|LOCUS_01950 49023 48787 gene locus_tag LOCUS_01960 49023 48787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01960 51627 49372 gene locus_tag LOCUS_01970 51627 49372 CDS product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966109.1 protein_id gnl|my_center|LOCUS_01970 51900 52934 gene locus_tag LOCUS_01980 51900 52934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01980 52962 56117 gene locus_tag LOCUS_01990 52962 56117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01990 56350 56578 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq attgcaatttatccccgcaaggggacggaaac 58085 56640 gene locus_tag LOCUS_02000 58085 56640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02000 59100 58087 gene locus_tag LOCUS_02010 59100 58087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02010 59715 59107 gene locus_tag LOCUS_02020 59715 59107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02020 59900 60106 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq ataccatccccgtaagggggcgaaaac 60274 60642 gene locus_tag LOCUS_02030 60274 60642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02030 60792 61306 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtaccatccccgtaagggggcgaaga 61545 63929 gene locus_tag LOCUS_02040 gene cas10 61545 63929 CDS product type III-A CRISPR-associated protein Cas10/Csm1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900580.1 protein_id gnl|my_center|LOCUS_02040 63913 64455 gene locus_tag LOCUS_02050 gene csm2 63913 64455 CDS product type III-A CRISPR-associated protein Csm2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002917164.1 protein_id gnl|my_center|LOCUS_02050 64460 65134 gene locus_tag LOCUS_02060 gene csm3 64460 65134 CDS product type III-A CRISPR-associated RAMP protein Csm3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002917166.1 protein_id gnl|my_center|LOCUS_02060 65115 66080 gene locus_tag LOCUS_02070 gene csm4 65115 66080 CDS product type III-A CRISPR-associated RAMP protein Csm4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414288.1 protein_id gnl|my_center|LOCUS_02070 66077 67180 gene locus_tag LOCUS_02080 gene csm5 66077 67180 CDS product type III-A CRISPR-associated RAMP protein Csm5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002917169.1 protein_id gnl|my_center|LOCUS_02080 67177 67932 gene locus_tag LOCUS_02090 gene cas6 67177 67932 CDS product CRISPR-associated endoribonuclease Cas6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837017.1 protein_id gnl|my_center|LOCUS_02090 68155 71313 gene locus_tag LOCUS_02100 68155 71313 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_149495417.1 protein_id gnl|my_center|LOCUS_02100 71320 71688 gene locus_tag LOCUS_02110 71320 71688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02110 71703 72101 gene locus_tag LOCUS_02120 gene mutT 71703 72101 CDS product 8-oxo-dGTP diphosphatase MutT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681243.1 protein_id gnl|my_center|LOCUS_02120 72425 73360 gene locus_tag LOCUS_02130 72425 73360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02130 73372 73686 gene locus_tag LOCUS_02140 73372 73686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02140 73706 74638 gene locus_tag LOCUS_02150 73706 74638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02150 74760 75959 gene locus_tag LOCUS_02160 74760 75959 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017115.1 protein_id gnl|my_center|LOCUS_02160 76032 76742 gene locus_tag LOCUS_02170 76032 76742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02170 76855 78528 gene locus_tag LOCUS_02180 76855 78528 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005898122.1 protein_id gnl|my_center|LOCUS_02180 79248 78769 gene locus_tag LOCUS_02190 gene tnpA 79248 78769 CDS product IS200/IS605 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000093392.1 protein_id gnl|my_center|LOCUS_02190 80900 79413 gene locus_tag LOCUS_02200 80900 79413 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389524.1 protein_id gnl|my_center|LOCUS_02200 81778 81161 gene locus_tag LOCUS_02210 81778 81161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02210 82457 81801 gene locus_tag LOCUS_02220 82457 81801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02220 83121 83045 gene locus_tag LOCUS_t00020 83121 83045 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 83280 83444 gene locus_tag LOCUS_02230 83280 83444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02230 83777 83484 gene locus_tag LOCUS_02240 83777 83484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02240 84016 83777 gene locus_tag LOCUS_02250 84016 83777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02250 84170 83982 gene locus_tag LOCUS_02260 84170 83982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02260 84200 84820 gene locus_tag LOCUS_02270 84200 84820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02270 84822 85514 gene locus_tag LOCUS_02280 gene tsaA 84822 85514 CDS product tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459538.1 protein_id gnl|my_center|LOCUS_02280 85526 86401 gene locus_tag LOCUS_02290 85526 86401 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963352.1 protein_id gnl|my_center|LOCUS_02290 87511 86480 gene locus_tag LOCUS_02300 87511 86480 CDS product P1 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867209.1 protein_id gnl|my_center|LOCUS_02300 88566 87628 gene locus_tag LOCUS_02310 gene metA 88566 87628 CDS product homoserine O-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965131.1 protein_id gnl|my_center|LOCUS_02310 90003 88729 gene locus_tag LOCUS_02320 90003 88729 CDS product O-acetylhomoserine aminocarboxypropyltransferase/cysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790318.1 protein_id gnl|my_center|LOCUS_02320 91047 90391 gene locus_tag LOCUS_02330 91047 90391 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000009571.1 protein_id gnl|my_center|LOCUS_02330 92057 91044 gene locus_tag LOCUS_02340 gene metN 92057 91044 CDS product methionine ABC transporter ATP-binding protein MetN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047863666.1 protein_id gnl|my_center|LOCUS_02340 93172 92246 gene locus_tag LOCUS_02350 93172 92246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02350 95429 93627 gene locus_tag LOCUS_02360 gene dnaK 95429 93627 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392122.1 protein_id gnl|my_center|LOCUS_02360 96588 95527 gene locus_tag LOCUS_02370 96588 95527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02370 97348 96716 gene locus_tag LOCUS_02380 97348 96716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02380 98753 97767 gene locus_tag LOCUS_02390 98753 97767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02390 99543 99004 gene locus_tag LOCUS_02400 99543 99004 CDS product rubrerythrin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418513.1 protein_id gnl|my_center|LOCUS_02400 102293 99678 gene locus_tag LOCUS_02410 102293 99678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02410 103142 102339 gene locus_tag LOCUS_02420 gene rlmB 103142 102339 CDS product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009887855.1 protein_id gnl|my_center|LOCUS_02420 103708 104571 gene locus_tag LOCUS_02430 gene fba 103708 104571 CDS product class II fructose-1,6-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964145.1 protein_id gnl|my_center|LOCUS_02430 105997 104726 gene locus_tag LOCUS_02440 105997 104726 CDS product folylpolyglutamate synthase/dihydrofolate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392070.1 protein_id gnl|my_center|LOCUS_02440 106503 105994 gene locus_tag LOCUS_02450 106503 105994 CDS product folate family ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641760.1 protein_id gnl|my_center|LOCUS_02450 108463 106916 gene locus_tag LOCUS_02460 108463 106916 CDS product alkaline phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_080510938.1 protein_id gnl|my_center|LOCUS_02460 108756 109574 gene locus_tag LOCUS_02470 108756 109574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02470 111890 109968 gene locus_tag LOCUS_02480 111890 109968 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043943600.1 protein_id gnl|my_center|LOCUS_02480 113641 111890 gene locus_tag LOCUS_02490 113641 111890 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966684.1 protein_id gnl|my_center|LOCUS_02490 114152 113676 gene locus_tag LOCUS_02500 114152 113676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02500 114425 114195 gene locus_tag LOCUS_02510 114425 114195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02510 114417 115547 gene locus_tag LOCUS_02520 114417 115547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02520 116229 115618 gene locus_tag LOCUS_02530 116229 115618 CDS product epoxyqueuosine reductase QueH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957156.1 protein_id gnl|my_center|LOCUS_02530 116361 116564 gene locus_tag LOCUS_02540 116361 116564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02540 116770 118065 gene locus_tag LOCUS_02550 116770 118065 CDS product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837602.1 protein_id gnl|my_center|LOCUS_02550 118108 119007 gene locus_tag LOCUS_02560 118108 119007 CDS product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837508.1 protein_id gnl|my_center|LOCUS_02560 119779 119183 gene locus_tag LOCUS_02570 119779 119183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02570 121367 120450 gene locus_tag LOCUS_02580 121367 120450 CDS product RnfABCDGE type electron transport complex subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428486.1 protein_id gnl|my_center|LOCUS_02580 122015 121383 gene locus_tag LOCUS_02590 gene rsxA 122015 121383 CDS product electron transport complex subunit RsxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005778198.1 protein_id gnl|my_center|LOCUS_02590 122682 122017 gene locus_tag LOCUS_02600 122682 122017 CDS product electron transport complex subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788152.1 protein_id gnl|my_center|LOCUS_02600 123247 122699 gene locus_tag LOCUS_02610 123247 122699 CDS product RnfABCDGE type electron transport complex subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948147.1 protein_id gnl|my_center|LOCUS_02610 124203 123244 gene locus_tag LOCUS_02620 124203 123244 CDS product RnfABCDGE type electron transport complex subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761244.1 protein_id gnl|my_center|LOCUS_02620 125525 124203 gene locus_tag LOCUS_02630 gene rsxC 125525 124203 CDS product electron transport complex subunit RsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948145.1 protein_id gnl|my_center|LOCUS_02630 125871 125996 gene locus_tag LOCUS_02640 125871 125996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02640 126595 126089 gene locus_tag LOCUS_02650 126595 126089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02650 127154 126618 gene locus_tag LOCUS_02660 127154 126618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02660 129040 127151 gene locus_tag LOCUS_02670 129040 127151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02670 129787 129044 gene locus_tag LOCUS_02680 129787 129044 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461000.1 protein_id gnl|my_center|LOCUS_02680 130610 129801 gene locus_tag LOCUS_02690 130610 129801 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_092473236.1 protein_id gnl|my_center|LOCUS_02690 131183 130617 gene locus_tag LOCUS_02700 gene rfbC 131183 130617 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965628.1 protein_id gnl|my_center|LOCUS_02700 132756 131440 gene locus_tag LOCUS_02710 132756 131440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02710 133417 132827 gene locus_tag LOCUS_02720 133417 132827 CDS product dipicolinate synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392579.1 protein_id gnl|my_center|LOCUS_02720 134208 133414 gene locus_tag LOCUS_02730 134208 133414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02730 135223 134312 gene locus_tag LOCUS_02740 135223 134312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02740 136350 135409 gene locus_tag LOCUS_02750 136350 135409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02750 137012 136332 gene locus_tag LOCUS_02760 137012 136332 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405372.1 protein_id gnl|my_center|LOCUS_02760 137880 137017 gene locus_tag LOCUS_02770 137880 137017 CDS product TraX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002261883.1 protein_id gnl|my_center|LOCUS_02770 138465 137947 gene locus_tag LOCUS_02780 138465 137947 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387373.1 protein_id gnl|my_center|LOCUS_02780 139054 138584 gene locus_tag LOCUS_02790 139054 138584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02790 141042 139261 gene locus_tag LOCUS_02800 141042 139261 CDS product DUF262 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080566.1 protein_id gnl|my_center|LOCUS_02800 >Feature sequence003 2910 1171 gene locus_tag LOCUS_02810 2910 1171 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965689.1 protein_id gnl|my_center|LOCUS_02810 4262 3153 gene locus_tag LOCUS_02820 4262 3153 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011793088.1 protein_id gnl|my_center|LOCUS_02820 5428 4274 gene locus_tag LOCUS_02830 gene rlmD 5428 4274 CDS product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000105059.1 protein_id gnl|my_center|LOCUS_02830 6201 5779 gene locus_tag LOCUS_02840 6201 5779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02840 6518 7600 gene locus_tag LOCUS_02850 gene serC 6518 7600 CDS product 3-phosphoserine/phosphohydroxythreonine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462039.1 protein_id gnl|my_center|LOCUS_02850 7625 8785 gene locus_tag LOCUS_02860 7625 8785 CDS product 3-phosphoglycerate dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000490251.1 protein_id gnl|my_center|LOCUS_02860 9807 8938 gene locus_tag LOCUS_02870 9807 8938 CDS product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003863110.1 protein_id gnl|my_center|LOCUS_02870 10119 11552 gene locus_tag LOCUS_02880 10119 11552 CDS product 6-phospho-beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002375743.1 protein_id gnl|my_center|LOCUS_02880 11585 12541 gene locus_tag LOCUS_02890 11585 12541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02890 13912 12611 gene locus_tag LOCUS_02900 13912 12611 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582759.1 protein_id gnl|my_center|LOCUS_02900 14258 14467 gene locus_tag LOCUS_02910 14258 14467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02910 14492 15841 gene locus_tag LOCUS_02920 14492 15841 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972693.1 protein_id gnl|my_center|LOCUS_02920 15957 16913 gene locus_tag LOCUS_02930 15957 16913 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775816.1 protein_id gnl|my_center|LOCUS_02930 16907 17821 gene locus_tag LOCUS_02940 16907 17821 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775817.1 protein_id gnl|my_center|LOCUS_02940 17839 20544 gene locus_tag LOCUS_02950 17839 20544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02950 22812 20617 gene locus_tag LOCUS_02960 22812 20617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02960 25408 23882 gene locus_tag LOCUS_02970 25408 23882 CDS product BCCT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678766.1 protein_id gnl|my_center|LOCUS_02970 26101 25409 gene locus_tag LOCUS_02980 26101 25409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02980 27905 26121 gene locus_tag LOCUS_02990 27905 26121 CDS product phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678765.1 protein_id gnl|my_center|LOCUS_02990 28805 28005 gene locus_tag LOCUS_03000 28805 28005 CDS product LicD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002379605.1 protein_id gnl|my_center|LOCUS_03000 30247 28850 gene locus_tag LOCUS_03010 30247 28850 CDS product oligosaccharide flippase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000091276.1 protein_id gnl|my_center|LOCUS_03010 31589 30465 gene locus_tag LOCUS_03020 31589 30465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03020 32704 31604 gene locus_tag LOCUS_03030 32704 31604 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461017.1 protein_id gnl|my_center|LOCUS_03030 33580 32714 gene locus_tag LOCUS_03040 33580 32714 CDS product beta-1,6-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767582.1 protein_id gnl|my_center|LOCUS_03040 34367 33588 gene locus_tag LOCUS_03050 34367 33588 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422862.1 protein_id gnl|my_center|LOCUS_03050 35725 34367 gene locus_tag LOCUS_03060 35725 34367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03060 36504 36352 gene locus_tag LOCUS_03070 36504 36352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03070 36875 36681 gene locus_tag LOCUS_03080 36875 36681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03080 37453 38811 gene locus_tag LOCUS_03090 37453 38811 CDS product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965627.1 protein_id gnl|my_center|LOCUS_03090 38808 39944 gene locus_tag LOCUS_03100 38808 39944 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392196.1 protein_id gnl|my_center|LOCUS_03100 39941 40930 gene locus_tag LOCUS_03110 gene pglE 39941 40930 CDS product (galactosaminyl)2-N,N'-diacetylbacillosaminyl-alpha1-diphospho-di-trans,octa-cis-undecaprenol synthase PglE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003704837.1 protein_id gnl|my_center|LOCUS_03110 42082 42873 gene locus_tag LOCUS_03120 42082 42873 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203389.1 protein_id gnl|my_center|LOCUS_03120 42902 43993 gene locus_tag LOCUS_03130 gene wecB 42902 43993 CDS product UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000140128.1 protein_id gnl|my_center|LOCUS_03130 44013 45011 gene locus_tag LOCUS_03140 44013 45011 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475870.1 protein_id gnl|my_center|LOCUS_03140 45022 46551 gene locus_tag LOCUS_03150 45022 46551 CDS product flippase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021083.1 protein_id gnl|my_center|LOCUS_03150 47270 46971 gene locus_tag LOCUS_03160 47270 46971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03160 48296 47385 gene locus_tag LOCUS_03170 48296 47385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03170 48506 50116 gene locus_tag LOCUS_03180 48506 50116 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681273.1 protein_id gnl|my_center|LOCUS_03180 51648 50140 gene locus_tag LOCUS_03190 51648 50140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03190 51949 51874 gene locus_tag LOCUS_t00030 51949 51874 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 52195 53454 gene locus_tag LOCUS_03200 52195 53454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03200 53489 54574 gene locus_tag LOCUS_03210 53489 54574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03210 55237 54632 gene locus_tag LOCUS_03220 55237 54632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03220 56058 55384 gene locus_tag LOCUS_03230 gene cobC 56058 55384 CDS product alpha-ribazole phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964694.1 protein_id gnl|my_center|LOCUS_03230 56341 57036 gene locus_tag LOCUS_03240 56341 57036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03240 57156 57779 gene locus_tag LOCUS_03250 57156 57779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03250 57939 58472 gene locus_tag LOCUS_03260 57939 58472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03260 58726 59361 gene locus_tag LOCUS_03270 58726 59361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03270 60809 59439 gene locus_tag LOCUS_03280 60809 59439 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001036271.1 protein_id gnl|my_center|LOCUS_03280 61715 60891 gene locus_tag LOCUS_03290 61715 60891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03290 62358 61723 gene locus_tag LOCUS_03300 gene hisIE 62358 61723 CDS product bifunctional phosphoribosyl-AMP cyclohydrolase/phosphoribosyl-ATP diphosphatase HisIE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861249.1 protein_id gnl|my_center|LOCUS_03300 63177 62425 gene locus_tag LOCUS_03310 gene hisF 63177 62425 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964259.1 protein_id gnl|my_center|LOCUS_03310 63913 63194 gene locus_tag LOCUS_03320 gene hisA 63913 63194 CDS product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino]imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242559.1 protein_id gnl|my_center|LOCUS_03320 64601 63993 gene locus_tag LOCUS_03330 gene hisH 64601 63993 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436678.1 protein_id gnl|my_center|LOCUS_03330 65188 64598 gene locus_tag LOCUS_03340 gene hisB 65188 64598 CDS product imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009566359.1 protein_id gnl|my_center|LOCUS_03340 66253 65192 gene locus_tag LOCUS_03350 gene hisC 66253 65192 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040076.1 protein_id gnl|my_center|LOCUS_03350 67700 66420 gene locus_tag LOCUS_03360 gene hisD 67700 66420 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009930740.1 protein_id gnl|my_center|LOCUS_03360 69289 67697 gene locus_tag LOCUS_03370 69289 67697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03370 69851 69543 gene locus_tag LOCUS_03380 gene trxA 69851 69543 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329897.1 protein_id gnl|my_center|LOCUS_03380 70411 70067 gene locus_tag LOCUS_03390 70411 70067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03390 70845 70501 gene locus_tag LOCUS_03400 70845 70501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03400 72207 71038 gene locus_tag LOCUS_03410 72207 71038 CDS product DHHW family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_138263010.1 protein_id gnl|my_center|LOCUS_03410 73639 72221 gene locus_tag LOCUS_03420 73639 72221 CDS product MBOAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461245.1 protein_id gnl|my_center|LOCUS_03420 74351 73779 gene locus_tag LOCUS_03430 74351 73779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03430 75420 74500 gene locus_tag LOCUS_03440 75420 74500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03440 75496 75936 gene locus_tag LOCUS_03450 gene spoVAC 75496 75936 CDS product stage V sporulation protein AC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944604.1 protein_id gnl|my_center|LOCUS_03450 76072 77100 gene locus_tag LOCUS_03460 gene spoVAD 76072 77100 CDS product stage V sporulation protein AD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392888.1 protein_id gnl|my_center|LOCUS_03460 77097 77453 gene locus_tag LOCUS_03470 gene spoVAE 77097 77453 CDS product stage V sporulation protein AE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392887.1 protein_id gnl|my_center|LOCUS_03470 77560 77841 gene locus_tag LOCUS_03480 77560 77841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03480 78103 77843 gene locus_tag LOCUS_03490 gene rpsT 78103 77843 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011183267.1 protein_id gnl|my_center|LOCUS_03490 78280 79065 gene locus_tag LOCUS_03500 gene gpr 78280 79065 CDS product GPR endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048007.1 protein_id gnl|my_center|LOCUS_03500 79219 80328 gene locus_tag LOCUS_03510 79219 80328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03510 81931 80447 gene locus_tag LOCUS_03520 81931 80447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03520 82399 83787 gene locus_tag LOCUS_03530 gene asnS 82399 83787 CDS product asparagine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966534.1 protein_id gnl|my_center|LOCUS_03530 83956 85011 gene locus_tag LOCUS_03540 gene mutY 83956 85011 CDS product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243838.1 protein_id gnl|my_center|LOCUS_03540 85139 85345 gene locus_tag LOCUS_03550 85139 85345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03550 85471 86775 gene locus_tag LOCUS_03560 85471 86775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03560 86865 87551 gene locus_tag LOCUS_03570 86865 87551 CDS product zf-HC2 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809618.1 protein_id gnl|my_center|LOCUS_03570 87556 88041 gene locus_tag LOCUS_03580 87556 88041 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_072771878.1 protein_id gnl|my_center|LOCUS_03580 89302 88151 gene locus_tag LOCUS_03590 89302 88151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03590 89976 89299 gene locus_tag LOCUS_03600 89976 89299 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085905.1 protein_id gnl|my_center|LOCUS_03600 90125 90271 gene locus_tag LOCUS_03610 90125 90271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03610 90264 91181 gene locus_tag LOCUS_03620 90264 91181 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861372.1 protein_id gnl|my_center|LOCUS_03620 91194 92153 gene locus_tag LOCUS_03630 91194 92153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03630 >Feature sequence004 379 1209 gene locus_tag LOCUS_03640 379 1209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03640 1193 1858 gene locus_tag LOCUS_03650 1193 1858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03650 2771 1968 gene locus_tag LOCUS_03660 2771 1968 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964642.1 protein_id gnl|my_center|LOCUS_03660 3114 4502 gene locus_tag LOCUS_03670 3114 4502 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476670.1 protein_id gnl|my_center|LOCUS_03670 4510 5388 gene locus_tag LOCUS_03680 4510 5388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03680 5407 6252 gene locus_tag LOCUS_03690 5407 6252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03690 6822 7073 gene locus_tag LOCUS_03700 6822 7073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03700 8073 7207 gene locus_tag LOCUS_03710 8073 7207 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009909131.1 protein_id gnl|my_center|LOCUS_03710 8371 9648 gene locus_tag LOCUS_03720 8371 9648 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012774915.1 protein_id gnl|my_center|LOCUS_03720 9723 10556 gene locus_tag LOCUS_03730 9723 10556 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002939305.1 protein_id gnl|my_center|LOCUS_03730 10560 11396 gene locus_tag LOCUS_03740 10560 11396 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011921761.1 protein_id gnl|my_center|LOCUS_03740 11506 13764 gene locus_tag LOCUS_03750 11506 13764 CDS product alpha-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_111154492.1 protein_id gnl|my_center|LOCUS_03750 13771 15597 gene locus_tag LOCUS_03760 13771 15597 CDS product alpha-amylase family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258398.1 protein_id gnl|my_center|LOCUS_03760 15609 16541 gene locus_tag LOCUS_03770 15609 16541 CDS product carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009968826.1 protein_id gnl|my_center|LOCUS_03770 16785 19397 gene locus_tag LOCUS_03780 16785 19397 CDS product glycoside hydrolase family 78 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256267.1 protein_id gnl|my_center|LOCUS_03780 20355 19507 gene locus_tag LOCUS_03790 20355 19507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03790 22173 20359 gene locus_tag LOCUS_03800 22173 20359 CDS product family 43 glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203676.1 protein_id gnl|my_center|LOCUS_03800 24385 22178 gene locus_tag LOCUS_03810 24385 22178 CDS product glycoside hydrolase family 2 TIM barrel-domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107432.1 protein_id gnl|my_center|LOCUS_03810 25957 24467 gene locus_tag LOCUS_03820 25957 24467 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775580.1 protein_id gnl|my_center|LOCUS_03820 26186 27487 gene locus_tag LOCUS_03830 26186 27487 CDS product family 1 glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256266.1 protein_id gnl|my_center|LOCUS_03830 28159 27623 gene locus_tag LOCUS_03840 28159 27623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03840 28377 29384 gene locus_tag LOCUS_03850 28377 29384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03850 29460 30806 gene locus_tag LOCUS_03860 29460 30806 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965780.1 protein_id gnl|my_center|LOCUS_03860 30843 32042 gene locus_tag LOCUS_03870 30843 32042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03870 32933 32130 gene locus_tag LOCUS_03880 gene rhaD 32933 32130 CDS product rhamnulose-1-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703941.1 protein_id gnl|my_center|LOCUS_03880 33862 34437 gene locus_tag LOCUS_03890 33862 34437 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459747.1 protein_id gnl|my_center|LOCUS_03890 34434 35165 gene locus_tag LOCUS_03900 34434 35165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03900 35178 36059 gene locus_tag LOCUS_03910 35178 36059 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459749.1 protein_id gnl|my_center|LOCUS_03910 36056 37309 gene locus_tag LOCUS_03920 36056 37309 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811490.1 protein_id gnl|my_center|LOCUS_03920 37562 38899 gene locus_tag LOCUS_03930 37562 38899 CDS product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461353.1 protein_id gnl|my_center|LOCUS_03930 38911 39558 gene locus_tag LOCUS_03940 38911 39558 CDS product TrkA family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809652.1 protein_id gnl|my_center|LOCUS_03940 39838 41721 gene locus_tag LOCUS_03950 39838 41721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03950 41714 42424 gene locus_tag LOCUS_03960 41714 42424 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966938.1 protein_id gnl|my_center|LOCUS_03960 42679 42957 gene locus_tag LOCUS_03970 42679 42957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03970 43056 45110 gene locus_tag LOCUS_03980 43056 45110 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860870.1 protein_id gnl|my_center|LOCUS_03980 47760 45499 gene locus_tag LOCUS_03990 gene glgP 47760 45499 CDS product glycogen/starch/alpha-glucan family phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000950158.1 protein_id gnl|my_center|LOCUS_03990 47889 48746 gene locus_tag LOCUS_04000 47889 48746 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001086430.1 protein_id gnl|my_center|LOCUS_04000 49830 48805 gene locus_tag LOCUS_04010 gene malR 49830 48805 CDS product maltose operon transcriptional repressor MalR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000219053.1 protein_id gnl|my_center|LOCUS_04010 50117 51799 gene locus_tag LOCUS_04020 50117 51799 CDS product PTS transporter subunit IIBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286368.1 protein_id gnl|my_center|LOCUS_04020 51806 52624 gene locus_tag LOCUS_04030 51806 52624 CDS product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000771997.1 protein_id gnl|my_center|LOCUS_04030 52637 54145 gene locus_tag LOCUS_04040 gene malQ 52637 54145 CDS product 4-alpha-glucanotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000747291.1 protein_id gnl|my_center|LOCUS_04040 54857 54333 gene locus_tag LOCUS_04050 54857 54333 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392726.1 protein_id gnl|my_center|LOCUS_04050 55772 54903 gene locus_tag LOCUS_04060 55772 54903 CDS product patatin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546408.1 protein_id gnl|my_center|LOCUS_04060 56018 56611 gene locus_tag LOCUS_04070 56018 56611 CDS product xanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007057285.1 protein_id gnl|my_center|LOCUS_04070 58531 56660 gene locus_tag LOCUS_04080 58531 56660 CDS product stage V sporulation protein D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009893708.1 protein_id gnl|my_center|LOCUS_04080 58776 59924 gene locus_tag LOCUS_04090 gene spoVE 58776 59924 CDS product stage V sporulation protein E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426995.1 protein_id gnl|my_center|LOCUS_04090 60096 61427 gene locus_tag LOCUS_04100 gene murA 60096 61427 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940516.1 protein_id gnl|my_center|LOCUS_04100 61517 62689 gene locus_tag LOCUS_04110 gene ftsZ 61517 62689 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965000.1 protein_id gnl|my_center|LOCUS_04110 62762 63391 gene locus_tag LOCUS_04120 62762 63391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04120 64026 63445 gene locus_tag LOCUS_04130 64026 63445 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965241.1 protein_id gnl|my_center|LOCUS_04130 64249 64028 gene locus_tag LOCUS_04140 64249 64028 CDS product YdbC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963866.1 protein_id gnl|my_center|LOCUS_04140 64781 64443 gene locus_tag LOCUS_04150 64781 64443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04150 67468 65012 gene locus_tag LOCUS_04160 67468 65012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04160 68604 67465 gene locus_tag LOCUS_04170 68604 67465 CDS product exonuclease SbcCD subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003733226.1 protein_id gnl|my_center|LOCUS_04170 69322 68843 gene locus_tag LOCUS_04180 69322 68843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04180 70071 69328 gene locus_tag LOCUS_04190 70071 69328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04190 71602 70235 gene locus_tag LOCUS_04200 71602 70235 CDS product PFL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989505.1 protein_id gnl|my_center|LOCUS_04200 71963 71694 gene locus_tag LOCUS_04210 71963 71694 CDS product ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846230.1 protein_id gnl|my_center|LOCUS_04210 72261 72740 gene locus_tag LOCUS_04220 72261 72740 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025774673.1 protein_id gnl|my_center|LOCUS_04220 72737 73927 gene locus_tag LOCUS_04230 72737 73927 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392702.1 protein_id gnl|my_center|LOCUS_04230 73940 74830 gene locus_tag LOCUS_04240 gene ispE 73940 74830 CDS product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391620.1 protein_id gnl|my_center|LOCUS_04240 74887 75090 gene locus_tag LOCUS_04250 74887 75090 CDS product DUF378 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003220771.1 protein_id gnl|my_center|LOCUS_04250 75772 75143 gene locus_tag LOCUS_04260 75772 75143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04260 76479 76165 gene locus_tag LOCUS_04270 76479 76165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04270 76761 77504 gene locus_tag LOCUS_04280 76761 77504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04280 78025 77594 gene locus_tag LOCUS_04290 gene ruvX 78025 77594 CDS product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259679.1 protein_id gnl|my_center|LOCUS_04290 78228 81581 gene locus_tag LOCUS_04300 gene addB 78228 81581 CDS product helicase-exonuclease AddAB subunit AddB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965561.1 protein_id gnl|my_center|LOCUS_04300 81578 85279 gene locus_tag LOCUS_04310 gene addA 81578 85279 CDS product helicase-exonuclease AddAB subunit AddA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101882.1 protein_id gnl|my_center|LOCUS_04310 85535 86086 gene locus_tag LOCUS_04320 gene infC 85535 86086 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051498574.1 protein_id gnl|my_center|LOCUS_04320 86105 86308 gene locus_tag LOCUS_04330 gene rpmI 86105 86308 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965657.1 protein_id gnl|my_center|LOCUS_04330 86363 86713 gene locus_tag LOCUS_04340 gene rplT 86363 86713 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001138360.1 protein_id gnl|my_center|LOCUS_04340 86793 87572 gene locus_tag LOCUS_04350 86793 87572 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002299518.1 protein_id gnl|my_center|LOCUS_04350 87569 88714 gene locus_tag LOCUS_04360 gene dprA 87569 88714 CDS product DNA-processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943186.1 protein_id gnl|my_center|LOCUS_04360 >Feature sequence005 156 1472 gene locus_tag LOCUS_04370 gene tig 156 1472 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229611.1 protein_id gnl|my_center|LOCUS_04370 1626 2228 gene locus_tag LOCUS_04380 gene clpP 1626 2228 CDS product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417102.1 protein_id gnl|my_center|LOCUS_04380 2282 3601 gene locus_tag LOCUS_04390 gene clpX 2282 3601 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965927.1 protein_id gnl|my_center|LOCUS_04390 3820 5103 gene locus_tag LOCUS_04400 3820 5103 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731178.1 protein_id gnl|my_center|LOCUS_04400 5191 7536 gene locus_tag LOCUS_04410 5191 7536 CDS product protein translocase subunit SecDF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944693.1 protein_id gnl|my_center|LOCUS_04410 7585 8052 gene locus_tag LOCUS_04420 gene nrdR 7585 8052 CDS product transcriptional regulator NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003399430.1 protein_id gnl|my_center|LOCUS_04420 8519 8151 gene locus_tag LOCUS_04430 8519 8151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04430 9223 8516 gene locus_tag LOCUS_04440 9223 8516 CDS product DUF421 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963990.1 protein_id gnl|my_center|LOCUS_04440 9290 10744 gene locus_tag LOCUS_04450 9290 10744 CDS product spore germination protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890705.1 protein_id gnl|my_center|LOCUS_04450 10747 11574 gene locus_tag LOCUS_04460 10747 11574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04460 11571 12557 gene locus_tag LOCUS_04470 11571 12557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04470 13903 12554 gene locus_tag LOCUS_04480 13903 12554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04480 14589 13900 gene locus_tag LOCUS_04490 14589 13900 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000638639.1 protein_id gnl|my_center|LOCUS_04490 16388 14586 gene locus_tag LOCUS_04500 16388 14586 CDS product Na/Pi cotransporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009898459.1 protein_id gnl|my_center|LOCUS_04500 16717 17652 gene locus_tag LOCUS_04510 gene hprK 16717 17652 CDS product HPr(Ser) kinase/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416935.1 protein_id gnl|my_center|LOCUS_04510 17680 18618 gene locus_tag LOCUS_04520 gene murB 17680 18618 CDS product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287058.1 protein_id gnl|my_center|LOCUS_04520 18632 19006 gene locus_tag LOCUS_04530 18632 19006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_04530 19094 19495 gene locus_tag LOCUS_04540 19094 19495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_04540 19532 20476 gene locus_tag LOCUS_04550 19532 20476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04550 20473 23988 gene locus_tag LOCUS_04560 20473 23988 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436251.1 protein_id gnl|my_center|LOCUS_04560 24227 25201 gene locus_tag LOCUS_04570 gene pfkA 24227 25201 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357588.1 protein_id gnl|my_center|LOCUS_04570 25491 26444 gene locus_tag LOCUS_04580 25491 26444 CDS product 2-dehydropantoate 2-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860663.1 protein_id gnl|my_center|LOCUS_04580 26571 28568 gene locus_tag LOCUS_04590 gene ligA 26571 28568 CDS product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861898.1 protein_id gnl|my_center|LOCUS_04590 28695 29585 gene locus_tag LOCUS_04600 gene spoIIIAA 28695 29585 CDS product stage III sporulation protein AA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230226.1 protein_id gnl|my_center|LOCUS_04600 29582 30040 gene locus_tag LOCUS_04610 29582 30040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04610 30066 30260 gene locus_tag LOCUS_04620 gene spoIIIAC 30066 30260 CDS product stage III sporulation protein AC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358967.1 protein_id gnl|my_center|LOCUS_04620 30257 30640 gene locus_tag LOCUS_04630 30257 30640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04630 30637 31722 gene locus_tag LOCUS_04640 30637 31722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04640 31722 32015 gene locus_tag LOCUS_04650 31722 32015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04650 32012 32521 gene locus_tag LOCUS_04660 32012 32521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04660 32552 33160 gene locus_tag LOCUS_04670 32552 33160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04670 33258 34670 gene locus_tag LOCUS_04680 gene radA 33258 34670 CDS product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399687.1 protein_id gnl|my_center|LOCUS_04680 34689 35894 gene locus_tag LOCUS_04690 34689 35894 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358892.1 protein_id gnl|my_center|LOCUS_04690 35891 36400 gene locus_tag LOCUS_04700 35891 36400 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000566988.1 protein_id gnl|my_center|LOCUS_04700 37501 36671 gene locus_tag LOCUS_04710 37501 36671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04710 39999 37588 gene locus_tag LOCUS_04720 39999 37588 CDS product endonuclease MutS2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048130.1 protein_id gnl|my_center|LOCUS_04720 40779 40033 gene locus_tag LOCUS_04730 gene recO 40779 40033 CDS product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861552.1 protein_id gnl|my_center|LOCUS_04730 41769 40831 gene locus_tag LOCUS_04740 gene era 41769 40831 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416645.1 protein_id gnl|my_center|LOCUS_04740 42294 41803 gene locus_tag LOCUS_04750 gene ybeY 42294 41803 CDS product rRNA maturation RNase YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430894.1 protein_id gnl|my_center|LOCUS_04750 43309 42347 gene locus_tag LOCUS_04760 43309 42347 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861553.1 protein_id gnl|my_center|LOCUS_04760 44415 43528 gene locus_tag LOCUS_04770 44415 43528 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776043.1 protein_id gnl|my_center|LOCUS_04770 45458 44448 gene locus_tag LOCUS_04780 45458 44448 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095327.1 protein_id gnl|my_center|LOCUS_04780 46741 45515 gene locus_tag LOCUS_04790 46741 45515 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776250.1 protein_id gnl|my_center|LOCUS_04790 47643 46771 gene locus_tag LOCUS_04800 47643 46771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04800 48190 48432 gene locus_tag LOCUS_04810 48190 48432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04810 48892 48728 gene locus_tag LOCUS_04820 48892 48728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04820 49468 48908 gene locus_tag LOCUS_04830 49468 48908 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101508.1 protein_id gnl|my_center|LOCUS_04830 49625 49700 gene locus_tag LOCUS_t00040 49625 49700 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 50559 49777 gene locus_tag LOCUS_04840 50559 49777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04840 50982 50596 gene locus_tag LOCUS_04850 50982 50596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04850 51368 51048 gene locus_tag LOCUS_04860 51368 51048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04860 52597 51452 gene locus_tag LOCUS_04870 gene tgt 52597 51452 CDS product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048086.1 protein_id gnl|my_center|LOCUS_04870 53769 52741 gene locus_tag LOCUS_04880 gene queA 53769 52741 CDS product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861694.1 protein_id gnl|my_center|LOCUS_04880 53923 55005 gene locus_tag LOCUS_04890 gene asd 53923 55005 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963351.1 protein_id gnl|my_center|LOCUS_04890 55047 55940 gene locus_tag LOCUS_04900 gene dapA 55047 55940 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422063.1 protein_id gnl|my_center|LOCUS_04900 56019 56777 gene locus_tag LOCUS_04910 gene dapB 56019 56777 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048150.1 protein_id gnl|my_center|LOCUS_04910 56923 58116 gene locus_tag LOCUS_04920 56923 58116 CDS product CapA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000887601.1 protein_id gnl|my_center|LOCUS_04920 58153 58620 gene locus_tag LOCUS_04930 58153 58620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04930 59936 58719 gene locus_tag LOCUS_04940 gene tyrS 59936 58719 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048264.1 protein_id gnl|my_center|LOCUS_04940 61965 60289 gene locus_tag LOCUS_04950 gene recN 61965 60289 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003645158.1 protein_id gnl|my_center|LOCUS_04950 62472 61984 gene locus_tag LOCUS_04960 gene argR 62472 61984 CDS product arginine repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_054935393.1 protein_id gnl|my_center|LOCUS_04960 63352 62501 gene locus_tag LOCUS_04970 63352 62501 CDS product NAD(+) kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948510.1 protein_id gnl|my_center|LOCUS_04970 64190 63387 gene locus_tag LOCUS_04980 64190 63387 CDS product TlyA family rRNA (cytidine-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438136.1 protein_id gnl|my_center|LOCUS_04980 66064 64187 gene locus_tag LOCUS_04990 gene dxs 66064 64187 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941346.1 protein_id gnl|my_center|LOCUS_04990 66571 66101 gene locus_tag LOCUS_05000 66571 66101 CDS product divergent PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810945.1 protein_id gnl|my_center|LOCUS_05000 67481 66600 gene locus_tag LOCUS_05010 67481 66600 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003820295.1 protein_id gnl|my_center|LOCUS_05010 67709 67494 gene locus_tag LOCUS_05020 67709 67494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05020 68910 67687 gene locus_tag LOCUS_05030 gene xseA 68910 67687 CDS product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272417.1 protein_id gnl|my_center|LOCUS_05030 69839 68898 gene locus_tag LOCUS_05040 69839 68898 CDS product O-sialoglycoprotein endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272419.1 protein_id gnl|my_center|LOCUS_05040 70279 69836 gene locus_tag LOCUS_05050 gene nusB 70279 69836 CDS product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899364.1 protein_id gnl|my_center|LOCUS_05050 70664 70299 gene locus_tag LOCUS_05060 70664 70299 CDS product Asp23/Gls24 family envelope stress response protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393032.1 protein_id gnl|my_center|LOCUS_05060 71867 70758 gene locus_tag LOCUS_05070 71867 70758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05070 71937 72224 gene locus_tag LOCUS_05080 71937 72224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05080 72426 72241 gene locus_tag LOCUS_05090 72426 72241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05090 72568 73374 gene locus_tag LOCUS_05100 72568 73374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05100 74331 73420 gene locus_tag LOCUS_05110 gene hslO 74331 73420 CDS product Hsp33 family molecular chaperone HslO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428049.1 protein_id gnl|my_center|LOCUS_05110 75085 74324 gene locus_tag LOCUS_05120 75085 74324 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000873069.1 protein_id gnl|my_center|LOCUS_05120 75700 75089 gene locus_tag LOCUS_05130 gene yihA 75700 75089 CDS product ribosome biogenesis GTP-binding protein YihA/YsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933808.1 protein_id gnl|my_center|LOCUS_05130 78166 75716 gene locus_tag LOCUS_05140 gene lon 78166 75716 CDS product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357593.1 protein_id gnl|my_center|LOCUS_05140 78835 78290 gene locus_tag LOCUS_05150 78835 78290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05150 80753 78858 gene locus_tag LOCUS_05160 80753 78858 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549141.1 protein_id gnl|my_center|LOCUS_05160 81531 80791 gene locus_tag LOCUS_05170 81531 80791 CDS product YjjG family noncanonical pyrimidine nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475861.1 protein_id gnl|my_center|LOCUS_05170 81880 81659 gene locus_tag LOCUS_05180 81880 81659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05180 83758 81929 gene locus_tag LOCUS_05190 83758 81929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05190 84444 83785 gene locus_tag LOCUS_05200 84444 83785 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012027441.1 protein_id gnl|my_center|LOCUS_05200 84940 84617 gene locus_tag LOCUS_05210 84940 84617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05210 85309 85001 gene locus_tag LOCUS_05220 85309 85001 CDS product YerC/YecD family TrpR-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817220.1 protein_id gnl|my_center|LOCUS_05220 85638 87365 gene locus_tag LOCUS_05230 85638 87365 CDS product carbon starvation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948291.1 protein_id gnl|my_center|LOCUS_05230 88002 87457 gene locus_tag LOCUS_05240 88002 87457 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001865515.1 protein_id gnl|my_center|LOCUS_05240 88714 88022 gene locus_tag LOCUS_05250 88714 88022 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009902966.1 protein_id gnl|my_center|LOCUS_05250 <89803 88905 gene locus_tag LOCUS_05260 <89803 88905 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003424535.1:translation elongation factor Ts >Feature sequence006 1038 2318 gene locus_tag LOCUS_05270 1038 2318 CDS product L-serine ammonia-lyase, iron-sulfur-dependent, subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814309.1 protein_id gnl|my_center|LOCUS_05270 2487 3185 gene locus_tag LOCUS_05280 2487 3185 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966496.1 protein_id gnl|my_center|LOCUS_05280 3185 4699 gene locus_tag LOCUS_05290 3185 4699 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048386.1 protein_id gnl|my_center|LOCUS_05290 4954 5604 gene locus_tag LOCUS_05300 gene rpe 4954 5604 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811794.1 protein_id gnl|my_center|LOCUS_05300 5618 6622 gene locus_tag LOCUS_05310 5618 6622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05310 6619 7338 gene locus_tag LOCUS_05320 gene rsxE 6619 7338 CDS product electron transport complex subunit RsxE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895956.1 protein_id gnl|my_center|LOCUS_05320 7335 7943 gene locus_tag LOCUS_05330 7335 7943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05330 7970 9079 gene locus_tag LOCUS_05340 7970 9079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05340 9113 10411 gene locus_tag LOCUS_05350 9113 10411 CDS product DUF1015 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022296.1 protein_id gnl|my_center|LOCUS_05350 10408 12342 gene locus_tag LOCUS_05360 10408 12342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05360 12332 13177 gene locus_tag LOCUS_05370 gene rlmA 12332 13177 CDS product 23S rRNA (guanine(745)-N(1))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005170523.1 protein_id gnl|my_center|LOCUS_05370 14609 13239 gene locus_tag LOCUS_05380 14609 13239 CDS product sodium-dependent transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925421.1 protein_id gnl|my_center|LOCUS_05380 16252 14729 gene locus_tag LOCUS_05390 16252 14729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05390 17288 16413 gene locus_tag LOCUS_05400 17288 16413 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700054.1 protein_id gnl|my_center|LOCUS_05400 17537 18283 gene locus_tag LOCUS_05410 17537 18283 CDS product TraX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002895510.1 protein_id gnl|my_center|LOCUS_05410 18478 18385 gene locus_tag LOCUS_t00050 18478 18385 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 18599 18512 gene locus_tag LOCUS_t00060 18599 18512 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 18830 19459 gene locus_tag LOCUS_05420 18830 19459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05420 19538 20896 gene locus_tag LOCUS_05430 19538 20896 CDS product putative DNA modification/repair radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460409.1 protein_id gnl|my_center|LOCUS_05430 20875 21669 gene locus_tag LOCUS_05440 20875 21669 CDS product TIGR03915 family putative DNA repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966616.1 protein_id gnl|my_center|LOCUS_05440 21666 22730 gene locus_tag LOCUS_05450 21666 22730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05450 22893 23369 gene locus_tag LOCUS_05460 22893 23369 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434191.1 protein_id gnl|my_center|LOCUS_05460 24373 23720 gene locus_tag LOCUS_05470 24373 23720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05470 24591 26027 gene locus_tag LOCUS_05480 24591 26027 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000891898.1 protein_id gnl|my_center|LOCUS_05480 26845 25934 gene locus_tag LOCUS_05490 26845 25934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05490 27124 26897 gene locus_tag LOCUS_05500 27124 26897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05500 27027 28355 gene locus_tag LOCUS_05510 27027 28355 CDS product sodium:alanine symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000451023.1 protein_id gnl|my_center|LOCUS_05510 29693 28410 gene locus_tag LOCUS_05520 29693 28410 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_178371730.1 protein_id gnl|my_center|LOCUS_05520 29917 31398 gene locus_tag LOCUS_05530 29917 31398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05530 31501 32553 gene locus_tag LOCUS_05540 31501 32553 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002673299.1 protein_id gnl|my_center|LOCUS_05540 32661 33203 gene locus_tag LOCUS_05550 gene spoVT 32661 33203 CDS product stage V sporulation protein T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391631.1 protein_id gnl|my_center|LOCUS_05550 33388 34461 gene locus_tag LOCUS_05560 gene hrcA 33388 34461 CDS product heat-inducible transcriptional repressor HrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392120.1 protein_id gnl|my_center|LOCUS_05560 34458 35087 gene locus_tag LOCUS_05570 gene grpE 34458 35087 CDS product nucleotide exchange factor GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964593.1 protein_id gnl|my_center|LOCUS_05570 35190 37019 gene locus_tag LOCUS_05580 gene dnaK 35190 37019 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964594.1 protein_id gnl|my_center|LOCUS_05580 37136 38305 gene locus_tag LOCUS_05590 gene dnaJ 37136 38305 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_142730484.1 protein_id gnl|my_center|LOCUS_05590 39323 38493 gene locus_tag LOCUS_05600 39323 38493 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003662288.1 protein_id gnl|my_center|LOCUS_05600 40829 39327 gene locus_tag LOCUS_05610 40829 39327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05610 41193 42251 gene locus_tag LOCUS_05620 41193 42251 CDS product PTS sugar transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003440236.1 protein_id gnl|my_center|LOCUS_05620 42931 42440 gene locus_tag LOCUS_05630 42931 42440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05630 43595 43008 gene locus_tag LOCUS_05640 43595 43008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05640 44643 43696 gene locus_tag LOCUS_05650 44643 43696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005807791.1 protein_id gnl|my_center|LOCUS_05650 45078 45260 gene locus_tag LOCUS_05660 45078 45260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05660 45398 45919 gene locus_tag LOCUS_05670 45398 45919 CDS product nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902348.1 protein_id gnl|my_center|LOCUS_05670 45928 46419 gene locus_tag LOCUS_05680 45928 46419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05680 46523 46822 gene locus_tag LOCUS_05690 46523 46822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05690 46895 47446 gene locus_tag LOCUS_05700 46895 47446 CDS product DJ-1/PfpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760842.1 protein_id gnl|my_center|LOCUS_05700 47462 48346 gene locus_tag LOCUS_05710 47462 48346 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891824.1 protein_id gnl|my_center|LOCUS_05710 48570 49073 gene locus_tag LOCUS_05720 48570 49073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05720 49168 49374 gene locus_tag LOCUS_05730 49168 49374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05730 49378 50187 gene locus_tag LOCUS_05740 49378 50187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_05740 50368 51324 gene locus_tag LOCUS_05750 50368 51324 CDS product ROK family glucokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965901.1 protein_id gnl|my_center|LOCUS_05750 51326 51853 gene locus_tag LOCUS_05760 51326 51853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05760 51846 52031 gene locus_tag LOCUS_05770 51846 52031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05770 52113 52550 gene locus_tag LOCUS_05780 52113 52550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05780 52836 53033 gene locus_tag LOCUS_05790 52836 53033 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001107500.1 protein_id gnl|my_center|LOCUS_05790 53037 53474 gene locus_tag LOCUS_05800 53037 53474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05800 55376 53586 gene locus_tag LOCUS_05810 55376 53586 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459675.1 protein_id gnl|my_center|LOCUS_05810 56150 55431 gene locus_tag LOCUS_05820 56150 55431 CDS product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943180.1 protein_id gnl|my_center|LOCUS_05820 56717 56157 gene locus_tag LOCUS_05830 56717 56157 CDS product TIGR01440 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228042.1 protein_id gnl|my_center|LOCUS_05830 58172 56859 gene locus_tag LOCUS_05840 58172 56859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05840 58412 59098 gene locus_tag LOCUS_05850 58412 59098 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_054938388.1 protein_id gnl|my_center|LOCUS_05850 59117 60628 gene locus_tag LOCUS_05860 59117 60628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05860 60833 60678 gene locus_tag LOCUS_05870 60833 60678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05870 61799 60858 gene locus_tag LOCUS_05880 61799 60858 CDS product pectinesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966644.1 protein_id gnl|my_center|LOCUS_05880 64137 61855 gene locus_tag LOCUS_05890 64137 61855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05890 64535 64257 gene locus_tag LOCUS_05900 64535 64257 CDS product DUF4160 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015613391.1 protein_id gnl|my_center|LOCUS_05900 64791 64519 gene locus_tag LOCUS_05910 64791 64519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05910 66303 64834 gene locus_tag LOCUS_05920 gene gltX 66303 64834 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964308.1 protein_id gnl|my_center|LOCUS_05920 66606 66863 gene locus_tag LOCUS_05930 66606 66863 CDS product AbrB/MazE/SpoVT family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965244.1 protein_id gnl|my_center|LOCUS_05930 66885 67811 gene locus_tag LOCUS_05940 66885 67811 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948255.1 protein_id gnl|my_center|LOCUS_05940 69219 67930 gene locus_tag LOCUS_05950 69219 67930 CDS product O-acetylhomoserine aminocarboxypropyltransferase/cysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763773.1 protein_id gnl|my_center|LOCUS_05950 69979 69674 gene locus_tag LOCUS_05960 69979 69674 CDS product type II toxin-antitoxin system RelB/DinJ family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009994780.1 protein_id gnl|my_center|LOCUS_05960 70132 70821 gene locus_tag LOCUS_05970 70132 70821 CDS product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986274.1 protein_id gnl|my_center|LOCUS_05970 70808 73237 gene locus_tag LOCUS_05980 70808 73237 CDS product homocysteine S-methyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949155.1 protein_id gnl|my_center|LOCUS_05980 74789 73302 gene locus_tag LOCUS_05990 74789 73302 CDS product oligosaccharide flippase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003838864.1 protein_id gnl|my_center|LOCUS_05990 75380 74826 gene locus_tag LOCUS_06000 75380 74826 CDS product SprT family zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011248957.1 protein_id gnl|my_center|LOCUS_06000 76285 75356 gene locus_tag LOCUS_06010 76285 75356 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707673.1 protein_id gnl|my_center|LOCUS_06010 76820 76287 gene locus_tag LOCUS_06020 76820 76287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06020 78199 76922 gene locus_tag LOCUS_06030 78199 76922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06030 78693 78196 gene locus_tag LOCUS_06040 78693 78196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06040 78803 79222 gene locus_tag LOCUS_06050 78803 79222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06050 79297 79370 gene locus_tag LOCUS_t00070 79297 79370 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 79491 79566 gene locus_tag LOCUS_t00080 79491 79566 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 80996 79779 gene locus_tag LOCUS_06060 80996 79779 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986283.1 protein_id gnl|my_center|LOCUS_06060 81311 81236 gene locus_tag LOCUS_t00090 81311 81236 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 81391 81315 gene locus_tag LOCUS_t00100 81391 81315 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 81751 81676 gene locus_tag LOCUS_t00110 81751 81676 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 82272 81823 gene locus_tag LOCUS_06070 82272 81823 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393155.1 protein_id gnl|my_center|LOCUS_06070 82412 82735 gene locus_tag LOCUS_06080 82412 82735 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003356887.1 protein_id gnl|my_center|LOCUS_06080 82837 83268 gene locus_tag LOCUS_06090 82837 83268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06090 83427 84644 gene locus_tag LOCUS_06100 gene nifS 83427 84644 CDS product cysteine desulfurase NifS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986887.1 protein_id gnl|my_center|LOCUS_06100 84646 85095 gene locus_tag LOCUS_06110 gene nifU 84646 85095 CDS product Fe-S cluster assembly scaffold protein NifU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003391905.1 protein_id gnl|my_center|LOCUS_06110 >Feature sequence007 466 251 gene locus_tag LOCUS_06120 466 251 CDS product Maff2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002610321.1 protein_id gnl|my_center|LOCUS_06120 2368 602 gene locus_tag LOCUS_06130 2368 602 CDS product type IV secretory system conjugative DNA transfer family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861117.1 protein_id gnl|my_center|LOCUS_06130 2844 2365 gene locus_tag LOCUS_06140 2844 2365 CDS product PcfB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002368727.1 protein_id gnl|my_center|LOCUS_06140 3369 2944 gene locus_tag LOCUS_06150 3369 2944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06150 4469 3435 gene locus_tag LOCUS_06160 4469 3435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06160 5259 4426 gene locus_tag LOCUS_06170 5259 4426 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288805.1 protein_id gnl|my_center|LOCUS_06170 6581 7852 gene locus_tag LOCUS_06180 6581 7852 CDS product glycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082016.1 protein_id gnl|my_center|LOCUS_06180 8064 8291 gene locus_tag LOCUS_06190 8064 8291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06190 8288 9523 gene locus_tag LOCUS_06200 8288 9523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06200 9642 10493 gene locus_tag LOCUS_06210 9642 10493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06210 10493 11629 gene locus_tag LOCUS_06220 10493 11629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06220 11633 12649 gene locus_tag LOCUS_06230 11633 12649 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682008.1 protein_id gnl|my_center|LOCUS_06230 12646 14562 gene locus_tag LOCUS_06240 12646 14562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06240 14564 15325 gene locus_tag LOCUS_06250 gene cobM 14564 15325 CDS product precorrin-4 C(11)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392606.1 protein_id gnl|my_center|LOCUS_06250 15322 16320 gene locus_tag LOCUS_06260 gene cbiG 15322 16320 CDS product cobalt-precorrin 5A hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721596.1 protein_id gnl|my_center|LOCUS_06260 16313 17047 gene locus_tag LOCUS_06270 gene cobJ 16313 17047 CDS product precorrin-3B C(17)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392608.1 protein_id gnl|my_center|LOCUS_06270 17044 17781 gene locus_tag LOCUS_06280 gene cobK 17044 17781 CDS product precorrin-6A reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392609.1 protein_id gnl|my_center|LOCUS_06280 17778 18980 gene locus_tag LOCUS_06290 17778 18980 CDS product bifunctional cobalt-precorrin-7 (C(5))-methyltransferase/cobalt-precorrin-6B (C(15))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035214081.1 protein_id gnl|my_center|LOCUS_06290 18977 20362 gene locus_tag LOCUS_06300 18977 20362 CDS product cobyrinate a,c-diamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258422.1 protein_id gnl|my_center|LOCUS_06300 20359 21423 gene locus_tag LOCUS_06310 gene cobT 20359 21423 CDS product nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071541537.1 protein_id gnl|my_center|LOCUS_06310 21417 21938 gene locus_tag LOCUS_06320 gene cobU 21417 21938 CDS product bifunctional adenosylcobinamide kinase/adenosylcobinamide-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338347.1 protein_id gnl|my_center|LOCUS_06320 21935 22687 gene locus_tag LOCUS_06330 gene cobS 21935 22687 CDS product adenosylcobinamide-GDP ribazoletransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257084.1 protein_id gnl|my_center|LOCUS_06330 22684 23001 gene locus_tag LOCUS_06340 22684 23001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06340 22995 23594 gene locus_tag LOCUS_06350 22995 23594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06350 23591 24541 gene locus_tag LOCUS_06360 gene cbiB 23591 24541 CDS product adenosylcobinamide-phosphate synthase CbiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943620.1 protein_id gnl|my_center|LOCUS_06360 24639 25688 gene locus_tag LOCUS_06370 gene cobD 24639 25688 CDS product threonine-phosphate decarboxylase CobD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001173241.1 protein_id gnl|my_center|LOCUS_06370 25685 27187 gene locus_tag LOCUS_06380 25685 27187 CDS product cobyric acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836536.1 protein_id gnl|my_center|LOCUS_06380 27184 27855 gene locus_tag LOCUS_06390 27184 27855 CDS product precorrin-8X methylmutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943629.1 protein_id gnl|my_center|LOCUS_06390 27978 29348 gene locus_tag LOCUS_06400 27978 29348 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029494943.1 protein_id gnl|my_center|LOCUS_06400 29535 31382 gene locus_tag LOCUS_06410 29535 31382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06410 32272 31517 gene locus_tag LOCUS_06420 gene pflA 32272 31517 CDS product pyruvate formate-lyase-activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262580.1 protein_id gnl|my_center|LOCUS_06420 34511 32259 gene locus_tag LOCUS_06430 gene pflB 34511 32259 CDS product formate C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289265.1 protein_id gnl|my_center|LOCUS_06430 35605 35153 gene locus_tag LOCUS_06440 35605 35153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06440 36721 35696 gene locus_tag LOCUS_06450 36721 35696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06450 38512 36911 gene locus_tag LOCUS_06460 38512 36911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06460 39362 38535 gene locus_tag LOCUS_06470 39362 38535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06470 40583 39423 gene locus_tag LOCUS_06480 40583 39423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06480 40960 42468 gene locus_tag LOCUS_06490 40960 42468 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005079788.1 protein_id gnl|my_center|LOCUS_06490 42497 43969 gene locus_tag LOCUS_06500 42497 43969 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107399.1 protein_id gnl|my_center|LOCUS_06500 44153 44395 gene locus_tag LOCUS_06510 44153 44395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06510 44402 45598 gene locus_tag LOCUS_06520 44402 45598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06520 47001 45652 gene locus_tag LOCUS_06530 47001 45652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06530 48895 47933 gene locus_tag LOCUS_06540 48895 47933 CDS product biotin--[acetyl-CoA-carboxylase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002358973.1 protein_id gnl|my_center|LOCUS_06540 49236 49766 gene locus_tag LOCUS_06550 49236 49766 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986765.1 protein_id gnl|my_center|LOCUS_06550 49750 50328 gene locus_tag LOCUS_06560 49750 50328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06560 50339 51019 gene locus_tag LOCUS_06570 50339 51019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06570 51000 51494 gene locus_tag LOCUS_06580 51000 51494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06580 52809 51664 gene locus_tag LOCUS_06590 52809 51664 CDS product glycoside hydrolase family 88 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963681.1 protein_id gnl|my_center|LOCUS_06590 54369 52813 gene locus_tag LOCUS_06600 54369 52813 CDS product glycoside hydrolase family 28 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963677.1 protein_id gnl|my_center|LOCUS_06600 54530 55345 gene locus_tag LOCUS_06610 54530 55345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06610 56282 55425 gene locus_tag LOCUS_06620 56282 55425 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210833.1 protein_id gnl|my_center|LOCUS_06620 57220 56294 gene locus_tag LOCUS_06630 57220 56294 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006311867.1 protein_id gnl|my_center|LOCUS_06630 58755 57385 gene locus_tag LOCUS_06640 58755 57385 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210835.1 protein_id gnl|my_center|LOCUS_06640 59905 59297 gene locus_tag LOCUS_06650 59905 59297 CDS product thymidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775779.1 protein_id gnl|my_center|LOCUS_06650 60634 59993 gene locus_tag LOCUS_06660 60634 59993 CDS product redox-sensing transcriptional repressor Rex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357537.1 protein_id gnl|my_center|LOCUS_06660 60888 61574 gene locus_tag LOCUS_06670 gene tepA 60888 61574 CDS product translocation-enhancing protein TepA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245712.1 protein_id gnl|my_center|LOCUS_06670 62934 61606 gene locus_tag LOCUS_06680 62934 61606 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966626.1 protein_id gnl|my_center|LOCUS_06680 64090 63179 gene locus_tag LOCUS_06690 gene cysK 64090 63179 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203747.1 protein_id gnl|my_center|LOCUS_06690 64389 64772 gene locus_tag LOCUS_06700 64389 64772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06700 64804 66159 gene locus_tag LOCUS_06710 gene ffh 64804 66159 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813193.1 protein_id gnl|my_center|LOCUS_06710 66245 66487 gene locus_tag LOCUS_06720 gene rpsP 66245 66487 CDS product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004451027.1 protein_id gnl|my_center|LOCUS_06720 66504 66737 gene locus_tag LOCUS_06730 66504 66737 CDS product KH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003728421.1 protein_id gnl|my_center|LOCUS_06730 66950 67486 gene locus_tag LOCUS_06740 gene rimM 66950 67486 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000170278.1 protein_id gnl|my_center|LOCUS_06740 67490 68722 gene locus_tag LOCUS_06750 67490 68722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06750 68983 69246 gene locus_tag LOCUS_06760 68983 69246 CDS product HPr family phosphocarrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391564.1 protein_id gnl|my_center|LOCUS_06760 69315 71162 gene locus_tag LOCUS_06770 gene uvrC 69315 71162 CDS product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436264.1 protein_id gnl|my_center|LOCUS_06770 72029 71217 gene locus_tag LOCUS_06780 72029 71217 CDS product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012027948.1 protein_id gnl|my_center|LOCUS_06780 73038 72223 gene locus_tag LOCUS_06790 73038 72223 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012027946.1 protein_id gnl|my_center|LOCUS_06790 73738 73055 gene locus_tag LOCUS_06800 73738 73055 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012027947.1 protein_id gnl|my_center|LOCUS_06800 73957 75084 gene locus_tag LOCUS_06810 73957 75084 CDS product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426955.1 protein_id gnl|my_center|LOCUS_06810 76307 75252 gene locus_tag LOCUS_06820 76307 75252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06820 78056 76323 gene locus_tag LOCUS_06830 gene lcfA 78056 76323 CDS product long-chain-fatty-acid--CoA ligase LcfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399166.1 protein_id gnl|my_center|LOCUS_06830 79265 78240 gene locus_tag LOCUS_06840 79265 78240 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002986000.1 protein_id gnl|my_center|LOCUS_06840 >Feature sequence008 570 722 gene locus_tag LOCUS_06850 570 722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06850 738 2081 gene locus_tag LOCUS_06860 738 2081 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009931271.1 protein_id gnl|my_center|LOCUS_06860 2348 3550 gene locus_tag LOCUS_06870 2348 3550 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902269.1 protein_id gnl|my_center|LOCUS_06870 3679 4557 gene locus_tag LOCUS_06880 3679 4557 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262676.1 protein_id gnl|my_center|LOCUS_06880 4571 5584 gene locus_tag LOCUS_06890 4571 5584 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_124797307.1 protein_id gnl|my_center|LOCUS_06890 5577 6416 gene locus_tag LOCUS_06900 5577 6416 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018211990.1 protein_id gnl|my_center|LOCUS_06900 6421 7134 gene locus_tag LOCUS_06910 6421 7134 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815204.1 protein_id gnl|my_center|LOCUS_06910 10507 7226 gene locus_tag LOCUS_06920 10507 7226 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721622.1 protein_id gnl|my_center|LOCUS_06920 11205 10501 gene locus_tag LOCUS_06930 11205 10501 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010774180.1 protein_id gnl|my_center|LOCUS_06930 11887 11303 gene locus_tag LOCUS_06940 11887 11303 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000363049.1 protein_id gnl|my_center|LOCUS_06940 12405 11884 gene locus_tag LOCUS_06950 12405 11884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06950 12971 12402 gene locus_tag LOCUS_06960 12971 12402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06960 13642 14220 gene locus_tag LOCUS_06970 13642 14220 CDS product DUF3793 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681044.1 protein_id gnl|my_center|LOCUS_06970 14625 14840 gene locus_tag LOCUS_06980 14625 14840 CDS product FeoA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003360986.1 protein_id gnl|my_center|LOCUS_06980 14920 15141 gene locus_tag LOCUS_06990 14920 15141 CDS product ferrous iron transport protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003360987.1 protein_id gnl|my_center|LOCUS_06990 15167 17356 gene locus_tag LOCUS_07000 gene feoB 15167 17356 CDS product ferrous iron transport protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948706.1 protein_id gnl|my_center|LOCUS_07000 17391 17570 gene locus_tag LOCUS_07010 17391 17570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07010 17694 18092 gene locus_tag LOCUS_07020 17694 18092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07020 18089 19822 gene locus_tag LOCUS_07030 18089 19822 CDS product ABC transporter ATP-binding protein/permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006995243.1 protein_id gnl|my_center|LOCUS_07030 19819 21489 gene locus_tag LOCUS_07040 19819 21489 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680530.1 protein_id gnl|my_center|LOCUS_07040 22405 21560 gene locus_tag LOCUS_07050 22405 21560 CDS product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948024.1 protein_id gnl|my_center|LOCUS_07050 22732 24111 gene locus_tag LOCUS_07060 gene murC 22732 24111 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966501.1 protein_id gnl|my_center|LOCUS_07060 24368 25165 gene locus_tag LOCUS_07070 24368 25165 CDS product zinc dependent phospholipase C family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678767.1 protein_id gnl|my_center|LOCUS_07070 25177 26421 gene locus_tag LOCUS_07080 25177 26421 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272444.1 protein_id gnl|my_center|LOCUS_07080 26671 29424 gene locus_tag LOCUS_07090 26671 29424 CDS product insulinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938240.1 protein_id gnl|my_center|LOCUS_07090 29738 30022 gene locus_tag LOCUS_07100 29738 30022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07100 30019 31452 gene locus_tag LOCUS_07110 30019 31452 CDS product terminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920595.1 protein_id gnl|my_center|LOCUS_07110 31728 33464 gene locus_tag LOCUS_07120 31728 33464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07120 33560 34513 gene locus_tag LOCUS_07130 33560 34513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07130 34612 35610 gene locus_tag LOCUS_07140 34612 35610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07140 35745 35957 gene locus_tag LOCUS_07150 35745 35957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07150 35962 36345 gene locus_tag LOCUS_07160 35962 36345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07160 36361 38232 gene locus_tag LOCUS_07170 36361 38232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07170 38236 38439 gene locus_tag LOCUS_07180 38236 38439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07180 38436 39701 gene locus_tag LOCUS_07190 38436 39701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07190 40477 39743 gene locus_tag LOCUS_07200 40477 39743 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460545.1 protein_id gnl|my_center|LOCUS_07200 41231 40482 gene locus_tag LOCUS_07210 41231 40482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07210 42159 41233 gene locus_tag LOCUS_07220 42159 41233 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460543.1 protein_id gnl|my_center|LOCUS_07220 42325 43044 gene locus_tag LOCUS_07230 42325 43044 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460542.1 protein_id gnl|my_center|LOCUS_07230 43041 44405 gene locus_tag LOCUS_07240 43041 44405 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272456.1 protein_id gnl|my_center|LOCUS_07240 44494 45435 gene locus_tag LOCUS_07250 44494 45435 CDS product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_129881641.1 protein_id gnl|my_center|LOCUS_07250 45609 45803 gene locus_tag LOCUS_07260 45609 45803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07260 45876 48476 gene locus_tag LOCUS_07270 45876 48476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07270 48480 49172 gene locus_tag LOCUS_07280 48480 49172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07280 50697 49357 gene locus_tag LOCUS_07290 50697 49357 CDS product D-alanyl-D-alanine carboxypeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093182.1 protein_id gnl|my_center|LOCUS_07290 50858 51541 gene locus_tag LOCUS_07300 50858 51541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07300 54388 51689 gene locus_tag LOCUS_07310 54388 51689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07310 56609 54795 gene locus_tag LOCUS_07320 gene argS 56609 54795 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393887.1 protein_id gnl|my_center|LOCUS_07320 57245 56772 gene locus_tag LOCUS_07330 57245 56772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07330 58089 57265 gene locus_tag LOCUS_07340 gene murI 58089 57265 CDS product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943554.1 protein_id gnl|my_center|LOCUS_07340 59176 58082 gene locus_tag LOCUS_07350 59176 58082 CDS product D-alanine--D-alanine ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256645.1 protein_id gnl|my_center|LOCUS_07350 59484 59633 gene locus_tag LOCUS_07360 gene rpmG 59484 59633 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421192.1 protein_id gnl|my_center|LOCUS_07360 59650 59889 gene locus_tag LOCUS_07370 59650 59889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07370 59918 60448 gene locus_tag LOCUS_07380 gene nusG 59918 60448 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357696.1 protein_id gnl|my_center|LOCUS_07380 60582 61007 gene locus_tag LOCUS_07390 gene rplK 60582 61007 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421189.1 protein_id gnl|my_center|LOCUS_07390 61065 61757 gene locus_tag LOCUS_07400 gene rplA 61065 61757 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393948.1 protein_id gnl|my_center|LOCUS_07400 62030 62545 gene locus_tag LOCUS_07410 gene rplJ 62030 62545 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700677.1 protein_id gnl|my_center|LOCUS_07410 62616 62990 gene locus_tag LOCUS_07420 gene rplL 62616 62990 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215374.1 protein_id gnl|my_center|LOCUS_07420 64167 63160 gene locus_tag LOCUS_07430 gene tsaD 64167 63160 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860650.1 protein_id gnl|my_center|LOCUS_07430 66729 64171 gene locus_tag LOCUS_07440 gene polA 66729 64171 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964413.1 protein_id gnl|my_center|LOCUS_07440 67039 66851 gene locus_tag LOCUS_07450 67039 66851 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422320.1 protein_id gnl|my_center|LOCUS_07450 67196 67537 gene locus_tag LOCUS_07460 67196 67537 CDS product arsenate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003396628.1 protein_id gnl|my_center|LOCUS_07460 67652 68560 gene locus_tag LOCUS_07470 67652 68560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07470 69638 68640 gene locus_tag LOCUS_07480 69638 68640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07480 69928 70626 gene locus_tag LOCUS_07490 69928 70626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07490 71843 70824 gene locus_tag LOCUS_07500 gene spoIID 71843 70824 CDS product stage II sporulation protein D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243408.1 protein_id gnl|my_center|LOCUS_07500 72029 73399 gene locus_tag LOCUS_07510 72029 73399 CDS product citrate/2-methylcitrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_156276303.1 protein_id gnl|my_center|LOCUS_07510 73399 74205 gene locus_tag LOCUS_07520 73399 74205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07520 >Feature sequence009 730 65 gene locus_tag LOCUS_07530 gene sfsA 730 65 CDS product DNA/RNA nuclease SfsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461735.1 protein_id gnl|my_center|LOCUS_07530 1201 746 gene locus_tag LOCUS_07540 1201 746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07540 1814 1296 gene locus_tag LOCUS_07550 1814 1296 CDS product O-acetyl-ADP-ribose deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549649.1 protein_id gnl|my_center|LOCUS_07550 2352 1825 gene locus_tag LOCUS_07560 2352 1825 CDS product cysteine hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722826.1 protein_id gnl|my_center|LOCUS_07560 2684 2466 gene locus_tag LOCUS_07570 2684 2466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07570 3852 3157 gene locus_tag LOCUS_07580 gene sigK 3852 3157 CDS product RNA polymerase sporulation sigma factor SigK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428359.1 protein_id gnl|my_center|LOCUS_07580 4008 4355 gene locus_tag LOCUS_07590 4008 4355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07590 4357 4716 gene locus_tag LOCUS_07600 4357 4716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07600 5341 4865 gene locus_tag LOCUS_07610 5341 4865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07610 7498 5573 gene locus_tag LOCUS_07620 7498 5573 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877962.1 protein_id gnl|my_center|LOCUS_07620 8266 7511 gene locus_tag LOCUS_07630 8266 7511 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966927.1 protein_id gnl|my_center|LOCUS_07630 9658 8270 gene locus_tag LOCUS_07640 9658 8270 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476670.1 protein_id gnl|my_center|LOCUS_07640 9875 10705 gene locus_tag LOCUS_07650 9875 10705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07650 10823 11620 gene locus_tag LOCUS_07660 10823 11620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07660 11617 12513 gene locus_tag LOCUS_07670 11617 12513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07670 12610 13122 gene locus_tag LOCUS_07680 12610 13122 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965803.1 protein_id gnl|my_center|LOCUS_07680 13605 13201 gene locus_tag LOCUS_07690 gene mgsA 13605 13201 CDS product methylglyoxal synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723016.1 protein_id gnl|my_center|LOCUS_07690 15999 13777 gene locus_tag LOCUS_07700 15999 13777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07700 16559 16026 gene locus_tag LOCUS_07710 16559 16026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07710 17402 16572 gene locus_tag LOCUS_07720 gene mreC 17402 16572 CDS product rod shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392075.1 protein_id gnl|my_center|LOCUS_07720 18491 17469 gene locus_tag LOCUS_07730 18491 17469 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403487.1 protein_id gnl|my_center|LOCUS_07730 19230 18676 gene locus_tag LOCUS_07740 19230 18676 CDS product Maf family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002354869.1 protein_id gnl|my_center|LOCUS_07740 19682 19236 gene locus_tag LOCUS_07750 gene dut 19682 19236 CDS product dUTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808844.1 protein_id gnl|my_center|LOCUS_07750 19846 19664 gene locus_tag LOCUS_07760 19846 19664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07760 21918 19849 gene locus_tag LOCUS_07770 21918 19849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07770 22347 21958 gene locus_tag LOCUS_07780 22347 21958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07780 22679 25075 gene locus_tag LOCUS_07790 22679 25075 CDS product glycogen/starch/alpha-glucan phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_081712308.1 protein_id gnl|my_center|LOCUS_07790 25315 27171 gene locus_tag LOCUS_07800 25315 27171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07800 27266 27715 gene locus_tag LOCUS_07810 27266 27715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07810 27731 28636 gene locus_tag LOCUS_07820 27731 28636 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015666.1 protein_id gnl|my_center|LOCUS_07820 28640 29122 gene locus_tag LOCUS_07830 28640 29122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07830 29237 30382 gene locus_tag LOCUS_07840 29237 30382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07840 31814 30435 gene locus_tag LOCUS_07850 gene mgtE 31814 30435 CDS product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001829287.1 protein_id gnl|my_center|LOCUS_07850 32761 32114 gene locus_tag LOCUS_07860 32761 32114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07860 33600 32758 gene locus_tag LOCUS_07870 33600 32758 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015943957.1 protein_id gnl|my_center|LOCUS_07870 33975 33604 gene locus_tag LOCUS_07880 33975 33604 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814465.1 protein_id gnl|my_center|LOCUS_07880 35558 34119 gene locus_tag LOCUS_07890 gene proS 35558 34119 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001040960.1 protein_id gnl|my_center|LOCUS_07890 35925 35692 gene locus_tag LOCUS_07900 gene acpP 35925 35692 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003362599.1 protein_id gnl|my_center|LOCUS_07900 36213 37052 gene locus_tag LOCUS_07910 gene dapF 36213 37052 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058127.1 protein_id gnl|my_center|LOCUS_07910 37229 38416 gene locus_tag LOCUS_07920 37229 38416 CDS product LL-diaminopimelate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461084.1 protein_id gnl|my_center|LOCUS_07920 38600 38472 gene locus_tag LOCUS_07930 38600 38472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07930 39744 38614 gene locus_tag LOCUS_07940 39744 38614 CDS product sodium ion-translocating decarboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356002.1 protein_id gnl|my_center|LOCUS_07940 40877 39990 gene locus_tag LOCUS_07950 40877 39990 CDS product aldose 1-epimerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003565426.1 protein_id gnl|my_center|LOCUS_07950 41856 40894 gene locus_tag LOCUS_07960 41856 40894 CDS product D-2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073434.1 protein_id gnl|my_center|LOCUS_07960 42583 41858 gene locus_tag LOCUS_07970 42583 41858 CDS product NAD-dependent protein deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963607.1 protein_id gnl|my_center|LOCUS_07970 43583 42693 gene locus_tag LOCUS_07980 43583 42693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07980 46351 43760 gene locus_tag LOCUS_07990 46351 43760 CDS product TetM/TetW/TetO/TetS family tetracycline resistance ribosomal protection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814361.1 protein_id gnl|my_center|LOCUS_07990 46786 46364 gene locus_tag LOCUS_08000 46786 46364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08000 47275 46982 gene locus_tag LOCUS_08010 47275 46982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08010 47190 49148 gene locus_tag LOCUS_08020 47190 49148 CDS product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836902.1 protein_id gnl|my_center|LOCUS_08020 50245 49304 gene locus_tag LOCUS_08030 50245 49304 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001291304.1 protein_id gnl|my_center|LOCUS_08030 51293 50238 gene locus_tag LOCUS_08040 51293 50238 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002902455.1 protein_id gnl|my_center|LOCUS_08040 52257 51316 gene locus_tag LOCUS_08050 52257 51316 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000103704.1 protein_id gnl|my_center|LOCUS_08050 53207 52257 gene locus_tag LOCUS_08060 53207 52257 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868767.1 protein_id gnl|my_center|LOCUS_08060 55292 53262 gene locus_tag LOCUS_08070 55292 53262 CDS product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836902.1 protein_id gnl|my_center|LOCUS_08070 56598 55744 gene locus_tag LOCUS_08080 gene rsmA 56598 55744 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001216839.1 protein_id gnl|my_center|LOCUS_08080 58150 56765 gene locus_tag LOCUS_08090 58150 56765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08090 59615 58308 gene locus_tag LOCUS_08100 59615 58308 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018305385.1 protein_id gnl|my_center|LOCUS_08100 60542 59634 gene locus_tag LOCUS_08110 gene ftsX 60542 59634 CDS product permease-like cell division protein FtsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357632.1 protein_id gnl|my_center|LOCUS_08110 61270 60539 gene locus_tag LOCUS_08120 gene ftsE 61270 60539 CDS product cell division ATP-binding protein FtsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357393.1 protein_id gnl|my_center|LOCUS_08120 >Feature sequence010 251 1642 gene locus_tag LOCUS_08130 gene trmFO 251 1642 CDS product methylenetetrahydrofolate--tRNA-(uracil(54)-C(5))-methyltransferase (FADH(2)-oxidizing) TrmFO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943183.1 protein_id gnl|my_center|LOCUS_08130 1655 2656 gene locus_tag LOCUS_08140 gene plsX 1655 2656 CDS product phosphate acyltransferase PlsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047867.1 protein_id gnl|my_center|LOCUS_08140 2844 3518 gene locus_tag LOCUS_08150 gene rnc 2844 3518 CDS product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428341.1 protein_id gnl|my_center|LOCUS_08150 3519 7076 gene locus_tag LOCUS_08160 gene smc 3519 7076 CDS product chromosome segregation protein SMC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460497.1 protein_id gnl|my_center|LOCUS_08160 7226 8164 gene locus_tag LOCUS_08170 gene ftsY 7226 8164 CDS product signal recognition particle-docking protein FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941793.1 protein_id gnl|my_center|LOCUS_08170 8275 8907 gene locus_tag LOCUS_08180 gene rdgB 8275 8907 CDS product RdgB/HAM1 family non-canonical purine NTP pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028655.1 protein_id gnl|my_center|LOCUS_08180 8922 9218 gene locus_tag LOCUS_08190 gene yhbY 8922 9218 CDS product ribosome assembly RNA-binding protein YhbY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002935148.1 protein_id gnl|my_center|LOCUS_08190 9215 9901 gene locus_tag LOCUS_08200 gene nadD 9215 9901 CDS product nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071402.1 protein_id gnl|my_center|LOCUS_08200 9855 10442 gene locus_tag LOCUS_08210 gene yqeK 9855 10442 CDS product bis(5'-nucleosyl)-tetraphosphatase (symmetrical) YqeK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000221169.1 protein_id gnl|my_center|LOCUS_08210 10569 11999 gene locus_tag LOCUS_08220 10569 11999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08220 12021 12401 gene locus_tag LOCUS_08230 gene rsfS 12021 12401 CDS product ribosome silencing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546466.1 protein_id gnl|my_center|LOCUS_08230 12453 15002 gene locus_tag LOCUS_08240 gene leuS 12453 15002 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921837.1 protein_id gnl|my_center|LOCUS_08240 15146 15322 gene locus_tag LOCUS_08250 15146 15322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08250 15600 16103 gene locus_tag LOCUS_08260 15600 16103 CDS product YqeG family HAD IIIA-type phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888598.1 protein_id gnl|my_center|LOCUS_08260 16100 16954 gene locus_tag LOCUS_08270 16100 16954 CDS product deoxyribonuclease IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060947.1 protein_id gnl|my_center|LOCUS_08270 17076 17633 gene locus_tag LOCUS_08280 gene efp 17076 17633 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358905.1 protein_id gnl|my_center|LOCUS_08280 17702 18274 gene locus_tag LOCUS_08290 17702 18274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08290 18616 18329 gene locus_tag LOCUS_08300 18616 18329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08300 18906 20567 gene locus_tag LOCUS_08310 18906 20567 CDS product formate--tetrahydrofolate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809880.1 protein_id gnl|my_center|LOCUS_08310 21557 20655 gene locus_tag LOCUS_08320 21557 20655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08320 21982 23133 gene locus_tag LOCUS_08330 21982 23133 CDS product cysteine desulfurase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966255.1 protein_id gnl|my_center|LOCUS_08330 23308 24507 gene locus_tag LOCUS_08340 gene thiI 23308 24507 CDS product tRNA 4-thiouridine(8) synthase ThiI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860948.1 protein_id gnl|my_center|LOCUS_08340 24513 25832 gene locus_tag LOCUS_08350 24513 25832 CDS product competence/damage-inducible protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582488.1 protein_id gnl|my_center|LOCUS_08350 25852 26745 gene locus_tag LOCUS_08360 25852 26745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08360 26979 29819 gene locus_tag LOCUS_08370 gene secA 26979 29819 CDS product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_177221404.1 protein_id gnl|my_center|LOCUS_08370 29883 30137 gene locus_tag LOCUS_08380 29883 30137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08380 30134 30472 gene locus_tag LOCUS_08390 30134 30472 CDS product type II toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002667012.1 protein_id gnl|my_center|LOCUS_08390 30501 31721 gene locus_tag LOCUS_08400 30501 31721 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861827.1 protein_id gnl|my_center|LOCUS_08400 32369 31842 gene locus_tag LOCUS_08410 32369 31842 CDS product QueT transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965709.1 protein_id gnl|my_center|LOCUS_08410 33460 32591 gene locus_tag LOCUS_08420 33460 32591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08420 33975 33469 gene locus_tag LOCUS_08430 gene trmL 33975 33469 CDS product tRNA (uridine(34)/cytosine(34)/5-carboxymethylaminomethyluridine(34)-2'-O)-methyltransferase TrmL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429657.1 protein_id gnl|my_center|LOCUS_08430 34819 33986 gene locus_tag LOCUS_08440 34819 33986 CDS product pyridoxamine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792714.1 protein_id gnl|my_center|LOCUS_08440 34988 35200 gene locus_tag LOCUS_08450 34988 35200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08450 35726 35250 gene locus_tag LOCUS_08460 35726 35250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08460 37546 35993 gene locus_tag LOCUS_08470 37546 35993 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012099524.1 protein_id gnl|my_center|LOCUS_08470 39072 37777 gene locus_tag LOCUS_08480 gene mtaB 39072 37777 CDS product tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase MtaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964598.1 protein_id gnl|my_center|LOCUS_08480 39354 40592 gene locus_tag LOCUS_08490 gene dacF 39354 40592 CDS product serine-type D-Ala-D-Ala carboxypeptidase DacF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000831996.1 protein_id gnl|my_center|LOCUS_08490 40813 42144 gene locus_tag LOCUS_08500 40813 42144 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243401.1 protein_id gnl|my_center|LOCUS_08500 42204 42608 gene locus_tag LOCUS_08510 42204 42608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048265.1 protein_id gnl|my_center|LOCUS_08510 42743 43243 gene locus_tag LOCUS_08520 42743 43243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08520 43270 43449 gene locus_tag LOCUS_08530 gene rpmF 43270 43449 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965052.1 protein_id gnl|my_center|LOCUS_08530 43541 44872 gene locus_tag LOCUS_08540 43541 44872 CDS product DUF512 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965017.1 protein_id gnl|my_center|LOCUS_08540 44891 46234 gene locus_tag LOCUS_08550 gene der 44891 46234 CDS product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426959.1 protein_id gnl|my_center|LOCUS_08550 46253 46912 gene locus_tag LOCUS_08560 gene plsY 46253 46912 CDS product glycerol-3-phosphate 1-O-acyltransferase PlsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426957.1 protein_id gnl|my_center|LOCUS_08560 47106 47181 gene locus_tag LOCUS_t00120 47106 47181 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 48439 47342 gene locus_tag LOCUS_08570 48439 47342 CDS product phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042402692.1 protein_id gnl|my_center|LOCUS_08570 49323 48457 gene locus_tag LOCUS_08580 49323 48457 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948300.1 protein_id gnl|my_center|LOCUS_08580 49506 49709 gene locus_tag LOCUS_08590 49506 49709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08590 49737 51107 gene locus_tag LOCUS_08600 49737 51107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08600 51191 52075 gene locus_tag LOCUS_08610 51191 52075 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243523.1 protein_id gnl|my_center|LOCUS_08610 52088 52984 gene locus_tag LOCUS_08620 52088 52984 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530307.1 protein_id gnl|my_center|LOCUS_08620 52996 53187 gene locus_tag LOCUS_08630 52996 53187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08630 53215 55374 gene locus_tag LOCUS_08640 gene gnpA 53215 55374 CDS product 1,3-beta-galactosyl-N-acetylhexosamine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389962.1 protein_id gnl|my_center|LOCUS_08640 56664 55450 gene locus_tag LOCUS_08650 gene nspC 56664 55450 CDS product carboxynorspermidine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461405.1 protein_id gnl|my_center|LOCUS_08650 57923 56664 gene locus_tag LOCUS_08660 57923 56664 CDS product saccharopine dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000088780.1 protein_id gnl|my_center|LOCUS_08660 58848 57970 gene locus_tag LOCUS_08670 gene speB 58848 57970 CDS product agmatinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888724.1 protein_id gnl|my_center|LOCUS_08670 59705 58848 gene locus_tag LOCUS_08680 gene speE 59705 58848 CDS product polyamine aminopropyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808145.1 protein_id gnl|my_center|LOCUS_08680 <60395 59719 gene locus_tag LOCUS_08690 <60395 59719 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000661024.1:aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme >Feature sequence011 1577 57 gene locus_tag LOCUS_08700 gene atpA 1577 57 CDS product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421367.1 protein_id gnl|my_center|LOCUS_08700 2171 1632 gene locus_tag LOCUS_08710 2171 1632 CDS product F0F1 ATP synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388978.1 protein_id gnl|my_center|LOCUS_08710 2674 2168 gene locus_tag LOCUS_08720 2674 2168 CDS product ATP synthase F0 subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940784.1 protein_id gnl|my_center|LOCUS_08720 2992 2711 gene locus_tag LOCUS_08730 2992 2711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08730 3788 3045 gene locus_tag LOCUS_08740 gene atpB 3788 3045 CDS product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_124796847.1 protein_id gnl|my_center|LOCUS_08740 4292 3792 gene locus_tag LOCUS_08750 4292 3792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08750 4575 4315 gene locus_tag LOCUS_08760 4575 4315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08760 6881 4890 gene locus_tag LOCUS_08770 6881 4890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08770 8487 7069 gene locus_tag LOCUS_08780 gene glgA 8487 7069 CDS product glycogen synthase GlgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965537.1 protein_id gnl|my_center|LOCUS_08780 9745 8618 gene locus_tag LOCUS_08790 gene glgD 9745 8618 CDS product glucose-1-phosphate adenylyltransferase subunit GlgD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965536.1 protein_id gnl|my_center|LOCUS_08790 10932 9739 gene locus_tag LOCUS_08800 10932 9739 CDS product glucose-1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965535.1 protein_id gnl|my_center|LOCUS_08800 13278 11014 gene locus_tag LOCUS_08810 gene glgB 13278 11014 CDS product 1,4-alpha-glucan branching protein GlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545591.1 protein_id gnl|my_center|LOCUS_08810 14613 13555 gene locus_tag LOCUS_08820 14613 13555 CDS product 3D domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947942.1 protein_id gnl|my_center|LOCUS_08820 15211 15984 gene locus_tag LOCUS_08830 15211 15984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08830 15984 16607 gene locus_tag LOCUS_08840 15984 16607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08840 16624 16872 gene locus_tag LOCUS_08850 16624 16872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08850 17925 16942 gene locus_tag LOCUS_08860 gene ydjG 17925 16942 CDS product NADH-dependent methylglyoxal reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000723698.1 protein_id gnl|my_center|LOCUS_08860 19675 18071 gene locus_tag LOCUS_08870 19675 18071 CDS product peptide chain release factor 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048268.1 protein_id gnl|my_center|LOCUS_08870 20835 19978 gene locus_tag LOCUS_08880 20835 19978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08880 21196 22605 gene locus_tag LOCUS_08890 21196 22605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08890 24631 22676 gene locus_tag LOCUS_08900 gene pulA 24631 22676 CDS product type I pullulanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009994410.1 protein_id gnl|my_center|LOCUS_08900 24756 26795 gene locus_tag LOCUS_08910 24756 26795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08910 27796 26834 gene locus_tag LOCUS_08920 27796 26834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08920 28758 27901 gene locus_tag LOCUS_08930 28758 27901 CDS product prephenate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428643.1 protein_id gnl|my_center|LOCUS_08930 30025 28751 gene locus_tag LOCUS_08940 gene aroA 30025 28751 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861345.1 protein_id gnl|my_center|LOCUS_08940 31216 30200 gene locus_tag LOCUS_08950 gene aroF 31216 30200 CDS product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964210.1 protein_id gnl|my_center|LOCUS_08950 31802 31338 gene locus_tag LOCUS_08960 gene aroQ 31802 31338 CDS product type II 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852001.1 protein_id gnl|my_center|LOCUS_08960 33045 31783 gene locus_tag LOCUS_08970 33045 31783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08970 34188 33046 gene locus_tag LOCUS_08980 gene aroC 34188 33046 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861346.1 protein_id gnl|my_center|LOCUS_08980 35235 34192 gene locus_tag LOCUS_08990 gene aroB 35235 34192 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002261933.1 protein_id gnl|my_center|LOCUS_08990 36302 35232 gene locus_tag LOCUS_09000 36302 35232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09000 36623 36462 gene locus_tag LOCUS_09010 36623 36462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09010 37392 36628 gene locus_tag LOCUS_09020 37392 36628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09020 38123 37401 gene locus_tag LOCUS_09030 38123 37401 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948182.1 protein_id gnl|my_center|LOCUS_09030 38319 39155 gene locus_tag LOCUS_09040 38319 39155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09040 39195 40568 gene locus_tag LOCUS_09050 39195 40568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09050 40626 41234 gene locus_tag LOCUS_09060 40626 41234 CDS product cytidylate kinase-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766580.1 protein_id gnl|my_center|LOCUS_09060 41389 42783 gene locus_tag LOCUS_09070 41389 42783 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022042.1 protein_id gnl|my_center|LOCUS_09070 42829 43536 gene locus_tag LOCUS_09080 42829 43536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09080 43490 43669 gene locus_tag LOCUS_09090 43490 43669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09090 43732 45144 gene locus_tag LOCUS_09100 43732 45144 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393793.1 protein_id gnl|my_center|LOCUS_09100 45411 45809 gene locus_tag LOCUS_09110 45411 45809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_09110 45852 46211 gene locus_tag LOCUS_09120 45852 46211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09120 47470 46265 gene locus_tag LOCUS_09130 47470 46265 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068831.1 protein_id gnl|my_center|LOCUS_09130 48592 47648 gene locus_tag LOCUS_09140 48592 47648 CDS product transketolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430702.1 protein_id gnl|my_center|LOCUS_09140 49445 48594 gene locus_tag LOCUS_09150 49445 48594 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430704.1 protein_id gnl|my_center|LOCUS_09150 49757 51208 gene locus_tag LOCUS_09160 49757 51208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09160 51417 51953 gene locus_tag LOCUS_09170 51417 51953 CDS product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948224.1 protein_id gnl|my_center|LOCUS_09170 52289 52107 gene locus_tag LOCUS_09180 52289 52107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09180 54028 52781 gene locus_tag LOCUS_09190 gene sstT 54028 52781 CDS product serine/threonine transporter SstT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811470.1 protein_id gnl|my_center|LOCUS_09190 55365 54268 gene locus_tag LOCUS_09200 55365 54268 CDS product dipeptide epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029490874.1 protein_id gnl|my_center|LOCUS_09200 56761 55382 gene locus_tag LOCUS_09210 gene pepV 56761 55382 CDS product dipeptidase PepV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966010.1 protein_id gnl|my_center|LOCUS_09210 57767 58966 gene locus_tag LOCUS_09220 57767 58966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09220 >Feature sequence012 225 770 gene locus_tag LOCUS_09230 225 770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09230 1151 900 gene locus_tag LOCUS_09240 1151 900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09240 1723 1385 gene locus_tag LOCUS_09250 1723 1385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09250 2106 1834 gene locus_tag LOCUS_09260 2106 1834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09260 2408 2124 gene locus_tag LOCUS_09270 2408 2124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09270 2674 2414 gene locus_tag LOCUS_09280 2674 2414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09280 2982 2680 gene locus_tag LOCUS_09290 2982 2680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09290 3639 2986 gene locus_tag LOCUS_09300 3639 2986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09300 4003 3620 gene locus_tag LOCUS_09310 4003 3620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09310 4161 4018 gene locus_tag LOCUS_09320 4161 4018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09320 4549 4196 gene locus_tag LOCUS_09330 4549 4196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09330 5391 4573 gene locus_tag LOCUS_09340 5391 4573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09340 7032 5404 gene locus_tag LOCUS_09350 7032 5404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09350 17869 7226 gene locus_tag LOCUS_09360 17869 7226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09360 19293 17881 gene locus_tag LOCUS_09370 19293 17881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09370 20120 19341 gene locus_tag LOCUS_09380 20120 19341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09380 20342 20142 gene locus_tag LOCUS_09390 20342 20142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09390 22485 20545 gene locus_tag LOCUS_09400 22485 20545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09400 22879 22487 gene locus_tag LOCUS_09410 22879 22487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09410 23043 22882 gene locus_tag LOCUS_09420 23043 22882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09420 23404 23180 gene locus_tag LOCUS_09430 23404 23180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09430 24651 23617 gene locus_tag LOCUS_09440 24651 23617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09440 26171 24750 gene locus_tag LOCUS_09450 26171 24750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09450 28120 26267 gene locus_tag LOCUS_09460 28120 26267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09460 29571 28117 gene locus_tag LOCUS_09470 29571 28117 CDS product terminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920595.1 protein_id gnl|my_center|LOCUS_09470 30262 29549 gene locus_tag LOCUS_09480 30262 29549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09480 30612 30307 gene locus_tag LOCUS_09490 30612 30307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09490 31552 30668 gene locus_tag LOCUS_09500 31552 30668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09500 32401 31754 gene locus_tag LOCUS_09510 32401 31754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09510 33176 32403 gene locus_tag LOCUS_09520 33176 32403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09520 33641 33282 gene locus_tag LOCUS_09530 33641 33282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09530 33937 33638 gene locus_tag LOCUS_09540 33937 33638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09540 34206 33940 gene locus_tag LOCUS_09550 34206 33940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09550 34441 34259 gene locus_tag LOCUS_09560 34441 34259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09560 34801 34451 gene locus_tag LOCUS_09570 34801 34451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09570 35014 34805 gene locus_tag LOCUS_09580 35014 34805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09580 35131 35421 gene locus_tag LOCUS_09590 35131 35421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09590 35635 35339 gene locus_tag LOCUS_09600 35635 35339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09600 35952 35707 gene locus_tag LOCUS_09610 35952 35707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09610 36123 36494 gene locus_tag LOCUS_09620 36123 36494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09620 36510 37466 gene locus_tag LOCUS_09630 36510 37466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09630 37845 38051 gene locus_tag LOCUS_09640 37845 38051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09640 38054 38470 gene locus_tag LOCUS_09650 38054 38470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09650 38467 38934 gene locus_tag LOCUS_09660 38467 38934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09660 39147 40697 gene locus_tag LOCUS_09670 39147 40697 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389524.1 protein_id gnl|my_center|LOCUS_09670 40737 40660 gene locus_tag LOCUS_t00130 40737 40660 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 43758 40876 gene locus_tag LOCUS_09680 gene uvrA 43758 40876 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391799.1 protein_id gnl|my_center|LOCUS_09680 45802 43745 gene locus_tag LOCUS_09690 gene uvrB 45802 43745 CDS product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357634.1 protein_id gnl|my_center|LOCUS_09690 46612 45887 gene locus_tag LOCUS_09700 gene radC 46612 45887 CDS product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385427.1 protein_id gnl|my_center|LOCUS_09700 46927 47937 gene locus_tag LOCUS_09710 46927 47937 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949019.1 protein_id gnl|my_center|LOCUS_09710 47925 48302 gene locus_tag LOCUS_09720 47925 48302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09720 49636 48455 gene locus_tag LOCUS_09730 49636 48455 CDS product FprA family A-type flavoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987112.1 protein_id gnl|my_center|LOCUS_09730 51057 49726 gene locus_tag LOCUS_09740 gene rmuC 51057 49726 CDS product DNA recombination protein RmuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527474.1 protein_id gnl|my_center|LOCUS_09740 52542 51061 gene locus_tag LOCUS_09750 52542 51061 CDS product transglutaminase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002382305.1 protein_id gnl|my_center|LOCUS_09750 53634 52561 gene locus_tag LOCUS_09760 53634 52561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09760 53961 54479 gene locus_tag LOCUS_09770 53961 54479 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010990112.1 protein_id gnl|my_center|LOCUS_09770 54593 55075 gene locus_tag LOCUS_09780 gene smpB 54593 55075 CDS product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003356515.1 protein_id gnl|my_center|LOCUS_09780 55138 55486 gene locus_tag LOCUS_tm00010 55138 55486 tmRNA product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 56051 55551 gene locus_tag LOCUS_09790 56051 55551 CDS product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009902015.1 protein_id gnl|my_center|LOCUS_09790 <57721 56055 gene locus_tag LOCUS_09800 <57721 56055 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011860925.1:phenylalanine--tRNA ligase subunit beta >Feature sequence013 910 1086 gene locus_tag LOCUS_09810 910 1086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09810 1436 1185 gene locus_tag LOCUS_09820 1436 1185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09820 1674 1589 gene locus_tag LOCUS_t00140 1674 1589 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 1934 1860 gene locus_tag LOCUS_t00150 1934 1860 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 3821 2001 gene locus_tag LOCUS_09830 gene glmS 3821 2001 CDS product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963484.1 protein_id gnl|my_center|LOCUS_09830 4840 4289 gene locus_tag LOCUS_09840 4840 4289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09840 5706 4837 gene locus_tag LOCUS_09850 5706 4837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09850 6924 5725 gene locus_tag LOCUS_09860 6924 5725 CDS product class I SAM-dependent RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963546.1 protein_id gnl|my_center|LOCUS_09860 7562 7011 gene locus_tag LOCUS_09870 7562 7011 CDS product S1 domain-containing RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000021451.1 protein_id gnl|my_center|LOCUS_09870 7941 7636 gene locus_tag LOCUS_09880 7941 7636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09880 8457 7987 gene locus_tag LOCUS_09890 8457 7987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09890 8723 8457 gene locus_tag LOCUS_09900 8723 8457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09900 9129 8884 gene locus_tag LOCUS_09910 9129 8884 CDS product RNA-binding S4 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287407.1 protein_id gnl|my_center|LOCUS_09910 9547 9278 gene locus_tag LOCUS_09920 9547 9278 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391633.1 protein_id gnl|my_center|LOCUS_09920 10318 9587 gene locus_tag LOCUS_09930 10318 9587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09930 10960 10514 gene locus_tag LOCUS_09940 10960 10514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09940 12080 11142 gene locus_tag LOCUS_09950 12080 11142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09950 13515 12046 gene locus_tag LOCUS_09960 13515 12046 CDS product coproporphyrinogen III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245132.1 protein_id gnl|my_center|LOCUS_09960 14151 13534 gene locus_tag LOCUS_09970 14151 13534 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545606.1 protein_id gnl|my_center|LOCUS_09970 14666 14205 gene locus_tag LOCUS_09980 gene dtd 14666 14205 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289097.1 protein_id gnl|my_center|LOCUS_09980 16973 14670 gene locus_tag LOCUS_09990 16973 14670 CDS product bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_196768340.1 protein_id gnl|my_center|LOCUS_09990 19119 16978 gene locus_tag LOCUS_10000 19119 16978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10000 20465 19116 gene locus_tag LOCUS_10010 20465 19116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10010 22070 20475 gene locus_tag LOCUS_10020 22070 20475 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048336.1 protein_id gnl|my_center|LOCUS_10020 23544 22246 gene locus_tag LOCUS_10030 23544 22246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10030 24443 23541 gene locus_tag LOCUS_10040 gene cdaA 24443 23541 CDS product diadenylate cyclase CdaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003360232.1 protein_id gnl|my_center|LOCUS_10040 25635 24460 gene locus_tag LOCUS_10050 25635 24460 CDS product bifunctional 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase/2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087257.1 protein_id gnl|my_center|LOCUS_10050 27481 25799 gene locus_tag LOCUS_10060 27481 25799 CDS product phospho-sugar mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002338467.1 protein_id gnl|my_center|LOCUS_10060 27806 29347 gene locus_tag LOCUS_10070 27806 29347 CDS product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257250.1 protein_id gnl|my_center|LOCUS_10070 29540 29992 gene locus_tag LOCUS_10080 29540 29992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10080 29982 31325 gene locus_tag LOCUS_10090 29982 31325 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107748.1 protein_id gnl|my_center|LOCUS_10090 32329 31397 gene locus_tag LOCUS_10100 gene rbsK 32329 31397 CDS product ribokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761960.1 protein_id gnl|my_center|LOCUS_10100 34442 32418 gene locus_tag LOCUS_10110 34442 32418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10110 35071 34532 gene locus_tag LOCUS_10120 35071 34532 CDS product phosphoribosyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016017.1 protein_id gnl|my_center|LOCUS_10120 35449 35117 gene locus_tag LOCUS_10130 35449 35117 CDS product HIT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964599.1 protein_id gnl|my_center|LOCUS_10130 38308 35648 gene locus_tag LOCUS_10140 gene alaS 38308 35648 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009889064.1 protein_id gnl|my_center|LOCUS_10140 39296 38733 gene locus_tag LOCUS_10150 39296 38733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10150 39563 40513 gene locus_tag LOCUS_10160 39563 40513 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919846.1 protein_id gnl|my_center|LOCUS_10160 41605 40586 gene locus_tag LOCUS_10170 41605 40586 CDS product alpha-hydroxy-acid oxidizing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048128.1 protein_id gnl|my_center|LOCUS_10170 41871 41962 gene locus_tag LOCUS_t00160 41871 41962 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 42097 42777 gene locus_tag LOCUS_10180 42097 42777 CDS product gamma-glutamyl-gamma-aminobutyrate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393651.1 protein_id gnl|my_center|LOCUS_10180 42784 43302 gene locus_tag LOCUS_10190 42784 43302 CDS product DNA topology modulation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002897695.1 protein_id gnl|my_center|LOCUS_10190 43323 44195 gene locus_tag LOCUS_10200 43323 44195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10200 45121 44246 gene locus_tag LOCUS_10210 45121 44246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10210 46368 45403 gene locus_tag LOCUS_10220 46368 45403 CDS product calcium/sodium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022960.1 protein_id gnl|my_center|LOCUS_10220 47742 46444 gene locus_tag LOCUS_10230 47742 46444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10230 48961 47813 gene locus_tag LOCUS_10240 gene fucO 48961 47813 CDS product lactaldehyde reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288246.1 protein_id gnl|my_center|LOCUS_10240 49914 49255 gene locus_tag LOCUS_10250 49914 49255 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963701.1 protein_id gnl|my_center|LOCUS_10250 50208 50684 gene locus_tag LOCUS_10260 gene fur 50208 50684 CDS product ferric iron uptake transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814098.1 protein_id gnl|my_center|LOCUS_10260 51091 52677 gene locus_tag LOCUS_10270 gene asnB 51091 52677 CDS product asparagine synthase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905297.1 protein_id gnl|my_center|LOCUS_10270 53611 52742 gene locus_tag LOCUS_10280 53611 52742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816588.1 protein_id gnl|my_center|LOCUS_10280 54333 53605 gene locus_tag LOCUS_10290 54333 53605 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816590.1 protein_id gnl|my_center|LOCUS_10290 54706 54326 gene locus_tag LOCUS_10300 54706 54326 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816592.1 protein_id gnl|my_center|LOCUS_10300 <55494 54860 gene locus_tag LOCUS_10310 <55494 54860 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010965114.1:polyribonucleotide nucleotidyltransferase >Feature sequence014 2582 1212 gene locus_tag LOCUS_10320 gene mnmE 2582 1212 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722170.1 protein_id gnl|my_center|LOCUS_10320 3833 2712 gene locus_tag LOCUS_10330 3833 2712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10330 4921 3839 gene locus_tag LOCUS_10340 4921 3839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10340 5242 4991 gene locus_tag LOCUS_10350 5242 4991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10350 5534 5235 gene locus_tag LOCUS_10360 5534 5235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10360 5929 5531 gene locus_tag LOCUS_10370 gene rnpA 5929 5531 CDS product ribonuclease P protein component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359393.1 protein_id gnl|my_center|LOCUS_10370 6311 6177 gene locus_tag LOCUS_10380 gene rpmH 6311 6177 CDS product 50S ribosomal protein L34 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003568442.1 protein_id gnl|my_center|LOCUS_10380 6698 8020 gene locus_tag LOCUS_10390 gene dnaA 6698 8020 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963330.1 protein_id gnl|my_center|LOCUS_10390 8431 8240 gene locus_tag LOCUS_10400 8431 8240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10400 8421 9527 gene locus_tag LOCUS_10410 gene dnaN 8421 9527 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963331.1 protein_id gnl|my_center|LOCUS_10410 9539 9754 gene locus_tag LOCUS_10420 gene yaaA 9539 9754 CDS product S4 domain-containing protein YaaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963332.1 protein_id gnl|my_center|LOCUS_10420 9758 10879 gene locus_tag LOCUS_10430 gene recF 9758 10879 CDS product DNA replication/repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142400.1 protein_id gnl|my_center|LOCUS_10430 10967 11218 gene locus_tag LOCUS_10440 gene remB 10967 11218 CDS product extracellular matrix regulator RemB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003219266.1 protein_id gnl|my_center|LOCUS_10440 11275 13269 gene locus_tag LOCUS_10450 gene gyrB 11275 13269 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815132.1 protein_id gnl|my_center|LOCUS_10450 13282 15846 gene locus_tag LOCUS_10460 gene gyrA 13282 15846 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963336.1 protein_id gnl|my_center|LOCUS_10460 15954 16136 gene locus_tag LOCUS_10470 15954 16136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10470 16166 16750 gene locus_tag LOCUS_10480 16166 16750 CDS product manganese efflux pump MntP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023653.1 protein_id gnl|my_center|LOCUS_10480 17513 16833 gene locus_tag LOCUS_10490 17513 16833 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728678.1 protein_id gnl|my_center|LOCUS_10490 17699 17571 gene locus_tag LOCUS_10500 17699 17571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10500 18412 17711 gene locus_tag LOCUS_10510 18412 17711 CDS product RNA pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810083.1 protein_id gnl|my_center|LOCUS_10510 18960 18409 gene locus_tag LOCUS_10520 18960 18409 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393013.1 protein_id gnl|my_center|LOCUS_10520 19306 22851 gene locus_tag LOCUS_10530 gene nifJ 19306 22851 CDS product pyruvate:ferredoxin (flavodoxin) oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987043.1 protein_id gnl|my_center|LOCUS_10530 23605 23318 gene locus_tag LOCUS_10540 23605 23318 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391158.1 protein_id gnl|my_center|LOCUS_10540 23961 23602 gene locus_tag LOCUS_10550 23961 23602 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766756.1 protein_id gnl|my_center|LOCUS_10550 24574 26145 gene locus_tag LOCUS_10560 gene mgtE 24574 26145 CDS product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986205.1 protein_id gnl|my_center|LOCUS_10560 26743 27381 gene locus_tag LOCUS_10570 26743 27381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10570 27378 28343 gene locus_tag LOCUS_10580 27378 28343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10580 29747 28458 gene locus_tag LOCUS_10590 29747 28458 CDS product D-alanyl-D-alanine carboxypeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454794.1 protein_id gnl|my_center|LOCUS_10590 29853 30389 gene locus_tag LOCUS_10600 29853 30389 CDS product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920495.1 protein_id gnl|my_center|LOCUS_10600 31428 30661 gene locus_tag LOCUS_10610 31428 30661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10610 31913 31425 gene locus_tag LOCUS_10620 31913 31425 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016060.1 protein_id gnl|my_center|LOCUS_10620 33005 32166 gene locus_tag LOCUS_10630 gene rsmI 33005 32166 CDS product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391594.1 protein_id gnl|my_center|LOCUS_10630 33733 33113 gene locus_tag LOCUS_10640 33733 33113 CDS product tRNA1(Val) (adenine(37)-N6)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_087456344.1 protein_id gnl|my_center|LOCUS_10640 34092 33922 gene locus_tag LOCUS_10650 34092 33922 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809805.1 protein_id gnl|my_center|LOCUS_10650 35321 34383 gene locus_tag LOCUS_10660 35321 34383 CDS product stage 0 sporulation family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404857.1 protein_id gnl|my_center|LOCUS_10660 35910 39836 gene locus_tag LOCUS_10670 35910 39836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10670 39967 40782 gene locus_tag LOCUS_10680 39967 40782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10680 41005 41547 gene locus_tag LOCUS_10690 41005 41547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10690 41771 42844 gene locus_tag LOCUS_10700 41771 42844 CDS product galactose mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007245976.1 protein_id gnl|my_center|LOCUS_10700 43104 44129 gene locus_tag LOCUS_10710 gene galE 43104 44129 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000996163.1 protein_id gnl|my_center|LOCUS_10710 44136 44318 gene locus_tag LOCUS_10720 44136 44318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10720 44346 46688 gene locus_tag LOCUS_10730 gene feoB 44346 46688 CDS product ferrous iron transport protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810412.1 protein_id gnl|my_center|LOCUS_10730 46869 47312 gene locus_tag LOCUS_10740 46869 47312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10740 47314 48093 gene locus_tag LOCUS_10750 47314 48093 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003022242.1 protein_id gnl|my_center|LOCUS_10750 49459 48164 gene locus_tag LOCUS_10760 gene tig 49459 48164 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723884.1 protein_id gnl|my_center|LOCUS_10760 49614 50297 gene locus_tag LOCUS_10770 gene sdaAB 49614 50297 CDS product L-serine ammonia-lyase, iron-sulfur-dependent subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002671219.1 protein_id gnl|my_center|LOCUS_10770 50294 51175 gene locus_tag LOCUS_10780 gene sdaAA 50294 51175 CDS product L-serine ammonia-lyase, iron-sulfur-dependent, subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460513.1 protein_id gnl|my_center|LOCUS_10780 >Feature sequence015 807 124 gene locus_tag LOCUS_10790 807 124 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357219.1 protein_id gnl|my_center|LOCUS_10790 2305 845 gene locus_tag LOCUS_10800 gene thrC 2305 845 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390008.1 protein_id gnl|my_center|LOCUS_10800 2766 2404 gene locus_tag LOCUS_10810 2766 2404 CDS product YraN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438259.1 protein_id gnl|my_center|LOCUS_10810 3410 2766 gene locus_tag LOCUS_10820 gene rnhB 3410 2766 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113866.1 protein_id gnl|my_center|LOCUS_10820 4327 3407 gene locus_tag LOCUS_10830 gene ylqF 4327 3407 CDS product ribosome biogenesis GTPase YlqF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047861.1 protein_id gnl|my_center|LOCUS_10830 4875 4324 gene locus_tag LOCUS_10840 gene lepB 4875 4324 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012774995.1 protein_id gnl|my_center|LOCUS_10840 5309 4968 gene locus_tag LOCUS_10850 gene rplS 5309 4968 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965066.1 protein_id gnl|my_center|LOCUS_10850 6169 5525 gene locus_tag LOCUS_10860 6169 5525 CDS product TIGR03936 family radical SAM-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048024.1 protein_id gnl|my_center|LOCUS_10860 8006 6144 gene locus_tag LOCUS_10870 8006 6144 CDS product TIGR03960 family B12-binding radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460899.1 protein_id gnl|my_center|LOCUS_10870 8532 8047 gene locus_tag LOCUS_10880 8532 8047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10880 9092 8529 gene locus_tag LOCUS_10890 9092 8529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10890 11511 9190 gene locus_tag LOCUS_10900 11511 9190 CDS product polyphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000421678.1 protein_id gnl|my_center|LOCUS_10900 11910 11560 gene locus_tag LOCUS_10910 11910 11560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10910 12818 11982 gene locus_tag LOCUS_10920 12818 11982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10920 13759 12815 gene locus_tag LOCUS_10930 13759 12815 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965413.1 protein_id gnl|my_center|LOCUS_10930 14248 13763 gene locus_tag LOCUS_10940 gene lspA 14248 13763 CDS product signal peptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454916.1 protein_id gnl|my_center|LOCUS_10940 17142 14350 gene locus_tag LOCUS_10950 gene ileS 17142 14350 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392382.1 protein_id gnl|my_center|LOCUS_10950 17979 17182 gene locus_tag LOCUS_10960 17979 17182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10960 18822 18001 gene locus_tag LOCUS_10970 18822 18001 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232140.1 protein_id gnl|my_center|LOCUS_10970 19270 18806 gene locus_tag LOCUS_10980 19270 18806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10980 20685 19378 gene locus_tag LOCUS_10990 20685 19378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10990 21641 20691 gene locus_tag LOCUS_11000 gene miaA 21641 20691 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245569.1 protein_id gnl|my_center|LOCUS_11000 23775 21625 gene locus_tag LOCUS_11010 23775 21625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11010 26430 23815 gene locus_tag LOCUS_11020 gene mutS 26430 23815 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435264.1 protein_id gnl|my_center|LOCUS_11020 26958 26551 gene locus_tag LOCUS_11030 26958 26551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11030 28410 27028 gene locus_tag LOCUS_11040 gene miaB 28410 27028 CDS product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435252.1 protein_id gnl|my_center|LOCUS_11040 28897 28511 gene locus_tag LOCUS_11050 28897 28511 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860967.1 protein_id gnl|my_center|LOCUS_11050 30195 28921 gene locus_tag LOCUS_11060 30195 28921 CDS product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964978.1 protein_id gnl|my_center|LOCUS_11060 30384 31085 gene locus_tag LOCUS_11070 gene nth 30384 31085 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964008.1 protein_id gnl|my_center|LOCUS_11070 31082 31414 gene locus_tag LOCUS_11080 31082 31414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11080 31552 31869 gene locus_tag LOCUS_11090 31552 31869 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026184004.1 protein_id gnl|my_center|LOCUS_11090 31866 32372 gene locus_tag LOCUS_11100 31866 32372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11100 32525 33025 gene locus_tag LOCUS_11110 32525 33025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11110 33018 35267 gene locus_tag LOCUS_11120 33018 35267 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003433859.1 protein_id gnl|my_center|LOCUS_11120 35269 37080 gene locus_tag LOCUS_11130 35269 37080 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003433862.1 protein_id gnl|my_center|LOCUS_11130 37208 37969 gene locus_tag LOCUS_11140 37208 37969 CDS product AzlC family ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071889.1 protein_id gnl|my_center|LOCUS_11140 37966 38277 gene locus_tag LOCUS_11150 37966 38277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11150 38280 39140 gene locus_tag LOCUS_11160 gene rfbD 38280 39140 CDS product dTDP-4-dehydrorhamnose reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877394.1 protein_id gnl|my_center|LOCUS_11160 40059 39220 gene locus_tag LOCUS_11170 40059 39220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_11170 40716 40084 gene locus_tag LOCUS_11180 40716 40084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_11180 40902 41915 gene locus_tag LOCUS_11190 40902 41915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11190 42817 41966 gene locus_tag LOCUS_11200 42817 41966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11200 42804 43013 gene locus_tag LOCUS_11210 42804 43013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11210 43324 44676 gene locus_tag LOCUS_11220 43324 44676 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000672105.1 protein_id gnl|my_center|LOCUS_11220 44820 45737 gene locus_tag LOCUS_11230 44820 45737 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003052879.1 protein_id gnl|my_center|LOCUS_11230 45752 46729 gene locus_tag LOCUS_11240 45752 46729 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000730582.1 protein_id gnl|my_center|LOCUS_11240 >Feature sequence016 951 283 gene locus_tag LOCUS_11250 gene sigF 951 283 CDS product RNA polymerase sporulation sigma factor SigF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230458.1 protein_id gnl|my_center|LOCUS_11250 1411 971 gene locus_tag LOCUS_11260 gene spoIIAB 1411 971 CDS product anti-sigma F factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230452.1 protein_id gnl|my_center|LOCUS_11260 1728 1414 gene locus_tag LOCUS_11270 1728 1414 CDS product anti-sigma factor antagonist inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393007.1 protein_id gnl|my_center|LOCUS_11270 3179 1914 gene locus_tag LOCUS_11280 3179 1914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11280 3693 3184 gene locus_tag LOCUS_11290 3693 3184 CDS product VanZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460983.1 protein_id gnl|my_center|LOCUS_11290 6403 3698 gene locus_tag LOCUS_11300 6403 3698 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861890.1 protein_id gnl|my_center|LOCUS_11300 8510 6723 gene locus_tag LOCUS_11310 8510 6723 CDS product bifunctional homocysteine S-methyltransferase/methylenetetrahydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963614.1 protein_id gnl|my_center|LOCUS_11310 8666 9271 gene locus_tag LOCUS_11320 8666 9271 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461583.1 protein_id gnl|my_center|LOCUS_11320 9268 10533 gene locus_tag LOCUS_11330 gene hflX 9268 10533 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895824.1 protein_id gnl|my_center|LOCUS_11330 11049 11489 gene locus_tag LOCUS_11340 11049 11489 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421494.1 protein_id gnl|my_center|LOCUS_11340 11648 12202 gene locus_tag LOCUS_11350 11648 12202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11350 13775 12291 gene locus_tag LOCUS_11360 13775 12291 CDS product C69 family dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009994262.1 protein_id gnl|my_center|LOCUS_11360 14743 13862 gene locus_tag LOCUS_11370 14743 13862 CDS product CPBP family intramembrane metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890740.1 protein_id gnl|my_center|LOCUS_11370 14921 14994 gene locus_tag LOCUS_t00170 14921 14994 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 15028 15103 gene locus_tag LOCUS_t00180 15028 15103 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 15250 16326 gene locus_tag LOCUS_11380 15250 16326 CDS product ATP-dependent 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201892.1 protein_id gnl|my_center|LOCUS_11380 17469 16405 gene locus_tag LOCUS_11390 gene rfbB 17469 16405 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965629.1 protein_id gnl|my_center|LOCUS_11390 18437 17523 gene locus_tag LOCUS_11400 gene rfbD 18437 17523 CDS product dTDP-4-dehydrorhamnose reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965612.1 protein_id gnl|my_center|LOCUS_11400 19344 18457 gene locus_tag LOCUS_11410 gene rfbA 19344 18457 CDS product glucose-1-phosphate thymidylyltransferase RfbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389370.1 protein_id gnl|my_center|LOCUS_11410 20423 19632 gene locus_tag LOCUS_11420 20423 19632 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107719.1 protein_id gnl|my_center|LOCUS_11420 22857 20428 gene locus_tag LOCUS_11430 22857 20428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11430 24068 22989 gene locus_tag LOCUS_11440 24068 22989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11440 25518 24214 gene locus_tag LOCUS_11450 25518 24214 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869172.1 protein_id gnl|my_center|LOCUS_11450 28452 25840 gene locus_tag LOCUS_11460 gene clpB 28452 25840 CDS product ATP-dependent chaperone ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000365401.1 protein_id gnl|my_center|LOCUS_11460 29835 28693 gene locus_tag LOCUS_11470 29835 28693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11470 30116 31288 gene locus_tag LOCUS_11480 30116 31288 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948041.1 protein_id gnl|my_center|LOCUS_11480 31304 32143 gene locus_tag LOCUS_11490 31304 32143 CDS product fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014519031.1 protein_id gnl|my_center|LOCUS_11490 32158 32709 gene locus_tag LOCUS_11500 32158 32709 CDS product Fe-S-containing hydro-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_158303423.1 protein_id gnl|my_center|LOCUS_11500 33948 32806 gene locus_tag LOCUS_11510 33948 32806 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964137.1 protein_id gnl|my_center|LOCUS_11510 34352 34738 gene locus_tag LOCUS_11520 34352 34738 CDS product metal-dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811011.1 protein_id gnl|my_center|LOCUS_11520 35141 34791 gene locus_tag LOCUS_11530 35141 34791 CDS product type II toxin-antitoxin system PemK/MazF family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963816.1 protein_id gnl|my_center|LOCUS_11530 35701 35285 gene locus_tag LOCUS_11540 gene acpS 35701 35285 CDS product holo-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003695557.1 protein_id gnl|my_center|LOCUS_11540 35889 36134 gene locus_tag LOCUS_11550 35889 36134 CDS product IreB family regulatory phosphoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964986.1 protein_id gnl|my_center|LOCUS_11550 37121 36180 gene locus_tag LOCUS_11560 37121 36180 CDS product tRNA-dihydrouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966723.1 protein_id gnl|my_center|LOCUS_11560 38144 37212 gene locus_tag LOCUS_11570 gene cysK 38144 37212 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004117534.1 protein_id gnl|my_center|LOCUS_11570 38428 38859 gene locus_tag LOCUS_11580 38428 38859 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393155.1 protein_id gnl|my_center|LOCUS_11580 38996 38921 gene locus_tag LOCUS_t00190 38996 38921 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 39200 40858 gene locus_tag LOCUS_11590 39200 40858 CDS product glutamine--tRNA ligase/YqeY domain fusion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943977.1 protein_id gnl|my_center|LOCUS_11590 40883 41035 gene locus_tag LOCUS_11600 40883 41035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11600 41099 42175 gene locus_tag LOCUS_11610 41099 42175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11610 42159 43601 gene locus_tag LOCUS_11620 42159 43601 CDS product VWA-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887812.1 protein_id gnl|my_center|LOCUS_11620 43614 45152 gene locus_tag LOCUS_11630 43614 45152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11630 45945 45277 gene locus_tag LOCUS_11640 45945 45277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11640 46271 45942 gene locus_tag LOCUS_11650 46271 45942 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947952.1 protein_id gnl|my_center|LOCUS_11650 47260 46580 gene locus_tag LOCUS_11660 47260 46580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11660 >Feature sequence017 306 103 gene locus_tag LOCUS_11670 306 103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11670 400 1179 gene locus_tag LOCUS_11680 400 1179 CDS product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809761.1 protein_id gnl|my_center|LOCUS_11680 1340 1264 gene locus_tag LOCUS_t00200 1340 1264 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 1576 2943 gene locus_tag LOCUS_11690 1576 2943 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015727.1 protein_id gnl|my_center|LOCUS_11690 4017 2992 gene locus_tag LOCUS_11700 4017 2992 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942020.1 protein_id gnl|my_center|LOCUS_11700 5159 4143 gene locus_tag LOCUS_11710 5159 4143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11710 6825 5320 gene locus_tag LOCUS_11720 6825 5320 CDS product carbon starvation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002666927.1 protein_id gnl|my_center|LOCUS_11720 8742 7237 gene locus_tag LOCUS_11730 8742 7237 CDS product carbon starvation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002666927.1 protein_id gnl|my_center|LOCUS_11730 9964 9044 gene locus_tag LOCUS_11740 9964 9044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11740 10099 10854 gene locus_tag LOCUS_11750 10099 10854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11750 12598 11246 gene locus_tag LOCUS_11760 12598 11246 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009902958.1 protein_id gnl|my_center|LOCUS_11760 12863 12624 gene locus_tag LOCUS_11770 12863 12624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11770 16194 12856 gene locus_tag LOCUS_11780 16194 12856 CDS product SbcC/MukB-like Walker B domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392027.1 protein_id gnl|my_center|LOCUS_11780 16796 16191 gene locus_tag LOCUS_11790 16796 16191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11790 18213 16780 gene locus_tag LOCUS_11800 18213 16780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11800 18850 18350 gene locus_tag LOCUS_11810 18850 18350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11810 19166 19834 gene locus_tag LOCUS_11820 19166 19834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11820 21561 19906 gene locus_tag LOCUS_11830 21561 19906 CDS product putative manganese-dependent inorganic diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461447.1 protein_id gnl|my_center|LOCUS_11830 21755 22552 gene locus_tag LOCUS_11840 21755 22552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11840 22644 24002 gene locus_tag LOCUS_11850 gene emmdR 22644 24002 CDS product multidrug efflux MATE transporter EmmdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_120727113.1 protein_id gnl|my_center|LOCUS_11850 24273 24926 gene locus_tag LOCUS_11860 24273 24926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11860 26118 24985 gene locus_tag LOCUS_11870 26118 24985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11870 26448 26137 gene locus_tag LOCUS_11880 26448 26137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11880 27510 26566 gene locus_tag LOCUS_11890 gene gluQRS 27510 26566 CDS product tRNA glutamyl-Q(34) synthetase GluQRS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792234.1 protein_id gnl|my_center|LOCUS_11890 28823 27507 gene locus_tag LOCUS_11900 28823 27507 CDS product M18 family aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048276.1 protein_id gnl|my_center|LOCUS_11900 30657 29116 gene locus_tag LOCUS_11910 30657 29116 CDS product PTS transporter subunit EIIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009890719.1 protein_id gnl|my_center|LOCUS_11910 30917 31504 gene locus_tag LOCUS_11920 30917 31504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11920 32698 31574 gene locus_tag LOCUS_11930 32698 31574 CDS product DUF362 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082494.1 protein_id gnl|my_center|LOCUS_11930 33686 32856 gene locus_tag LOCUS_11940 33686 32856 CDS product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262750.1 protein_id gnl|my_center|LOCUS_11940 33939 34352 gene locus_tag LOCUS_11950 33939 34352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11950 34440 35105 gene locus_tag LOCUS_11960 34440 35105 CDS product TrkA family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061014.1 protein_id gnl|my_center|LOCUS_11960 35102 35533 gene locus_tag LOCUS_11970 35102 35533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11970 35530 36906 gene locus_tag LOCUS_11980 35530 36906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11980 37000 37656 gene locus_tag LOCUS_11990 37000 37656 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109158.1 protein_id gnl|my_center|LOCUS_11990 37807 38475 gene locus_tag LOCUS_12000 37807 38475 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963474.1 protein_id gnl|my_center|LOCUS_12000 38636 38712 gene locus_tag LOCUS_t00210 38636 38712 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 38804 38878 gene locus_tag LOCUS_t00220 38804 38878 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 40342 39011 gene locus_tag LOCUS_12010 gene serS 40342 39011 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948259.1 protein_id gnl|my_center|LOCUS_12010 41424 40555 gene locus_tag LOCUS_12020 41424 40555 CDS product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229053.1 protein_id gnl|my_center|LOCUS_12020 42279 41428 gene locus_tag LOCUS_12030 gene soj 42279 41428 CDS product sporulation initiation inhibitor protein Soj inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003219244.1 protein_id gnl|my_center|LOCUS_12030 43267 42473 gene locus_tag LOCUS_12040 gene noc 43267 42473 CDS product nucleoid occlusion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429292.1 protein_id gnl|my_center|LOCUS_12040 44132 43425 gene locus_tag LOCUS_12050 gene rsmG 44132 43425 CDS product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393994.1 protein_id gnl|my_center|LOCUS_12050 45197 44214 gene locus_tag LOCUS_12060 45197 44214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12060 >Feature sequence018 2635 1901 gene locus_tag LOCUS_12070 2635 1901 CDS product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263557.1 protein_id gnl|my_center|LOCUS_12070 3930 2698 gene locus_tag LOCUS_12080 3930 2698 CDS product spermidine/putrescine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895984.1 protein_id gnl|my_center|LOCUS_12080 4775 3927 gene locus_tag LOCUS_12090 4775 3927 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459711.1 protein_id gnl|my_center|LOCUS_12090 5593 4775 gene locus_tag LOCUS_12100 5593 4775 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003432157.1 protein_id gnl|my_center|LOCUS_12100 6647 5601 gene locus_tag LOCUS_12110 6647 5601 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272316.1 protein_id gnl|my_center|LOCUS_12110 7868 6906 gene locus_tag LOCUS_12120 7868 6906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12120 9324 7879 gene locus_tag LOCUS_12130 9324 7879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12130 10212 9340 gene locus_tag LOCUS_12140 10212 9340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12140 10958 10209 gene locus_tag LOCUS_12150 10958 10209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12150 11333 11133 gene locus_tag LOCUS_12160 gene rpmE 11333 11133 CDS product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008632496.1 protein_id gnl|my_center|LOCUS_12160 11801 12919 gene locus_tag LOCUS_12170 11801 12919 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964048.1 protein_id gnl|my_center|LOCUS_12170 14252 13080 gene locus_tag LOCUS_12180 14252 13080 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013582790.1 protein_id gnl|my_center|LOCUS_12180 14844 14365 gene locus_tag LOCUS_12190 14844 14365 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_165442218.1 protein_id gnl|my_center|LOCUS_12190 16086 15328 gene locus_tag LOCUS_12200 gene spo0A 16086 15328 CDS product sporulation transcription factor Spo0A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003424711.1 protein_id gnl|my_center|LOCUS_12200 17418 16222 gene locus_tag LOCUS_12210 gene spoIVB 17418 16222 CDS product SpoIVB peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986434.1 protein_id gnl|my_center|LOCUS_12210 17626 17708 gene locus_tag LOCUS_t00230 17626 17708 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 17903 17822 gene locus_tag LOCUS_t00240 17903 17822 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 18044 18892 gene locus_tag LOCUS_12220 18044 18892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12220 19744 18899 gene locus_tag LOCUS_12230 19744 18899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12230 21269 19869 gene locus_tag LOCUS_12240 21269 19869 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861085.1 protein_id gnl|my_center|LOCUS_12240 21915 21352 gene locus_tag LOCUS_12250 21915 21352 CDS product lytic transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438043.1 protein_id gnl|my_center|LOCUS_12250 22541 21912 gene locus_tag LOCUS_12260 gene coaE 22541 21912 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704406.1 protein_id gnl|my_center|LOCUS_12260 23563 22538 gene locus_tag LOCUS_12270 23563 22538 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249899.1 protein_id gnl|my_center|LOCUS_12270 24742 23651 gene locus_tag LOCUS_12280 gene prfA 24742 23651 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227645.1 protein_id gnl|my_center|LOCUS_12280 24965 24774 gene locus_tag LOCUS_12290 24965 24774 CDS product DUF951 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025773685.1 protein_id gnl|my_center|LOCUS_12290 25162 26097 gene locus_tag LOCUS_12300 25162 26097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12300 26190 26732 gene locus_tag LOCUS_12310 26190 26732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12310 27587 26772 gene locus_tag LOCUS_12320 gene yqeB 27587 26772 CDS product selenium-dependent molybdenum cofactor biosynthesis protein YqeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437839.1 protein_id gnl|my_center|LOCUS_12320 28622 27591 gene locus_tag LOCUS_12330 28622 27591 CDS product XdhC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_144034111.1 protein_id gnl|my_center|LOCUS_12330 28871 28641 gene locus_tag LOCUS_12340 28871 28641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12340 29948 28875 gene locus_tag LOCUS_12350 29948 28875 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681891.1 protein_id gnl|my_center|LOCUS_12350 30637 30005 gene locus_tag LOCUS_12360 gene yedF 30637 30005 CDS product sulfurtransferase-like selenium metabolism protein YedF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681889.1 protein_id gnl|my_center|LOCUS_12360 31689 30652 gene locus_tag LOCUS_12370 gene selD 31689 30652 CDS product selenide, water dikinase SelD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462047.1 protein_id gnl|my_center|LOCUS_12370 32395 31691 gene locus_tag LOCUS_12380 gene yqeC 32395 31691 CDS product selenium cofactor biosynthesis protein YqeC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459386.1 protein_id gnl|my_center|LOCUS_12380 34683 32395 gene locus_tag LOCUS_12390 34683 32395 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897245.1 protein_id gnl|my_center|LOCUS_12390 35153 34680 gene locus_tag LOCUS_12400 35153 34680 CDS product 2Fe-2S iron-sulfur cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009902988.1 protein_id gnl|my_center|LOCUS_12400 35945 35160 gene locus_tag LOCUS_12410 35945 35160 CDS product FAD binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009902983.1 protein_id gnl|my_center|LOCUS_12410 36055 36717 gene locus_tag LOCUS_12420 gene mocA 36055 36717 CDS product molybdenum cofactor cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002362242.1 protein_id gnl|my_center|LOCUS_12420 38185 36785 gene locus_tag LOCUS_12430 38185 36785 CDS product nucleobase:cation symporter-2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869179.1 protein_id gnl|my_center|LOCUS_12430 39873 38347 gene locus_tag LOCUS_12440 39873 38347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12440 41125 40031 gene locus_tag LOCUS_12450 41125 40031 CDS product electron transfer flavoprotein subunit alpha/FixB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986692.1 protein_id gnl|my_center|LOCUS_12450 41941 41147 gene locus_tag LOCUS_12460 gene etfB 41941 41147 CDS product electron transfer flavoprotein subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003427760.1 protein_id gnl|my_center|LOCUS_12460 43128 41959 gene locus_tag LOCUS_12470 43128 41959 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418888.1 protein_id gnl|my_center|LOCUS_12470 44105 43233 gene locus_tag LOCUS_12480 44105 43233 CDS product 3-hydroxybutyryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005901831.1 protein_id gnl|my_center|LOCUS_12480 44930 44145 gene locus_tag LOCUS_12490 44930 44145 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005901833.1 protein_id gnl|my_center|LOCUS_12490 >Feature sequence019 408 869 gene locus_tag LOCUS_12500 408 869 CDS product YhcH/YjgK/YiaL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073873.1 protein_id gnl|my_center|LOCUS_12500 862 1566 gene locus_tag LOCUS_12510 862 1566 CDS product N-acetylmannosamine-6-phosphate 2-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130140.1 protein_id gnl|my_center|LOCUS_12510 1582 2511 gene locus_tag LOCUS_12520 1582 2511 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081773.1 protein_id gnl|my_center|LOCUS_12520 2542 3180 gene locus_tag LOCUS_12530 2542 3180 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041170003.1 protein_id gnl|my_center|LOCUS_12530 4495 3287 gene locus_tag LOCUS_12540 4495 3287 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005807909.1 protein_id gnl|my_center|LOCUS_12540 5846 4512 gene locus_tag LOCUS_12550 gene aspS 5846 4512 CDS product aspartate--tRNA(Asn) ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902296.1 protein_id gnl|my_center|LOCUS_12550 6547 5927 gene locus_tag LOCUS_12560 6547 5927 CDS product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002902061.1 protein_id gnl|my_center|LOCUS_12560 6788 8803 gene locus_tag LOCUS_12570 6788 8803 CDS product glycoside hydrolase family 31 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582587.1 protein_id gnl|my_center|LOCUS_12570 8984 10357 gene locus_tag LOCUS_12580 8984 10357 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029494943.1 protein_id gnl|my_center|LOCUS_12580 10941 10399 gene locus_tag LOCUS_12590 10941 10399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12590 11129 11884 gene locus_tag LOCUS_12600 11129 11884 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067058.1 protein_id gnl|my_center|LOCUS_12600 11899 12840 gene locus_tag LOCUS_12610 gene pyrB 11899 12840 CDS product aspartate carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048210.1 protein_id gnl|my_center|LOCUS_12610 12842 13279 gene locus_tag LOCUS_12620 12842 13279 CDS product aspartate carbamoyltransferase regulatory subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003816669.1 protein_id gnl|my_center|LOCUS_12620 15047 13758 gene locus_tag LOCUS_12630 15047 13758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12630 15765 15040 gene locus_tag LOCUS_12640 15765 15040 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895627.1 protein_id gnl|my_center|LOCUS_12640 17311 15941 gene locus_tag LOCUS_12650 17311 15941 CDS product sodium-dependent transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020940.1 protein_id gnl|my_center|LOCUS_12650 17498 18043 gene locus_tag LOCUS_12660 17498 18043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12660 18033 18377 gene locus_tag LOCUS_12670 18033 18377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12670 18367 18987 gene locus_tag LOCUS_12680 18367 18987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12680 18974 19615 gene locus_tag LOCUS_12690 18974 19615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12690 19761 20126 gene locus_tag LOCUS_12700 19761 20126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12700 21874 20267 gene locus_tag LOCUS_12710 21874 20267 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948757.1 protein_id gnl|my_center|LOCUS_12710 22082 23905 gene locus_tag LOCUS_12720 gene typA 22082 23905 CDS product translational GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986883.1 protein_id gnl|my_center|LOCUS_12720 25013 23985 gene locus_tag LOCUS_12730 25013 23985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12730 25388 26611 gene locus_tag LOCUS_12740 25388 26611 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392748.1 protein_id gnl|my_center|LOCUS_12740 26706 27932 gene locus_tag LOCUS_12750 26706 27932 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009891452.1 protein_id gnl|my_center|LOCUS_12750 28840 28013 gene locus_tag LOCUS_12760 28840 28013 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461790.1 protein_id gnl|my_center|LOCUS_12760 29024 29740 gene locus_tag LOCUS_12770 29024 29740 CDS product YoaK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436876.1 protein_id gnl|my_center|LOCUS_12770 29916 30389 gene locus_tag LOCUS_12780 29916 30389 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005061267.1 protein_id gnl|my_center|LOCUS_12780 30390 31370 gene locus_tag LOCUS_12790 30390 31370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12790 31575 33065 gene locus_tag LOCUS_12800 31575 33065 CDS product DUF1846 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389785.1 protein_id gnl|my_center|LOCUS_12800 33658 33155 gene locus_tag LOCUS_12810 33658 33155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12810 33925 35154 gene locus_tag LOCUS_12820 33925 35154 CDS product class I SAM-dependent rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582740.1 protein_id gnl|my_center|LOCUS_12820 35405 37492 gene locus_tag LOCUS_12830 35405 37492 CDS product glutamine synthetase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965946.1 protein_id gnl|my_center|LOCUS_12830 37695 39014 gene locus_tag LOCUS_12840 gene glnA 37695 39014 CDS product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005807771.1 protein_id gnl|my_center|LOCUS_12840 39090 39659 gene locus_tag LOCUS_12850 39090 39659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12850 39758 41389 gene locus_tag LOCUS_12860 39758 41389 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966175.1 protein_id gnl|my_center|LOCUS_12860 42263 41505 gene locus_tag LOCUS_12870 42263 41505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12870 43721 42525 gene locus_tag LOCUS_12880 43721 42525 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679691.1 protein_id gnl|my_center|LOCUS_12880 44048 44332 gene locus_tag LOCUS_12890 gene rpsF 44048 44332 CDS product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048444.1 protein_id gnl|my_center|LOCUS_12890 44363 44842 gene locus_tag LOCUS_12900 44363 44842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12900 >Feature sequence020 453 2690 gene locus_tag LOCUS_12910 453 2690 CDS product glycoside hydrolase family 2 TIM barrel-domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107432.1 protein_id gnl|my_center|LOCUS_12910 3068 2793 gene locus_tag LOCUS_12920 3068 2793 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815811.1 protein_id gnl|my_center|LOCUS_12920 3433 3071 gene locus_tag LOCUS_12930 3433 3071 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006307660.1 protein_id gnl|my_center|LOCUS_12930 3895 3692 gene locus_tag LOCUS_12940 3895 3692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12940 4235 3939 gene locus_tag LOCUS_12950 4235 3939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12950 5868 4351 gene locus_tag LOCUS_12960 5868 4351 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000416108.1 protein_id gnl|my_center|LOCUS_12960 6785 6234 gene locus_tag LOCUS_12970 6785 6234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12970 8550 6922 gene locus_tag LOCUS_12980 8550 6922 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775580.1 protein_id gnl|my_center|LOCUS_12980 8978 11221 gene locus_tag LOCUS_12990 8978 11221 CDS product glycoside hydrolase family 3 N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776044.1 protein_id gnl|my_center|LOCUS_12990 11266 12642 gene locus_tag LOCUS_13000 11266 12642 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437109.1 protein_id gnl|my_center|LOCUS_13000 13648 12734 gene locus_tag LOCUS_13010 gene argF 13648 12734 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868438.1 protein_id gnl|my_center|LOCUS_13010 14850 13645 gene locus_tag LOCUS_13020 14850 13645 CDS product acetylornithine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393770.1 protein_id gnl|my_center|LOCUS_13020 15824 14970 gene locus_tag LOCUS_13030 gene argB 15824 14970 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435171.1 protein_id gnl|my_center|LOCUS_13030 17226 15997 gene locus_tag LOCUS_13040 gene argJ 17226 15997 CDS product bifunctional glutamate N-acetyltransferase/amino-acid acetyltransferase ArgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393772.1 protein_id gnl|my_center|LOCUS_13040 18318 17383 gene locus_tag LOCUS_13050 gene argC 18318 17383 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197909.1 protein_id gnl|my_center|LOCUS_13050 19715 18315 gene locus_tag LOCUS_13060 gene argH 19715 18315 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808617.1 protein_id gnl|my_center|LOCUS_13060 21284 20049 gene locus_tag LOCUS_13070 21284 20049 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808619.1 protein_id gnl|my_center|LOCUS_13070 22403 21555 gene locus_tag LOCUS_13080 22403 21555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13080 23232 22405 gene locus_tag LOCUS_13090 23232 22405 CDS product MYG1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973334.1 protein_id gnl|my_center|LOCUS_13090 23722 24897 gene locus_tag LOCUS_13100 23722 24897 CDS product IS110-like element ISFnu4 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015895.1 protein_id gnl|my_center|LOCUS_13100 25793 25008 gene locus_tag LOCUS_13110 25793 25008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13110 27370 25997 gene locus_tag LOCUS_13120 27370 25997 CDS product ATP-grasp domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263541.1 protein_id gnl|my_center|LOCUS_13120 28141 27389 gene locus_tag LOCUS_13130 28141 27389 CDS product esterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529927.1 protein_id gnl|my_center|LOCUS_13130 28997 28230 gene locus_tag LOCUS_13140 28997 28230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13140 30239 29160 gene locus_tag LOCUS_13150 30239 29160 CDS product branched-chain amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244231.1 protein_id gnl|my_center|LOCUS_13150 30689 30489 gene locus_tag LOCUS_13160 30689 30489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13160 30724 31377 gene locus_tag LOCUS_13170 30724 31377 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001010777.1 protein_id gnl|my_center|LOCUS_13170 31566 32324 gene locus_tag LOCUS_13180 31566 32324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13180 32426 32821 gene locus_tag LOCUS_13190 32426 32821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13190 33892 32948 gene locus_tag LOCUS_13200 33892 32948 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000421907.1 protein_id gnl|my_center|LOCUS_13200 35777 34155 gene locus_tag LOCUS_13210 35777 34155 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389524.1 protein_id gnl|my_center|LOCUS_13210 37025 35898 gene locus_tag LOCUS_13220 37025 35898 CDS product SPASM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002390206.1 protein_id gnl|my_center|LOCUS_13220 37799 37053 gene locus_tag LOCUS_13230 37799 37053 CDS product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001060027.1 protein_id gnl|my_center|LOCUS_13230 38086 39558 gene locus_tag LOCUS_13240 38086 39558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13240 39585 41048 gene locus_tag LOCUS_13250 39585 41048 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_202887107.1 protein_id gnl|my_center|LOCUS_13250 41129 41710 gene locus_tag LOCUS_13260 41129 41710 CDS product chromate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948278.1 protein_id gnl|my_center|LOCUS_13260 41707 42264 gene locus_tag LOCUS_13270 41707 42264 CDS product chromate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763311.1 protein_id gnl|my_center|LOCUS_13270 42286 43725 gene locus_tag LOCUS_13280 42286 43725 CDS product glycoside hydrolase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861817.1 protein_id gnl|my_center|LOCUS_13280 44175 44345 gene locus_tag LOCUS_13290 44175 44345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13290 >Feature sequence021 1373 1804 gene locus_tag LOCUS_13300 1373 1804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13300 1841 2347 gene locus_tag LOCUS_13310 1841 2347 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009896384.1 protein_id gnl|my_center|LOCUS_13310 5645 2469 gene locus_tag LOCUS_13320 5645 2469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13320 5978 6730 gene locus_tag LOCUS_13330 5978 6730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13330 6727 7548 gene locus_tag LOCUS_13340 6727 7548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13340 7803 10757 gene locus_tag LOCUS_13350 7803 10757 CDS product acyl-CoA dehydratase activase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016931.1 protein_id gnl|my_center|LOCUS_13350 10774 12090 gene locus_tag LOCUS_13360 10774 12090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13360 13084 12170 gene locus_tag LOCUS_13370 13084 12170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13370 14775 13045 gene locus_tag LOCUS_13380 14775 13045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13380 15917 14913 gene locus_tag LOCUS_13390 15917 14913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13390 16137 16772 gene locus_tag LOCUS_13400 16137 16772 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011110319.1 protein_id gnl|my_center|LOCUS_13400 16816 17634 gene locus_tag LOCUS_13410 16816 17634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13410 17860 18519 gene locus_tag LOCUS_13420 17860 18519 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000384085.1 protein_id gnl|my_center|LOCUS_13420 18500 19174 gene locus_tag LOCUS_13430 18500 19174 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001154147.1 protein_id gnl|my_center|LOCUS_13430 19180 19938 gene locus_tag LOCUS_13440 19180 19938 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815845.1 protein_id gnl|my_center|LOCUS_13440 20051 20962 gene locus_tag LOCUS_13450 20051 20962 CDS product cysteine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007056925.1 protein_id gnl|my_center|LOCUS_13450 21103 21369 gene locus_tag LOCUS_13460 21103 21369 CDS product type II toxin-antitoxin system RelB/DinJ family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812262.1 protein_id gnl|my_center|LOCUS_13460 21362 21625 gene locus_tag LOCUS_13470 21362 21625 CDS product Txe/YoeB family addiction module toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464459.1 protein_id gnl|my_center|LOCUS_13470 22255 21680 gene locus_tag LOCUS_13480 22255 21680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13480 23361 22369 gene locus_tag LOCUS_13490 23361 22369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13490 25002 23374 gene locus_tag LOCUS_13500 25002 23374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13500 26500 25124 gene locus_tag LOCUS_13510 26500 25124 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051187.1 protein_id gnl|my_center|LOCUS_13510 27544 26669 gene locus_tag LOCUS_13520 gene galU 27544 26669 CDS product UTP--glucose-1-phosphate uridylyltransferase GalU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048121.1 protein_id gnl|my_center|LOCUS_13520 28568 27585 gene locus_tag LOCUS_13530 28568 27585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13530 28747 29868 gene locus_tag LOCUS_13540 gene prfB 28747 29868 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_096772597.1 protein_id gnl|my_center|LOCUS_13540 32437 29924 gene locus_tag LOCUS_13550 32437 29924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_060618669.1 protein_id gnl|my_center|LOCUS_13550 35535 32497 gene locus_tag LOCUS_13560 35535 32497 CDS product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895801.1 protein_id gnl|my_center|LOCUS_13560 36998 35574 gene locus_tag LOCUS_13570 36998 35574 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860945.1 protein_id gnl|my_center|LOCUS_13570 37238 37648 gene locus_tag LOCUS_13580 37238 37648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13580 39656 37731 gene locus_tag LOCUS_13590 39656 37731 CDS product PTS fructose transporter subunit IIABC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897443.1 protein_id gnl|my_center|LOCUS_13590 40639 39734 gene locus_tag LOCUS_13600 gene pfkB 40639 39734 CDS product 1-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861506.1 protein_id gnl|my_center|LOCUS_13600 41391 40636 gene locus_tag LOCUS_13610 41391 40636 CDS product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002323503.1 protein_id gnl|my_center|LOCUS_13610 41667 42446 gene locus_tag LOCUS_13620 41667 42446 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245153.1 protein_id gnl|my_center|LOCUS_13620 43917 42523 gene locus_tag LOCUS_13630 gene gltA 43917 42523 CDS product NADPH-dependent glutamate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048248.1 protein_id gnl|my_center|LOCUS_13630 >Feature sequence022 282 3380 gene locus_tag LOCUS_13640 282 3380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13640 3544 4437 gene locus_tag LOCUS_13650 3544 4437 CDS product D-alanyl-D-alanine carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459514.1 protein_id gnl|my_center|LOCUS_13650 4523 5254 gene locus_tag LOCUS_13660 4523 5254 CDS product YkgJ family cysteine cluster protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015538576.1 protein_id gnl|my_center|LOCUS_13660 5419 6444 gene locus_tag LOCUS_13670 5419 6444 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856994.1 protein_id gnl|my_center|LOCUS_13670 6608 7555 gene locus_tag LOCUS_13680 6608 7555 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549276.1 protein_id gnl|my_center|LOCUS_13680 7548 8342 gene locus_tag LOCUS_13690 7548 8342 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811779.1 protein_id gnl|my_center|LOCUS_13690 10589 8478 gene locus_tag LOCUS_13700 10589 8478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13700 11974 10886 gene locus_tag LOCUS_13710 11974 10886 CDS product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391957.1 protein_id gnl|my_center|LOCUS_13710 13314 12394 gene locus_tag LOCUS_13720 13314 12394 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048395.1 protein_id gnl|my_center|LOCUS_13720 13449 15455 gene locus_tag LOCUS_13730 13449 15455 CDS product fructose-1,6-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964880.1 protein_id gnl|my_center|LOCUS_13730 15694 16977 gene locus_tag LOCUS_13740 15694 16977 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359322.1 protein_id gnl|my_center|LOCUS_13740 17072 17860 gene locus_tag LOCUS_13750 17072 17860 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966803.1 protein_id gnl|my_center|LOCUS_13750 18470 17922 gene locus_tag LOCUS_13760 18470 17922 CDS product DUF1836 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476576.1 protein_id gnl|my_center|LOCUS_13760 18633 19472 gene locus_tag LOCUS_13770 18633 19472 CDS product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922568.1 protein_id gnl|my_center|LOCUS_13770 19626 21155 gene locus_tag LOCUS_13780 gene cls 19626 21155 CDS product cardiolipin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461555.1 protein_id gnl|my_center|LOCUS_13780 21394 22374 gene locus_tag LOCUS_13790 21394 22374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13790 22680 23516 gene locus_tag LOCUS_13800 22680 23516 CDS product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948208.1 protein_id gnl|my_center|LOCUS_13800 23677 24330 gene locus_tag LOCUS_13810 23677 24330 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262170.1 protein_id gnl|my_center|LOCUS_13810 24346 25128 gene locus_tag LOCUS_13820 gene yecC 24346 25128 CDS product L-cystine ABC transporter ATP-binding protein YecC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001273033.1 protein_id gnl|my_center|LOCUS_13820 25411 26766 gene locus_tag LOCUS_13830 25411 26766 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109290.1 protein_id gnl|my_center|LOCUS_13830 26964 29177 gene locus_tag LOCUS_13840 26964 29177 CDS product ATP-dependent RecD-like DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434402.1 protein_id gnl|my_center|LOCUS_13840 29321 30346 gene locus_tag LOCUS_13850 29321 30346 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420729.1 protein_id gnl|my_center|LOCUS_13850 30512 30868 gene locus_tag LOCUS_13860 30512 30868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13860 30884 32092 gene locus_tag LOCUS_13870 30884 32092 CDS product sodium ion-translocating decarboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902660.1 protein_id gnl|my_center|LOCUS_13870 32215 34863 gene locus_tag LOCUS_13880 gene pcrA 32215 34863 CDS product DNA helicase PcrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_225356248.1 protein_id gnl|my_center|LOCUS_13880 34874 35650 gene locus_tag LOCUS_13890 gene thyX 34874 35650 CDS product FAD-dependent thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421197.1 protein_id gnl|my_center|LOCUS_13890 35647 36315 gene locus_tag LOCUS_13900 35647 36315 CDS product thymidylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947925.1 protein_id gnl|my_center|LOCUS_13900 36339 37151 gene locus_tag LOCUS_13910 36339 37151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13910 37165 38295 gene locus_tag LOCUS_13920 37165 38295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13920 38439 39674 gene locus_tag LOCUS_13930 38439 39674 CDS product U32 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438167.1 protein_id gnl|my_center|LOCUS_13930 39747 39820 gene locus_tag LOCUS_t00250 39747 39820 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 41651 39969 gene locus_tag LOCUS_13940 41651 39969 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000031832.1 protein_id gnl|my_center|LOCUS_13940 42674 41673 gene locus_tag LOCUS_13950 42674 41673 CDS product virulence RhuM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681377.1 protein_id gnl|my_center|LOCUS_13950 42960 42760 gene locus_tag LOCUS_13960 42960 42760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13960 43844 43029 gene locus_tag LOCUS_13970 43844 43029 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860782.1 protein_id gnl|my_center|LOCUS_13970 >Feature sequence023 17 781 gene locus_tag LOCUS_13980 17 781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13980 919 1836 gene locus_tag LOCUS_13990 919 1836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13990 1859 2503 gene locus_tag LOCUS_14000 1859 2503 CDS product ferredoxin-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001070227.1 protein_id gnl|my_center|LOCUS_14000 2516 4672 gene locus_tag LOCUS_14010 2516 4672 CDS product aldehyde ferredoxin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001273527.1 protein_id gnl|my_center|LOCUS_14010 4699 5616 gene locus_tag LOCUS_14020 4699 5616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14020 6046 7284 gene locus_tag LOCUS_14030 6046 7284 CDS product molybdopterin molybdotransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272494.1 protein_id gnl|my_center|LOCUS_14030 7274 7792 gene locus_tag LOCUS_14040 7274 7792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14040 7810 8829 gene locus_tag LOCUS_14050 7810 8829 CDS product molybdopterin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435117.1 protein_id gnl|my_center|LOCUS_14050 8902 9399 gene locus_tag LOCUS_14060 gene moaC 8902 9399 CDS product cyclic pyranopterin monophosphate synthase MoaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719152.1 protein_id gnl|my_center|LOCUS_14060 9392 10372 gene locus_tag LOCUS_14070 gene moaA 9392 10372 CDS product GTP 3',8-cyclase MoaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393625.1 protein_id gnl|my_center|LOCUS_14070 10377 11309 gene locus_tag LOCUS_14080 10377 11309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14080 11398 12285 gene locus_tag LOCUS_14090 gene modA 11398 12285 CDS product molybdate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243706.1 protein_id gnl|my_center|LOCUS_14090 12306 12980 gene locus_tag LOCUS_14100 gene modB 12306 12980 CDS product molybdate ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888685.1 protein_id gnl|my_center|LOCUS_14100 12977 14023 gene locus_tag LOCUS_14110 12977 14023 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002379414.1 protein_id gnl|my_center|LOCUS_14110 14157 14573 gene locus_tag LOCUS_14120 14157 14573 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000845472.1 protein_id gnl|my_center|LOCUS_14120 14575 15702 gene locus_tag LOCUS_14130 14575 15702 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861704.1 protein_id gnl|my_center|LOCUS_14130 15730 16233 gene locus_tag LOCUS_14140 15730 16233 CDS product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682427.1 protein_id gnl|my_center|LOCUS_14140 16761 17630 gene locus_tag LOCUS_14150 16761 17630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14150 18253 17741 gene locus_tag LOCUS_14160 18253 17741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14160 18714 18250 gene locus_tag LOCUS_14170 gene rnhA 18714 18250 CDS product ribonuclease HI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064241132.1 protein_id gnl|my_center|LOCUS_14170 19118 20920 gene locus_tag LOCUS_14180 19118 20920 CDS product ribonuclease J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964990.1 protein_id gnl|my_center|LOCUS_14180 20970 22979 gene locus_tag LOCUS_14190 20970 22979 CDS product DHH family phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429268.1 protein_id gnl|my_center|LOCUS_14190 22976 24079 gene locus_tag LOCUS_14200 gene glf 22976 24079 CDS product UDP-galactopyranose mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011922747.1 protein_id gnl|my_center|LOCUS_14200 24305 24760 gene locus_tag LOCUS_14210 gene rplI 24305 24760 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815187.1 protein_id gnl|my_center|LOCUS_14210 24844 26247 gene locus_tag LOCUS_14220 gene dnaB 24844 26247 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546182.1 protein_id gnl|my_center|LOCUS_14220 26247 27710 gene locus_tag LOCUS_14230 gene tilS 26247 27710 CDS product tRNA lysidine(34) synthetase TilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404456.1 protein_id gnl|my_center|LOCUS_14230 27697 28242 gene locus_tag LOCUS_14240 gene hpt 27697 28242 CDS product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966479.1 protein_id gnl|my_center|LOCUS_14240 28275 30404 gene locus_tag LOCUS_14250 28275 30404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14250 30423 31514 gene locus_tag LOCUS_14260 30423 31514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14260 31573 32388 gene locus_tag LOCUS_14270 31573 32388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14270 32404 33249 gene locus_tag LOCUS_14280 32404 33249 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_223846944.1 protein_id gnl|my_center|LOCUS_14280 34657 33326 gene locus_tag LOCUS_14290 34657 33326 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436703.1 protein_id gnl|my_center|LOCUS_14290 34922 35470 gene locus_tag LOCUS_14300 gene yfcE 34922 35470 CDS product phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948679.1 protein_id gnl|my_center|LOCUS_14300 35697 35954 gene locus_tag LOCUS_14310 35697 35954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14310 36007 36948 gene locus_tag LOCUS_14320 36007 36948 CDS product ketopantoate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964780.1 protein_id gnl|my_center|LOCUS_14320 39516 37012 gene locus_tag LOCUS_14330 39516 37012 CDS product helicase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003592867.1 protein_id gnl|my_center|LOCUS_14330 40661 39576 gene locus_tag LOCUS_14340 40661 39576 CDS product PRK06851 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393267.1 protein_id gnl|my_center|LOCUS_14340 41436 40870 gene locus_tag LOCUS_14350 41436 40870 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947937.1 protein_id gnl|my_center|LOCUS_14350 >Feature sequence024 549 34 gene locus_tag LOCUS_14360 549 34 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14360 1358 852 gene locus_tag LOCUS_14370 1358 852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14370 1840 1355 gene locus_tag LOCUS_14380 1840 1355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14380 2293 1931 gene locus_tag LOCUS_14390 2293 1931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14390 3221 2340 gene locus_tag LOCUS_14400 3221 2340 CDS product DUF6017 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861119.1 protein_id gnl|my_center|LOCUS_14400 3785 3279 gene locus_tag LOCUS_14410 3785 3279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14410 4085 3816 gene locus_tag LOCUS_14420 4085 3816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14420 4690 4082 gene locus_tag LOCUS_14430 4690 4082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14430 5523 4759 gene locus_tag LOCUS_14440 5523 4759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14440 5425 5658 gene locus_tag LOCUS_14450 5425 5658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14450 6201 7172 gene locus_tag LOCUS_14460 6201 7172 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003562943.1 protein_id gnl|my_center|LOCUS_14460 7191 8048 gene locus_tag LOCUS_14470 7191 8048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14470 8150 9622 gene locus_tag LOCUS_14480 8150 9622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14480 10008 11651 gene locus_tag LOCUS_14490 10008 11651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14490 11819 13174 gene locus_tag LOCUS_14500 11819 13174 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068386.1 protein_id gnl|my_center|LOCUS_14500 13291 13983 gene locus_tag LOCUS_14510 13291 13983 CDS product DUF3990 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054641.1 protein_id gnl|my_center|LOCUS_14510 13949 14587 gene locus_tag LOCUS_14520 13949 14587 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032740920.1 protein_id gnl|my_center|LOCUS_14520 15137 16165 gene locus_tag LOCUS_14530 15137 16165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012027029.1 protein_id gnl|my_center|LOCUS_14530 16180 16932 gene locus_tag LOCUS_14540 16180 16932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14540 17191 17916 gene locus_tag LOCUS_14550 17191 17916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14550 18815 18042 gene locus_tag LOCUS_14560 18815 18042 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948093.1 protein_id gnl|my_center|LOCUS_14560 19878 18817 gene locus_tag LOCUS_14570 19878 18817 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948092.1 protein_id gnl|my_center|LOCUS_14570 20047 21111 gene locus_tag LOCUS_14580 20047 21111 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000722885.1 protein_id gnl|my_center|LOCUS_14580 21529 22851 gene locus_tag LOCUS_14590 21529 22851 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068386.1 protein_id gnl|my_center|LOCUS_14590 23749 23195 gene locus_tag LOCUS_14600 23749 23195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14600 24105 23860 gene locus_tag LOCUS_14610 24105 23860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14610 24135 24266 gene locus_tag LOCUS_14620 24135 24266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14620 24384 24460 gene locus_tag LOCUS_t00260 24384 24460 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 24684 25412 gene locus_tag LOCUS_14630 24684 25412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14630 25505 25723 gene locus_tag LOCUS_14640 25505 25723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14640 26606 25896 gene locus_tag LOCUS_14650 26606 25896 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815204.1 protein_id gnl|my_center|LOCUS_14650 27377 26610 gene locus_tag LOCUS_14660 27377 26610 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680286.1 protein_id gnl|my_center|LOCUS_14660 28365 27370 gene locus_tag LOCUS_14670 28365 27370 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002674209.1 protein_id gnl|my_center|LOCUS_14670 29261 28383 gene locus_tag LOCUS_14680 29261 28383 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680288.1 protein_id gnl|my_center|LOCUS_14680 30559 29336 gene locus_tag LOCUS_14690 30559 29336 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002674234.1 protein_id gnl|my_center|LOCUS_14690 31677 30793 gene locus_tag LOCUS_14700 31677 30793 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861195.1 protein_id gnl|my_center|LOCUS_14700 32951 31674 gene locus_tag LOCUS_14710 32951 31674 CDS product L-serine ammonia-lyase, iron-sulfur-dependent, subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679977.1 protein_id gnl|my_center|LOCUS_14710 34038 32977 gene locus_tag LOCUS_14720 34038 32977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14720 34860 34060 gene locus_tag LOCUS_14730 34860 34060 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860631.1 protein_id gnl|my_center|LOCUS_14730 36104 34923 gene locus_tag LOCUS_14740 36104 34923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14740 37176 36115 gene locus_tag LOCUS_14750 37176 36115 CDS product aldose 1-epimerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_094661859.1 protein_id gnl|my_center|LOCUS_14750 38142 37384 gene locus_tag LOCUS_14760 gene phnF 38142 37384 CDS product phosphonate metabolism transcriptional regulator PhnF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002194085.1 protein_id gnl|my_center|LOCUS_14760 38678 38932 gene locus_tag LOCUS_14770 38678 38932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14770 39729 39016 gene locus_tag LOCUS_14780 39729 39016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14780 40165 40264 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence025 1071 2276 gene locus_tag LOCUS_14790 1071 2276 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000908499.1 protein_id gnl|my_center|LOCUS_14790 3773 2331 gene locus_tag LOCUS_14800 3773 2331 CDS product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358530.1 protein_id gnl|my_center|LOCUS_14800 5144 3786 gene locus_tag LOCUS_14810 gene trkA 5144 3786 CDS product Trk system potassium transporter TrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948929.1 protein_id gnl|my_center|LOCUS_14810 6511 5192 gene locus_tag LOCUS_14820 6511 5192 CDS product thymidine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034349496.1 protein_id gnl|my_center|LOCUS_14820 7584 6667 gene locus_tag LOCUS_14830 7584 6667 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459548.1 protein_id gnl|my_center|LOCUS_14830 8755 7586 gene locus_tag LOCUS_14840 8755 7586 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814424.1 protein_id gnl|my_center|LOCUS_14840 10294 8762 gene locus_tag LOCUS_14850 10294 8762 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459549.1 protein_id gnl|my_center|LOCUS_14850 11708 10533 gene locus_tag LOCUS_14860 11708 10533 CDS product BMP family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459550.1 protein_id gnl|my_center|LOCUS_14860 12359 11910 gene locus_tag LOCUS_14870 12359 11910 CDS product cytidine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964852.1 protein_id gnl|my_center|LOCUS_14870 12816 12373 gene locus_tag LOCUS_14880 12816 12373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14880 12964 13230 gene locus_tag LOCUS_14890 12964 13230 CDS product type II toxin-antitoxin system RelB/DinJ family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004113434.1 protein_id gnl|my_center|LOCUS_14890 13231 13494 gene locus_tag LOCUS_14900 13231 13494 CDS product Txe/YoeB family addiction module toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813975.1 protein_id gnl|my_center|LOCUS_14900 14265 13546 gene locus_tag LOCUS_14910 gene deoD 14265 13546 CDS product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003020631.1 protein_id gnl|my_center|LOCUS_14910 16376 14490 gene locus_tag LOCUS_14920 16376 14490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14920 17424 16507 gene locus_tag LOCUS_14930 17424 16507 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640877.1 protein_id gnl|my_center|LOCUS_14930 18051 19985 gene locus_tag LOCUS_14940 18051 19985 CDS product NAD(+) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203175.1 protein_id gnl|my_center|LOCUS_14940 19989 20345 gene locus_tag LOCUS_14950 19989 20345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14950 20371 22077 gene locus_tag LOCUS_14960 20371 22077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14960 22637 22158 gene locus_tag LOCUS_14970 22637 22158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14970 23985 22807 gene locus_tag LOCUS_14980 23985 22807 CDS product phosphopentomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811028.1 protein_id gnl|my_center|LOCUS_14980 24321 26069 gene locus_tag LOCUS_14990 gene pyk 24321 26069 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436250.1 protein_id gnl|my_center|LOCUS_14990 26087 26386 gene locus_tag LOCUS_15000 26087 26386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_15000 26393 26539 gene locus_tag LOCUS_15010 26393 26539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15010 28152 26626 gene locus_tag LOCUS_15020 gene gpmI 28152 26626 CDS product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948029.1 protein_id gnl|my_center|LOCUS_15020 29019 28249 gene locus_tag LOCUS_15030 gene tpiA 29019 28249 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948028.1 protein_id gnl|my_center|LOCUS_15030 30427 29219 gene locus_tag LOCUS_15040 30427 29219 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429565.1 protein_id gnl|my_center|LOCUS_15040 32143 30695 gene locus_tag LOCUS_15050 32143 30695 CDS product flippase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_128519551.1 protein_id gnl|my_center|LOCUS_15050 33127 32144 gene locus_tag LOCUS_15060 33127 32144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15060 34097 33141 gene locus_tag LOCUS_15070 34097 33141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15070 35257 34109 gene locus_tag LOCUS_15080 35257 34109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15080 36268 35270 gene locus_tag LOCUS_15090 36268 35270 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000446968.1 protein_id gnl|my_center|LOCUS_15090 37258 36284 gene locus_tag LOCUS_15100 37258 36284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15100 38377 37268 gene locus_tag LOCUS_15110 38377 37268 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_224434606.1 protein_id gnl|my_center|LOCUS_15110 39378 38374 gene locus_tag LOCUS_15120 39378 38374 CDS product N-acetyl-alpha-D-glucosaminyl-diphospho-ditrans,octacis-undecaprenol 4-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000999466.1 protein_id gnl|my_center|LOCUS_15120 <40328 39375 gene locus_tag LOCUS_15130 <40328 39375 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002936357.1:sugar transferase >Feature sequence026 395 1078 gene locus_tag LOCUS_15140 gene mtnN 395 1078 CDS product 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814409.1 protein_id gnl|my_center|LOCUS_15140 1535 1095 gene locus_tag LOCUS_15150 1535 1095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15150 2390 1596 gene locus_tag LOCUS_15160 2390 1596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15160 4127 2586 gene locus_tag LOCUS_15170 gene malQ 4127 2586 CDS product 4-alpha-glucanotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259705.1 protein_id gnl|my_center|LOCUS_15170 4252 5439 gene locus_tag LOCUS_15180 4252 5439 CDS product DHHA1 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258870.1 protein_id gnl|my_center|LOCUS_15180 5609 6361 gene locus_tag LOCUS_15190 gene trmB 5609 6361 CDS product tRNA (guanosine(46)-N7)-methyltransferase TrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003355768.1 protein_id gnl|my_center|LOCUS_15190 6363 7412 gene locus_tag LOCUS_15200 6363 7412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15200 7931 10168 gene locus_tag LOCUS_15210 7931 10168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15210 11662 10742 gene locus_tag LOCUS_15220 11662 10742 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203586.1 protein_id gnl|my_center|LOCUS_15220 11825 12601 gene locus_tag LOCUS_15230 11825 12601 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083383.1 protein_id gnl|my_center|LOCUS_15230 12670 13305 gene locus_tag LOCUS_15240 12670 13305 CDS product RpiB/LacA/LacB family sugar-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965894.1 protein_id gnl|my_center|LOCUS_15240 13398 13808 gene locus_tag LOCUS_15250 13398 13808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15250 14061 15803 gene locus_tag LOCUS_15260 14061 15803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15260 16042 17322 gene locus_tag LOCUS_15270 16042 17322 CDS product voltage-gated chloride channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387108.1 protein_id gnl|my_center|LOCUS_15270 17691 19481 gene locus_tag LOCUS_15280 gene thrS 17691 19481 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989741.1 protein_id gnl|my_center|LOCUS_15280 19935 19555 gene locus_tag LOCUS_15290 19935 19555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15290 21216 20155 gene locus_tag LOCUS_15300 gene trpS 21216 20155 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760790.1 protein_id gnl|my_center|LOCUS_15300 21160 21363 gene locus_tag LOCUS_15310 21160 21363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15310 21555 21479 gene locus_tag LOCUS_t00270 21555 21479 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 21671 21597 gene locus_tag LOCUS_t00280 21671 21597 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 22120 23724 gene locus_tag LOCUS_15320 gene pckA 22120 23724 CDS product phosphoenolpyruvate carboxykinase (ATP) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761973.1 protein_id gnl|my_center|LOCUS_15320 23895 24557 gene locus_tag LOCUS_15330 23895 24557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15330 26069 24657 gene locus_tag LOCUS_15340 26069 24657 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289668.1 protein_id gnl|my_center|LOCUS_15340 27921 26404 gene locus_tag LOCUS_15350 27921 26404 CDS product sodium/proline symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054550.1 protein_id gnl|my_center|LOCUS_15350 28143 28916 gene locus_tag LOCUS_15360 gene azlC 28143 28916 CDS product azaleucine resistance protein AzlC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009969035.1 protein_id gnl|my_center|LOCUS_15360 28913 29245 gene locus_tag LOCUS_15370 gene azlD 28913 29245 CDS product branched-chain amino acid transporter AzlD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245988.1 protein_id gnl|my_center|LOCUS_15370 30292 29285 gene locus_tag LOCUS_15380 gene ansA 30292 29285 CDS product asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399032.1 protein_id gnl|my_center|LOCUS_15380 30440 31294 gene locus_tag LOCUS_15390 30440 31294 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938750.1 protein_id gnl|my_center|LOCUS_15390 31812 31351 gene locus_tag LOCUS_15400 31812 31351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15400 32803 31841 gene locus_tag LOCUS_15410 32803 31841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15410 34055 32835 gene locus_tag LOCUS_15420 34055 32835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15420 >Feature sequence027 3368 117 gene locus_tag LOCUS_15430 gene carB 3368 117 CDS product carbamoyl-phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009892173.1 protein_id gnl|my_center|LOCUS_15430 4479 3370 gene locus_tag LOCUS_15440 gene carA 4479 3370 CDS product glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429883.1 protein_id gnl|my_center|LOCUS_15440 5107 4514 gene locus_tag LOCUS_15450 gene pyrE 5107 4514 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420885.1 protein_id gnl|my_center|LOCUS_15450 6171 5245 gene locus_tag LOCUS_15460 6171 5245 CDS product dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048207.1 protein_id gnl|my_center|LOCUS_15460 6944 6171 gene locus_tag LOCUS_15470 6944 6171 CDS product dihydroorotate dehydrogenase electron transfer subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965939.1 protein_id gnl|my_center|LOCUS_15470 7791 6925 gene locus_tag LOCUS_15480 gene pyrF 7791 6925 CDS product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965940.1 protein_id gnl|my_center|LOCUS_15480 9101 7911 gene locus_tag LOCUS_15490 9101 7911 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048209.1 protein_id gnl|my_center|LOCUS_15490 9512 9270 gene locus_tag LOCUS_15500 9512 9270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15500 9584 10255 gene locus_tag LOCUS_15510 gene cysE 9584 10255 CDS product serine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_069591551.1 protein_id gnl|my_center|LOCUS_15510 11144 10461 gene locus_tag LOCUS_15520 11144 10461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15520 11627 11208 gene locus_tag LOCUS_15530 11627 11208 CDS product DUF3842 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_054935469.1 protein_id gnl|my_center|LOCUS_15530 13015 11627 gene locus_tag LOCUS_15540 gene pepV 13015 11627 CDS product dipeptidase PepV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048281.1 protein_id gnl|my_center|LOCUS_15540 13623 13138 gene locus_tag LOCUS_15550 13623 13138 CDS product small multi-drug export protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948482.1 protein_id gnl|my_center|LOCUS_15550 14415 13663 gene locus_tag LOCUS_15560 14415 13663 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963545.1 protein_id gnl|my_center|LOCUS_15560 15803 14430 gene locus_tag LOCUS_15570 gene yeeO 15803 14430 CDS product toxic metabolite efflux MATE transporter YeeO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000943916.1 protein_id gnl|my_center|LOCUS_15570 16137 15958 gene locus_tag LOCUS_15580 16137 15958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15580 17481 16327 gene locus_tag LOCUS_15590 gene metK 17481 16327 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966140.1 protein_id gnl|my_center|LOCUS_15590 18486 17821 gene locus_tag LOCUS_15600 gene deoC 18486 17821 CDS product deoxyribose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439345.1 protein_id gnl|my_center|LOCUS_15600 18638 18501 gene locus_tag LOCUS_15610 18638 18501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15610 19322 18705 gene locus_tag LOCUS_15620 19322 18705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15620 21323 19413 gene locus_tag LOCUS_15630 21323 19413 CDS product bifunctional 4-hydroxy-3-methylbut-2-enyl diphosphate reductase/30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811135.1 protein_id gnl|my_center|LOCUS_15630 22026 21415 gene locus_tag LOCUS_15640 22026 21415 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228617.1 protein_id gnl|my_center|LOCUS_15640 22692 22027 gene locus_tag LOCUS_15650 gene cmk 22692 22027 CDS product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943242.1 protein_id gnl|my_center|LOCUS_15650 24103 22808 gene locus_tag LOCUS_15660 24103 22808 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229222.1 protein_id gnl|my_center|LOCUS_15660 25030 24239 gene locus_tag LOCUS_15670 25030 24239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15670 25877 25176 gene locus_tag LOCUS_15680 25877 25176 CDS product Bax inhibitor-1/YccA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970505.1 protein_id gnl|my_center|LOCUS_15680 25991 27073 gene locus_tag LOCUS_15690 gene hemW 25991 27073 CDS product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143078.1 protein_id gnl|my_center|LOCUS_15690 27778 27200 gene locus_tag LOCUS_15700 27778 27200 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944116.1 protein_id gnl|my_center|LOCUS_15700 28547 27771 gene locus_tag LOCUS_15710 28547 27771 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812246.1 protein_id gnl|my_center|LOCUS_15710 29636 28611 gene locus_tag LOCUS_15720 29636 28611 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812249.1 protein_id gnl|my_center|LOCUS_15720 29812 30492 gene locus_tag LOCUS_15730 29812 30492 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_022619212.1 protein_id gnl|my_center|LOCUS_15730 30513 31490 gene locus_tag LOCUS_15740 30513 31490 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096000.1 protein_id gnl|my_center|LOCUS_15740 31487 32071 gene locus_tag LOCUS_15750 31487 32071 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005803433.1 protein_id gnl|my_center|LOCUS_15750 <33753 32264 gene locus_tag LOCUS_15760 <33753 32264 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_201627021.1:elongation factor G >Feature sequence028 997 2430 gene locus_tag LOCUS_15770 gene uxaC 997 2430 CDS product glucuronate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964011.1 protein_id gnl|my_center|LOCUS_15770 2596 3321 gene locus_tag LOCUS_15780 2596 3321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15780 3430 4782 gene locus_tag LOCUS_15790 3430 4782 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109290.1 protein_id gnl|my_center|LOCUS_15790 5545 4838 gene locus_tag LOCUS_15800 5545 4838 CDS product LrgB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990639.1 protein_id gnl|my_center|LOCUS_15800 5954 5526 gene locus_tag LOCUS_15810 gene lrgA 5954 5526 CDS product antiholin-like murein hydrolase modulator LrgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399155.1 protein_id gnl|my_center|LOCUS_15810 7054 6119 gene locus_tag LOCUS_15820 7054 6119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15820 7946 7065 gene locus_tag LOCUS_15830 7946 7065 CDS product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963818.1 protein_id gnl|my_center|LOCUS_15830 8272 9387 gene locus_tag LOCUS_15840 8272 9387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15840 10663 9446 gene locus_tag LOCUS_15850 10663 9446 CDS product FtsW/RodA/SpoVE family cell cycle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674463.1 protein_id gnl|my_center|LOCUS_15850 10939 12141 gene locus_tag LOCUS_15860 10939 12141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15860 12326 12751 gene locus_tag LOCUS_15870 gene tsaE 12326 12751 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966123.1 protein_id gnl|my_center|LOCUS_15870 12748 13479 gene locus_tag LOCUS_15880 gene tsaB 12748 13479 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546261.1 protein_id gnl|my_center|LOCUS_15880 13488 13934 gene locus_tag LOCUS_15890 gene rpiB 13488 13934 CDS product ribose 5-phosphate isomerase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161952859.1 protein_id gnl|my_center|LOCUS_15890 13957 14583 gene locus_tag LOCUS_15900 gene upp 13957 14583 CDS product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966163.1 protein_id gnl|my_center|LOCUS_15900 15673 14654 gene locus_tag LOCUS_15910 15673 14654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15910 16431 15670 gene locus_tag LOCUS_15920 16431 15670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15920 17587 16433 gene locus_tag LOCUS_15930 17587 16433 CDS product toxic anion resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454642.1 protein_id gnl|my_center|LOCUS_15930 18342 17719 gene locus_tag LOCUS_15940 18342 17719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15940 19016 18528 gene locus_tag LOCUS_15950 19016 18528 CDS product DNA-deoxyinosine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390104.1 protein_id gnl|my_center|LOCUS_15950 19903 19013 gene locus_tag LOCUS_15960 19903 19013 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476527.1 protein_id gnl|my_center|LOCUS_15960 21036 20149 gene locus_tag LOCUS_15970 21036 20149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15970 22355 21282 gene locus_tag LOCUS_15980 gene leuB 22355 21282 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267364.1 protein_id gnl|my_center|LOCUS_15980 23019 22531 gene locus_tag LOCUS_15990 gene leuD 23019 22531 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868466.1 protein_id gnl|my_center|LOCUS_15990 24298 23039 gene locus_tag LOCUS_16000 gene leuC 24298 23039 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895941.1 protein_id gnl|my_center|LOCUS_16000 26147 24495 gene locus_tag LOCUS_16010 26147 24495 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461751.1 protein_id gnl|my_center|LOCUS_16010 26844 28670 gene locus_tag LOCUS_16020 gene ftsH 26844 28670 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272679.1 protein_id gnl|my_center|LOCUS_16020 28917 29546 gene locus_tag LOCUS_16030 28917 29546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16030 31664 29661 gene locus_tag LOCUS_16040 31664 29661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16040 31830 31573 gene locus_tag LOCUS_16050 31830 31573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16050 33048 32119 gene locus_tag LOCUS_16060 33048 32119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16060 >Feature sequence029 210 884 gene locus_tag LOCUS_16070 210 884 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392875.1 protein_id gnl|my_center|LOCUS_16070 885 1610 gene locus_tag LOCUS_16080 gene scpA 885 1610 CDS product segregation/condensation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001199758.1 protein_id gnl|my_center|LOCUS_16080 1607 2137 gene locus_tag LOCUS_16090 gene scpB 1607 2137 CDS product SMC-Scp complex subunit ScpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428258.1 protein_id gnl|my_center|LOCUS_16090 2134 2805 gene locus_tag LOCUS_16100 2134 2805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16100 2921 3319 gene locus_tag LOCUS_16110 gene ytfJ 2921 3319 CDS product GerW family sporulation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965359.1 protein_id gnl|my_center|LOCUS_16110 3539 4372 gene locus_tag LOCUS_16120 3539 4372 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460221.1 protein_id gnl|my_center|LOCUS_16120 4547 5866 gene locus_tag LOCUS_16130 4547 5866 CDS product acyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903114.1 protein_id gnl|my_center|LOCUS_16130 5931 6311 gene locus_tag LOCUS_16140 5931 6311 CDS product biotin/lipoyl-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_149793471.1 protein_id gnl|my_center|LOCUS_16140 6335 7738 gene locus_tag LOCUS_16150 gene oadA 6335 7738 CDS product sodium-extruding oxaloacetate decarboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870743.1 protein_id gnl|my_center|LOCUS_16150 8496 7822 gene locus_tag LOCUS_16160 8496 7822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16160 9241 8687 gene locus_tag LOCUS_16170 9241 8687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16170 9479 10357 gene locus_tag LOCUS_16180 9479 10357 CDS product YicC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965023.1 protein_id gnl|my_center|LOCUS_16180 10389 10658 gene locus_tag LOCUS_16190 10389 10658 CDS product DUF370 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003388626.1 protein_id gnl|my_center|LOCUS_16190 10663 11235 gene locus_tag LOCUS_16200 gene gmk 10663 11235 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460557.1 protein_id gnl|my_center|LOCUS_16200 11259 13520 gene locus_tag LOCUS_16210 gene priA 11259 13520 CDS product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047882.1 protein_id gnl|my_center|LOCUS_16210 13551 14087 gene locus_tag LOCUS_16220 gene def 13551 14087 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003431159.1 protein_id gnl|my_center|LOCUS_16220 14087 15007 gene locus_tag LOCUS_16230 gene fmt 14087 15007 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232070.1 protein_id gnl|my_center|LOCUS_16230 15007 16329 gene locus_tag LOCUS_16240 gene rsmB 15007 16329 CDS product 16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965032.1 protein_id gnl|my_center|LOCUS_16240 16369 17409 gene locus_tag LOCUS_16250 gene rlmN 16369 17409 CDS product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000626897.1 protein_id gnl|my_center|LOCUS_16250 17429 18178 gene locus_tag LOCUS_16260 17429 18178 CDS product Stp1/IreP family PP2C-type Ser/Thr phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003701707.1 protein_id gnl|my_center|LOCUS_16260 18171 20027 gene locus_tag LOCUS_16270 gene pknB 18171 20027 CDS product Stk1 family PASTA domain-containing Ser/Thr kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_087065956.1 protein_id gnl|my_center|LOCUS_16270 20039 20917 gene locus_tag LOCUS_16280 gene rsgA 20039 20917 CDS product ribosome small subunit-dependent GTPase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001113935.1 protein_id gnl|my_center|LOCUS_16280 20917 21576 gene locus_tag LOCUS_16290 20917 21576 CDS product thiamine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389681.1 protein_id gnl|my_center|LOCUS_16290 23326 21764 gene locus_tag LOCUS_16300 23326 21764 CDS product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643972.1 protein_id gnl|my_center|LOCUS_16300 23531 24934 gene locus_tag LOCUS_16310 gene murD 23531 24934 CDS product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048369.1 protein_id gnl|my_center|LOCUS_16310 25012 25692 gene locus_tag LOCUS_16320 25012 25692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16320 25853 27115 gene locus_tag LOCUS_16330 25853 27115 CDS product methionine gamma-lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986378.1 protein_id gnl|my_center|LOCUS_16330 27143 28459 gene locus_tag LOCUS_16340 27143 28459 CDS product C1 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010714165.1 protein_id gnl|my_center|LOCUS_16340 30054 28516 gene locus_tag LOCUS_16350 30054 28516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16350 30167 30868 gene locus_tag LOCUS_16360 30167 30868 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405200.1 protein_id gnl|my_center|LOCUS_16360 >Feature sequence030 3568 431 gene locus_tag LOCUS_16370 3568 431 CDS product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202280.1 protein_id gnl|my_center|LOCUS_16370 4607 3558 gene locus_tag LOCUS_16380 4607 3558 CDS product virulence RhuM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202293.1 protein_id gnl|my_center|LOCUS_16380 5480 4626 gene locus_tag LOCUS_16390 5480 4626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16390 7420 5480 gene locus_tag LOCUS_16400 7420 5480 CDS product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_211204934.1 protein_id gnl|my_center|LOCUS_16400 8069 7434 gene locus_tag LOCUS_16410 8069 7434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16410 8716 8066 gene locus_tag LOCUS_16420 8716 8066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16420 11966 8736 gene locus_tag LOCUS_16430 11966 8736 CDS product helicase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000401853.1 protein_id gnl|my_center|LOCUS_16430 13910 12270 gene locus_tag LOCUS_16440 gene groL 13910 12270 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435012.1 protein_id gnl|my_center|LOCUS_16440 14243 13959 gene locus_tag LOCUS_16450 14243 13959 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357350.1 protein_id gnl|my_center|LOCUS_16450 14491 14240 gene locus_tag LOCUS_16460 14491 14240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16460 15489 14500 gene locus_tag LOCUS_16470 15489 14500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16470 17941 15635 gene locus_tag LOCUS_16480 17941 15635 CDS product ATP-dependent Clp protease ATP-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141541.1 protein_id gnl|my_center|LOCUS_16480 18536 18276 gene locus_tag LOCUS_16490 18536 18276 CDS product TIGR03905 family TSCPD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761253.1 protein_id gnl|my_center|LOCUS_16490 18535 18861 gene locus_tag LOCUS_16500 18535 18861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16500 19631 18783 gene locus_tag LOCUS_16510 19631 18783 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223008.1 protein_id gnl|my_center|LOCUS_16510 22082 19806 gene locus_tag LOCUS_16520 22082 19806 CDS product hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704357.1 protein_id gnl|my_center|LOCUS_16520 23333 22134 gene locus_tag LOCUS_16530 23333 22134 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392817.1 protein_id gnl|my_center|LOCUS_16530 24275 23370 gene locus_tag LOCUS_16540 gene thrB 24275 23370 CDS product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392818.1 protein_id gnl|my_center|LOCUS_16540 25527 24292 gene locus_tag LOCUS_16550 25527 24292 CDS product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_196768329.1 protein_id gnl|my_center|LOCUS_16550 26000 25569 gene locus_tag LOCUS_16560 26000 25569 CDS product ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357848.1 protein_id gnl|my_center|LOCUS_16560 28775 26325 gene locus_tag LOCUS_16570 28775 26325 CDS product penicillin-binding protein 1A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965598.1 protein_id gnl|my_center|LOCUS_16570 29218 29607 gene locus_tag LOCUS_16580 29218 29607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16580 31446 29752 gene locus_tag LOCUS_16590 31446 29752 CDS product DAK2 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004440884.1 protein_id gnl|my_center|LOCUS_16590 >Feature sequence031 2121 544 gene locus_tag LOCUS_16600 gene hcp 2121 544 CDS product hydroxylamine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003433949.1 protein_id gnl|my_center|LOCUS_16600 3587 2235 gene locus_tag LOCUS_16610 gene gdhA 3587 2235 CDS product NADP-specific glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815054.1 protein_id gnl|my_center|LOCUS_16610 3991 3740 gene locus_tag LOCUS_16620 3991 3740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16620 4902 4069 gene locus_tag LOCUS_16630 4902 4069 CDS product Mrp/NBP35 family ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680483.1 protein_id gnl|my_center|LOCUS_16630 5080 6690 gene locus_tag LOCUS_16640 5080 6690 CDS product polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392657.1 protein_id gnl|my_center|LOCUS_16640 6808 8706 gene locus_tag LOCUS_16650 6808 8706 CDS product nucleoside-diphosphate sugar epimerase/dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048118.1 protein_id gnl|my_center|LOCUS_16650 8762 10057 gene locus_tag LOCUS_16660 8762 10057 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000856534.1 protein_id gnl|my_center|LOCUS_16660 10086 10484 gene locus_tag LOCUS_16670 10086 10484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16670 10630 10971 gene locus_tag LOCUS_16680 10630 10971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16680 11024 11098 gene locus_tag LOCUS_t00290 11024 11098 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 11225 11584 gene locus_tag LOCUS_16690 11225 11584 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461083.1 protein_id gnl|my_center|LOCUS_16690 11581 11862 gene locus_tag LOCUS_16700 11581 11862 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000147081.1 protein_id gnl|my_center|LOCUS_16700 12027 12737 gene locus_tag LOCUS_16710 gene pyrH 12027 12737 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003362575.1 protein_id gnl|my_center|LOCUS_16710 12825 13379 gene locus_tag LOCUS_16720 gene frr 12825 13379 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002985763.1 protein_id gnl|my_center|LOCUS_16720 13493 14206 gene locus_tag LOCUS_16730 13493 14206 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460415.1 protein_id gnl|my_center|LOCUS_16730 14237 15097 gene locus_tag LOCUS_16740 14237 15097 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434000.1 protein_id gnl|my_center|LOCUS_16740 15114 16265 gene locus_tag LOCUS_16750 15114 16265 CDS product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861463.1 protein_id gnl|my_center|LOCUS_16750 16275 17423 gene locus_tag LOCUS_16760 gene rseP 16275 17423 CDS product RIP metalloprotease RseP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006312540.1 protein_id gnl|my_center|LOCUS_16760 17443 18489 gene locus_tag LOCUS_16770 gene ispG 17443 18489 CDS product flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861462.1 protein_id gnl|my_center|LOCUS_16770 18512 19117 gene locus_tag LOCUS_16780 18512 19117 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000599739.1 protein_id gnl|my_center|LOCUS_16780 19132 23421 gene locus_tag LOCUS_16790 19132 23421 CDS product PolC-type DNA polymerase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986794.1 protein_id gnl|my_center|LOCUS_16790 25318 23534 gene locus_tag LOCUS_16800 25318 23534 CDS product Na/Pi cotransporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009898459.1 protein_id gnl|my_center|LOCUS_16800 25709 25587 gene locus_tag LOCUS_16810 25709 25587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16810 25892 26149 gene locus_tag LOCUS_16820 25892 26149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16820 26133 26495 gene locus_tag LOCUS_16830 26133 26495 CDS product toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682305.1 protein_id gnl|my_center|LOCUS_16830 26675 28150 gene locus_tag LOCUS_16840 26675 28150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16840 28988 28521 gene locus_tag LOCUS_16850 28988 28521 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009889129.1 protein_id gnl|my_center|LOCUS_16850 >Feature sequence032 867 388 gene locus_tag LOCUS_16860 867 388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16860 2572 908 gene locus_tag LOCUS_16870 2572 908 CDS product Na+/H+ antiporter NhaC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262192.1 protein_id gnl|my_center|LOCUS_16870 2575 2850 gene locus_tag LOCUS_16880 2575 2850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16880 3250 2864 gene locus_tag LOCUS_16890 3250 2864 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459934.1 protein_id gnl|my_center|LOCUS_16890 3513 3854 gene locus_tag LOCUS_16900 3513 3854 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437587.1 protein_id gnl|my_center|LOCUS_16900 3934 4155 gene locus_tag LOCUS_16910 3934 4155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16910 4480 6372 gene locus_tag LOCUS_16920 4480 6372 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000796568.1 protein_id gnl|my_center|LOCUS_16920 6539 8338 gene locus_tag LOCUS_16930 6539 8338 CDS product aminopeptidase P family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203603.1 protein_id gnl|my_center|LOCUS_16930 9339 8383 gene locus_tag LOCUS_16940 9339 8383 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228264.1 protein_id gnl|my_center|LOCUS_16940 9413 10135 gene locus_tag LOCUS_16950 9413 10135 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812913.1 protein_id gnl|my_center|LOCUS_16950 10847 10197 gene locus_tag LOCUS_16960 10847 10197 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390012.1 protein_id gnl|my_center|LOCUS_16960 10985 12157 gene locus_tag LOCUS_16970 10985 12157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16970 12154 13764 gene locus_tag LOCUS_16980 gene ptsP 12154 13764 CDS product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391192.1 protein_id gnl|my_center|LOCUS_16980 14557 13814 gene locus_tag LOCUS_16990 14557 13814 CDS product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964597.1 protein_id gnl|my_center|LOCUS_16990 15570 14653 gene locus_tag LOCUS_17000 gene prmA 15570 14653 CDS product 50S ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003385115.1 protein_id gnl|my_center|LOCUS_17000 15886 17358 gene locus_tag LOCUS_17010 gene nagE 15886 17358 CDS product N-acetylglucosamine-specific PTS transporter subunit IIBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005418270.1 protein_id gnl|my_center|LOCUS_17010 17558 18286 gene locus_tag LOCUS_17020 gene nagB 17558 18286 CDS product glucosamine-6-phosphate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868991.1 protein_id gnl|my_center|LOCUS_17020 18451 19578 gene locus_tag LOCUS_17030 gene nagA 18451 19578 CDS product N-acetylglucosamine-6-phosphate deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830343.1 protein_id gnl|my_center|LOCUS_17030 19575 20180 gene locus_tag LOCUS_17040 19575 20180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17040 20469 20984 gene locus_tag LOCUS_17050 20469 20984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17050 21198 22073 gene locus_tag LOCUS_17060 21198 22073 CDS product phosphate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454000.1 protein_id gnl|my_center|LOCUS_17060 22151 22993 gene locus_tag LOCUS_17070 gene pstC 22151 22993 CDS product phosphate ABC transporter permease subunit PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454007.1 protein_id gnl|my_center|LOCUS_17070 22986 23843 gene locus_tag LOCUS_17080 gene pstA 22986 23843 CDS product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003432350.1 protein_id gnl|my_center|LOCUS_17080 23985 24749 gene locus_tag LOCUS_17090 gene pstB 23985 24749 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000041121.1 protein_id gnl|my_center|LOCUS_17090 24763 25431 gene locus_tag LOCUS_17100 gene phoU 24763 25431 CDS product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922357.1 protein_id gnl|my_center|LOCUS_17100 25692 26069 gene locus_tag LOCUS_17110 25692 26069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17110 >Feature sequence033 3281 7816 gene locus_tag LOCUS_17120 gene gltB 3281 7816 CDS product glutamate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005807931.1 protein_id gnl|my_center|LOCUS_17120 7830 9308 gene locus_tag LOCUS_17130 7830 9308 CDS product glutamate synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330518.1 protein_id gnl|my_center|LOCUS_17130 9797 9462 gene locus_tag LOCUS_17140 9797 9462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17140 10056 9790 gene locus_tag LOCUS_17150 10056 9790 CDS product type II toxin-antitoxin system Phd/YefM family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272532.1 protein_id gnl|my_center|LOCUS_17150 11892 10168 gene locus_tag LOCUS_17160 11892 10168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17160 12305 12027 gene locus_tag LOCUS_17170 12305 12027 CDS product DUF4160 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015613391.1 protein_id gnl|my_center|LOCUS_17170 12564 12298 gene locus_tag LOCUS_17180 12564 12298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17180 13528 12791 gene locus_tag LOCUS_17190 13528 12791 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048090.1 protein_id gnl|my_center|LOCUS_17190 15251 13707 gene locus_tag LOCUS_17200 15251 13707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17200 15341 15496 gene locus_tag LOCUS_17210 15341 15496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17210 15971 15567 gene locus_tag LOCUS_17220 15971 15567 CDS product Mini-ribonuclease 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357282.1 protein_id gnl|my_center|LOCUS_17220 17428 16145 gene locus_tag LOCUS_17230 gene obgE 17428 16145 CDS product GTPase ObgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888921.1 protein_id gnl|my_center|LOCUS_17230 17861 17610 gene locus_tag LOCUS_17240 gene rpmA 17861 17610 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003222623.1 protein_id gnl|my_center|LOCUS_17240 18187 17876 gene locus_tag LOCUS_17250 gene rplU 18187 17876 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000270907.1 protein_id gnl|my_center|LOCUS_17250 19377 18319 gene locus_tag LOCUS_17260 19377 18319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17260 20693 19374 gene locus_tag LOCUS_17270 20693 19374 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732282.1 protein_id gnl|my_center|LOCUS_17270 21969 20686 gene locus_tag LOCUS_17280 21969 20686 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454972.1 protein_id gnl|my_center|LOCUS_17280 22801 21989 gene locus_tag LOCUS_17290 22801 21989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17290 23203 23024 gene locus_tag LOCUS_17300 23203 23024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17300 23873 23409 gene locus_tag LOCUS_17310 23873 23409 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013363085.1 protein_id gnl|my_center|LOCUS_17310 24193 25158 gene locus_tag LOCUS_17320 24193 25158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17320 25918 25199 gene locus_tag LOCUS_17330 25918 25199 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003433947.1 protein_id gnl|my_center|LOCUS_17330 26121 25921 gene locus_tag LOCUS_17340 26121 25921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17340 >Feature sequence034 205 17 gene locus_tag LOCUS_17350 205 17 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17350 1346 705 gene locus_tag LOCUS_17360 1346 705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17360 1684 1472 gene locus_tag LOCUS_17370 1684 1472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17370 2234 2434 gene locus_tag LOCUS_17380 2234 2434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17380 2495 5611 gene locus_tag LOCUS_17390 2495 5611 CDS product glycoside hydrolase family 2 TIM barrel-domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068233.1 protein_id gnl|my_center|LOCUS_17390 6744 5767 gene locus_tag LOCUS_17400 6744 5767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17400 6763 6972 gene locus_tag LOCUS_17410 6763 6972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17410 7005 8444 gene locus_tag LOCUS_17420 7005 8444 CDS product glycoside hydrolase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861817.1 protein_id gnl|my_center|LOCUS_17420 8515 10026 gene locus_tag LOCUS_17430 8515 10026 CDS product carboxylesterase/lipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_084146450.1 protein_id gnl|my_center|LOCUS_17430 10284 10592 gene locus_tag LOCUS_17440 10284 10592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17440 10642 13557 gene locus_tag LOCUS_17450 10642 13557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17450 13630 15693 gene locus_tag LOCUS_17460 13630 15693 CDS product YgiQ family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437073.1 protein_id gnl|my_center|LOCUS_17460 15666 16787 gene locus_tag LOCUS_17470 15666 16787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17470 18677 16851 gene locus_tag LOCUS_17480 gene uidA 18677 16851 CDS product beta-glucuronidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003648792.1 protein_id gnl|my_center|LOCUS_17480 19092 20480 gene locus_tag LOCUS_17490 19092 20480 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289668.1 protein_id gnl|my_center|LOCUS_17490 20612 21814 gene locus_tag LOCUS_17500 20612 21814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17500 21907 22161 gene locus_tag LOCUS_17510 21907 22161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17510 22197 23237 gene locus_tag LOCUS_17520 gene mglB 22197 23237 CDS product galactose/glucose ABC transporter substrate-binding protein MglB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707762.1 protein_id gnl|my_center|LOCUS_17520 23403 24944 gene locus_tag LOCUS_17530 gene mglA 23403 24944 CDS product galactose/methyl galactoside ABC transporter ATP-binding protein MglA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000255020.1 protein_id gnl|my_center|LOCUS_17530 >Feature sequence035 251 1198 gene locus_tag LOCUS_17540 251 1198 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583074.1 protein_id gnl|my_center|LOCUS_17540 1195 2310 gene locus_tag LOCUS_17550 1195 2310 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583075.1 protein_id gnl|my_center|LOCUS_17550 2307 3515 gene locus_tag LOCUS_17560 2307 3515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17560 3569 5161 gene locus_tag LOCUS_17570 3569 5161 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963828.1 protein_id gnl|my_center|LOCUS_17570 5261 5509 gene locus_tag LOCUS_17580 5261 5509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17580 5626 7743 gene locus_tag LOCUS_17590 gene rnr 5626 7743 CDS product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948032.1 protein_id gnl|my_center|LOCUS_17590 8133 9905 gene locus_tag LOCUS_17600 8133 9905 CDS product oleate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262036.1 protein_id gnl|my_center|LOCUS_17600 10233 12008 gene locus_tag LOCUS_17610 10233 12008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17610 12278 14632 gene locus_tag LOCUS_17620 12278 14632 CDS product glycoside hydrolase family 3 N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776044.1 protein_id gnl|my_center|LOCUS_17620 14815 14742 gene locus_tag LOCUS_t00300 14815 14742 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 15039 15320 gene locus_tag LOCUS_17630 15039 15320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17630 15473 15619 gene locus_tag LOCUS_17640 gene scfA 15473 15619 CDS product six-cysteine ranthipeptide SCIFF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009891067.1 protein_id gnl|my_center|LOCUS_17640 15688 17139 gene locus_tag LOCUS_17650 gene scfB 15688 17139 CDS product thioether cross-link-forming SCIFF peptide maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861666.1 protein_id gnl|my_center|LOCUS_17650 17140 18567 gene locus_tag LOCUS_17660 17140 18567 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391589.1 protein_id gnl|my_center|LOCUS_17660 18705 19871 gene locus_tag LOCUS_17670 18705 19871 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804836.1 protein_id gnl|my_center|LOCUS_17670 22525 19955 gene locus_tag LOCUS_17680 22525 19955 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680864.1 protein_id gnl|my_center|LOCUS_17680 22942 22562 gene locus_tag LOCUS_17690 22942 22562 CDS product metal-sensitive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813255.1 protein_id gnl|my_center|LOCUS_17690 23962 23126 gene locus_tag LOCUS_17700 23962 23126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17700 24727 23975 gene locus_tag LOCUS_17710 24727 23975 CDS product esterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529927.1 protein_id gnl|my_center|LOCUS_17710 24921 24745 gene locus_tag LOCUS_17720 24921 24745 CDS product DUF4250 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766883.1 protein_id gnl|my_center|LOCUS_17720 25177 24989 gene locus_tag LOCUS_17730 gene rpmB 25177 24989 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965040.1 protein_id gnl|my_center|LOCUS_17730 >Feature sequence036 236 33 gene locus_tag LOCUS_17740 236 33 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17740 881 1060 gene locus_tag LOCUS_17750 881 1060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17750 1967 1128 gene locus_tag LOCUS_17760 1967 1128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17760 3318 1978 gene locus_tag LOCUS_17770 3318 1978 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_088620334.1 protein_id gnl|my_center|LOCUS_17770 3562 3476 gene locus_tag LOCUS_t00310 3562 3476 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 3837 3763 gene locus_tag LOCUS_t00320 3837 3763 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 3920 3845 gene locus_tag LOCUS_t00330 3920 3845 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 4599 4063 gene locus_tag LOCUS_17780 4599 4063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17780 5175 4612 gene locus_tag LOCUS_17790 5175 4612 CDS product DUF1643 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263212.1 protein_id gnl|my_center|LOCUS_17790 5366 7291 gene locus_tag LOCUS_17800 5366 7291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17800 7321 7983 gene locus_tag LOCUS_17810 7321 7983 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583630.1 protein_id gnl|my_center|LOCUS_17810 8001 9497 gene locus_tag LOCUS_17820 8001 9497 CDS product carboxypeptidase M32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016113.1 protein_id gnl|my_center|LOCUS_17820 10932 9691 gene locus_tag LOCUS_17830 gene hisS 10932 9691 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767712.1 protein_id gnl|my_center|LOCUS_17830 11192 12412 gene locus_tag LOCUS_17840 11192 12412 CDS product OFA family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877874.1 protein_id gnl|my_center|LOCUS_17840 12517 12741 gene locus_tag LOCUS_17850 12517 12741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17850 12689 13390 gene locus_tag LOCUS_17860 12689 13390 CDS product iron-sulfur cluster assembly scaffold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005780363.1 protein_id gnl|my_center|LOCUS_17860 13408 14406 gene locus_tag LOCUS_17870 13408 14406 CDS product GGGtGRT protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965854.1 protein_id gnl|my_center|LOCUS_17870 14532 16451 gene locus_tag LOCUS_17880 14532 16451 CDS product flavocytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272522.1 protein_id gnl|my_center|LOCUS_17880 16448 16810 gene locus_tag LOCUS_17890 16448 16810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17890 17278 16874 gene locus_tag LOCUS_17900 17278 16874 CDS product DUF1284 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966724.1 protein_id gnl|my_center|LOCUS_17900 17826 17275 gene locus_tag LOCUS_17910 17826 17275 CDS product biotin transporter BioY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080866.1 protein_id gnl|my_center|LOCUS_17910 18066 19703 gene locus_tag LOCUS_17920 18066 19703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17920 19716 20465 gene locus_tag LOCUS_17930 19716 20465 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481692.1 protein_id gnl|my_center|LOCUS_17930 20462 21667 gene locus_tag LOCUS_17940 20462 21667 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963643.1 protein_id gnl|my_center|LOCUS_17940 21874 24057 gene locus_tag LOCUS_17950 21874 24057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17950 >Feature sequence037 <1 522 gene locus_tag LOCUS_17960 <1 522 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005814304.1:response regulator transcription factor 604 2025 gene locus_tag LOCUS_17970 604 2025 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814305.1 protein_id gnl|my_center|LOCUS_17970 2107 3054 gene locus_tag LOCUS_17980 2107 3054 CDS product DUF1385 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966170.1 protein_id gnl|my_center|LOCUS_17980 3048 3899 gene locus_tag LOCUS_17990 gene prmC 3048 3899 CDS product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943724.1 protein_id gnl|my_center|LOCUS_17990 4026 5207 gene locus_tag LOCUS_18000 gene recA 4026 5207 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965121.1 protein_id gnl|my_center|LOCUS_18000 5208 5723 gene locus_tag LOCUS_18010 5208 5723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18010 5838 7163 gene locus_tag LOCUS_18020 gene rimO 5838 7163 CDS product 30S ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861176.1 protein_id gnl|my_center|LOCUS_18020 7182 7772 gene locus_tag LOCUS_18030 gene pgsA 7182 7772 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001052967.1 protein_id gnl|my_center|LOCUS_18030 7769 8431 gene locus_tag LOCUS_18040 7769 8431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18040 9499 8486 gene locus_tag LOCUS_18050 gene asnA 9499 8486 CDS product aspartate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949062.1 protein_id gnl|my_center|LOCUS_18050 10004 9636 gene locus_tag LOCUS_18060 10004 9636 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812106.1 protein_id gnl|my_center|LOCUS_18060 10195 11955 gene locus_tag LOCUS_18070 10195 11955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18070 12286 13857 gene locus_tag LOCUS_18080 gene rny 12286 13857 CDS product ribonuclease Y inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812942.1 protein_id gnl|my_center|LOCUS_18080 14390 16096 gene locus_tag LOCUS_18090 14390 16096 CDS product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000823441.1 protein_id gnl|my_center|LOCUS_18090 16231 17166 gene locus_tag LOCUS_18100 16231 17166 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000534165.1 protein_id gnl|my_center|LOCUS_18100 17168 18271 gene locus_tag LOCUS_18110 17168 18271 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000974106.1 protein_id gnl|my_center|LOCUS_18110 18285 19382 gene locus_tag LOCUS_18120 18285 19382 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722316.1 protein_id gnl|my_center|LOCUS_18120 19383 20315 gene locus_tag LOCUS_18130 gene opp1F 19383 20315 CDS product oligopeptide ABC transporter ATP-binding protein Opp1F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355795.1 protein_id gnl|my_center|LOCUS_18130 20882 20397 gene locus_tag LOCUS_18140 20882 20397 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003385459.1 protein_id gnl|my_center|LOCUS_18140 22595 21273 gene locus_tag LOCUS_18150 22595 21273 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682237.1 protein_id gnl|my_center|LOCUS_18150 22985 22740 gene locus_tag LOCUS_18160 22985 22740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18160 23712 23269 gene locus_tag LOCUS_18170 23712 23269 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_124797437.1 protein_id gnl|my_center|LOCUS_18170 23908 23738 gene locus_tag LOCUS_18180 23908 23738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003427864.1 protein_id gnl|my_center|LOCUS_18180 >Feature sequence038 868 479 gene locus_tag LOCUS_18190 868 479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18190 1527 901 gene locus_tag LOCUS_18200 1527 901 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287965.1 protein_id gnl|my_center|LOCUS_18200 2315 1545 gene locus_tag LOCUS_18210 2315 1545 CDS product EFR1 family ferrodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861832.1 protein_id gnl|my_center|LOCUS_18210 2559 2374 gene locus_tag LOCUS_18220 2559 2374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18220 2799 2590 gene locus_tag LOCUS_18230 2799 2590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18230 3134 2892 gene locus_tag LOCUS_18240 3134 2892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18240 3337 3990 gene locus_tag LOCUS_18250 3337 3990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18250 4200 4763 gene locus_tag LOCUS_18260 4200 4763 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460044.1 protein_id gnl|my_center|LOCUS_18260 4760 7141 gene locus_tag LOCUS_18270 4760 7141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18270 7132 8517 gene locus_tag LOCUS_18280 gene melB 7132 8517 CDS product melibiose:sodium transporter MelB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032709637.1 protein_id gnl|my_center|LOCUS_18280 8510 10111 gene locus_tag LOCUS_18290 8510 10111 CDS product alpha-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001201677.1 protein_id gnl|my_center|LOCUS_18290 11056 10253 gene locus_tag LOCUS_18300 11056 10253 CDS product ADP-ribosylglycohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005679031.1 protein_id gnl|my_center|LOCUS_18300 11496 11146 gene locus_tag LOCUS_18310 11496 11146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18310 11720 11496 gene locus_tag LOCUS_18320 11720 11496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18320 12267 11746 gene locus_tag LOCUS_18330 12267 11746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_18330 13470 12745 gene locus_tag LOCUS_18340 13470 12745 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009994066.1 protein_id gnl|my_center|LOCUS_18340 13800 13588 gene locus_tag LOCUS_18350 13800 13588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18350 14396 13899 gene locus_tag LOCUS_18360 14396 13899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18360 15882 14377 gene locus_tag LOCUS_18370 15882 14377 CDS product Y-family DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007057658.1 protein_id gnl|my_center|LOCUS_18370 18484 16409 gene locus_tag LOCUS_18380 gene ptsG 18484 16409 CDS product glucose-specific PTS transporter subunit IIBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948935.1 protein_id gnl|my_center|LOCUS_18380 19421 18573 gene locus_tag LOCUS_18390 19421 18573 CDS product PRD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948570.1 protein_id gnl|my_center|LOCUS_18390 19788 20588 gene locus_tag LOCUS_18400 19788 20588 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681896.1 protein_id gnl|my_center|LOCUS_18400 21008 20652 gene locus_tag LOCUS_18410 21008 20652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18410 21336 21677 gene locus_tag LOCUS_18420 21336 21677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18420 22876 21800 gene locus_tag LOCUS_18430 22876 21800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18430 >Feature sequence039 689 2860 gene locus_tag LOCUS_18440 gene nrdD 689 2860 CDS product anaerobic ribonucleoside-triphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905257.1 protein_id gnl|my_center|LOCUS_18440 2860 3411 gene locus_tag LOCUS_18450 gene nrdG 2860 3411 CDS product anaerobic ribonucleoside-triphosphate reductase activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905258.1 protein_id gnl|my_center|LOCUS_18450 3425 4405 gene locus_tag LOCUS_18460 3425 4405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18460 6175 4595 gene locus_tag LOCUS_18470 6175 4595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18470 6436 7464 gene locus_tag LOCUS_18480 6436 7464 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964797.1 protein_id gnl|my_center|LOCUS_18480 7538 8833 gene locus_tag LOCUS_18490 7538 8833 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987056.1 protein_id gnl|my_center|LOCUS_18490 11235 8932 gene locus_tag LOCUS_18500 11235 8932 CDS product ATP-dependent Clp protease ATP-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964222.1 protein_id gnl|my_center|LOCUS_18500 11954 11259 gene locus_tag LOCUS_18510 11954 11259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18510 13343 12141 gene locus_tag LOCUS_18520 13343 12141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18520 14089 13340 gene locus_tag LOCUS_18530 gene truA 14089 13340 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048349.1 protein_id gnl|my_center|LOCUS_18530 15008 14193 gene locus_tag LOCUS_18540 15008 14193 CDS product energy-coupling factor transporter transmembrane protein EcfT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357319.1 protein_id gnl|my_center|LOCUS_18540 15922 15002 gene locus_tag LOCUS_18550 15922 15002 CDS product energy-coupling factor transporter ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966382.1 protein_id gnl|my_center|LOCUS_18550 16777 15938 gene locus_tag LOCUS_18560 16777 15938 CDS product energy-coupling factor transporter ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435660.1 protein_id gnl|my_center|LOCUS_18560 17895 17020 gene locus_tag LOCUS_18570 17895 17020 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434910.1 protein_id gnl|my_center|LOCUS_18570 18980 17925 gene locus_tag LOCUS_18580 gene ruvB 18980 17925 CDS product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426579.1 protein_id gnl|my_center|LOCUS_18580 19592 18984 gene locus_tag LOCUS_18590 gene ruvA 19592 18984 CDS product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011174059.1 protein_id gnl|my_center|LOCUS_18590 20272 19769 gene locus_tag LOCUS_18600 gene ruvC 20272 19769 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810732.1 protein_id gnl|my_center|LOCUS_18600 20505 20580 gene locus_tag LOCUS_t00340 20505 20580 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 21018 21599 gene locus_tag LOCUS_18610 21018 21599 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000402394.1 protein_id gnl|my_center|LOCUS_18610 21643 21852 gene locus_tag LOCUS_18620 21643 21852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18620 22046 22291 gene locus_tag LOCUS_18630 22046 22291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18630 >Feature sequence040 192 791 gene locus_tag LOCUS_18640 192 791 CDS product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966126.1 protein_id gnl|my_center|LOCUS_18640 2256 850 gene locus_tag LOCUS_18650 2256 850 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202731.1 protein_id gnl|my_center|LOCUS_18650 2484 3428 gene locus_tag LOCUS_18660 2484 3428 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680111.1 protein_id gnl|my_center|LOCUS_18660 3654 4982 gene locus_tag LOCUS_18670 3654 4982 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013582535.1 protein_id gnl|my_center|LOCUS_18670 5545 5033 gene locus_tag LOCUS_18680 gene cobO 5545 5033 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867207.1 protein_id gnl|my_center|LOCUS_18680 6141 5545 gene locus_tag LOCUS_18690 6141 5545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18690 6275 6862 gene locus_tag LOCUS_18700 6275 6862 CDS product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393630.1 protein_id gnl|my_center|LOCUS_18700 6837 7460 gene locus_tag LOCUS_18710 6837 7460 CDS product cyclodeaminase/cyclohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026198967.1 protein_id gnl|my_center|LOCUS_18710 7473 8318 gene locus_tag LOCUS_18720 7473 8318 CDS product tetrahydrofolate dehydrogenase/cyclohydrolase catalytic domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009902122.1 protein_id gnl|my_center|LOCUS_18720 9106 8369 gene locus_tag LOCUS_18730 9106 8369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18730 11069 9315 gene locus_tag LOCUS_18740 11069 9315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18740 11989 11069 gene locus_tag LOCUS_18750 11989 11069 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434205.1 protein_id gnl|my_center|LOCUS_18750 12455 12697 gene locus_tag LOCUS_18760 12455 12697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18760 12925 13479 gene locus_tag LOCUS_18770 12925 13479 CDS product ECF-type riboflavin transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011921974.1 protein_id gnl|my_center|LOCUS_18770 13565 15286 gene locus_tag LOCUS_18780 13565 15286 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002380507.1 protein_id gnl|my_center|LOCUS_18780 15276 16106 gene locus_tag LOCUS_18790 15276 16106 CDS product energy-coupling factor transporter transmembrane component T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011921979.1 protein_id gnl|my_center|LOCUS_18790 18162 16210 gene locus_tag LOCUS_18800 18162 16210 CDS product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948830.1 protein_id gnl|my_center|LOCUS_18800 18100 18309 gene locus_tag LOCUS_18810 18100 18309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18810 18513 19130 gene locus_tag LOCUS_18820 18513 19130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18820 19523 19861 gene locus_tag LOCUS_18830 19523 19861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18830 20144 20881 gene locus_tag LOCUS_18840 20144 20881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18840 21072 21983 gene locus_tag LOCUS_18850 21072 21983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18850 >Feature sequence041 253 1335 gene locus_tag LOCUS_18860 253 1335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18860 3035 1392 gene locus_tag LOCUS_18870 3035 1392 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870027.1 protein_id gnl|my_center|LOCUS_18870 4771 3032 gene locus_tag LOCUS_18880 4771 3032 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530490.1 protein_id gnl|my_center|LOCUS_18880 5818 5048 gene locus_tag LOCUS_18890 5818 5048 CDS product TraX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986406.1 protein_id gnl|my_center|LOCUS_18890 6984 6346 gene locus_tag LOCUS_18900 6984 6346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18900 7216 7141 gene locus_tag LOCUS_t00350 7216 7141 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 7359 7733 gene locus_tag LOCUS_18910 7359 7733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18910 7742 8668 gene locus_tag LOCUS_18920 7742 8668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18920 8678 9649 gene locus_tag LOCUS_18930 8678 9649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18930 9667 11025 gene locus_tag LOCUS_18940 9667 11025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18940 12441 11113 gene locus_tag LOCUS_18950 12441 11113 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986486.1 protein_id gnl|my_center|LOCUS_18950 13403 12468 gene locus_tag LOCUS_18960 13403 12468 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234240.1 protein_id gnl|my_center|LOCUS_18960 13666 13917 gene locus_tag LOCUS_18970 13666 13917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18970 14388 14011 gene locus_tag LOCUS_18980 14388 14011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18980 14549 15538 gene locus_tag LOCUS_18990 14549 15538 CDS product nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294378.1 protein_id gnl|my_center|LOCUS_18990 16510 15656 gene locus_tag LOCUS_19000 16510 15656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19000 18584 16695 gene locus_tag LOCUS_19010 18584 16695 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257959.1 protein_id gnl|my_center|LOCUS_19010 20365 18581 gene locus_tag LOCUS_19020 20365 18581 CDS product ABC transporter transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000862474.1 protein_id gnl|my_center|LOCUS_19020 >Feature sequence042 <1 933 gene locus_tag LOCUS_19030 <1 933 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003700007.1:elongation factor Tu 1147 1779 gene locus_tag LOCUS_19040 1147 1779 CDS product GyrI-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548076.1 protein_id gnl|my_center|LOCUS_19040 1876 3426 gene locus_tag LOCUS_19050 gene guaA 1876 3426 CDS product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048241.1 protein_id gnl|my_center|LOCUS_19050 4210 3683 gene locus_tag LOCUS_19060 4210 3683 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964793.1 protein_id gnl|my_center|LOCUS_19060 4362 4691 gene locus_tag LOCUS_19070 4362 4691 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436216.1 protein_id gnl|my_center|LOCUS_19070 4982 5581 gene locus_tag LOCUS_19080 4982 5581 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678795.1 protein_id gnl|my_center|LOCUS_19080 5645 6223 gene locus_tag LOCUS_19090 5645 6223 CDS product chromate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016599.1 protein_id gnl|my_center|LOCUS_19090 6220 6792 gene locus_tag LOCUS_19100 6220 6792 CDS product chromate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789600.1 protein_id gnl|my_center|LOCUS_19100 7622 6822 gene locus_tag LOCUS_19110 gene thiD 7622 6822 CDS product bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966376.1 protein_id gnl|my_center|LOCUS_19110 7755 8294 gene locus_tag LOCUS_19120 7755 8294 CDS product TIGR00730 family Rossman fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000705809.1 protein_id gnl|my_center|LOCUS_19120 8368 9120 gene locus_tag LOCUS_19130 8368 9120 CDS product ZIP family metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948822.1 protein_id gnl|my_center|LOCUS_19130 9781 9164 gene locus_tag LOCUS_19140 9781 9164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19140 10806 9778 gene locus_tag LOCUS_19150 gene holA 10806 9778 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942847.1 protein_id gnl|my_center|LOCUS_19150 10974 12257 gene locus_tag LOCUS_19160 10974 12257 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054367.1 protein_id gnl|my_center|LOCUS_19160 12340 12930 gene locus_tag LOCUS_19170 12340 12930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19170 13752 12985 gene locus_tag LOCUS_19180 13752 12985 CDS product copper homeostasis protein CutC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460200.1 protein_id gnl|my_center|LOCUS_19180 15444 13945 gene locus_tag LOCUS_19190 gene galT 15444 13945 CDS product UDP-glucose--hexose-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966244.1 protein_id gnl|my_center|LOCUS_19190 16727 15441 gene locus_tag LOCUS_19200 gene galK 16727 15441 CDS product galactokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456582.1 protein_id gnl|my_center|LOCUS_19200 17982 16867 gene locus_tag LOCUS_19210 17982 16867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19210 <18627 18082 gene locus_tag LOCUS_19220 <18627 18082 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011986521.1:molecular chaperone HtpG >Feature sequence043 146 2206 gene locus_tag LOCUS_19230 gene recG 146 2206 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941980.1 protein_id gnl|my_center|LOCUS_19230 2828 2292 gene locus_tag LOCUS_19240 2828 2292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19240 3426 2917 gene locus_tag LOCUS_19250 3426 2917 CDS product transcription repressor NadR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356248.1 protein_id gnl|my_center|LOCUS_19250 4842 3484 gene locus_tag LOCUS_19260 4842 3484 CDS product alpha-amylase family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965974.1 protein_id gnl|my_center|LOCUS_19260 5039 6982 gene locus_tag LOCUS_19270 gene glgB 5039 6982 CDS product 1,4-alpha-glucan branching protein GlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001100880.1 protein_id gnl|my_center|LOCUS_19270 7123 9045 gene locus_tag LOCUS_19280 7123 9045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19280 9063 10043 gene locus_tag LOCUS_19290 9063 10043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19290 10048 11292 gene locus_tag LOCUS_19300 10048 11292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19300 11526 13559 gene locus_tag LOCUS_19310 11526 13559 CDS product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000748903.1 protein_id gnl|my_center|LOCUS_19310 13955 13653 gene locus_tag LOCUS_19320 13955 13653 CDS product Dabb family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016687.1 protein_id gnl|my_center|LOCUS_19320 14322 14026 gene locus_tag LOCUS_19330 14322 14026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19330 14912 14676 gene locus_tag LOCUS_19340 14912 14676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19340 15054 14866 gene locus_tag LOCUS_19350 15054 14866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19350 15494 16177 gene locus_tag LOCUS_19360 15494 16177 CDS product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966155.1 protein_id gnl|my_center|LOCUS_19360 16215 16439 gene locus_tag LOCUS_19370 16215 16439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19370 16457 16948 gene locus_tag LOCUS_19380 16457 16948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19380 >Feature sequence044 2766 22 gene locus_tag LOCUS_19390 2766 22 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19390 3546 4643 gene locus_tag LOCUS_19400 3546 4643 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012028292.1 protein_id gnl|my_center|LOCUS_19400 4661 5584 gene locus_tag LOCUS_19410 4661 5584 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461074.1 protein_id gnl|my_center|LOCUS_19410 5586 6410 gene locus_tag LOCUS_19420 5586 6410 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808997.1 protein_id gnl|my_center|LOCUS_19420 6489 6950 gene locus_tag LOCUS_19430 6489 6950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19430 7020 7301 gene locus_tag LOCUS_19440 7020 7301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19440 7291 7587 gene locus_tag LOCUS_19450 7291 7587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19450 7897 7664 gene locus_tag LOCUS_19460 7897 7664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19460 8846 8025 gene locus_tag LOCUS_19470 8846 8025 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947941.1 protein_id gnl|my_center|LOCUS_19470 9807 8848 gene locus_tag LOCUS_19480 9807 8848 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920869.1 protein_id gnl|my_center|LOCUS_19480 11811 9811 gene locus_tag LOCUS_19490 gene metG 11811 9811 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947939.1 protein_id gnl|my_center|LOCUS_19490 12148 12017 gene locus_tag LOCUS_19500 12148 12017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19500 13224 12502 gene locus_tag LOCUS_19510 gene treR 13224 12502 CDS product trehalose operon repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000987228.1 protein_id gnl|my_center|LOCUS_19510 13449 14864 gene locus_tag LOCUS_19520 gene treP 13449 14864 CDS product PTS system trehalose-specific EIIBC component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986523.1 protein_id gnl|my_center|LOCUS_19520 14883 16508 gene locus_tag LOCUS_19530 gene treC 14883 16508 CDS product alpha,alpha-phosphotrehalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986524.1 protein_id gnl|my_center|LOCUS_19530 >Feature sequence045 894 1373 gene locus_tag LOCUS_19540 894 1373 CDS product cytidine/deoxycytidylate deaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032889952.1 protein_id gnl|my_center|LOCUS_19540 1490 2488 gene locus_tag LOCUS_19550 gene argF 1490 2488 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095369.1 protein_id gnl|my_center|LOCUS_19550 2708 3280 gene locus_tag LOCUS_19560 2708 3280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19560 3384 3875 gene locus_tag LOCUS_19570 3384 3875 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459411.1 protein_id gnl|my_center|LOCUS_19570 3862 5028 gene locus_tag LOCUS_19580 3862 5028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19580 5118 5194 gene locus_tag LOCUS_t00360 5118 5194 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 6981 5323 gene locus_tag LOCUS_19590 gene ilvD 6981 5323 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393742.1 protein_id gnl|my_center|LOCUS_19590 8013 6994 gene locus_tag LOCUS_19600 gene ilvC 8013 6994 CDS product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938673.1 protein_id gnl|my_center|LOCUS_19600 8652 8089 gene locus_tag LOCUS_19610 gene ilvN 8652 8089 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023691.1 protein_id gnl|my_center|LOCUS_19610 10330 8666 gene locus_tag LOCUS_19620 gene ilvB 10330 8666 CDS product biosynthetic-type acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966446.1 protein_id gnl|my_center|LOCUS_19620 10662 11870 gene locus_tag LOCUS_19630 10662 11870 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966536.1 protein_id gnl|my_center|LOCUS_19630 13197 11992 gene locus_tag LOCUS_19640 gene ilvA 13197 11992 CDS product threonine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083156.1 protein_id gnl|my_center|LOCUS_19640 14226 13456 gene locus_tag LOCUS_19650 14226 13456 CDS product tRNA threonylcarbamoyladenosine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964226.1 protein_id gnl|my_center|LOCUS_19650 15432 14329 gene locus_tag LOCUS_19660 gene mnmA 15432 14329 CDS product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393152.1 protein_id gnl|my_center|LOCUS_19660 >Feature sequence046 2494 1334 gene locus_tag LOCUS_19670 2494 1334 CDS product glycoside hydrolase family 88 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003596395.1 protein_id gnl|my_center|LOCUS_19670 4266 2500 gene locus_tag LOCUS_19680 gene uidA 4266 2500 CDS product beta-glucuronidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775174.1 protein_id gnl|my_center|LOCUS_19680 5230 4370 gene locus_tag LOCUS_19690 5230 4370 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002383582.1 protein_id gnl|my_center|LOCUS_19690 6173 5247 gene locus_tag LOCUS_19700 6173 5247 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356840.1 protein_id gnl|my_center|LOCUS_19700 7670 6351 gene locus_tag LOCUS_19710 7670 6351 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002359868.1 protein_id gnl|my_center|LOCUS_19710 7573 7827 gene locus_tag LOCUS_19720 7573 7827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19720 8015 9832 gene locus_tag LOCUS_19730 8015 9832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19730 9807 11069 gene locus_tag LOCUS_19740 9807 11069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19740 11084 12880 gene locus_tag LOCUS_19750 11084 12880 CDS product heparinase II/III-family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201967.1 protein_id gnl|my_center|LOCUS_19750 12892 13686 gene locus_tag LOCUS_19760 12892 13686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002369000.1 protein_id gnl|my_center|LOCUS_19760 13688 15091 gene locus_tag LOCUS_19770 13688 15091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19770 >Feature sequence047 749 825 gene locus_tag LOCUS_t00370 749 825 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 1298 3655 gene locus_tag LOCUS_19780 1298 3655 CDS product peptidase domain-containing ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681955.1 protein_id gnl|my_center|LOCUS_19780 3767 4174 gene locus_tag LOCUS_19790 3767 4174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19790 4451 4550 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 4859 5224 gene locus_tag LOCUS_19800 4859 5224 CDS product endonuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942019.1 protein_id gnl|my_center|LOCUS_19800 5404 5859 gene locus_tag LOCUS_19810 5404 5859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19810 5861 6973 gene locus_tag LOCUS_19820 5861 6973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19820 7010 8512 gene locus_tag LOCUS_19830 7010 8512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19830 8876 8565 gene locus_tag LOCUS_19840 8876 8565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19840 9126 8866 gene locus_tag LOCUS_19850 9126 8866 CDS product type II toxin-antitoxin system Phd/YefM family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681231.1 protein_id gnl|my_center|LOCUS_19850 9271 10308 gene locus_tag LOCUS_19860 9271 10308 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000136824.1 protein_id gnl|my_center|LOCUS_19860 10308 10508 gene locus_tag LOCUS_19870 10308 10508 CDS product PTS ascorbate transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000796544.1 protein_id gnl|my_center|LOCUS_19870 11756 10656 gene locus_tag LOCUS_19880 11756 10656 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071622.1 protein_id gnl|my_center|LOCUS_19880 12175 11753 gene locus_tag LOCUS_19890 12175 11753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19890 13305 12292 gene locus_tag LOCUS_19900 gene aroF 13305 12292 CDS product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964210.1 protein_id gnl|my_center|LOCUS_19900 13517 13999 gene locus_tag LOCUS_19910 gene ybaK 13517 13999 CDS product Cys-tRNA(Pro) deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000710860.1 protein_id gnl|my_center|LOCUS_19910 14469 14969 gene locus_tag LOCUS_19920 gene purE 14469 14969 CDS product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704271.1 protein_id gnl|my_center|LOCUS_19920 >Feature sequence048 1115 498 gene locus_tag LOCUS_19930 1115 498 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460672.1 protein_id gnl|my_center|LOCUS_19930 1242 2993 gene locus_tag LOCUS_19940 1242 2993 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679279.1 protein_id gnl|my_center|LOCUS_19940 2986 4710 gene locus_tag LOCUS_19950 2986 4710 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679276.1 protein_id gnl|my_center|LOCUS_19950 5064 4768 gene locus_tag LOCUS_19960 5064 4768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19960 5454 5083 gene locus_tag LOCUS_19970 5454 5083 CDS product metal-dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964778.1 protein_id gnl|my_center|LOCUS_19970 7180 5471 gene locus_tag LOCUS_19980 7180 5471 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016528.1 protein_id gnl|my_center|LOCUS_19980 8937 7177 gene locus_tag LOCUS_19990 8937 7177 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949135.1 protein_id gnl|my_center|LOCUS_19990 10458 8941 gene locus_tag LOCUS_20000 10458 8941 CDS product energy-coupling factor ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461242.1 protein_id gnl|my_center|LOCUS_20000 11123 10455 gene locus_tag LOCUS_20010 11123 10455 CDS product energy-coupling factor transporter transmembrane component T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461241.1 protein_id gnl|my_center|LOCUS_20010 11788 11177 gene locus_tag LOCUS_20020 11788 11177 CDS product MptD family putative ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172641883.1 protein_id gnl|my_center|LOCUS_20020 11977 12939 gene locus_tag LOCUS_20030 11977 12939 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015943652.1 protein_id gnl|my_center|LOCUS_20030 <14641 13098 gene locus_tag LOCUS_20040 <14641 13098 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011462084.1:ABC transporter ATP-binding protein >Feature sequence049 <1 983 gene locus_tag LOCUS_20050 <1 983 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_101721463.1:FAD-dependent oxidoreductase 1544 1104 gene locus_tag LOCUS_20060 gene mgsA 1544 1104 CDS product methylglyoxal synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355823.1 protein_id gnl|my_center|LOCUS_20060 3206 1944 gene locus_tag LOCUS_20070 3206 1944 CDS product glutamate-5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836905.1 protein_id gnl|my_center|LOCUS_20070 3986 3210 gene locus_tag LOCUS_20080 gene proB 3986 3210 CDS product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723561.1 protein_id gnl|my_center|LOCUS_20080 4797 3991 gene locus_tag LOCUS_20090 gene proC 4797 3991 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000689692.1 protein_id gnl|my_center|LOCUS_20090 5107 5688 gene locus_tag LOCUS_20100 5107 5688 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002279620.1 protein_id gnl|my_center|LOCUS_20100 5837 7612 gene locus_tag LOCUS_20110 5837 7612 CDS product oleate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262036.1 protein_id gnl|my_center|LOCUS_20110 7685 9109 gene locus_tag LOCUS_20120 7685 9109 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393287.1 protein_id gnl|my_center|LOCUS_20120 9382 9206 gene locus_tag LOCUS_20130 9382 9206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20130 9556 9401 gene locus_tag LOCUS_20140 9556 9401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20140 10903 9692 gene locus_tag LOCUS_20150 10903 9692 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_132377852.1 protein_id gnl|my_center|LOCUS_20150 12301 10955 gene locus_tag LOCUS_20160 12301 10955 CDS product acetyl-CoA hydrolase/transferase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461055.1 protein_id gnl|my_center|LOCUS_20160 12675 13178 gene locus_tag LOCUS_20170 gene coaD 12675 13178 CDS product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245283.1 protein_id gnl|my_center|LOCUS_20170 >Feature sequence050 928 137 gene locus_tag LOCUS_20180 928 137 CDS product DUF4300 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680836.1 protein_id gnl|my_center|LOCUS_20180 1934 1188 gene locus_tag LOCUS_20190 1934 1188 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815081.1 protein_id gnl|my_center|LOCUS_20190 2445 2020 gene locus_tag LOCUS_20200 2445 2020 CDS product RNHCP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436247.1 protein_id gnl|my_center|LOCUS_20200 2735 3142 gene locus_tag LOCUS_20210 2735 3142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20210 3145 3348 gene locus_tag LOCUS_20220 3145 3348 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986143.1 protein_id gnl|my_center|LOCUS_20220 4070 3441 gene locus_tag LOCUS_20230 4070 3441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20230 4330 4950 gene locus_tag LOCUS_20240 4330 4950 CDS product YigZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249474.1 protein_id gnl|my_center|LOCUS_20240 5160 6158 gene locus_tag LOCUS_20250 5160 6158 CDS product deoxyguanosinetriphosphate triphosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392159.1 protein_id gnl|my_center|LOCUS_20250 6180 7955 gene locus_tag LOCUS_20260 gene dnaG 6180 7955 CDS product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009896376.1 protein_id gnl|my_center|LOCUS_20260 7997 9076 gene locus_tag LOCUS_20270 gene rpoD 7997 9076 CDS product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_054935954.1 protein_id gnl|my_center|LOCUS_20270 9519 13340 gene locus_tag LOCUS_20280 gene rpoB 9519 13340 CDS product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009966326.1 protein_id gnl|my_center|LOCUS_20280 >Feature sequence051 854 135 gene locus_tag LOCUS_20290 gene rpsB 854 135 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460417.1 protein_id gnl|my_center|LOCUS_20290 3009 1057 gene locus_tag LOCUS_20300 3009 1057 CDS product LTA synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000873616.1 protein_id gnl|my_center|LOCUS_20300 3437 3144 gene locus_tag LOCUS_20310 3437 3144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20310 3573 4187 gene locus_tag LOCUS_20320 3573 4187 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966844.1 protein_id gnl|my_center|LOCUS_20320 4417 4259 gene locus_tag LOCUS_20330 4417 4259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20330 4834 4475 gene locus_tag LOCUS_20340 4834 4475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20340 5350 4934 gene locus_tag LOCUS_20350 5350 4934 CDS product flavodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009902921.1 protein_id gnl|my_center|LOCUS_20350 6276 5512 gene locus_tag LOCUS_20360 6276 5512 CDS product heparan-alpha-glucosaminide N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458912.1 protein_id gnl|my_center|LOCUS_20360 6961 6410 gene locus_tag LOCUS_20370 6961 6410 CDS product NADH peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461089.1 protein_id gnl|my_center|LOCUS_20370 8457 7096 gene locus_tag LOCUS_20380 8457 7096 CDS product uracil-xanthine permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051618921.1 protein_id gnl|my_center|LOCUS_20380 8764 9891 gene locus_tag LOCUS_20390 8764 9891 CDS product cysteine desulfurase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830860.1 protein_id gnl|my_center|LOCUS_20390 9910 10764 gene locus_tag LOCUS_20400 9910 10764 CDS product tRNA 2-thiocytidine(32) synthetase TtcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416734.1 protein_id gnl|my_center|LOCUS_20400 10942 10859 gene locus_tag LOCUS_t00380 10942 10859 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 12640 11123 gene locus_tag LOCUS_20410 12640 11123 CDS product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965086.1 protein_id gnl|my_center|LOCUS_20410 >Feature sequence052 2265 184 gene locus_tag LOCUS_20420 gene vanT 2265 184 CDS product serine racemase VanT catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009893196.1 protein_id gnl|my_center|LOCUS_20420 3004 2252 gene locus_tag LOCUS_20430 3004 2252 CDS product M15 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436406.1 protein_id gnl|my_center|LOCUS_20430 4041 3001 gene locus_tag LOCUS_20440 gene vanG 4041 3001 CDS product D-alanine--D-serine ligase VanG-Cd inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861276.1 protein_id gnl|my_center|LOCUS_20440 5240 4173 gene locus_tag LOCUS_20450 5240 4173 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021367800.1 protein_id gnl|my_center|LOCUS_20450 5967 5272 gene locus_tag LOCUS_20460 gene vanR 5967 5272 CDS product vancomycin resistance response regulator transcriptoin factor VanR-G-Cd inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436401.1 protein_id gnl|my_center|LOCUS_20460 7024 6113 gene locus_tag LOCUS_20470 7024 6113 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964148.1 protein_id gnl|my_center|LOCUS_20470 7760 7014 gene locus_tag LOCUS_20480 7760 7014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20480 8330 7791 gene locus_tag LOCUS_20490 8330 7791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20490 8550 9626 gene locus_tag LOCUS_20500 8550 9626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20500 9828 10139 gene locus_tag LOCUS_20510 9828 10139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20510 10143 11609 gene locus_tag LOCUS_20520 10143 11609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20520 11660 11926 gene locus_tag LOCUS_20530 11660 11926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20530 >Feature sequence053 <1 845 gene locus_tag LOCUS_20540 <1 845 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002368703.1:relaxase/mobilization nuclease domain-containing protein 858 1742 gene locus_tag LOCUS_20550 858 1742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20550 1886 2194 gene locus_tag LOCUS_20560 1886 2194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20560 3602 2166 gene locus_tag LOCUS_20570 3602 2166 CDS product glycoside hydrolase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861817.1 protein_id gnl|my_center|LOCUS_20570 5596 3926 gene locus_tag LOCUS_20580 5596 3926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20580 7447 5780 gene locus_tag LOCUS_20590 7447 5780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20590 8491 7652 gene locus_tag LOCUS_20600 8491 7652 CDS product PRD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644019.1 protein_id gnl|my_center|LOCUS_20600 9121 8870 gene locus_tag LOCUS_20610 9121 8870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20610 9385 9299 gene locus_tag LOCUS_t00390 9385 9299 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 9606 9980 gene locus_tag LOCUS_20620 9606 9980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20620 9996 10931 gene locus_tag LOCUS_20630 9996 10931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20630 <11631 10975 gene locus_tag LOCUS_20640 <11631 10975 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010966555.1:ABC transporter ATP-binding protein >Feature sequence054 345 190 gene locus_tag LOCUS_20650 345 190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20650 669 1685 gene locus_tag LOCUS_20660 669 1685 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973786.1 protein_id gnl|my_center|LOCUS_20660 1746 3086 gene locus_tag LOCUS_20670 1746 3086 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013583013.1 protein_id gnl|my_center|LOCUS_20670 3183 4034 gene locus_tag LOCUS_20680 3183 4034 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052964.1 protein_id gnl|my_center|LOCUS_20680 4034 4876 gene locus_tag LOCUS_20690 4034 4876 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068636.1 protein_id gnl|my_center|LOCUS_20690 4890 6368 gene locus_tag LOCUS_20700 gene malQ 4890 6368 CDS product 4-alpha-glucanotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000747274.1 protein_id gnl|my_center|LOCUS_20700 6689 7135 gene locus_tag LOCUS_20710 6689 7135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20710 7160 7489 gene locus_tag LOCUS_20720 7160 7489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20720 8869 7577 gene locus_tag LOCUS_20730 gene galK 8869 7577 CDS product galactokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028786.1 protein_id gnl|my_center|LOCUS_20730 9094 9957 gene locus_tag LOCUS_20740 9094 9957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20740 >Feature sequence055 780 1145 gene locus_tag LOCUS_20750 780 1145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20750 1148 2644 gene locus_tag LOCUS_20760 1148 2644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20760 2785 2706 gene locus_tag LOCUS_t00400 2785 2706 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 3113 3592 gene locus_tag LOCUS_20770 3113 3592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20770 3778 4110 gene locus_tag LOCUS_20780 3778 4110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20780 4841 4242 gene locus_tag LOCUS_20790 4841 4242 CDS product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476271.1 protein_id gnl|my_center|LOCUS_20790 5927 4944 gene locus_tag LOCUS_20800 5927 4944 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000762189.1 protein_id gnl|my_center|LOCUS_20800 6839 5952 gene locus_tag LOCUS_20810 6839 5952 CDS product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723743.1 protein_id gnl|my_center|LOCUS_20810 7092 8288 gene locus_tag LOCUS_20820 gene coaBC 7092 8288 CDS product bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861611.1 protein_id gnl|my_center|LOCUS_20820 8494 9435 gene locus_tag LOCUS_20830 8494 9435 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722318.1 protein_id gnl|my_center|LOCUS_20830 9435 10466 gene locus_tag LOCUS_20840 9435 10466 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002893621.1 protein_id gnl|my_center|LOCUS_20840 >Feature sequence056 1217 102 gene locus_tag LOCUS_20850 gene nusA 1217 102 CDS product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231912.1 protein_id gnl|my_center|LOCUS_20850 1744 1253 gene locus_tag LOCUS_20860 gene rimP 1744 1253 CDS product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231915.1 protein_id gnl|my_center|LOCUS_20860 2398 1922 gene locus_tag LOCUS_20870 2398 1922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20870 3860 2619 gene locus_tag LOCUS_20880 3860 2619 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429165.1 protein_id gnl|my_center|LOCUS_20880 5414 3993 gene locus_tag LOCUS_20890 gene glyS 5414 3993 CDS product glycine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000287157.1 protein_id gnl|my_center|LOCUS_20890 6118 5633 gene locus_tag LOCUS_20900 gene rlmH 6118 5633 CDS product 23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003702726.1 protein_id gnl|my_center|LOCUS_20900 8579 6330 gene locus_tag LOCUS_20910 gene gyrA 8579 6330 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008632827.1 protein_id gnl|my_center|LOCUS_20910 10755 8764 gene locus_tag LOCUS_20920 gene gyrB 10755 8764 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080806.1 protein_id gnl|my_center|LOCUS_20920 >Feature sequence057 353 57 gene locus_tag LOCUS_20930 gene rplW 353 57 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435681.1 protein_id gnl|my_center|LOCUS_20930 976 353 gene locus_tag LOCUS_20940 gene rplD 976 353 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009887887.1 protein_id gnl|my_center|LOCUS_20940 1623 991 gene locus_tag LOCUS_20950 gene rplC 1623 991 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966412.1 protein_id gnl|my_center|LOCUS_20950 2032 1721 gene locus_tag LOCUS_20960 gene rpsJ 2032 1721 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003129973.1 protein_id gnl|my_center|LOCUS_20960 4374 2617 gene locus_tag LOCUS_20970 4374 2617 CDS product NFACT RNA binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861612.1 protein_id gnl|my_center|LOCUS_20970 5394 4618 gene locus_tag LOCUS_20980 5394 4618 CDS product Nif3-like dinuclear metal center hexameric protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047988.1 protein_id gnl|my_center|LOCUS_20980 6209 5538 gene locus_tag LOCUS_20990 6209 5538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20990 6464 6210 gene locus_tag LOCUS_21000 6464 6210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21000 6976 6689 gene locus_tag LOCUS_21010 6976 6689 CDS product zinc-ribbon domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815560.1 protein_id gnl|my_center|LOCUS_21010 8488 7292 gene locus_tag LOCUS_21020 8488 7292 CDS product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986808.1 protein_id gnl|my_center|LOCUS_21020 8693 9898 gene locus_tag LOCUS_21030 8693 9898 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009930700.1 protein_id gnl|my_center|LOCUS_21030 >Feature sequence058 679 1995 gene locus_tag LOCUS_21040 679 1995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21040 2077 3189 gene locus_tag LOCUS_21050 2077 3189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21050 3186 3650 gene locus_tag LOCUS_21060 3186 3650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21060 3659 4546 gene locus_tag LOCUS_21070 3659 4546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21070 4783 4616 gene locus_tag LOCUS_21080 4783 4616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21080 4969 4790 gene locus_tag LOCUS_21090 4969 4790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21090 5676 5416 gene locus_tag LOCUS_21100 5676 5416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21100 5895 6218 gene locus_tag LOCUS_21110 5895 6218 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026184004.1 protein_id gnl|my_center|LOCUS_21110 6215 6799 gene locus_tag LOCUS_21120 6215 6799 CDS product DUF2812 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459652.1 protein_id gnl|my_center|LOCUS_21120 7144 8070 gene locus_tag LOCUS_21130 7144 8070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21130 8119 8424 gene locus_tag LOCUS_21140 8119 8424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21140 9168 8416 gene locus_tag LOCUS_21150 9168 8416 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202637.1 protein_id gnl|my_center|LOCUS_21150 9707 9168 gene locus_tag LOCUS_21160 9707 9168 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020471.1 protein_id gnl|my_center|LOCUS_21160 9825 10121 gene locus_tag LOCUS_21170 9825 10121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_21170 10143 10292 gene locus_tag LOCUS_21180 10143 10292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21180 >Feature sequence059 2775 2851 gene locus_tag LOCUS_t00410 2775 2851 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 3020 3271 gene locus_tag LOCUS_21190 3020 3271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21190 4271 3405 gene locus_tag LOCUS_21200 4271 3405 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009909131.1 protein_id gnl|my_center|LOCUS_21200 4569 5846 gene locus_tag LOCUS_21210 4569 5846 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012774915.1 protein_id gnl|my_center|LOCUS_21210 5921 6754 gene locus_tag LOCUS_21220 5921 6754 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002939305.1 protein_id gnl|my_center|LOCUS_21220 6758 7594 gene locus_tag LOCUS_21230 6758 7594 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011921761.1 protein_id gnl|my_center|LOCUS_21230 7704 9962 gene locus_tag LOCUS_21240 7704 9962 CDS product alpha-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_111154492.1 protein_id gnl|my_center|LOCUS_21240 >Feature sequence060 1030 257 gene locus_tag LOCUS_21250 1030 257 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853290.1 protein_id gnl|my_center|LOCUS_21250 1535 1032 gene locus_tag LOCUS_21260 1535 1032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21260 2218 1505 gene locus_tag LOCUS_21270 2218 1505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21270 4076 2349 gene locus_tag LOCUS_21280 4076 2349 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_072772887.1 protein_id gnl|my_center|LOCUS_21280 5849 4080 gene locus_tag LOCUS_21290 5849 4080 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048173276.1 protein_id gnl|my_center|LOCUS_21290 6674 5919 gene locus_tag LOCUS_21300 6674 5919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21300 7725 6748 gene locus_tag LOCUS_21310 7725 6748 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015945452.1 protein_id gnl|my_center|LOCUS_21310 8084 7902 gene locus_tag LOCUS_21320 8084 7902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21320 8656 8177 gene locus_tag LOCUS_21330 8656 8177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21330 9405 8803 gene locus_tag LOCUS_21340 9405 8803 CDS product L-2-amino-thiazoline-4-carboxylic acid hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681208.1 protein_id gnl|my_center|LOCUS_21340 10044 9412 gene locus_tag LOCUS_21350 10044 9412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21350 >Feature sequence061 1849 851 gene locus_tag LOCUS_21360 1849 851 CDS product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434938.1 protein_id gnl|my_center|LOCUS_21360 3027 2029 gene locus_tag LOCUS_21370 3027 2029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21370 6383 3024 gene locus_tag LOCUS_21380 6383 3024 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272308.1 protein_id gnl|my_center|LOCUS_21380 9404 6591 gene locus_tag LOCUS_21390 9404 6591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21390 >Feature sequence062 4851 4471 gene locus_tag LOCUS_21400 4851 4471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21400 5718 5089 gene locus_tag LOCUS_21410 5718 5089 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259074.1 protein_id gnl|my_center|LOCUS_21410 6701 5715 gene locus_tag LOCUS_21420 6701 5715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21420 8293 6686 gene locus_tag LOCUS_21430 8293 6686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21430 8531 9214 gene locus_tag LOCUS_21440 8531 9214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21440 >Feature sequence063 719 102 gene locus_tag LOCUS_21450 gene udk 719 102 CDS product uridine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986880.1 protein_id gnl|my_center|LOCUS_21450 865 1482 gene locus_tag LOCUS_21460 865 1482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21460 1495 3114 gene locus_tag LOCUS_21470 gene cls 1495 3114 CDS product cardiolipin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262851.1 protein_id gnl|my_center|LOCUS_21470 4121 3183 gene locus_tag LOCUS_21480 4121 3183 CDS product nucleoside hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087473.1 protein_id gnl|my_center|LOCUS_21480 5113 4133 gene locus_tag LOCUS_21490 5113 4133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21490 6125 5256 gene locus_tag LOCUS_21500 6125 5256 CDS product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173361714.1 protein_id gnl|my_center|LOCUS_21500 6954 6280 gene locus_tag LOCUS_21510 6954 6280 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002666310.1 protein_id gnl|my_center|LOCUS_21510 8517 6967 gene locus_tag LOCUS_21520 8517 6967 CDS product DUF1538 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048012.1 protein_id gnl|my_center|LOCUS_21520 9298 8717 gene locus_tag LOCUS_21530 9298 8717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21530 >Feature sequence064 976 71 gene locus_tag LOCUS_21540 976 71 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480161.1 protein_id gnl|my_center|LOCUS_21540 1169 1813 gene locus_tag LOCUS_21550 1169 1813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21550 1951 2637 gene locus_tag LOCUS_21560 1951 2637 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289316.1 protein_id gnl|my_center|LOCUS_21560 2864 3964 gene locus_tag LOCUS_21570 gene uxuA 2864 3964 CDS product mannonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244855.1 protein_id gnl|my_center|LOCUS_21570 3973 5559 gene locus_tag LOCUS_21580 3973 5559 CDS product mannitol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_054937112.1 protein_id gnl|my_center|LOCUS_21580 5721 6650 gene locus_tag LOCUS_21590 5721 6650 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721732.1 protein_id gnl|my_center|LOCUS_21590 6704 6964 gene locus_tag LOCUS_21600 6704 6964 CDS product DUF4160 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808730.1 protein_id gnl|my_center|LOCUS_21600 6979 7275 gene locus_tag LOCUS_21610 6979 7275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21610 7406 7882 gene locus_tag LOCUS_21620 7406 7882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21620 7890 8393 gene locus_tag LOCUS_21630 7890 8393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905797.1 protein_id gnl|my_center|LOCUS_21630 <9048 8485 gene locus_tag LOCUS_21640 <9048 8485 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011391810.1:phosphopyruvate hydratase >Feature sequence065 634 71 gene locus_tag LOCUS_21650 634 71 CDS product chromate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763311.1 protein_id gnl|my_center|LOCUS_21650 1218 631 gene locus_tag LOCUS_21660 1218 631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21660 1365 2474 gene locus_tag LOCUS_21670 1365 2474 CDS product SPASM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002390206.1 protein_id gnl|my_center|LOCUS_21670 3634 2516 gene locus_tag LOCUS_21680 3634 2516 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287288.1 protein_id gnl|my_center|LOCUS_21680 5006 3651 gene locus_tag LOCUS_21690 5006 3651 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000828469.1 protein_id gnl|my_center|LOCUS_21690 6529 5021 gene locus_tag LOCUS_21700 6529 5021 CDS product tripartite tricarboxylate transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002724194.1 protein_id gnl|my_center|LOCUS_21700 7056 6541 gene locus_tag LOCUS_21710 7056 6541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21710 8112 7147 gene locus_tag LOCUS_21720 8112 7147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21720 >Feature sequence066 1932 1678 gene locus_tag LOCUS_21730 gene rpsO 1932 1678 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419491.1 protein_id gnl|my_center|LOCUS_21730 3000 2080 gene locus_tag LOCUS_21740 3000 2080 CDS product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965112.1 protein_id gnl|my_center|LOCUS_21740 3891 3007 gene locus_tag LOCUS_21750 gene truB 3891 3007 CDS product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766456.1 protein_id gnl|my_center|LOCUS_21750 4868 3891 gene locus_tag LOCUS_21760 4868 3891 CDS product bifunctional oligoribonuclease/PAP phosphatase NrnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965110.1 protein_id gnl|my_center|LOCUS_21760 5287 4898 gene locus_tag LOCUS_21770 gene rbfA 5287 4898 CDS product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460392.1 protein_id gnl|my_center|LOCUS_21770 7901 5424 gene locus_tag LOCUS_21780 7901 5424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21780 8275 7898 gene locus_tag LOCUS_21790 8275 7898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21790 >Feature sequence067 <1 1188 gene locus_tag LOCUS_21800 <1 1188 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012047942.1:amidophosphoribosyltransferase 1193 2239 gene locus_tag LOCUS_21810 gene purM 1193 2239 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813914.1 protein_id gnl|my_center|LOCUS_21810 2233 2829 gene locus_tag LOCUS_21820 gene purN 2233 2829 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964703.1 protein_id gnl|my_center|LOCUS_21820 3006 3806 gene locus_tag LOCUS_21830 3006 3806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21830 3831 5012 gene locus_tag LOCUS_21840 3831 5012 CDS product phosphoribosylaminoimidazolecarboxamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860970.1 protein_id gnl|my_center|LOCUS_21840 5216 6517 gene locus_tag LOCUS_21850 gene purD 5216 6517 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545691.1 protein_id gnl|my_center|LOCUS_21850 >Feature sequence068 1592 696 gene locus_tag LOCUS_21860 1592 696 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000059807.1 protein_id gnl|my_center|LOCUS_21860 1709 3100 gene locus_tag LOCUS_21870 1709 3100 CDS product sodium-dependent transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001088187.1 protein_id gnl|my_center|LOCUS_21870 3329 4300 gene locus_tag LOCUS_21880 3329 4300 CDS product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721396.1 protein_id gnl|my_center|LOCUS_21880 4366 5499 gene locus_tag LOCUS_21890 4366 5499 CDS product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004113569.1 protein_id gnl|my_center|LOCUS_21890 5714 5514 gene locus_tag LOCUS_21900 5714 5514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21900 6553 5711 gene locus_tag LOCUS_21910 6553 5711 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808284.1 protein_id gnl|my_center|LOCUS_21910 7253 6642 gene locus_tag LOCUS_21920 7253 6642 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767703.1 protein_id gnl|my_center|LOCUS_21920 >Feature sequence069 820 891 gene locus_tag LOCUS_t00420 820 891 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 968 2287 gene locus_tag LOCUS_21930 968 2287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21930 2520 2347 gene locus_tag LOCUS_21940 2520 2347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21940 4960 2582 gene locus_tag LOCUS_21950 4960 2582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21950 6028 4997 gene locus_tag LOCUS_21960 gene dusB 6028 4997 CDS product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434962.1 protein_id gnl|my_center|LOCUS_21960 6211 7362 gene locus_tag LOCUS_21970 6211 7362 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583054.1 protein_id gnl|my_center|LOCUS_21970 >Feature sequence070 1659 355 gene locus_tag LOCUS_21980 1659 355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21980 2300 1959 gene locus_tag LOCUS_21990 gene rplQ 2300 1959 CDS product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966384.1 protein_id gnl|my_center|LOCUS_21990 3283 2318 gene locus_tag LOCUS_22000 3283 2318 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003427733.1 protein_id gnl|my_center|LOCUS_22000 3996 3394 gene locus_tag LOCUS_22010 gene rpsD 3996 3394 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421121.1 protein_id gnl|my_center|LOCUS_22010 4427 4017 gene locus_tag LOCUS_22020 gene rpsK 4427 4017 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421122.1 protein_id gnl|my_center|LOCUS_22020 4813 4442 gene locus_tag LOCUS_22030 gene rpsM 4813 4442 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357564.1 protein_id gnl|my_center|LOCUS_22030 4839 5033 gene locus_tag LOCUS_22040 4839 5033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22040 5296 5045 gene locus_tag LOCUS_22050 gene infA 5296 5045 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357316.1 protein_id gnl|my_center|LOCUS_22050 6471 5680 gene locus_tag LOCUS_22060 gene map 6471 5680 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545375.1 protein_id gnl|my_center|LOCUS_22060 7106 6474 gene locus_tag LOCUS_22070 gene adk 7106 6474 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103583.1 protein_id gnl|my_center|LOCUS_22070 >Feature sequence071 1909 971 gene locus_tag LOCUS_22080 1909 971 CDS product ribonuclease Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014518928.1 protein_id gnl|my_center|LOCUS_22080 2023 2190 gene locus_tag LOCUS_22090 2023 2190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22090 4355 2253 gene locus_tag LOCUS_22100 4355 2253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22100 5122 5038 gene locus_tag LOCUS_t00430 5122 5038 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 6624 5236 gene locus_tag LOCUS_22110 6624 5236 CDS product amino acid carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016013.1 protein_id gnl|my_center|LOCUS_22110 >Feature sequence072 2905 1916 gene locus_tag LOCUS_22120 2905 1916 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812005.1 protein_id gnl|my_center|LOCUS_22120 3903 2905 gene locus_tag LOCUS_22130 3903 2905 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812003.1 protein_id gnl|my_center|LOCUS_22130 4972 3923 gene locus_tag LOCUS_22140 4972 3923 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812002.1 protein_id gnl|my_center|LOCUS_22140 5904 4987 gene locus_tag LOCUS_22150 5904 4987 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811999.1 protein_id gnl|my_center|LOCUS_22150 6293 6369 gene locus_tag LOCUS_t00440 6293 6369 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence073 300 1100 gene locus_tag LOCUS_22160 300 1100 CDS product gluconate 5-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762840.1 protein_id gnl|my_center|LOCUS_22160 1346 1822 gene locus_tag LOCUS_22170 1346 1822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22170 2636 1905 gene locus_tag LOCUS_22180 2636 1905 CDS product IS3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000866395.1 protein_id gnl|my_center|LOCUS_22180 3106 2750 gene locus_tag LOCUS_22190 3106 2750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22190 4104 3223 gene locus_tag LOCUS_22200 4104 3223 CDS product aldose epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920915.1 protein_id gnl|my_center|LOCUS_22200 5671 4181 gene locus_tag LOCUS_22210 5671 4181 CDS product altronate dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763047.1 protein_id gnl|my_center|LOCUS_22210 <6648 5758 gene locus_tag LOCUS_22220 <6648 5758 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010964014.1:tagaturonate reductase >Feature sequence074 240 1619 gene locus_tag LOCUS_22230 240 1619 CDS product Trk family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888508.1 protein_id gnl|my_center|LOCUS_22230 2916 1699 gene locus_tag LOCUS_22240 gene pepT 2916 1699 CDS product peptidase T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460034.1 protein_id gnl|my_center|LOCUS_22240 3482 3075 gene locus_tag LOCUS_22250 3482 3075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22250 4894 3482 gene locus_tag LOCUS_22260 gene atpD 4894 3482 CDS product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393855.1 protein_id gnl|my_center|LOCUS_22260 5842 4964 gene locus_tag LOCUS_22270 gene atpG 5842 4964 CDS product ATP synthase F1 subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437835.1 protein_id gnl|my_center|LOCUS_22270 <6464 5829 gene locus_tag LOCUS_22280 <6464 5829 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011393857.1:F0F1 ATP synthase subunit alpha >Feature sequence075 6100 2555 gene locus_tag LOCUS_22290 gene nifJ 6100 2555 CDS product pyruvate:ferredoxin (flavodoxin) oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987043.1 protein_id gnl|my_center|LOCUS_22290 >Feature sequence076 <1 1022 gene locus_tag LOCUS_22300 <1 1022 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010963681.1:glycoside hydrolase family 88 protein 3213 1303 gene locus_tag LOCUS_22310 3213 1303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22310 5320 3221 gene locus_tag LOCUS_22320 5320 3221 CDS product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930970.1 protein_id gnl|my_center|LOCUS_22320 5570 6172 gene locus_tag LOCUS_22330 5570 6172 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048232.1 protein_id gnl|my_center|LOCUS_22330 6240 6315 gene locus_tag LOCUS_t00450 6240 6315 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence077 1709 93 gene locus_tag LOCUS_22340 1709 93 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680024.1 protein_id gnl|my_center|LOCUS_22340 1935 2135 gene locus_tag LOCUS_22350 1935 2135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22350 2394 2200 gene locus_tag LOCUS_22360 2394 2200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22360 3251 2409 gene locus_tag LOCUS_22370 3251 2409 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012099498.1 protein_id gnl|my_center|LOCUS_22370 4042 3248 gene locus_tag LOCUS_22380 4042 3248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22380 4501 4115 gene locus_tag LOCUS_22390 4501 4115 CDS product cysteine-rich VLP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861105.1 protein_id gnl|my_center|LOCUS_22390 <6022 4491 gene locus_tag LOCUS_22400 <6022 4491 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002368703.1:relaxase/mobilization nuclease domain-containing protein >Feature sequence078 2 1399 gene locus_tag LOCUS_22410 2 1399 CDS product sodium/proline symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054550.1 protein_id gnl|my_center|LOCUS_22410 2198 1536 gene locus_tag LOCUS_22420 2198 1536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22420 3953 2349 gene locus_tag LOCUS_22430 gene pckA 3953 2349 CDS product phosphoenolpyruvate carboxykinase (ATP) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761973.1 protein_id gnl|my_center|LOCUS_22430 4465 5097 gene locus_tag LOCUS_22440 4465 5097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358943.1 protein_id gnl|my_center|LOCUS_22440 5186 5260 gene locus_tag LOCUS_t00460 5186 5260 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 5302 5378 gene locus_tag LOCUS_t00470 5302 5378 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence079 1151 138 gene locus_tag LOCUS_22450 gene asnA 1151 138 CDS product aspartate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949062.1 protein_id gnl|my_center|LOCUS_22450 2892 1594 gene locus_tag LOCUS_22460 gene eno 2892 1594 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357098.1 protein_id gnl|my_center|LOCUS_22460 3281 4702 gene locus_tag LOCUS_22470 3281 4702 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009931271.1 protein_id gnl|my_center|LOCUS_22470 >Feature sequence080 18 866 gene locus_tag LOCUS_22480 gene atpG 18 866 CDS product ATP synthase F1 subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437835.1 protein_id gnl|my_center|LOCUS_22480 884 2278 gene locus_tag LOCUS_22490 gene atpD 884 2278 CDS product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003425850.1 protein_id gnl|my_center|LOCUS_22490 2282 2680 gene locus_tag LOCUS_22500 2282 2680 CDS product F0F1 ATP synthase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227688.1 protein_id gnl|my_center|LOCUS_22500 2846 4186 gene locus_tag LOCUS_22510 2846 4186 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109290.1 protein_id gnl|my_center|LOCUS_22510 5002 4244 gene locus_tag LOCUS_22520 gene aroD 5002 4244 CDS product type I 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230523.1 protein_id gnl|my_center|LOCUS_22520 >Feature sequence081 621 1484 gene locus_tag LOCUS_22530 621 1484 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942649.1 protein_id gnl|my_center|LOCUS_22530 1486 2541 gene locus_tag LOCUS_22540 1486 2541 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942650.1 protein_id gnl|my_center|LOCUS_22540 2544 3293 gene locus_tag LOCUS_22550 2544 3293 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809682.1 protein_id gnl|my_center|LOCUS_22550 3286 3993 gene locus_tag LOCUS_22560 3286 3993 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942652.1 protein_id gnl|my_center|LOCUS_22560 4093 5376 gene locus_tag LOCUS_22570 4093 5376 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965775.1 protein_id gnl|my_center|LOCUS_22570 4110 4209 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence082 <1 738 gene locus_tag LOCUS_22580 <1 738 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011392595.1:ribonuclease Y 815 1369 gene locus_tag LOCUS_22590 815 1369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22590 1800 3497 gene locus_tag LOCUS_22600 1800 3497 CDS product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000823441.1 protein_id gnl|my_center|LOCUS_22600 3660 4595 gene locus_tag LOCUS_22610 3660 4595 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000534165.1 protein_id gnl|my_center|LOCUS_22610 >Feature sequence083 189 1689 gene locus_tag LOCUS_r00010 189 1689 rRNA product 16S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 2095 5054 gene locus_tag LOCUS_r00020 2095 5054 rRNA product 23S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 5214 5320 gene locus_tag LOCUS_r00030 5214 5320 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 >Feature sequence084 <1 2159 gene locus_tag LOCUS_22620 <1 2159 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011068298.1:phosphoribosylformylglycinamidine synthase 2300 3745 gene locus_tag LOCUS_22630 gene purB 2300 3745 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965127.1 protein_id gnl|my_center|LOCUS_22630 3941 4648 gene locus_tag LOCUS_22640 3941 4648 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041823010.1 protein_id gnl|my_center|LOCUS_22640 >Feature sequence085 1007 12 gene locus_tag LOCUS_22650 1007 12 CDS product 2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122039.1 protein_id gnl|my_center|LOCUS_22650 3082 1217 gene locus_tag LOCUS_22660 3082 1217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22660 2352 2451 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 4133 3282 gene locus_tag LOCUS_22670 4133 3282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22670 4624 4130 gene locus_tag LOCUS_22680 4624 4130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22680 >Feature sequence086 3825 3924 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence087 326 2815 gene locus_tag LOCUS_22690 326 2815 CDS product TraG family conjugative transposon ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107104.1 protein_id gnl|my_center|LOCUS_22690 2826 2925 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3278 4282 gene locus_tag LOCUS_22700 gene traJ 3278 4282 CDS product conjugative transposon protein TraJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107101.1 protein_id gnl|my_center|LOCUS_22700 4347 4955 gene locus_tag LOCUS_22710 gene traK 4347 4955 CDS product conjugative transposon protein TraK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004308760.1 protein_id gnl|my_center|LOCUS_22710 >Feature sequence088 24 1457 gene locus_tag LOCUS_22720 24 1457 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010818874.1 protein_id gnl|my_center|LOCUS_22720 1454 2575 gene locus_tag LOCUS_22730 1454 2575 CDS product SPASM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002390206.1 protein_id gnl|my_center|LOCUS_22730 2593 3159 gene locus_tag LOCUS_22740 2593 3159 CDS product chromate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948278.1 protein_id gnl|my_center|LOCUS_22740 3156 3722 gene locus_tag LOCUS_22750 3156 3722 CDS product chromate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763311.1 protein_id gnl|my_center|LOCUS_22750 >Feature sequence089 69 2159 gene locus_tag LOCUS_22760 69 2159 CDS product DNA topoisomerase 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002368714.1 protein_id gnl|my_center|LOCUS_22760 2159 3046 gene locus_tag LOCUS_22770 2159 3046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22770 3055 3570 gene locus_tag LOCUS_22780 3055 3570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22780 3560 3763 gene locus_tag LOCUS_22790 3560 3763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22790 3937 4284 gene locus_tag LOCUS_22800 3937 4284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22800 >Feature sequence090 1276 551 gene locus_tag LOCUS_22810 1276 551 CDS product DUF4366 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035394374.1 protein_id gnl|my_center|LOCUS_22810 1532 1266 gene locus_tag LOCUS_22820 1532 1266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22820 3279 1546 gene locus_tag LOCUS_22830 3279 1546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22830 <4580 3276 gene locus_tag LOCUS_22840 <4580 3276 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010773627.1:ATP-binding protein >Feature sequence091 49 1446 gene locus_tag LOCUS_22850 49 1446 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002894432.1 protein_id gnl|my_center|LOCUS_22850 1521 2447 gene locus_tag LOCUS_22860 1521 2447 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002898777.1 protein_id gnl|my_center|LOCUS_22860 2444 3274 gene locus_tag LOCUS_22870 2444 3274 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000730333.1 protein_id gnl|my_center|LOCUS_22870 3307 4416 gene locus_tag LOCUS_22880 3307 4416 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476671.1 protein_id gnl|my_center|LOCUS_22880 >Feature sequence092 341 1363 gene locus_tag LOCUS_22890 341 1363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22890 1492 2520 gene locus_tag LOCUS_22900 1492 2520 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942020.1 protein_id gnl|my_center|LOCUS_22900 3925 2561 gene locus_tag LOCUS_22910 3925 2561 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015727.1 protein_id gnl|my_center|LOCUS_22910 4086 4162 gene locus_tag LOCUS_t00480 4086 4162 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence093 2319 2418 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2789 4246 gene locus_tag LOCUS_22920 2789 4246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22920 >Feature sequence094 1356 220 gene locus_tag LOCUS_22930 1356 220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22930 2030 1353 gene locus_tag LOCUS_22940 2030 1353 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920607.1 protein_id gnl|my_center|LOCUS_22940 2174 2317 gene locus_tag LOCUS_22950 2174 2317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22950 2310 3194 gene locus_tag LOCUS_22960 2310 3194 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861372.1 protein_id gnl|my_center|LOCUS_22960 3197 4063 gene locus_tag LOCUS_22970 3197 4063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22970 >Feature sequence095 1055 153 gene locus_tag LOCUS_22980 1055 153 CDS product type II CAAX endopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000066795.1 protein_id gnl|my_center|LOCUS_22980 1363 1052 gene locus_tag LOCUS_22990 1363 1052 CDS product heavy metal-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080935.1 protein_id gnl|my_center|LOCUS_22990 1997 1344 gene locus_tag LOCUS_23000 1997 1344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23000 3377 2190 gene locus_tag LOCUS_23010 3377 2190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23010 3818 3507 gene locus_tag LOCUS_23020 3818 3507 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814866.1 protein_id gnl|my_center|LOCUS_23020 >Feature sequence096 426 800 gene locus_tag LOCUS_23030 426 800 CDS product desulfoferrodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004453642.1 protein_id gnl|my_center|LOCUS_23030 924 1121 gene locus_tag LOCUS_23040 924 1121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23040 1140 1343 gene locus_tag LOCUS_23050 1140 1343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23050 1340 1915 gene locus_tag LOCUS_23060 1340 1915 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860883.1 protein_id gnl|my_center|LOCUS_23060 1944 2264 gene locus_tag LOCUS_23070 gene trxA 1944 2264 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460330.1 protein_id gnl|my_center|LOCUS_23070 >Feature sequence097 1829 90 gene locus_tag LOCUS_23080 gene ade 1829 90 CDS product adenine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964205.1 protein_id gnl|my_center|LOCUS_23080 2476 2003 gene locus_tag LOCUS_23090 2476 2003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23090 2501 2600 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3601 2744 gene locus_tag LOCUS_23100 3601 2744 CDS product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082812.1 protein_id gnl|my_center|LOCUS_23100 >Feature sequence098 69 656 gene locus_tag LOCUS_23110 69 656 CDS product Qnr family pentapeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704297.1 protein_id gnl|my_center|LOCUS_23110 669 1121 gene locus_tag LOCUS_23120 669 1121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23120 2025 1144 gene locus_tag LOCUS_23130 2025 1144 CDS product DUF5131 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062695943.1 protein_id gnl|my_center|LOCUS_23130 2137 3168 gene locus_tag LOCUS_23140 2137 3168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23140 3260 3394 gene locus_tag LOCUS_23150 3260 3394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23150 >Feature sequence099 628 2484 gene locus_tag LOCUS_23160 628 2484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23160 2503 2841 gene locus_tag LOCUS_23170 2503 2841 CDS product YbaB/EbfC family nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009887752.1 protein_id gnl|my_center|LOCUS_23170 2860 3459 gene locus_tag LOCUS_23180 gene recR 2860 3459 CDS product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421618.1 protein_id gnl|my_center|LOCUS_23180 >Feature sequence100 123 1427 gene locus_tag LOCUS_23190 123 1427 CDS product DUF3945 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202385.1 protein_id gnl|my_center|LOCUS_23190 1453 3540 gene locus_tag LOCUS_23200 1453 3540 CDS product type IA DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202386.1 protein_id gnl|my_center|LOCUS_23200 >Feature sequence101 563 189 gene locus_tag LOCUS_23210 563 189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23210 2321 657 gene locus_tag LOCUS_23220 2321 657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23220 2970 2305 gene locus_tag LOCUS_23230 2970 2305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23230 >Feature sequence102 616 1047 gene locus_tag LOCUS_23240 616 1047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23240 1078 1536 gene locus_tag LOCUS_23250 1078 1536 CDS product PcfB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002368727.1 protein_id gnl|my_center|LOCUS_23250 >Feature sequence103 1426 215 gene locus_tag LOCUS_23260 1426 215 CDS product FprA family A-type flavoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903248.1 protein_id gnl|my_center|LOCUS_23260 <3283 1450 gene locus_tag LOCUS_23270 <3283 1450 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005903247.1:acyl-CoA dehydrogenase family protein >Feature sequence104 <1 1230 gene locus_tag LOCUS_23280 <1 1230 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007051542.1:phosphoenolpyruvate--protein phosphotransferase 1414 2595 gene locus_tag LOCUS_23290 1414 2595 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426667.1 protein_id gnl|my_center|LOCUS_23290 >Feature sequence105 86 3 gene locus_tag LOCUS_t00490 86 3 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 385 1851 gene locus_tag LOCUS_23300 385 1851 CDS product lipopolysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202937.1 protein_id gnl|my_center|LOCUS_23300 2067 3167 gene locus_tag LOCUS_23310 gene uxuA 2067 3167 CDS product mannonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244855.1 protein_id gnl|my_center|LOCUS_23310 >Feature sequence106 853 419 gene locus_tag LOCUS_23320 853 419 CDS product DUF3408 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011199138.1 protein_id gnl|my_center|LOCUS_23320 1433 912 gene locus_tag LOCUS_23330 1433 912 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011199137.1 protein_id gnl|my_center|LOCUS_23330 3117 1555 gene locus_tag LOCUS_23340 3117 1555 CDS product relaxase/mobilization nuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007559083.1 protein_id gnl|my_center|LOCUS_23340 >Feature sequence107 <3037 748 gene locus_tag LOCUS_23350 <3037 748 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013389421.1:evolved beta-galactosidase subunit alpha >Feature sequence108 <3010 541 gene locus_tag LOCUS_23360 <3010 541 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011068233.1:glycoside hydrolase family 2 TIM barrel-domain containing protein >Feature sequence109 1719 694 gene locus_tag LOCUS_23370 1719 694 CDS product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391957.1 protein_id gnl|my_center|LOCUS_23370 2775 1813 gene locus_tag LOCUS_23380 2775 1813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23380 >Feature sequence110 25 1107 gene locus_tag LOCUS_23390 gene serC 25 1107 CDS product 3-phosphoserine/phosphohydroxythreonine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462039.1 protein_id gnl|my_center|LOCUS_23390 1273 2433 gene locus_tag LOCUS_23400 1273 2433 CDS product 3-phosphoglycerate dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000490251.1 protein_id gnl|my_center|LOCUS_23400 >Feature sequence111 <1 1206 gene locus_tag LOCUS_23410 <1 1206 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013368424.1:DEAD/DEAH box helicase family protein note possible pseudo, frameshifted >Feature sequence112 1701 1261 gene locus_tag LOCUS_23420 gene rplO 1701 1261 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810128.1 protein_id gnl|my_center|LOCUS_23420 1907 1722 gene locus_tag LOCUS_23430 1907 1722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23430 2422 1922 gene locus_tag LOCUS_23440 gene rpsE 2422 1922 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393920.1 protein_id gnl|my_center|LOCUS_23440 2801 2442 gene locus_tag LOCUS_23450 gene rplR 2801 2442 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003225816.1 protein_id gnl|my_center|LOCUS_23450 >Feature sequence113 <1 749 gene locus_tag LOCUS_23460 <1 749 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002288805.1:ParA family protein 706 1635 gene locus_tag LOCUS_23470 gene spo0J 706 1635 CDS product stage 0 sporulation protein Spo0J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226832.1 protein_id gnl|my_center|LOCUS_23470 1696 2145 gene locus_tag LOCUS_23480 1696 2145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23480 2288 2746 gene locus_tag LOCUS_23490 2288 2746 CDS product PcfB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002368727.1 protein_id gnl|my_center|LOCUS_23490 >Feature sequence114 930 409 gene locus_tag LOCUS_23500 930 409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23500 2118 1030 gene locus_tag LOCUS_23510 2118 1030 CDS product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005449968.1 protein_id gnl|my_center|LOCUS_23510 >Feature sequence115 1494 157 gene locus_tag LOCUS_23520 1494 157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23520 1959 1729 gene locus_tag LOCUS_23530 1959 1729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23530 >Feature sequence116 >Feature sequence117 2405 1386 gene locus_tag LOCUS_23540 2405 1386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23540 >Feature sequence118 356 3 gene locus_tag LOCUS_23550 356 3 CDS product PqqD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009889198.1 protein_id gnl|my_center|LOCUS_23550 2245 356 gene locus_tag LOCUS_23560 2245 356 CDS product oligopeptide transporter, OPT family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986707.1 protein_id gnl|my_center|LOCUS_23560 >Feature sequence119 1055 405 gene locus_tag LOCUS_23570 1055 405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23570 1490 2092 gene locus_tag LOCUS_23580 1490 2092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23580 >Feature sequence120 <1 541 gene locus_tag LOCUS_23590 <1 541 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011109303.1:DUF262 domain-containing protein >Feature sequence121 335 1360 gene locus_tag LOCUS_23600 gene galE 335 1360 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861656.1 protein_id gnl|my_center|LOCUS_23600 >Feature sequence122 <1 1337 gene locus_tag LOCUS_23610 <1 1337 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001036271.1:MATE family efflux transporter 2104 1469 gene locus_tag LOCUS_23620 2104 1469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23620 >Feature sequence123 487 155 gene locus_tag LOCUS_23630 gene mobC 487 155 CDS product plasmid mobilization relaxosome protein MobC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002368707.1 protein_id gnl|my_center|LOCUS_23630 <2318 484 gene locus_tag LOCUS_23640 <2318 484 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011861367.1:DEAD/DEAH box helicase family protein >Feature sequence124 162 1400 gene locus_tag LOCUS_23650 gene istA 162 1400 CDS product IS21-like element ISMac9 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023062.1 protein_id gnl|my_center|LOCUS_23650 1397 2185 gene locus_tag LOCUS_23660 gene istB 1397 2185 CDS product IS21-like element ISMac9 family helper ATPase IstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023283.1 protein_id gnl|my_center|LOCUS_23660 >Feature sequence125 207 839 gene locus_tag LOCUS_23670 gene adk 207 839 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103583.1 protein_id gnl|my_center|LOCUS_23670 842 1633 gene locus_tag LOCUS_23680 gene map 842 1633 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545375.1 protein_id gnl|my_center|LOCUS_23680 >Feature sequence126 >Feature sequence127 1133 255 gene locus_tag LOCUS_23690 1133 255 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262676.1 protein_id gnl|my_center|LOCUS_23690 2098 1304 gene locus_tag LOCUS_23700 2098 1304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23700 >Feature sequence128 617 2050 gene locus_tag LOCUS_23710 gene uxaC 617 2050 CDS product glucuronate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964011.1 protein_id gnl|my_center|LOCUS_23710 >Feature sequence129 1422 64 gene locus_tag LOCUS_23720 1422 64 CDS product IS1182-like element ISBma2 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205178.1 protein_id gnl|my_center|LOCUS_23720 1955 1440 gene locus_tag LOCUS_23730 1955 1440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23730 >Feature sequence130 1536 196 gene locus_tag LOCUS_23740 1536 196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23740 >Feature sequence131 1781 804 gene locus_tag LOCUS_23750 1781 804 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229856.1 protein_id gnl|my_center|LOCUS_23750 >Feature sequence132 <1911 239 gene locus_tag LOCUS_23760 <1911 239 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011462083.1:ABC transporter ATP-binding protein >Feature sequence133 <1750 809 gene locus_tag LOCUS_23770 <1750 809 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003436795.1:phenylalanine--tRNA ligase subunit alpha >Feature sequence134 1732 527 gene locus_tag LOCUS_23780 1732 527 CDS product IS110-like element ISPa11 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003147159.1 protein_id gnl|my_center|LOCUS_23780 >Feature sequence135 1478 660 gene locus_tag LOCUS_23790 1478 660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23790 >Feature sequence136 >Feature sequence137 <1 813 gene locus_tag LOCUS_23800 <1 813 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011948495.1:HAMP domain-containing sensor histidine kinase 915 1598 gene locus_tag LOCUS_23810 915 1598 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003399472.1 protein_id gnl|my_center|LOCUS_23810 >Feature sequence138 >Feature sequence139 316 1440 gene locus_tag LOCUS_23820 316 1440 CDS product sodium ion-translocating decarboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869047.1 protein_id gnl|my_center|LOCUS_23820 >Feature sequence140 <1 1174 gene locus_tag LOCUS_23830 <1 1174 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011948259.1:serine--tRNA ligase 1379 1455 gene locus_tag LOCUS_t00500 1379 1455 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 1547 1618 gene locus_tag LOCUS_t00510 1547 1618 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence141 518 811 gene locus_tag LOCUS_23840 518 811 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202678.1 protein_id gnl|my_center|LOCUS_23840 813 1130 gene locus_tag LOCUS_23850 813 1130 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004311261.1 protein_id gnl|my_center|LOCUS_23850 >Feature sequence142 134 682 gene locus_tag LOCUS_23860 134 682 CDS product RnfABCDGE type electron transport complex subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009902280.1 protein_id gnl|my_center|LOCUS_23860 699 1364 gene locus_tag LOCUS_23870 699 1364 CDS product electron transport complex subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005904084.1 protein_id gnl|my_center|LOCUS_23870 >Feature sequence143 1424 1017 gene locus_tag LOCUS_23880 1424 1017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23880 >Feature sequence144 1 309 gene locus_tag LOCUS_23890 1 309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23890 324 1253 gene locus_tag LOCUS_23900 gene trxB 324 1253 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393897.1 protein_id gnl|my_center|LOCUS_23900 >Feature sequence145 >Feature sequence146 234 992 gene locus_tag LOCUS_23910 234 992 CDS product esterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529927.1 protein_id gnl|my_center|LOCUS_23910 >Feature sequence147 746 327 gene locus_tag LOCUS_23920 746 327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23920 >Feature sequence148 <1 1061 gene locus_tag LOCUS_23930 <1 1061 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011987043.1:pyruvate:ferredoxin (flavodoxin) oxidoreductase >Feature sequence149 439 367 gene locus_tag LOCUS_t00520 439 367 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 848 459 gene locus_tag LOCUS_23940 848 459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23940 1072 878 gene locus_tag LOCUS_23950 1072 878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23950 >Feature sequence150 256 717 gene locus_tag LOCUS_23960 256 717 CDS product DUF523 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809665.1 protein_id gnl|my_center|LOCUS_23960 >Feature sequence151 198 22 gene locus_tag LOCUS_23970 198 22 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23970 302 997 gene locus_tag LOCUS_23980 302 997 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_022619212.1 protein_id gnl|my_center|LOCUS_23980 >Feature sequence152 >Feature sequence153 >Feature sequence154 862 5 gene locus_tag LOCUS_23990 862 5 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210833.1 protein_id gnl|my_center|LOCUS_23990 >Feature sequence155 828 205 gene locus_tag LOCUS_24000 828 205 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809017.1 protein_id gnl|my_center|LOCUS_24000 >Feature sequence156 >Feature sequence157 <1 507 gene locus_tag LOCUS_24010 <1 507 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_025773568.1:DNA-directed RNA polymerase subunit beta' >Feature sequence158 447 956 gene locus_tag LOCUS_24020 447 956 CDS product ferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459551.1 protein_id gnl|my_center|LOCUS_24020 >Feature sequence159 <1096 60 gene locus_tag LOCUS_24030 <1096 60 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010965537.1:glycogen synthase GlgA >Feature sequence160 845 9 gene locus_tag LOCUS_24040 845 9 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24040 >Feature sequence161 58 954 gene locus_tag LOCUS_24050 58 954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24050 >Feature sequence162 >Feature sequence163 >Feature sequence164