>Feature sequence01 181 798 gene locus_tag LOCUS_00010 181 798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00010 798 1832 gene locus_tag LOCUS_00020 798 1832 CDS product inorganic phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816804.1 protein_id gnl|my_center|LOCUS_00020 1975 3048 gene locus_tag LOCUS_00030 1975 3048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00030 3051 4832 gene locus_tag LOCUS_00040 3051 4832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00040 5233 5030 gene locus_tag LOCUS_00050 5233 5030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00050 5129 6325 gene locus_tag LOCUS_00060 5129 6325 CDS product aromatic acid exporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003853634.1 protein_id gnl|my_center|LOCUS_00060 7868 6426 gene locus_tag LOCUS_00070 gene radA 7868 6426 CDS product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028928.1 protein_id gnl|my_center|LOCUS_00070 8077 9153 gene locus_tag LOCUS_00080 gene disA 8077 9153 CDS product DNA integrity scanning diadenylate cyclase DisA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975482.1 protein_id gnl|my_center|LOCUS_00080 9277 9516 gene locus_tag LOCUS_00090 9277 9516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00090 10442 9609 gene locus_tag LOCUS_00100 10442 9609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00100 10500 11567 gene locus_tag LOCUS_00110 10500 11567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00110 14284 11702 gene locus_tag LOCUS_00120 14284 11702 CDS product ATP-dependent Clp protease ATP-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975461.1 protein_id gnl|my_center|LOCUS_00120 14680 14471 gene locus_tag LOCUS_00130 14680 14471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00130 15675 15322 gene locus_tag LOCUS_00140 gene lsr2 15675 15322 CDS product iron-regulated nucleoid-associated protein Lsr2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419513.1 protein_id gnl|my_center|LOCUS_00140 17937 16354 gene locus_tag LOCUS_00150 gene lysS 17937 16354 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230454.1 protein_id gnl|my_center|LOCUS_00150 18937 17990 gene locus_tag LOCUS_00160 gene panC 18937 17990 CDS product pantoate--beta-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013399.1 protein_id gnl|my_center|LOCUS_00160 19869 18934 gene locus_tag LOCUS_00170 19869 18934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00170 21910 19991 gene locus_tag LOCUS_00180 21910 19991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00180 22749 21910 gene locus_tag LOCUS_00190 22749 21910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00190 23254 22736 gene locus_tag LOCUS_00200 23254 22736 CDS product DUF3180 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005113140.1 protein_id gnl|my_center|LOCUS_00200 23896 23300 gene locus_tag LOCUS_00210 23896 23300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00210 24297 23896 gene locus_tag LOCUS_00220 gene folB 24297 23896 CDS product dihydroneopterin aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003853806.1 protein_id gnl|my_center|LOCUS_00220 25311 24352 gene locus_tag LOCUS_00230 gene folP 25311 24352 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467816.1 protein_id gnl|my_center|LOCUS_00230 25541 25747 gene locus_tag LOCUS_00240 25541 25747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00240 26874 25909 gene locus_tag LOCUS_00250 26874 25909 CDS product Abi family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083539905.1 protein_id gnl|my_center|LOCUS_00250 27897 27313 gene locus_tag LOCUS_00260 gene folE 27897 27313 CDS product GTP cyclohydrolase I FolE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975430.1 protein_id gnl|my_center|LOCUS_00260 30136 27884 gene locus_tag LOCUS_00270 gene ftsH 30136 27884 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030867756.1 protein_id gnl|my_center|LOCUS_00270 31043 30492 gene locus_tag LOCUS_00280 gene hpt 31043 30492 CDS product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007452004.1 protein_id gnl|my_center|LOCUS_00280 32370 31237 gene locus_tag LOCUS_00290 gene tilS 32370 31237 CDS product tRNA lysidine(34) synthetase TilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390178.1 protein_id gnl|my_center|LOCUS_00290 32627 32403 gene locus_tag LOCUS_00300 32627 32403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00300 33380 32895 gene locus_tag LOCUS_00310 33380 32895 CDS product inorganic diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731048.1 protein_id gnl|my_center|LOCUS_00310 33711 35261 gene locus_tag LOCUS_00320 33711 35261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00320 35471 38629 gene locus_tag LOCUS_00330 35471 38629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00330 38894 39106 gene locus_tag LOCUS_00340 38894 39106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00340 39075 40316 gene locus_tag LOCUS_00350 39075 40316 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224969.1 protein_id gnl|my_center|LOCUS_00350 40558 41178 gene locus_tag LOCUS_00360 40558 41178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00360 41400 42131 gene locus_tag LOCUS_00370 41400 42131 CDS product metal-dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777093.1 protein_id gnl|my_center|LOCUS_00370 43110 42226 gene locus_tag LOCUS_00380 43110 42226 CDS product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777094.1 protein_id gnl|my_center|LOCUS_00380 43923 43111 gene locus_tag LOCUS_00390 43923 43111 CDS product metal ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777095.1 protein_id gnl|my_center|LOCUS_00390 45076 44114 gene locus_tag LOCUS_00400 45076 44114 CDS product metal ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777096.1 protein_id gnl|my_center|LOCUS_00400 46221 45421 gene locus_tag LOCUS_00410 46221 45421 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727225.1 protein_id gnl|my_center|LOCUS_00410 47233 46418 gene locus_tag LOCUS_00420 47233 46418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00420 49043 47715 gene locus_tag LOCUS_00430 49043 47715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00430 50782 49436 gene locus_tag LOCUS_00440 50782 49436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00440 52418 51429 gene locus_tag LOCUS_00450 52418 51429 CDS product bile acid:sodium symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855200.1 protein_id gnl|my_center|LOCUS_00450 54181 52589 gene locus_tag LOCUS_00460 54181 52589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00460 55579 54443 gene locus_tag LOCUS_00470 55579 54443 CDS product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023514.1 protein_id gnl|my_center|LOCUS_00470 58937 56232 gene locus_tag LOCUS_00480 58937 56232 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009994787.1 protein_id gnl|my_center|LOCUS_00480 59515 59159 gene locus_tag LOCUS_00490 59515 59159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00490 60399 59764 gene locus_tag LOCUS_00500 60399 59764 CDS product Fic/DOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899616.1 protein_id gnl|my_center|LOCUS_00500 60672 60403 gene locus_tag LOCUS_00510 60672 60403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00510 61300 60740 gene locus_tag LOCUS_00520 61300 60740 CDS product zeta toxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_142413611.1 protein_id gnl|my_center|LOCUS_00520 61517 61329 gene locus_tag LOCUS_00530 61517 61329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00530 61822 61520 gene locus_tag LOCUS_00540 61822 61520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00540 62173 61982 gene locus_tag LOCUS_00550 62173 61982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00550 62789 62998 gene locus_tag LOCUS_00560 62789 62998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00560 62998 63645 gene locus_tag LOCUS_00570 62998 63645 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028002888.1 protein_id gnl|my_center|LOCUS_00570 64860 65384 gene locus_tag LOCUS_00580 64860 65384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00580 65450 66307 gene locus_tag LOCUS_00590 65450 66307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00590 67669 66389 gene locus_tag LOCUS_00600 67669 66389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00600 68904 67816 gene locus_tag LOCUS_00610 68904 67816 CDS product diacylglycerol kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804319.1 protein_id gnl|my_center|LOCUS_00610 69169 69005 gene locus_tag LOCUS_00620 69169 69005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00620 70480 69173 gene locus_tag LOCUS_00630 gene serS 70480 69173 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004574367.1 protein_id gnl|my_center|LOCUS_00630 71552 70605 gene locus_tag LOCUS_00640 gene pheA 71552 70605 CDS product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804316.1 protein_id gnl|my_center|LOCUS_00640 72650 71763 gene locus_tag LOCUS_00650 72650 71763 CDS product spermidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014223.1 protein_id gnl|my_center|LOCUS_00650 72777 73400 gene locus_tag LOCUS_00660 72777 73400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00660 73593 75683 gene locus_tag LOCUS_00670 gene pta 73593 75683 CDS product phosphate acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940288.1 protein_id gnl|my_center|LOCUS_00670 76329 75892 gene locus_tag LOCUS_00680 76329 75892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00680 76656 79883 gene locus_tag LOCUS_00690 76656 79883 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189742338.1 protein_id gnl|my_center|LOCUS_00690 80306 81016 gene locus_tag LOCUS_00700 80306 81016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00700 81289 82185 gene locus_tag LOCUS_00710 81289 82185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00710 82723 83148 gene locus_tag LOCUS_00720 82723 83148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00720 83213 83428 gene locus_tag LOCUS_00730 83213 83428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00730 83458 83844 gene locus_tag LOCUS_00740 83458 83844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00740 84014 86521 gene locus_tag LOCUS_00750 84014 86521 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730259.1 protein_id gnl|my_center|LOCUS_00750 87474 86818 gene locus_tag LOCUS_00760 87474 86818 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694521.1 protein_id gnl|my_center|LOCUS_00760 89015 87612 gene locus_tag LOCUS_00770 89015 87612 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485269.1 protein_id gnl|my_center|LOCUS_00770 89496 89104 gene locus_tag LOCUS_00780 89496 89104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00780 89429 90703 gene locus_tag LOCUS_00790 89429 90703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00790 92084 90870 gene locus_tag LOCUS_00800 92084 90870 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727143.1 protein_id gnl|my_center|LOCUS_00800 92243 92866 gene locus_tag LOCUS_00810 92243 92866 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086809.1 protein_id gnl|my_center|LOCUS_00810 92980 94089 gene locus_tag LOCUS_00820 92980 94089 CDS product sucrase ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013769.1 protein_id gnl|my_center|LOCUS_00820 95943 94294 gene locus_tag LOCUS_00830 95943 94294 CDS product NAD-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013348.1 protein_id gnl|my_center|LOCUS_00830 97935 96331 gene locus_tag LOCUS_00840 97935 96331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00840 98834 98322 gene locus_tag LOCUS_00850 98834 98322 CDS product PTS glucose transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989640.1 protein_id gnl|my_center|LOCUS_00850 99172 99759 gene locus_tag LOCUS_00860 99172 99759 CDS product arsenic metallochaperone ArsD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804467.1 protein_id gnl|my_center|LOCUS_00860 100959 99934 gene locus_tag LOCUS_00870 gene fbaA 100959 99934 CDS product class II fructose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029142.1 protein_id gnl|my_center|LOCUS_00870 101224 101610 gene locus_tag LOCUS_00880 101224 101610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00880 101917 103512 gene locus_tag LOCUS_00890 101917 103512 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006313426.1 protein_id gnl|my_center|LOCUS_00890 103796 104848 gene locus_tag LOCUS_00900 103796 104848 CDS product ornithine cyclodeaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804303.1 protein_id gnl|my_center|LOCUS_00900 105884 105069 gene locus_tag LOCUS_00910 105884 105069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00910 106905 106150 gene locus_tag LOCUS_00920 106905 106150 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892159.1 protein_id gnl|my_center|LOCUS_00920 107602 107021 gene locus_tag LOCUS_00930 gene pyrE 107602 107021 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029143.1 protein_id gnl|my_center|LOCUS_00930 109224 107668 gene locus_tag LOCUS_00940 109224 107668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00940 109584 109252 gene locus_tag LOCUS_00950 109584 109252 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897834.1 protein_id gnl|my_center|LOCUS_00950 109893 111353 gene locus_tag LOCUS_00960 109893 111353 CDS product oligopeptide:H+ symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_165446571.1 protein_id gnl|my_center|LOCUS_00960 111686 112876 gene locus_tag LOCUS_00970 111686 112876 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728185.1 protein_id gnl|my_center|LOCUS_00970 113124 113648 gene locus_tag LOCUS_00980 113124 113648 CDS product DUF4242 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005079458.1 protein_id gnl|my_center|LOCUS_00980 113679 114764 gene locus_tag LOCUS_00990 113679 114764 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005115250.1 protein_id gnl|my_center|LOCUS_00990 115021 116355 gene locus_tag LOCUS_01000 115021 116355 CDS product pyrimidine permease RutG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729472.1 protein_id gnl|my_center|LOCUS_01000 117982 116465 gene locus_tag LOCUS_01010 117982 116465 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052115.1 protein_id gnl|my_center|LOCUS_01010 119001 118189 gene locus_tag LOCUS_01020 119001 118189 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222171.1 protein_id gnl|my_center|LOCUS_01020 119632 119087 gene locus_tag LOCUS_01030 119632 119087 CDS product YbhB/YbcL family Raf kinase inhibitor-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230876.1 protein_id gnl|my_center|LOCUS_01030 120651 119716 gene locus_tag LOCUS_01040 120651 119716 CDS product carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776299.1 protein_id gnl|my_center|LOCUS_01040 120939 122375 gene locus_tag LOCUS_01050 120939 122375 CDS product glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013988.1 protein_id gnl|my_center|LOCUS_01050 123226 122642 gene locus_tag LOCUS_01060 123226 122642 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003693637.1 protein_id gnl|my_center|LOCUS_01060 124542 123346 gene locus_tag LOCUS_01070 124542 123346 CDS product putative glycoside hydrolase family 15 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229158.1 protein_id gnl|my_center|LOCUS_01070 126247 124532 gene locus_tag LOCUS_01080 gene pelF 126247 124532 CDS product GT4 family glycosyltransferase PelF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016350.1 protein_id gnl|my_center|LOCUS_01080 127636 126281 gene locus_tag LOCUS_01090 127636 126281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01090 132917 128028 gene locus_tag LOCUS_01100 132917 128028 CDS product NAD-glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028707.1 protein_id gnl|my_center|LOCUS_01100 133137 134072 gene locus_tag LOCUS_01110 133137 134072 CDS product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004531451.1 protein_id gnl|my_center|LOCUS_01110 135449 134157 gene locus_tag LOCUS_01120 135449 134157 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013638.1 protein_id gnl|my_center|LOCUS_01120 135868 136518 gene locus_tag LOCUS_01130 135868 136518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01130 138338 138562 gene locus_tag LOCUS_01140 138338 138562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01140 140081 138873 gene locus_tag LOCUS_01150 140081 138873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01150 141109 140234 gene locus_tag LOCUS_01160 141109 140234 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015943077.1 protein_id gnl|my_center|LOCUS_01160 141547 141164 gene locus_tag LOCUS_01170 141547 141164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01170 142293 141550 gene locus_tag LOCUS_01180 142293 141550 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049878191.1 protein_id gnl|my_center|LOCUS_01180 144490 142490 gene locus_tag LOCUS_01190 144490 142490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930034.1 protein_id gnl|my_center|LOCUS_01190 144887 145429 gene locus_tag LOCUS_01200 144887 145429 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_204250228.1 protein_id gnl|my_center|LOCUS_01200 145542 146771 gene locus_tag LOCUS_01210 gene argE 145542 146771 CDS product acetylornithine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004534727.1 protein_id gnl|my_center|LOCUS_01210 147322 148329 gene locus_tag LOCUS_01220 147322 148329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01220 149128 148502 gene locus_tag LOCUS_01230 149128 148502 CDS product ArsR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229780.1 protein_id gnl|my_center|LOCUS_01230 149802 149161 gene locus_tag LOCUS_01240 149802 149161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01240 150480 150028 gene locus_tag LOCUS_01250 150480 150028 CDS product CrcB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053642.1 protein_id gnl|my_center|LOCUS_01250 150884 150480 gene locus_tag LOCUS_01260 150884 150480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01260 153822 151009 gene locus_tag LOCUS_01270 153822 151009 CDS product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_179552221.1 protein_id gnl|my_center|LOCUS_01270 154721 154020 gene locus_tag LOCUS_01280 154721 154020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01280 156643 154988 gene locus_tag LOCUS_01290 156643 154988 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029388.1 protein_id gnl|my_center|LOCUS_01290 157480 156737 gene locus_tag LOCUS_01300 157480 156737 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230642.1 protein_id gnl|my_center|LOCUS_01300 157733 158602 gene locus_tag LOCUS_01310 157733 158602 CDS product PRD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068759.1 protein_id gnl|my_center|LOCUS_01310 159291 160271 gene locus_tag LOCUS_01320 gene manX 159291 160271 CDS product PTS mannose transporter subunit IIAB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000150543.1 protein_id gnl|my_center|LOCUS_01320 160268 161134 gene locus_tag LOCUS_01330 gene manY 160268 161134 CDS product PTS mannose transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000406918.1 protein_id gnl|my_center|LOCUS_01330 161146 162000 gene locus_tag LOCUS_01340 161146 162000 CDS product PTS mannose transporter subunit IID inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005163650.1 protein_id gnl|my_center|LOCUS_01340 162173 162946 gene locus_tag LOCUS_01350 162173 162946 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245153.1 protein_id gnl|my_center|LOCUS_01350 162958 163605 gene locus_tag LOCUS_01360 162958 163605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01360 164131 163781 gene locus_tag LOCUS_01370 164131 163781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01370 164670 164143 gene locus_tag LOCUS_01380 164670 164143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01380 166606 164864 gene locus_tag LOCUS_01390 166606 164864 CDS product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014364.1 protein_id gnl|my_center|LOCUS_01390 167809 166856 gene locus_tag LOCUS_01400 167809 166856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01400 168101 168703 gene locus_tag LOCUS_01410 168101 168703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01410 168950 170347 gene locus_tag LOCUS_01420 gene galK 168950 170347 CDS product galactokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776399.1 protein_id gnl|my_center|LOCUS_01420 170810 170974 gene locus_tag LOCUS_01430 170810 170974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01430 171491 171811 gene locus_tag LOCUS_01440 171491 171811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01440 171813 172631 gene locus_tag LOCUS_01450 171813 172631 CDS product shikimate 5-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896853.1 protein_id gnl|my_center|LOCUS_01450 173612 172974 gene locus_tag LOCUS_01460 173612 172974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01460 174678 173854 gene locus_tag LOCUS_01470 174678 173854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01470 175377 174850 gene locus_tag LOCUS_01480 175377 174850 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005116126.1 protein_id gnl|my_center|LOCUS_01480 175551 175886 gene locus_tag LOCUS_01490 175551 175886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01490 176272 176161 gene locus_tag LOCUS_r00010 176272 176161 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 176350 176277 gene locus_tag LOCUS_t00010 176350 176277 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 177665 176442 gene locus_tag LOCUS_01500 177665 176442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01500 178321 177869 gene locus_tag LOCUS_01510 178321 177869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01510 178677 178372 gene locus_tag LOCUS_01520 178677 178372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01520 179909 178680 gene locus_tag LOCUS_01530 179909 178680 CDS product inorganic phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011265565.1 protein_id gnl|my_center|LOCUS_01530 180614 180503 gene locus_tag LOCUS_r00020 180614 180503 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 180692 180619 gene locus_tag LOCUS_t00020 180692 180619 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 180910 180836 gene locus_tag LOCUS_t00030 180910 180836 tRNA product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 181705 181109 gene locus_tag LOCUS_01540 181705 181109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01540 184335 181705 gene locus_tag LOCUS_01550 gene gyrA 184335 181705 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803674.1 protein_id gnl|my_center|LOCUS_01550 186451 184415 gene locus_tag LOCUS_01560 gene gyrB 186451 184415 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803673.1 protein_id gnl|my_center|LOCUS_01560 187561 186866 gene locus_tag LOCUS_01570 187561 186866 CDS product DUF721 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975057.1 protein_id gnl|my_center|LOCUS_01570 188795 187554 gene locus_tag LOCUS_01580 gene recF 188795 187554 CDS product DNA replication/repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975056.1 protein_id gnl|my_center|LOCUS_01580 190036 188912 gene locus_tag LOCUS_01590 gene dnaN 190036 188912 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803666.1 protein_id gnl|my_center|LOCUS_01590 192535 190838 gene locus_tag LOCUS_01600 gene dnaA 192535 190838 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803665.1 protein_id gnl|my_center|LOCUS_01600 193105 193242 gene locus_tag LOCUS_01610 gene rpmH 193105 193242 CDS product 50S ribosomal protein L34 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975051.1 protein_id gnl|my_center|LOCUS_01610 193507 193734 gene locus_tag LOCUS_01620 193507 193734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01620 193731 194204 gene locus_tag LOCUS_01630 193731 194204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01630 194256 195245 gene locus_tag LOCUS_01640 gene yidC 194256 195245 CDS product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777156.1 protein_id gnl|my_center|LOCUS_01640 195357 195923 gene locus_tag LOCUS_01650 195357 195923 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029290.1 protein_id gnl|my_center|LOCUS_01650 195925 196566 gene locus_tag LOCUS_01660 gene rsmG 195925 196566 CDS product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777154.1 protein_id gnl|my_center|LOCUS_01660 197020 197862 gene locus_tag LOCUS_01670 197020 197862 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777153.1 protein_id gnl|my_center|LOCUS_01670 198099 199397 gene locus_tag LOCUS_01680 198099 199397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01680 199836 199510 gene locus_tag LOCUS_01690 gene trxA 199836 199510 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056655.1 protein_id gnl|my_center|LOCUS_01690 200924 199890 gene locus_tag LOCUS_01700 gene trxB 200924 199890 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777150.1 protein_id gnl|my_center|LOCUS_01700 202361 201171 gene locus_tag LOCUS_01710 202361 201171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01710 204222 202558 gene locus_tag LOCUS_01720 204222 202558 CDS product murein biosynthesis integral membrane protein MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013399360.1 protein_id gnl|my_center|LOCUS_01720 204790 204287 gene locus_tag LOCUS_01730 204790 204287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01730 204920 206344 gene locus_tag LOCUS_01740 204920 206344 CDS product CCA tRNA nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975035.1 protein_id gnl|my_center|LOCUS_01740 206535 206840 gene locus_tag LOCUS_01750 gene rpsF 206535 206840 CDS product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811753.1 protein_id gnl|my_center|LOCUS_01750 206936 207568 gene locus_tag LOCUS_01760 206936 207568 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777138.1 protein_id gnl|my_center|LOCUS_01760 207652 207888 gene locus_tag LOCUS_01770 gene rpsR 207652 207888 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777137.1 protein_id gnl|my_center|LOCUS_01770 207909 208361 gene locus_tag LOCUS_01780 gene rplI 207909 208361 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777136.1 protein_id gnl|my_center|LOCUS_01780 208603 208370 gene locus_tag LOCUS_01790 208603 208370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01790 208677 208907 gene locus_tag LOCUS_01800 208677 208907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01800 209551 210357 gene locus_tag LOCUS_01810 209551 210357 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014886.1 protein_id gnl|my_center|LOCUS_01810 210517 211716 gene locus_tag LOCUS_01820 210517 211716 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288819.1 protein_id gnl|my_center|LOCUS_01820 211822 213177 gene locus_tag LOCUS_01830 gene dnaB 211822 213177 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929839.1 protein_id gnl|my_center|LOCUS_01830 >Feature sequence02 830 387 gene locus_tag LOCUS_01840 830 387 CDS product YchJ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027912.1 protein_id gnl|my_center|LOCUS_01840 2425 998 gene locus_tag LOCUS_01850 2425 998 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728113.1 protein_id gnl|my_center|LOCUS_01850 2924 3760 gene locus_tag LOCUS_01860 2924 3760 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727032.1 protein_id gnl|my_center|LOCUS_01860 3825 4889 gene locus_tag LOCUS_01870 3825 4889 CDS product aliphatic sulfonate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049743398.1 protein_id gnl|my_center|LOCUS_01870 4889 5731 gene locus_tag LOCUS_01880 4889 5731 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727031.1 protein_id gnl|my_center|LOCUS_01880 6178 8301 gene locus_tag LOCUS_01890 gene acs 6178 8301 CDS product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230537.1 protein_id gnl|my_center|LOCUS_01890 9557 8469 gene locus_tag LOCUS_01900 9557 8469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01900 9790 10641 gene locus_tag LOCUS_01910 9790 10641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01910 10812 11420 gene locus_tag LOCUS_01920 10812 11420 CDS product DUF1269 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002893760.1 protein_id gnl|my_center|LOCUS_01920 11721 11566 gene locus_tag LOCUS_01930 11721 11566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01930 13460 11889 gene locus_tag LOCUS_01940 13460 11889 CDS product DHA2 family efflux MFS transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775824.1 protein_id gnl|my_center|LOCUS_01940 13729 14046 gene locus_tag LOCUS_01950 13729 14046 CDS product acylphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728332.1 protein_id gnl|my_center|LOCUS_01950 14697 14065 gene locus_tag LOCUS_01960 14697 14065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01960 14924 15505 gene locus_tag LOCUS_01970 14924 15505 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730169.1 protein_id gnl|my_center|LOCUS_01970 15509 16039 gene locus_tag LOCUS_01980 15509 16039 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730168.1 protein_id gnl|my_center|LOCUS_01980 16197 16637 gene locus_tag LOCUS_01990 16197 16637 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836803.1 protein_id gnl|my_center|LOCUS_01990 17390 16740 gene locus_tag LOCUS_02000 17390 16740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02000 17861 18652 gene locus_tag LOCUS_02010 17861 18652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02010 19502 18753 gene locus_tag LOCUS_02020 19502 18753 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003701034.1 protein_id gnl|my_center|LOCUS_02020 20169 19495 gene locus_tag LOCUS_02030 20169 19495 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529174.1 protein_id gnl|my_center|LOCUS_02030 21017 20199 gene locus_tag LOCUS_02040 21017 20199 CDS product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014330185.1 protein_id gnl|my_center|LOCUS_02040 22131 21286 gene locus_tag LOCUS_02050 22131 21286 CDS product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014330185.1 protein_id gnl|my_center|LOCUS_02050 23390 22230 gene locus_tag LOCUS_02060 23390 22230 CDS product PLP-dependent aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804431.1 protein_id gnl|my_center|LOCUS_02060 24851 23700 gene locus_tag LOCUS_02070 24851 23700 CDS product PLP-dependent aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804431.1 protein_id gnl|my_center|LOCUS_02070 26325 25327 gene locus_tag LOCUS_02080 26325 25327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02080 27172 26666 gene locus_tag LOCUS_02090 27172 26666 CDS product CoA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003891579.1 protein_id gnl|my_center|LOCUS_02090 28632 27172 gene locus_tag LOCUS_02100 28632 27172 CDS product O-acetylhomoserine aminocarboxypropyltransferase/cysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726769.1 protein_id gnl|my_center|LOCUS_02100 29009 30610 gene locus_tag LOCUS_02110 29009 30610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02110 31623 30703 gene locus_tag LOCUS_02120 31623 30703 CDS product YwqG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989979.1 protein_id gnl|my_center|LOCUS_02120 32564 31665 gene locus_tag LOCUS_02130 32564 31665 CDS product YwqG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986634.1 protein_id gnl|my_center|LOCUS_02130 33875 32844 gene locus_tag LOCUS_02140 33875 32844 CDS product iron-siderophore ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383252.1 protein_id gnl|my_center|LOCUS_02140 33990 35261 gene locus_tag LOCUS_02150 33990 35261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02150 35287 36339 gene locus_tag LOCUS_02160 35287 36339 CDS product iron chelate uptake ABC transporter family permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537420.1 protein_id gnl|my_center|LOCUS_02160 36625 37308 gene locus_tag LOCUS_02170 36625 37308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02170 38400 37375 gene locus_tag LOCUS_02180 38400 37375 CDS product magnesium and cobalt transport protein CorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013358.1 protein_id gnl|my_center|LOCUS_02180 39433 38573 gene locus_tag LOCUS_02190 39433 38573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02190 39888 39433 gene locus_tag LOCUS_02200 39888 39433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02200 41338 40046 gene locus_tag LOCUS_02210 41338 40046 CDS product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804520.1 protein_id gnl|my_center|LOCUS_02210 42044 41574 gene locus_tag LOCUS_02220 42044 41574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02220 43389 42322 gene locus_tag LOCUS_02230 43389 42322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02230 43717 47742 gene locus_tag LOCUS_02240 43717 47742 CDS product S8 family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466704.1 protein_id gnl|my_center|LOCUS_02240 47988 51974 gene locus_tag LOCUS_02250 47988 51974 CDS product S8 family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466704.1 protein_id gnl|my_center|LOCUS_02250 52381 56421 gene locus_tag LOCUS_02260 52381 56421 CDS product S8 family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466704.1 protein_id gnl|my_center|LOCUS_02260 56517 56657 gene locus_tag LOCUS_02270 56517 56657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02270 56943 57197 gene locus_tag LOCUS_02280 56943 57197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02280 57485 58318 gene locus_tag LOCUS_02290 gene nadE 57485 58318 CDS product ammonia-dependent NAD(+) synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000174904.1 protein_id gnl|my_center|LOCUS_02290 59930 58422 gene locus_tag LOCUS_02300 59930 58422 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965780.1 protein_id gnl|my_center|LOCUS_02300 61767 60127 gene locus_tag LOCUS_02310 61767 60127 CDS product Na+/H+ antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411714.1 protein_id gnl|my_center|LOCUS_02310 62203 63108 gene locus_tag LOCUS_02320 gene pdxS 62203 63108 CDS product pyridoxal 5'-phosphate synthase lyase subunit PdxS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051767629.1 protein_id gnl|my_center|LOCUS_02320 63224 63862 gene locus_tag LOCUS_02330 gene pdxT 63224 63862 CDS product pyridoxal 5'-phosphate synthase glutaminase subunit PdxT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013889.1 protein_id gnl|my_center|LOCUS_02330 64638 63973 gene locus_tag LOCUS_02340 64638 63973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02340 66088 65831 gene locus_tag LOCUS_02350 66088 65831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02350 66201 66620 gene locus_tag LOCUS_02360 66201 66620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02360 67062 66715 gene locus_tag LOCUS_02370 67062 66715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02370 68645 67338 gene locus_tag LOCUS_02380 68645 67338 CDS product M18 family aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776646.1 protein_id gnl|my_center|LOCUS_02380 69770 68790 gene locus_tag LOCUS_02390 69770 68790 CDS product CPBP family intramembrane metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803896.1 protein_id gnl|my_center|LOCUS_02390 69994 69767 gene locus_tag LOCUS_02400 69994 69767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02400 70013 72148 gene locus_tag LOCUS_02410 70013 72148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02410 73902 72307 gene locus_tag LOCUS_02420 73902 72307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02420 75287 73899 gene locus_tag LOCUS_02430 75287 73899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02430 75388 75621 gene locus_tag LOCUS_02440 75388 75621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02440 75618 78512 gene locus_tag LOCUS_02450 75618 78512 CDS product multicopper oxidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_082793861.1 protein_id gnl|my_center|LOCUS_02450 78727 79623 gene locus_tag LOCUS_02460 78727 79623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02460 81023 79812 gene locus_tag LOCUS_02470 81023 79812 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775996.1 protein_id gnl|my_center|LOCUS_02470 82517 81309 gene locus_tag LOCUS_02480 82517 81309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02480 83344 82520 gene locus_tag LOCUS_02490 83344 82520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02490 83689 83516 gene locus_tag LOCUS_02500 83689 83516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02500 83672 83953 gene locus_tag LOCUS_02510 83672 83953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02510 85482 84037 gene locus_tag LOCUS_02520 85482 84037 CDS product sugar porter family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013450.1 protein_id gnl|my_center|LOCUS_02520 86707 85706 gene locus_tag LOCUS_02530 86707 85706 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_203754103.1 protein_id gnl|my_center|LOCUS_02530 87349 86744 gene locus_tag LOCUS_02540 87349 86744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02540 87576 87770 gene locus_tag LOCUS_02550 87576 87770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02550 89462 88491 gene locus_tag LOCUS_02560 89462 88491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02560 90881 91786 gene locus_tag LOCUS_02570 90881 91786 CDS product methylenetetrahydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803922.1 protein_id gnl|my_center|LOCUS_02570 91935 94262 gene locus_tag LOCUS_02580 gene metE 91935 94262 CDS product 5-methyltetrahydropteroyltriglutamate--homocysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803923.1 protein_id gnl|my_center|LOCUS_02580 94780 96219 gene locus_tag LOCUS_02590 gene glpT 94780 96219 CDS product glycerol-3-phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246460.1 protein_id gnl|my_center|LOCUS_02590 96327 98309 gene locus_tag LOCUS_02600 96327 98309 CDS product M13 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726765.1 protein_id gnl|my_center|LOCUS_02600 99166 98429 gene locus_tag LOCUS_02610 99166 98429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02610 99533 99294 gene locus_tag LOCUS_02620 99533 99294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02620 100430 99771 gene locus_tag LOCUS_02630 100430 99771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02630 100700 101494 gene locus_tag LOCUS_02640 100700 101494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02640 101517 101861 gene locus_tag LOCUS_02650 101517 101861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02650 101926 102327 gene locus_tag LOCUS_02660 101926 102327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02660 102392 102778 gene locus_tag LOCUS_02670 102392 102778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02670 102843 103229 gene locus_tag LOCUS_02680 102843 103229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02680 103642 104172 gene locus_tag LOCUS_02690 103642 104172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02690 104200 105102 gene locus_tag LOCUS_02700 104200 105102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02700 105428 108451 gene locus_tag LOCUS_02710 105428 108451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02710 108592 109878 gene locus_tag LOCUS_02720 108592 109878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02720 109997 114385 gene locus_tag LOCUS_02730 109997 114385 CDS product FtsK/SpoIIIE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776163.1 protein_id gnl|my_center|LOCUS_02730 114503 116527 gene locus_tag LOCUS_02740 114503 116527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02740 117022 116639 gene locus_tag LOCUS_02750 117022 116639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02750 123306 117025 gene locus_tag LOCUS_02760 123306 117025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02760 123770 123486 gene locus_tag LOCUS_02770 123770 123486 CDS product WXG100 family type VII secretion target inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257420.1 protein_id gnl|my_center|LOCUS_02770 124073 124543 gene locus_tag LOCUS_02780 124073 124543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02780 124758 125417 gene locus_tag LOCUS_02790 124758 125417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02790 125610 126275 gene locus_tag LOCUS_02800 125610 126275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02800 126300 126974 gene locus_tag LOCUS_02810 126300 126974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02810 126991 127854 gene locus_tag LOCUS_02820 126991 127854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02820 127856 128512 gene locus_tag LOCUS_02830 127856 128512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02830 128602 129294 gene locus_tag LOCUS_02840 128602 129294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02840 129369 130028 gene locus_tag LOCUS_02850 129369 130028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02850 130118 130429 gene locus_tag LOCUS_02860 130118 130429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02860 133525 130526 gene locus_tag LOCUS_02870 133525 130526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02870 133800 136154 gene locus_tag LOCUS_02880 133800 136154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02880 136141 137886 gene locus_tag LOCUS_02890 136141 137886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02890 137980 139086 gene locus_tag LOCUS_02900 137980 139086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02900 139083 139961 gene locus_tag LOCUS_02910 139083 139961 CDS product anchored repeat-type ABC transporter ATP-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013399434.1 protein_id gnl|my_center|LOCUS_02910 139958 140812 gene locus_tag LOCUS_02920 139958 140812 CDS product anchored repeat-type ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004115980.1 protein_id gnl|my_center|LOCUS_02920 141127 142197 gene locus_tag LOCUS_02930 141127 142197 CDS product zinc-dependent alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978698.1 protein_id gnl|my_center|LOCUS_02930 143924 142602 gene locus_tag LOCUS_02940 143924 142602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02940 145710 144145 gene locus_tag LOCUS_02950 145710 144145 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803919.1 protein_id gnl|my_center|LOCUS_02950 145908 146486 gene locus_tag LOCUS_02960 145908 146486 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803918.1 protein_id gnl|my_center|LOCUS_02960 146623 146943 gene locus_tag LOCUS_02970 146623 146943 CDS product putative quinol monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776253.1 protein_id gnl|my_center|LOCUS_02970 147205 148017 gene locus_tag LOCUS_02980 147205 148017 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804024.1 protein_id gnl|my_center|LOCUS_02980 148729 148535 gene locus_tag LOCUS_02990 148729 148535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02990 148915 148751 gene locus_tag LOCUS_03000 148915 148751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03000 148970 150319 gene locus_tag LOCUS_03010 148970 150319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03010 150736 152478 gene locus_tag LOCUS_03020 150736 152478 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730315.1 protein_id gnl|my_center|LOCUS_03020 152722 154197 gene locus_tag LOCUS_03030 152722 154197 CDS product putative DNA binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003022198.1 protein_id gnl|my_center|LOCUS_03030 154957 154334 gene locus_tag LOCUS_03040 154957 154334 CDS product superoxide dismutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775980.1 protein_id gnl|my_center|LOCUS_03040 156522 157073 gene locus_tag LOCUS_03050 156522 157073 CDS product MarR family winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223356.1 protein_id gnl|my_center|LOCUS_03050 157596 158120 gene locus_tag LOCUS_03060 157596 158120 CDS product ferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284940.1 protein_id gnl|my_center|LOCUS_03060 158366 159718 gene locus_tag LOCUS_03070 gene nhaA 158366 159718 CDS product Na+/H+ antiporter NhaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777007.1 protein_id gnl|my_center|LOCUS_03070 159875 163120 gene locus_tag LOCUS_03080 gene lysX 159875 163120 CDS product bifunctional lysylphosphatidylglycerol synthetase/lysine--tRNA ligase LysX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223114.1 protein_id gnl|my_center|LOCUS_03080 163458 165020 gene locus_tag LOCUS_03090 163458 165020 CDS product sodium:alanine symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003863416.1 protein_id gnl|my_center|LOCUS_03090 165186 165512 gene locus_tag LOCUS_03100 165186 165512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03100 165668 165754 gene locus_tag LOCUS_t00040 165668 165754 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 165983 166864 gene locus_tag LOCUS_03110 gene fhaA 165983 166864 CDS product antibiotic biosynthesis regulator FhaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975091.1 protein_id gnl|my_center|LOCUS_03110 166864 167328 gene locus_tag LOCUS_03120 166864 167328 CDS product FHA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003861086.1 protein_id gnl|my_center|LOCUS_03120 167332 169092 gene locus_tag LOCUS_03130 167332 169092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03130 169085 170545 gene locus_tag LOCUS_03140 169085 170545 CDS product FtsW/RodA/SpoVE family cell cycle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007056849.1 protein_id gnl|my_center|LOCUS_03140 170538 171977 gene locus_tag LOCUS_03150 170538 171977 CDS product penicillin-binding transpeptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776672.1 protein_id gnl|my_center|LOCUS_03150 171974 173731 gene locus_tag LOCUS_03160 171974 173731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03160 173779 175932 gene locus_tag LOCUS_03170 gene pknB 173779 175932 CDS product Stk1 family PASTA domain-containing Ser/Thr kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029269.1 protein_id gnl|my_center|LOCUS_03170 176791 176159 gene locus_tag LOCUS_03180 176791 176159 CDS product gamma-glutamyl-gamma-aminobutyrate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776675.1 protein_id gnl|my_center|LOCUS_03180 176968 176807 gene locus_tag LOCUS_03190 176968 176807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03190 177736 176987 gene locus_tag LOCUS_03200 177736 176987 CDS product class E sortase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776677.1 protein_id gnl|my_center|LOCUS_03200 177896 178210 gene locus_tag LOCUS_03210 177896 178210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03210 179326 178409 gene locus_tag LOCUS_03220 179326 178409 CDS product LysR family transcriptional regulator ArgP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971834.1 protein_id gnl|my_center|LOCUS_03220 179535 180167 gene locus_tag LOCUS_03230 179535 180167 CDS product LysE/ArgO family amino acid transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005095323.1 protein_id gnl|my_center|LOCUS_03230 181623 180190 gene locus_tag LOCUS_03240 181623 180190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03240 182219 181671 gene locus_tag LOCUS_03250 182219 181671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03250 >Feature sequence03 134 241 gene locus_tag LOCUS_r00030 134 241 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 568 1311 gene locus_tag LOCUS_03260 568 1311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03260 1737 2615 gene locus_tag LOCUS_03270 1737 2615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03270 2847 2921 gene locus_tag LOCUS_t00050 2847 2921 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 3046 5244 gene locus_tag LOCUS_03280 3046 5244 CDS product acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776644.1 protein_id gnl|my_center|LOCUS_03280 5384 6214 gene locus_tag LOCUS_03290 5384 6214 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013802.1 protein_id gnl|my_center|LOCUS_03290 6373 7185 gene locus_tag LOCUS_03300 6373 7185 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742086.1 protein_id gnl|my_center|LOCUS_03300 8011 8247 gene locus_tag LOCUS_03310 gene rpmB 8011 8247 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731012.1 protein_id gnl|my_center|LOCUS_03310 8251 8421 gene locus_tag LOCUS_03320 gene rpmG 8251 8421 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005063154.1 protein_id gnl|my_center|LOCUS_03320 8424 8729 gene locus_tag LOCUS_03330 gene rpsN 8424 8729 CDS product 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897467.1 protein_id gnl|my_center|LOCUS_03330 8820 9107 gene locus_tag LOCUS_03340 8820 9107 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003950507.1 protein_id gnl|my_center|LOCUS_03340 9635 10423 gene locus_tag LOCUS_03350 9635 10423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03350 10637 11350 gene locus_tag LOCUS_03360 10637 11350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03360 11658 12410 gene locus_tag LOCUS_03370 11658 12410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03370 13767 12532 gene locus_tag LOCUS_03380 gene lldD 13767 12532 CDS product quinone-dependent L-lactate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015490.1 protein_id gnl|my_center|LOCUS_03380 14185 16155 gene locus_tag LOCUS_03390 14185 16155 CDS product thioredoxin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230910.1 protein_id gnl|my_center|LOCUS_03390 17426 16485 gene locus_tag LOCUS_03400 17426 16485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03400 17526 18227 gene locus_tag LOCUS_03410 17526 18227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03410 19037 18372 gene locus_tag LOCUS_03420 19037 18372 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005079489.1 protein_id gnl|my_center|LOCUS_03420 20337 19225 gene locus_tag LOCUS_03430 20337 19225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803908.1 protein_id gnl|my_center|LOCUS_03430 21720 20665 gene locus_tag LOCUS_03440 21720 20665 CDS product ThiF family adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014840.1 protein_id gnl|my_center|LOCUS_03440 22481 21711 gene locus_tag LOCUS_03450 22481 21711 CDS product thiazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857587.1 protein_id gnl|my_center|LOCUS_03450 22819 22622 gene locus_tag LOCUS_03460 gene thiS 22819 22622 CDS product sulfur carrier protein ThiS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976708.1 protein_id gnl|my_center|LOCUS_03460 23950 22868 gene locus_tag LOCUS_03470 gene thiO 23950 22868 CDS product glycine oxidase ThiO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003861894.1 protein_id gnl|my_center|LOCUS_03470 24573 23953 gene locus_tag LOCUS_03480 24573 23953 CDS product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776709.1 protein_id gnl|my_center|LOCUS_03480 25240 25169 gene locus_tag LOCUS_t00060 25240 25169 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 25337 25993 gene locus_tag LOCUS_03490 gene dcd 25337 25993 CDS product dCTP deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975261.1 protein_id gnl|my_center|LOCUS_03490 26125 27456 gene locus_tag LOCUS_03500 26125 27456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03500 29076 27652 gene locus_tag LOCUS_03510 29076 27652 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015250.1 protein_id gnl|my_center|LOCUS_03510 29470 29237 gene locus_tag LOCUS_03520 29470 29237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03520 29911 30534 gene locus_tag LOCUS_03530 29911 30534 CDS product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898105.1 protein_id gnl|my_center|LOCUS_03530 30623 32281 gene locus_tag LOCUS_03540 30623 32281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03540 32278 33075 gene locus_tag LOCUS_03550 32278 33075 CDS product energy-coupling factor transporter transmembrane component T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731491.1 protein_id gnl|my_center|LOCUS_03550 34499 33597 gene locus_tag LOCUS_03560 34499 33597 CDS product aminodeoxychorismate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230727.1 protein_id gnl|my_center|LOCUS_03560 35923 34673 gene locus_tag LOCUS_03570 35923 34673 CDS product multidrug effflux MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894372.1 protein_id gnl|my_center|LOCUS_03570 36449 36652 gene locus_tag LOCUS_03580 36449 36652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03580 37399 36731 gene locus_tag LOCUS_03590 37399 36731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03590 37875 37396 gene locus_tag LOCUS_03600 37875 37396 CDS product low molecular weight protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804863.1 protein_id gnl|my_center|LOCUS_03600 39362 38082 gene locus_tag LOCUS_03610 39362 38082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03610 41084 39762 gene locus_tag LOCUS_03620 41084 39762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03620 42797 41223 gene locus_tag LOCUS_03630 42797 41223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03630 45188 43542 gene locus_tag LOCUS_03640 45188 43542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03640 46570 45323 gene locus_tag LOCUS_03650 46570 45323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03650 47849 49681 gene locus_tag LOCUS_03660 gene dnaK 47849 49681 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051640.1 protein_id gnl|my_center|LOCUS_03660 49684 50262 gene locus_tag LOCUS_03670 49684 50262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03670 50546 51553 gene locus_tag LOCUS_03680 50546 51553 CDS product DnaJ C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390361.1 protein_id gnl|my_center|LOCUS_03680 51557 52063 gene locus_tag LOCUS_03690 51557 52063 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804833.1 protein_id gnl|my_center|LOCUS_03690 52485 53027 gene locus_tag LOCUS_03700 52485 53027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03700 53047 53556 gene locus_tag LOCUS_03710 53047 53556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03710 53549 54643 gene locus_tag LOCUS_03720 53549 54643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03720 54771 55370 gene locus_tag LOCUS_03730 54771 55370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03730 56396 55590 gene locus_tag LOCUS_03740 gene trmB 56396 55590 CDS product tRNA (guanosine(46)-N7)-methyltransferase TrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804561.1 protein_id gnl|my_center|LOCUS_03740 57036 56638 gene locus_tag LOCUS_03750 57036 56638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013365.1 protein_id gnl|my_center|LOCUS_03750 57521 58996 gene locus_tag LOCUS_03760 gene cycA 57521 58996 CDS product D-serine/D-alanine/glycine transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729183.1 protein_id gnl|my_center|LOCUS_03760 59433 60908 gene locus_tag LOCUS_03770 gene cycA 59433 60908 CDS product D-serine/D-alanine/glycine transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729183.1 protein_id gnl|my_center|LOCUS_03770 62679 61069 gene locus_tag LOCUS_03780 62679 61069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03780 63125 65605 gene locus_tag LOCUS_03790 63125 65605 CDS product Tex family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223450.1 protein_id gnl|my_center|LOCUS_03790 66657 65821 gene locus_tag LOCUS_03800 66657 65821 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803740.1 protein_id gnl|my_center|LOCUS_03800 71002 66836 gene locus_tag LOCUS_03810 71002 66836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03810 71427 71654 gene locus_tag LOCUS_03820 71427 71654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03820 71665 72099 gene locus_tag LOCUS_03830 71665 72099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03830 72250 74739 gene locus_tag LOCUS_03840 72250 74739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03840 75336 74752 gene locus_tag LOCUS_03850 75336 74752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03850 75540 76106 gene locus_tag LOCUS_03860 gene purN 75540 76106 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878360.1 protein_id gnl|my_center|LOCUS_03860 76323 77933 gene locus_tag LOCUS_03870 gene purH 76323 77933 CDS product bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222720.1 protein_id gnl|my_center|LOCUS_03870 78159 78740 gene locus_tag LOCUS_03880 78159 78740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03880 79032 80306 gene locus_tag LOCUS_03890 79032 80306 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973528.1 protein_id gnl|my_center|LOCUS_03890 80512 81390 gene locus_tag LOCUS_03900 80512 81390 CDS product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776152.1 protein_id gnl|my_center|LOCUS_03900 82343 81513 gene locus_tag LOCUS_03910 gene phnF 82343 81513 CDS product phosphonate metabolism transcriptional regulator PhnF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002194085.1 protein_id gnl|my_center|LOCUS_03910 82427 83302 gene locus_tag LOCUS_03920 82427 83302 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776151.1 protein_id gnl|my_center|LOCUS_03920 83389 84453 gene locus_tag LOCUS_03930 gene trpS 83389 84453 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_124091865.1 protein_id gnl|my_center|LOCUS_03930 84487 85083 gene locus_tag LOCUS_03940 84487 85083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03940 86597 85188 gene locus_tag LOCUS_03950 gene aztD 86597 85188 CDS product zinc metallochaperone AztD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013328.1 protein_id gnl|my_center|LOCUS_03950 88000 86891 gene locus_tag LOCUS_03960 88000 86891 CDS product mannose-1-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776146.1 protein_id gnl|my_center|LOCUS_03960 88347 88805 gene locus_tag LOCUS_03970 gene sdhC 88347 88805 CDS product succinate dehydrogenase, cytochrome b556 subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776147.1 protein_id gnl|my_center|LOCUS_03970 88809 89294 gene locus_tag LOCUS_03980 gene sdhD 88809 89294 CDS product succinate dehydrogenase, hydrophobic membrane anchor protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776148.1 protein_id gnl|my_center|LOCUS_03980 89346 91109 gene locus_tag LOCUS_03990 gene sdhA 89346 91109 CDS product succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776149.1 protein_id gnl|my_center|LOCUS_03990 91111 91899 gene locus_tag LOCUS_04000 91111 91899 CDS product succinate dehydrogenase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776150.1 protein_id gnl|my_center|LOCUS_04000 92142 93392 gene locus_tag LOCUS_04010 92142 93392 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776145.1 protein_id gnl|my_center|LOCUS_04010 93641 97480 gene locus_tag LOCUS_04020 93641 97480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04020 97568 98314 gene locus_tag LOCUS_04030 gene mazG 97568 98314 CDS product nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941834.1 protein_id gnl|my_center|LOCUS_04030 98686 99966 gene locus_tag LOCUS_04040 gene eno 98686 99966 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804956.1 protein_id gnl|my_center|LOCUS_04040 100190 100834 gene locus_tag LOCUS_04050 100190 100834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04050 100930 101529 gene locus_tag LOCUS_04060 100930 101529 CDS product DUF501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005109980.1 protein_id gnl|my_center|LOCUS_04060 101682 102635 gene locus_tag LOCUS_04070 101682 102635 CDS product Ppx/GppA phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975718.1 protein_id gnl|my_center|LOCUS_04070 102699 104315 gene locus_tag LOCUS_04080 102699 104315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04080 104754 106139 gene locus_tag LOCUS_04090 104754 106139 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486678.1 protein_id gnl|my_center|LOCUS_04090 106399 106473 gene locus_tag LOCUS_t00070 106399 106473 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 106798 107682 gene locus_tag LOCUS_04100 106798 107682 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011100993.1 protein_id gnl|my_center|LOCUS_04100 107880 108848 gene locus_tag LOCUS_04110 107880 108848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04110 109019 110296 gene locus_tag LOCUS_04120 109019 110296 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003891590.1 protein_id gnl|my_center|LOCUS_04120 110530 111783 gene locus_tag LOCUS_04130 gene ilvA 110530 111783 CDS product threonine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029975.1 protein_id gnl|my_center|LOCUS_04130 112423 111926 gene locus_tag LOCUS_04140 gene greA 112423 111926 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776308.1 protein_id gnl|my_center|LOCUS_04140 112838 113809 gene locus_tag LOCUS_04150 gene mca 112838 113809 CDS product mycothiol conjugate amidase Mca inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896662.1 protein_id gnl|my_center|LOCUS_04150 114100 114909 gene locus_tag LOCUS_04160 gene uppS 114100 114909 CDS product polyprenyl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776303.1 protein_id gnl|my_center|LOCUS_04160 115021 115548 gene locus_tag LOCUS_04170 115021 115548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04170 115676 116182 gene locus_tag LOCUS_04180 115676 116182 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_105566594.1 protein_id gnl|my_center|LOCUS_04180 116654 117871 gene locus_tag LOCUS_04190 gene entS 116654 117871 CDS product enterobactin transporter EntS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704709.1 protein_id gnl|my_center|LOCUS_04190 119432 118005 gene locus_tag LOCUS_04200 119432 118005 CDS product class II fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776300.1 protein_id gnl|my_center|LOCUS_04200 120355 119636 gene locus_tag LOCUS_04210 120355 119636 CDS product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731025.1 protein_id gnl|my_center|LOCUS_04210 120773 121780 gene locus_tag LOCUS_04220 gene glpX 120773 121780 CDS product class II fructose-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803850.1 protein_id gnl|my_center|LOCUS_04220 122980 121979 gene locus_tag LOCUS_04230 122980 121979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04230 123638 123000 gene locus_tag LOCUS_04240 gene purE 123638 123000 CDS product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975752.1 protein_id gnl|my_center|LOCUS_04240 124928 123738 gene locus_tag LOCUS_04250 124928 123738 CDS product 5-(carboxyamino)imidazole ribonucleotide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_219537380.1 protein_id gnl|my_center|LOCUS_04250 125298 125915 gene locus_tag LOCUS_04260 125298 125915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04260 126896 126096 gene locus_tag LOCUS_04270 126896 126096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04270 127086 127295 gene locus_tag LOCUS_04280 127086 127295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04280 127591 128007 gene locus_tag LOCUS_04290 127591 128007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04290 128028 128249 gene locus_tag LOCUS_04300 128028 128249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04300 128420 129730 gene locus_tag LOCUS_04310 128420 129730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04310 131580 129934 gene locus_tag LOCUS_04320 131580 129934 CDS product phospholipid carrier-dependent glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930192.1 protein_id gnl|my_center|LOCUS_04320 131778 132743 gene locus_tag LOCUS_04330 gene rsmI 131778 132743 CDS product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229988.1 protein_id gnl|my_center|LOCUS_04330 132810 133883 gene locus_tag LOCUS_04340 132810 133883 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028796.1 protein_id gnl|my_center|LOCUS_04340 134114 134935 gene locus_tag LOCUS_04350 134114 134935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04350 135321 136142 gene locus_tag LOCUS_04360 135321 136142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04360 136188 137060 gene locus_tag LOCUS_04370 gene rsmA 136188 137060 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975667.1 protein_id gnl|my_center|LOCUS_04370 137129 138136 gene locus_tag LOCUS_04380 137129 138136 CDS product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021269012.1 protein_id gnl|my_center|LOCUS_04380 140034 138205 gene locus_tag LOCUS_04390 140034 138205 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729311.1 protein_id gnl|my_center|LOCUS_04390 140270 140341 gene locus_tag LOCUS_t00080 140270 140341 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 140428 141882 gene locus_tag LOCUS_04400 gene glmU 140428 141882 CDS product bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929929.1 protein_id gnl|my_center|LOCUS_04400 141903 142883 gene locus_tag LOCUS_04410 141903 142883 CDS product ribose-phosphate diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005059141.1 protein_id gnl|my_center|LOCUS_04410 144176 143046 gene locus_tag LOCUS_04420 144176 143046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04420 144654 145469 gene locus_tag LOCUS_04430 144654 145469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04430 145469 146578 gene locus_tag LOCUS_04440 145469 146578 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769496.1 protein_id gnl|my_center|LOCUS_04440 146689 148404 gene locus_tag LOCUS_04450 146689 148404 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056069.1 protein_id gnl|my_center|LOCUS_04450 149483 148515 gene locus_tag LOCUS_04460 149483 148515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04460 150442 149480 gene locus_tag LOCUS_04470 150442 149480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04470 150624 151544 gene locus_tag LOCUS_04480 150624 151544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04480 151803 152801 gene locus_tag LOCUS_04490 151803 152801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04490 152792 153892 gene locus_tag LOCUS_04500 152792 153892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803906.1 protein_id gnl|my_center|LOCUS_04500 153892 154620 gene locus_tag LOCUS_04510 153892 154620 CDS product acylneuraminate cytidylyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932825.1 protein_id gnl|my_center|LOCUS_04510 154711 156954 gene locus_tag LOCUS_04520 154711 156954 CDS product N-acetylneuraminate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000582619.1 protein_id gnl|my_center|LOCUS_04520 156966 158051 gene locus_tag LOCUS_04530 156966 158051 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028385.1 protein_id gnl|my_center|LOCUS_04530 158048 159163 gene locus_tag LOCUS_04540 158048 159163 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081188.1 protein_id gnl|my_center|LOCUS_04540 159301 160563 gene locus_tag LOCUS_04550 159301 160563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04550 160566 161606 gene locus_tag LOCUS_04560 160566 161606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04560 161672 162619 gene locus_tag LOCUS_04570 161672 162619 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142791.1 protein_id gnl|my_center|LOCUS_04570 162632 163879 gene locus_tag LOCUS_04580 162632 163879 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966352.1 protein_id gnl|my_center|LOCUS_04580 164277 163969 gene locus_tag LOCUS_04590 164277 163969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04590 165131 164274 gene locus_tag LOCUS_04600 165131 164274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04600 >Feature sequence04 240 878 gene locus_tag LOCUS_04610 gene upp 240 878 CDS product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004114100.1 protein_id gnl|my_center|LOCUS_04610 1456 2208 gene locus_tag LOCUS_04620 1456 2208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04620 2361 2906 gene locus_tag LOCUS_04630 2361 2906 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532447.1 protein_id gnl|my_center|LOCUS_04630 3056 2965 gene locus_tag LOCUS_t00090 3056 2965 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 3311 3658 gene locus_tag LOCUS_04640 3311 3658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04640 3876 4340 gene locus_tag LOCUS_04650 3876 4340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04650 4539 5183 gene locus_tag LOCUS_04660 4539 5183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04660 5355 5792 gene locus_tag LOCUS_04670 5355 5792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04670 5854 6288 gene locus_tag LOCUS_04680 5854 6288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04680 6467 6847 gene locus_tag LOCUS_04690 6467 6847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04690 6915 7358 gene locus_tag LOCUS_04700 6915 7358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04700 7549 7461 gene locus_tag LOCUS_t00100 7549 7461 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 7675 8685 gene locus_tag LOCUS_04710 7675 8685 CDS product NAD(P)H-quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731232.1 protein_id gnl|my_center|LOCUS_04710 8934 9473 gene locus_tag LOCUS_04720 8934 9473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04720 9785 10660 gene locus_tag LOCUS_04730 9785 10660 CDS product CoA ester lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728516.1 protein_id gnl|my_center|LOCUS_04730 11053 10787 gene locus_tag LOCUS_04740 11053 10787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04740 11233 11159 gene locus_tag LOCUS_t00110 11233 11159 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 11553 12317 gene locus_tag LOCUS_04750 11553 12317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04750 12317 13105 gene locus_tag LOCUS_04760 12317 13105 CDS product fused MFS/spermidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804823.1 protein_id gnl|my_center|LOCUS_04760 14182 13208 gene locus_tag LOCUS_04770 14182 13208 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929952.1 protein_id gnl|my_center|LOCUS_04770 15430 14369 gene locus_tag LOCUS_04780 15430 14369 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929952.1 protein_id gnl|my_center|LOCUS_04780 15702 16583 gene locus_tag LOCUS_04790 15702 16583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896454.1 protein_id gnl|my_center|LOCUS_04790 18135 16702 gene locus_tag LOCUS_04800 gene purB 18135 16702 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776538.1 protein_id gnl|my_center|LOCUS_04800 18387 18980 gene locus_tag LOCUS_04810 18387 18980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04810 19000 21375 gene locus_tag LOCUS_04820 19000 21375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04820 21641 22768 gene locus_tag LOCUS_04830 gene hisC 21641 22768 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029330.1 protein_id gnl|my_center|LOCUS_04830 23171 24337 gene locus_tag LOCUS_04840 gene pdhA 23171 24337 CDS product pyruvate dehydrogenase (acetyl-transferring) E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230923.1 protein_id gnl|my_center|LOCUS_04840 24340 25326 gene locus_tag LOCUS_04850 24340 25326 CDS product alpha-ketoacid dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776524.1 protein_id gnl|my_center|LOCUS_04850 25426 26901 gene locus_tag LOCUS_04860 25426 26901 CDS product dihydrolipoamide acetyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776523.1 protein_id gnl|my_center|LOCUS_04860 28189 27077 gene locus_tag LOCUS_04870 28189 27077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04870 28897 28235 gene locus_tag LOCUS_04880 28897 28235 CDS product sugar O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031718.1 protein_id gnl|my_center|LOCUS_04880 29194 30972 gene locus_tag LOCUS_04890 29194 30972 CDS product long-chain-fatty-acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_188700193.1 protein_id gnl|my_center|LOCUS_04890 31284 32162 gene locus_tag LOCUS_04900 31284 32162 CDS product MetQ/NlpA family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068221.1 protein_id gnl|my_center|LOCUS_04900 32309 33364 gene locus_tag LOCUS_04910 32309 33364 CDS product methionine ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005082323.1 protein_id gnl|my_center|LOCUS_04910 33365 34060 gene locus_tag LOCUS_04920 33365 34060 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005057738.1 protein_id gnl|my_center|LOCUS_04920 36218 35457 gene locus_tag LOCUS_04930 36218 35457 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930017.1 protein_id gnl|my_center|LOCUS_04930 37811 36393 gene locus_tag LOCUS_04940 37811 36393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04940 38764 37811 gene locus_tag LOCUS_04950 38764 37811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04950 38994 40283 gene locus_tag LOCUS_04960 38994 40283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04960 40273 40767 gene locus_tag LOCUS_04970 40273 40767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04970 41180 41971 gene locus_tag LOCUS_04980 41180 41971 CDS product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003891419.1 protein_id gnl|my_center|LOCUS_04980 41971 42921 gene locus_tag LOCUS_04990 41971 42921 CDS product hexose kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003891418.1 protein_id gnl|my_center|LOCUS_04990 43109 45106 gene locus_tag LOCUS_05000 43109 45106 CDS product fructose-specific PTS transporter subunit EIIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726656.1 protein_id gnl|my_center|LOCUS_05000 45207 46901 gene locus_tag LOCUS_05010 gene ptsP 45207 46901 CDS product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804335.1 protein_id gnl|my_center|LOCUS_05010 47136 47414 gene locus_tag LOCUS_05020 47136 47414 CDS product HPr family phosphocarrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804336.1 protein_id gnl|my_center|LOCUS_05020 47839 49974 gene locus_tag LOCUS_05030 47839 49974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05030 50785 50114 gene locus_tag LOCUS_05040 50785 50114 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804387.1 protein_id gnl|my_center|LOCUS_05040 50974 51315 gene locus_tag LOCUS_05050 50974 51315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05050 51577 52167 gene locus_tag LOCUS_05060 51577 52167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05060 52594 54216 gene locus_tag LOCUS_05070 gene groL 52594 54216 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892307.1 protein_id gnl|my_center|LOCUS_05070 54548 55684 gene locus_tag LOCUS_05080 gene rlmC 54548 55684 CDS product 23S rRNA (uracil(747)-C(5))-methyltransferase RlmC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816017.1 protein_id gnl|my_center|LOCUS_05080 55750 57054 gene locus_tag LOCUS_05090 55750 57054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05090 57738 57211 gene locus_tag LOCUS_05100 57738 57211 CDS product DinB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803955.1 protein_id gnl|my_center|LOCUS_05100 57973 59382 gene locus_tag LOCUS_05110 57973 59382 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008659213.1 protein_id gnl|my_center|LOCUS_05110 59689 60408 gene locus_tag LOCUS_05120 59689 60408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05120 60405 61172 gene locus_tag LOCUS_05130 60405 61172 CDS product 2,3-dihydro-2,3-dihydroxybenzoate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005092036.1 protein_id gnl|my_center|LOCUS_05130 61271 62374 gene locus_tag LOCUS_05140 gene amoC 61271 62374 CDS product amonabactin biosynthesis isochorismate synthase AmoC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706310.1 protein_id gnl|my_center|LOCUS_05140 63512 62508 gene locus_tag LOCUS_05150 63512 62508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05150 63687 65135 gene locus_tag LOCUS_05160 63687 65135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05160 65653 65363 gene locus_tag LOCUS_05170 65653 65363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05170 67568 66069 gene locus_tag LOCUS_05180 67568 66069 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804419.1 protein_id gnl|my_center|LOCUS_05180 68274 67570 gene locus_tag LOCUS_05190 68274 67570 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804420.1 protein_id gnl|my_center|LOCUS_05190 68621 68349 gene locus_tag LOCUS_05200 68621 68349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05200 68763 69554 gene locus_tag LOCUS_05210 68763 69554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05210 69766 70470 gene locus_tag LOCUS_05220 69766 70470 CDS product metal-dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974588.1 protein_id gnl|my_center|LOCUS_05220 71329 72018 gene locus_tag LOCUS_05230 71329 72018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05230 73216 72200 gene locus_tag LOCUS_05240 73216 72200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05240 73394 73467 gene locus_tag LOCUS_t00120 73394 73467 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 73643 76606 gene locus_tag LOCUS_05250 73643 76606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05250 77066 78232 gene locus_tag LOCUS_05260 gene sucC 77066 78232 CDS product ADP-forming succinate--CoA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804537.1 protein_id gnl|my_center|LOCUS_05260 78262 79179 gene locus_tag LOCUS_05270 gene sucD 78262 79179 CDS product succinate--CoA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896926.1 protein_id gnl|my_center|LOCUS_05270 79414 80340 gene locus_tag LOCUS_05280 79414 80340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05280 81661 80507 gene locus_tag LOCUS_05290 81661 80507 CDS product VIT1/CCC1 transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015009.1 protein_id gnl|my_center|LOCUS_05290 82460 81963 gene locus_tag LOCUS_05300 82460 81963 CDS product DNA starvation/stationary phase protection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804007.1 protein_id gnl|my_center|LOCUS_05300 83278 82616 gene locus_tag LOCUS_05310 83278 82616 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003816035.1 protein_id gnl|my_center|LOCUS_05310 83983 83297 gene locus_tag LOCUS_05320 83983 83297 CDS product NAD(P)H-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034285367.1 protein_id gnl|my_center|LOCUS_05320 84246 86855 gene locus_tag LOCUS_05330 gene clpB 84246 86855 CDS product ATP-dependent chaperone ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007057489.1 protein_id gnl|my_center|LOCUS_05330 87065 88033 gene locus_tag LOCUS_05340 87065 88033 CDS product NAD-dependent protein deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011896407.1 protein_id gnl|my_center|LOCUS_05340 88235 89440 gene locus_tag LOCUS_05350 88235 89440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05350 89753 90742 gene locus_tag LOCUS_05360 89753 90742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05360 91057 91773 gene locus_tag LOCUS_05370 91057 91773 CDS product DUF4956 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803956.1 protein_id gnl|my_center|LOCUS_05370 91897 92817 gene locus_tag LOCUS_05380 91897 92817 CDS product VTC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803957.1 protein_id gnl|my_center|LOCUS_05380 93108 94799 gene locus_tag LOCUS_05390 93108 94799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05390 95187 95396 gene locus_tag LOCUS_05400 95187 95396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05400 95761 96813 gene locus_tag LOCUS_05410 95761 96813 CDS product phosphodiester glycosidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836504.1 protein_id gnl|my_center|LOCUS_05410 96810 98003 gene locus_tag LOCUS_05420 96810 98003 CDS product bifunctional glycosyltransferase family 2/GtrA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002918104.1 protein_id gnl|my_center|LOCUS_05420 99955 98237 gene locus_tag LOCUS_05430 99955 98237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05430 100562 102475 gene locus_tag LOCUS_05440 100562 102475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05440 104541 102580 gene locus_tag LOCUS_05450 104541 102580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05450 106327 105182 gene locus_tag LOCUS_05460 gene purM 106327 105182 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804525.1 protein_id gnl|my_center|LOCUS_05460 108078 106327 gene locus_tag LOCUS_05470 gene purF 108078 106327 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804524.1 protein_id gnl|my_center|LOCUS_05470 108771 108319 gene locus_tag LOCUS_05480 108771 108319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05480 109916 108774 gene locus_tag LOCUS_05490 109916 108774 CDS product asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230730.1 protein_id gnl|my_center|LOCUS_05490 109806 110078 gene locus_tag LOCUS_05500 109806 110078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05500 110176 110517 gene locus_tag LOCUS_05510 110176 110517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05510 110670 111953 gene locus_tag LOCUS_05520 gene purD 110670 111953 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029417.1 protein_id gnl|my_center|LOCUS_05520 112238 113164 gene locus_tag LOCUS_05530 112238 113164 CDS product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974901.1 protein_id gnl|my_center|LOCUS_05530 114131 113283 gene locus_tag LOCUS_05540 114131 113283 CDS product FCD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727054.1 protein_id gnl|my_center|LOCUS_05540 116027 114354 gene locus_tag LOCUS_05550 116027 114354 CDS product L-lactate permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028722.1 protein_id gnl|my_center|LOCUS_05550 116872 117666 gene locus_tag LOCUS_05560 116872 117666 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892015.1 protein_id gnl|my_center|LOCUS_05560 117683 119311 gene locus_tag LOCUS_05570 117683 119311 CDS product LutB/LldF family L-lactate oxidation iron-sulfur protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727053.1 protein_id gnl|my_center|LOCUS_05570 119311 119955 gene locus_tag LOCUS_05580 119311 119955 CDS product LUD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978042.1 protein_id gnl|my_center|LOCUS_05580 121758 120199 gene locus_tag LOCUS_05590 121758 120199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05590 123857 122355 gene locus_tag LOCUS_05600 123857 122355 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803746.1 protein_id gnl|my_center|LOCUS_05600 124227 125360 gene locus_tag LOCUS_05610 124227 125360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05610 125574 125500 gene locus_tag LOCUS_t00130 125574 125500 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 127558 125684 gene locus_tag LOCUS_05620 127558 125684 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803869.1 protein_id gnl|my_center|LOCUS_05620 129612 127558 gene locus_tag LOCUS_05630 129612 127558 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803870.1 protein_id gnl|my_center|LOCUS_05630 130628 129612 gene locus_tag LOCUS_05640 130628 129612 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776608.1 protein_id gnl|my_center|LOCUS_05640 132813 130669 gene locus_tag LOCUS_05650 132813 130669 CDS product transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930028.1 protein_id gnl|my_center|LOCUS_05650 132980 133183 gene locus_tag LOCUS_05660 132980 133183 CDS product DUF4177 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975360.1 protein_id gnl|my_center|LOCUS_05660 133369 133851 gene locus_tag LOCUS_05670 133369 133851 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975361.1 protein_id gnl|my_center|LOCUS_05670 133844 135013 gene locus_tag LOCUS_05680 133844 135013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05680 135850 135173 gene locus_tag LOCUS_05690 135850 135173 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_175285932.1 protein_id gnl|my_center|LOCUS_05690 136336 137514 gene locus_tag LOCUS_05700 136336 137514 CDS product MarP family serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_141863754.1 protein_id gnl|my_center|LOCUS_05700 138047 137643 gene locus_tag LOCUS_05710 gene aroQ 138047 137643 CDS product type II 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728012.1 protein_id gnl|my_center|LOCUS_05710 138233 139159 gene locus_tag LOCUS_05720 gene nth 138233 139159 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_078343767.1 protein_id gnl|my_center|LOCUS_05720 139210 139989 gene locus_tag LOCUS_05730 139210 139989 CDS product CoA pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029090.1 protein_id gnl|my_center|LOCUS_05730 142109 140103 gene locus_tag LOCUS_05740 142109 140103 CDS product bifunctional 3'-5' exonuclease/DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930206.1 protein_id gnl|my_center|LOCUS_05740 142318 143910 gene locus_tag LOCUS_05750 142318 143910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05750 143951 145204 gene locus_tag LOCUS_05760 143951 145204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05760 145334 145993 gene locus_tag LOCUS_05770 145334 145993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05770 146075 146578 gene locus_tag LOCUS_05780 146075 146578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05780 146586 147170 gene locus_tag LOCUS_05790 146586 147170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05790 150051 147283 gene locus_tag LOCUS_05800 150051 147283 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485160.1 protein_id gnl|my_center|LOCUS_05800 150284 151195 gene locus_tag LOCUS_05810 150284 151195 CDS product rhodanese-related sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015551.1 protein_id gnl|my_center|LOCUS_05810 151195 151692 gene locus_tag LOCUS_05820 151195 151692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05820 151950 153041 gene locus_tag LOCUS_05830 151950 153041 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384492.1 protein_id gnl|my_center|LOCUS_05830 153237 153596 gene locus_tag LOCUS_05840 153237 153596 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776291.1 protein_id gnl|my_center|LOCUS_05840 153539 154243 gene locus_tag LOCUS_05850 153539 154243 CDS product cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005086746.1 protein_id gnl|my_center|LOCUS_05850 154285 154434 gene locus_tag LOCUS_05860 154285 154434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05860 >Feature sequence05 2380 1337 gene locus_tag LOCUS_05870 2380 1337 CDS product tRNA (adenine-N1)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027901.1 protein_id gnl|my_center|LOCUS_05870 2733 2611 gene locus_tag LOCUS_05880 2733 2611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05880 4051 2735 gene locus_tag LOCUS_05890 gene mshC 4051 2735 CDS product cysteine--1-D-myo-inosityl 2-amino-2-deoxy-alpha-D-glucopyranoside ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977162.1 protein_id gnl|my_center|LOCUS_05890 5034 4210 gene locus_tag LOCUS_05900 5034 4210 CDS product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775661.1 protein_id gnl|my_center|LOCUS_05900 6204 5302 gene locus_tag LOCUS_05910 6204 5302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083192.1 protein_id gnl|my_center|LOCUS_05910 8138 6390 gene locus_tag LOCUS_05920 gene leuA 8138 6390 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930223.1 protein_id gnl|my_center|LOCUS_05920 9998 8559 gene locus_tag LOCUS_05930 9998 8559 CDS product LCP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486662.1 protein_id gnl|my_center|LOCUS_05930 11343 10186 gene locus_tag LOCUS_05940 11343 10186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05940 12925 11465 gene locus_tag LOCUS_05950 12925 11465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05950 13456 12935 gene locus_tag LOCUS_05960 gene ybeY 13456 12935 CDS product rRNA maturation RNase YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775754.1 protein_id gnl|my_center|LOCUS_05960 14608 13460 gene locus_tag LOCUS_05970 14608 13460 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228400.1 protein_id gnl|my_center|LOCUS_05970 15464 14691 gene locus_tag LOCUS_05980 15464 14691 CDS product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775758.1 protein_id gnl|my_center|LOCUS_05980 16764 15628 gene locus_tag LOCUS_05990 gene dnaJ 16764 15628 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976250.1 protein_id gnl|my_center|LOCUS_05990 16763 16966 gene locus_tag LOCUS_06000 16763 16966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06000 17044 17913 gene locus_tag LOCUS_06010 17044 17913 CDS product DUF3097 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775761.1 protein_id gnl|my_center|LOCUS_06010 18178 18597 gene locus_tag LOCUS_06020 18178 18597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06020 20524 19238 gene locus_tag LOCUS_06030 gene hemW 20524 19238 CDS product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016326185.1 protein_id gnl|my_center|LOCUS_06030 21617 20661 gene locus_tag LOCUS_06040 21617 20661 CDS product BsuBI/PstI family type II restriction endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389328.1 protein_id gnl|my_center|LOCUS_06040 23023 21614 gene locus_tag LOCUS_06050 23023 21614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06050 25099 23249 gene locus_tag LOCUS_06060 gene lepA 25099 23249 CDS product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083190386.1 protein_id gnl|my_center|LOCUS_06060 26209 25187 gene locus_tag LOCUS_06070 26209 25187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06070 26974 26711 gene locus_tag LOCUS_06080 gene rpsT 26974 26711 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775769.1 protein_id gnl|my_center|LOCUS_06080 27914 27243 gene locus_tag LOCUS_06090 27914 27243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06090 28964 27930 gene locus_tag LOCUS_06100 28964 27930 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775770.1 protein_id gnl|my_center|LOCUS_06100 31170 29119 gene locus_tag LOCUS_06110 31170 29119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06110 32405 31170 gene locus_tag LOCUS_06120 32405 31170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06120 33601 32636 gene locus_tag LOCUS_06130 gene whiA 33601 32636 CDS product DNA-binding protein WhiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976869.1 protein_id gnl|my_center|LOCUS_06130 34762 33710 gene locus_tag LOCUS_06140 gene yvcK 34762 33710 CDS product uridine diphosphate-N-acetylglucosamine-binding protein YvcK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028061.1 protein_id gnl|my_center|LOCUS_06140 35785 34871 gene locus_tag LOCUS_06150 gene rapZ 35785 34871 CDS product RNase adapter RapZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_093455885.1 protein_id gnl|my_center|LOCUS_06150 37614 36175 gene locus_tag LOCUS_06160 37614 36175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06160 38103 37645 gene locus_tag LOCUS_06170 38103 37645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06170 38969 38412 gene locus_tag LOCUS_06180 gene gmk 38969 38412 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805082.1 protein_id gnl|my_center|LOCUS_06180 39391 39011 gene locus_tag LOCUS_06190 gene mihF 39391 39011 CDS product integration host factor, actinobacterial type inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_110106423.1 protein_id gnl|my_center|LOCUS_06190 39791 39570 gene locus_tag LOCUS_06200 39791 39570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06200 40693 39797 gene locus_tag LOCUS_06210 gene pyrF 40693 39797 CDS product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485777.1 protein_id gnl|my_center|LOCUS_06210 44013 40693 gene locus_tag LOCUS_06220 gene carB 44013 40693 CDS product carbamoyl-phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977343.1 protein_id gnl|my_center|LOCUS_06220 45201 44014 gene locus_tag LOCUS_06230 gene carA 45201 44014 CDS product glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027810.1 protein_id gnl|my_center|LOCUS_06230 45947 45408 gene locus_tag LOCUS_06240 45947 45408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06240 47393 46092 gene locus_tag LOCUS_06250 47393 46092 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805076.1 protein_id gnl|my_center|LOCUS_06250 48425 47424 gene locus_tag LOCUS_06260 48425 47424 CDS product aspartate carbamoyltransferase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027811.1 protein_id gnl|my_center|LOCUS_06260 49090 48422 gene locus_tag LOCUS_06270 gene pyrR 49090 48422 CDS product bifunctional pyr operon transcriptional regulator/uracil phosphoribosyltransferase PyrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805074.1 protein_id gnl|my_center|LOCUS_06270 49417 50121 gene locus_tag LOCUS_06280 49417 50121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06280 50915 50505 gene locus_tag LOCUS_06290 50915 50505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06290 51478 50915 gene locus_tag LOCUS_06300 gene efp 51478 50915 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224610.1 protein_id gnl|my_center|LOCUS_06300 52834 51707 gene locus_tag LOCUS_06310 gene aroB 52834 51707 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027813.1 protein_id gnl|my_center|LOCUS_06310 54383 52860 gene locus_tag LOCUS_06320 54383 52860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06320 55600 54383 gene locus_tag LOCUS_06330 gene aroC 55600 54383 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977330.1 protein_id gnl|my_center|LOCUS_06330 56655 55720 gene locus_tag LOCUS_06340 56655 55720 CDS product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027816.1 protein_id gnl|my_center|LOCUS_06340 58096 56903 gene locus_tag LOCUS_06350 gene mltG 58096 56903 CDS product endolytic transglycosylase MltG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003823435.1 protein_id gnl|my_center|LOCUS_06350 58656 58093 gene locus_tag LOCUS_06360 gene ruvX 58656 58093 CDS product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775670.1 protein_id gnl|my_center|LOCUS_06360 61346 58659 gene locus_tag LOCUS_06370 gene alaS 61346 58659 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775671.1 protein_id gnl|my_center|LOCUS_06370 59895 59794 gene locus_tag LOCUS_t00140 59895 59794 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 61997 61512 gene locus_tag LOCUS_06380 61997 61512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06380 62434 61997 gene locus_tag LOCUS_06390 62434 61997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06390 63372 62740 gene locus_tag LOCUS_06400 gene rpsD 63372 62740 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775672.1 protein_id gnl|my_center|LOCUS_06400 64706 64071 gene locus_tag LOCUS_06410 64706 64071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06410 66255 64744 gene locus_tag LOCUS_06420 66255 64744 CDS product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977320.1 protein_id gnl|my_center|LOCUS_06420 66821 66387 gene locus_tag LOCUS_06430 gene dtd 66821 66387 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804517.1 protein_id gnl|my_center|LOCUS_06430 67437 66910 gene locus_tag LOCUS_06440 67437 66910 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013557.1 protein_id gnl|my_center|LOCUS_06440 69404 67632 gene locus_tag LOCUS_06450 gene aspS 69404 67632 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805009.1 protein_id gnl|my_center|LOCUS_06450 70589 69642 gene locus_tag LOCUS_06460 70589 69642 CDS product type IV toxin-antitoxin system AbiEi family antitoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727857.1 protein_id gnl|my_center|LOCUS_06460 72314 70953 gene locus_tag LOCUS_06470 gene hisS 72314 70953 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805006.1 protein_id gnl|my_center|LOCUS_06470 72690 72493 gene locus_tag LOCUS_06480 72690 72493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06480 72616 73884 gene locus_tag LOCUS_06490 72616 73884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06490 74776 74066 gene locus_tag LOCUS_06500 74776 74066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06500 75640 74903 gene locus_tag LOCUS_06510 75640 74903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06510 76487 75822 gene locus_tag LOCUS_06520 76487 75822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06520 77668 76961 gene locus_tag LOCUS_06530 77668 76961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06530 78311 78063 gene locus_tag LOCUS_06540 78311 78063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06540 82069 78677 gene locus_tag LOCUS_06550 82069 78677 CDS product type I restriction endonuclease subunit R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870273.1 protein_id gnl|my_center|LOCUS_06550 83430 82234 gene locus_tag LOCUS_06560 83430 82234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06560 85058 83433 gene locus_tag LOCUS_06570 85058 83433 CDS product type I restriction-modification system subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870275.1 protein_id gnl|my_center|LOCUS_06570 86439 85456 gene locus_tag LOCUS_06580 86439 85456 CDS product Abi family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946804.1 protein_id gnl|my_center|LOCUS_06580 89044 86567 gene locus_tag LOCUS_06590 gene relA 89044 86567 CDS product GTP pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977314.1 protein_id gnl|my_center|LOCUS_06590 90508 89339 gene locus_tag LOCUS_06600 gene secF 90508 89339 CDS product protein translocase subunit SecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805001.1 protein_id gnl|my_center|LOCUS_06600 92202 90511 gene locus_tag LOCUS_06610 gene secD 92202 90511 CDS product protein translocase subunit SecD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805000.1 protein_id gnl|my_center|LOCUS_06610 92661 92302 gene locus_tag LOCUS_06620 92661 92302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06620 94105 93002 gene locus_tag LOCUS_06630 gene ruvB 94105 93002 CDS product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977309.1 protein_id gnl|my_center|LOCUS_06630 94780 94160 gene locus_tag LOCUS_06640 gene ruvA 94780 94160 CDS product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005076202.1 protein_id gnl|my_center|LOCUS_06640 95693 95004 gene locus_tag LOCUS_06650 95693 95004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06650 96717 95959 gene locus_tag LOCUS_06660 96717 95959 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977306.1 protein_id gnl|my_center|LOCUS_06660 97620 96853 gene locus_tag LOCUS_06670 97620 96853 CDS product glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051560.1 protein_id gnl|my_center|LOCUS_06670 98894 97620 gene locus_tag LOCUS_06680 98894 97620 CDS product Mur ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068484.1 protein_id gnl|my_center|LOCUS_06680 98878 99033 gene locus_tag LOCUS_06690 98878 99033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06690 100328 99096 gene locus_tag LOCUS_06700 100328 99096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06700 101349 100774 gene locus_tag LOCUS_06710 101349 100774 CDS product HIT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804993.1 protein_id gnl|my_center|LOCUS_06710 102084 101437 gene locus_tag LOCUS_06720 102084 101437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06720 102776 102579 gene locus_tag LOCUS_06730 102776 102579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06730 104160 102709 gene locus_tag LOCUS_06740 104160 102709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06740 104472 104606 gene locus_tag LOCUS_06750 104472 104606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06750 104747 105742 gene locus_tag LOCUS_06760 104747 105742 CDS product restriction endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804173.1 protein_id gnl|my_center|LOCUS_06760 106068 108977 gene locus_tag LOCUS_06770 106068 108977 CDS product FAD-binding and (Fe-S)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031757.1 protein_id gnl|my_center|LOCUS_06770 110011 109061 gene locus_tag LOCUS_06780 110011 109061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06780 111187 110075 gene locus_tag LOCUS_06790 111187 110075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06790 112152 111673 gene locus_tag LOCUS_06800 112152 111673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06800 113253 113882 gene locus_tag LOCUS_06810 113253 113882 CDS product DJ-1/PfpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004450361.1 protein_id gnl|my_center|LOCUS_06810 113890 114414 gene locus_tag LOCUS_06820 113890 114414 CDS product DUF1697 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009910909.1 protein_id gnl|my_center|LOCUS_06820 114547 115119 gene locus_tag LOCUS_06830 114547 115119 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948303.1 protein_id gnl|my_center|LOCUS_06830 117380 115347 gene locus_tag LOCUS_06840 gene thrS 117380 115347 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804992.1 protein_id gnl|my_center|LOCUS_06840 117955 117512 gene locus_tag LOCUS_06850 117955 117512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06850 117851 118054 gene locus_tag LOCUS_06860 117851 118054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06860 120799 118085 gene locus_tag LOCUS_06870 120799 118085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06870 122605 121715 gene locus_tag LOCUS_06880 122605 121715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06880 123372 122674 gene locus_tag LOCUS_06890 123372 122674 CDS product biotin/lipoate A/B protein ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903895.1 protein_id gnl|my_center|LOCUS_06890 123661 125151 gene locus_tag LOCUS_06900 123661 125151 CDS product anion permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233725.1 protein_id gnl|my_center|LOCUS_06900 125343 126824 gene locus_tag LOCUS_06910 125343 126824 CDS product glycoside hydrolase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732872.1 protein_id gnl|my_center|LOCUS_06910 128137 127016 gene locus_tag LOCUS_06920 128137 127016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06920 131088 128200 gene locus_tag LOCUS_06930 gene uvrA 131088 128200 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028066.1 protein_id gnl|my_center|LOCUS_06930 132021 131215 gene locus_tag LOCUS_06940 132021 131215 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110825.1 protein_id gnl|my_center|LOCUS_06940 132465 132286 gene locus_tag LOCUS_06950 132465 132286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06950 135040 133328 gene locus_tag LOCUS_06960 135040 133328 CDS product formate--tetrahydrofolate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391657.1 protein_id gnl|my_center|LOCUS_06960 136322 135273 gene locus_tag LOCUS_06970 136322 135273 CDS product zinc-dependent alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804077.1 protein_id gnl|my_center|LOCUS_06970 137595 136618 gene locus_tag LOCUS_06980 gene nrdF 137595 136618 CDS product class 1b ribonucleoside-diphosphate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_070938867.1 protein_id gnl|my_center|LOCUS_06980 139923 137743 gene locus_tag LOCUS_06990 gene nrdE 139923 137743 CDS product class 1b ribonucleoside-diphosphate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014876938.1 protein_id gnl|my_center|LOCUS_06990 140423 139896 gene locus_tag LOCUS_07000 140423 139896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07000 140723 140499 gene locus_tag LOCUS_07010 140723 140499 CDS product redoxin NrdH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815707.1 protein_id gnl|my_center|LOCUS_07010 <142099 141497 gene locus_tag LOCUS_07020 <142099 141497 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164930149.1:DUF2183 domain-containing protein >Feature sequence06 1262 1558 gene locus_tag LOCUS_07030 1262 1558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07030 2823 1684 gene locus_tag LOCUS_07040 gene asd 2823 1684 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812646.1 protein_id gnl|my_center|LOCUS_07040 3569 2919 gene locus_tag LOCUS_07050 3569 2919 CDS product dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225957.1 protein_id gnl|my_center|LOCUS_07050 4473 3592 gene locus_tag LOCUS_07060 4473 3592 CDS product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004574972.1 protein_id gnl|my_center|LOCUS_07060 5634 4627 gene locus_tag LOCUS_07070 5634 4627 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776549.1 protein_id gnl|my_center|LOCUS_07070 8158 5885 gene locus_tag LOCUS_07080 8158 5885 CDS product RNA degradosome polyphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161270140.1 protein_id gnl|my_center|LOCUS_07080 9286 8225 gene locus_tag LOCUS_07090 gene mshD 9286 8225 CDS product mycothiol synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974818.1 protein_id gnl|my_center|LOCUS_07090 10147 9470 gene locus_tag LOCUS_07100 gene glnR 10147 9470 CDS product two-component system response regulator GlnR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029474.1 protein_id gnl|my_center|LOCUS_07100 10442 10561 gene locus_tag LOCUS_07110 10442 10561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07110 10781 11479 gene locus_tag LOCUS_07120 10781 11479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07120 11545 12780 gene locus_tag LOCUS_07130 11545 12780 CDS product folate-binding protein YgfZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974789.1 protein_id gnl|my_center|LOCUS_07130 13936 12905 gene locus_tag LOCUS_07140 13936 12905 CDS product ATP-dependent 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804723.1 protein_id gnl|my_center|LOCUS_07140 15630 14428 gene locus_tag LOCUS_07150 15630 14428 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029790.1 protein_id gnl|my_center|LOCUS_07150 15986 16059 gene locus_tag LOCUS_t00150 15986 16059 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 16136 16414 gene locus_tag LOCUS_07160 16136 16414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07160 16519 17265 gene locus_tag LOCUS_07170 gene nusG 16519 17265 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005080371.1 protein_id gnl|my_center|LOCUS_07170 17532 17960 gene locus_tag LOCUS_07180 gene rplK 17532 17960 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892734.1 protein_id gnl|my_center|LOCUS_07180 18098 18793 gene locus_tag LOCUS_07190 gene rplA 18098 18793 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403292.1 protein_id gnl|my_center|LOCUS_07190 19059 20033 gene locus_tag LOCUS_07200 gene tehA 19059 20033 CDS product dicarboxylate transporter/tellurite-resistance protein TehA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225019.1 protein_id gnl|my_center|LOCUS_07200 20134 21288 gene locus_tag LOCUS_07210 20134 21288 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037397743.1 protein_id gnl|my_center|LOCUS_07210 21688 22218 gene locus_tag LOCUS_07220 gene rplJ 21688 22218 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776392.1 protein_id gnl|my_center|LOCUS_07220 22374 22751 gene locus_tag LOCUS_07230 gene rplL 22374 22751 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776391.1 protein_id gnl|my_center|LOCUS_07230 23082 24623 gene locus_tag LOCUS_07240 23082 24623 CDS product sucrose-6-phosphate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009896953.1 protein_id gnl|my_center|LOCUS_07240 25086 24877 gene locus_tag LOCUS_07250 25086 24877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07250 25201 26862 gene locus_tag LOCUS_07260 25201 26862 CDS product sucrose-specific PTS transporter subunit IIBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015272.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_07260 27137 27790 gene locus_tag LOCUS_07270 27137 27790 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003862331.1 protein_id gnl|my_center|LOCUS_07270 28975 27899 gene locus_tag LOCUS_07280 28975 27899 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000226009.1 protein_id gnl|my_center|LOCUS_07280 30437 29124 gene locus_tag LOCUS_07290 30437 29124 CDS product molybdopterin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029253.1 protein_id gnl|my_center|LOCUS_07290 31283 30579 gene locus_tag LOCUS_07300 31283 30579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07300 31549 31283 gene locus_tag LOCUS_07310 31549 31283 CDS product MoaD/ThiS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003863405.1 protein_id gnl|my_center|LOCUS_07310 32865 31654 gene locus_tag LOCUS_07320 gene moaA 32865 31654 CDS product GTP 3',8-cyclase MoaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_106977887.1 protein_id gnl|my_center|LOCUS_07320 33095 33904 gene locus_tag LOCUS_07330 gene modA 33095 33904 CDS product molybdate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013478.1 protein_id gnl|my_center|LOCUS_07330 34014 34814 gene locus_tag LOCUS_07340 34014 34814 CDS product molybdenum ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013477.1 protein_id gnl|my_center|LOCUS_07340 34939 36318 gene locus_tag LOCUS_07350 34939 36318 CDS product molybdopterin molybdotransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013476.1 protein_id gnl|my_center|LOCUS_07350 36427 36927 gene locus_tag LOCUS_07360 gene moaC 36427 36927 CDS product cyclic pyranopterin monophosphate synthase MoaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013475.1 protein_id gnl|my_center|LOCUS_07360 36985 37503 gene locus_tag LOCUS_07370 36985 37503 CDS product MogA/MoaB family molybdenum cofactor biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013474.1 protein_id gnl|my_center|LOCUS_07370 37493 37999 gene locus_tag LOCUS_07380 37493 37999 CDS product molybdenum cofactor biosynthesis protein MoaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013473.1 protein_id gnl|my_center|LOCUS_07380 38128 39321 gene locus_tag LOCUS_07390 38128 39321 CDS product ThiF family adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013472.1 protein_id gnl|my_center|LOCUS_07390 39400 43119 gene locus_tag LOCUS_07400 39400 43119 CDS product nitrate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878246.1 protein_id gnl|my_center|LOCUS_07400 43119 44732 gene locus_tag LOCUS_07410 gene narH 43119 44732 CDS product nitrate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730341.1 protein_id gnl|my_center|LOCUS_07410 44736 45476 gene locus_tag LOCUS_07420 gene narJ 44736 45476 CDS product nitrate reductase molybdenum cofactor assembly chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775895.1 protein_id gnl|my_center|LOCUS_07420 45503 46336 gene locus_tag LOCUS_07430 gene narI 45503 46336 CDS product respiratory nitrate reductase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730339.1 protein_id gnl|my_center|LOCUS_07430 46367 47587 gene locus_tag LOCUS_07440 46367 47587 CDS product nitrate/nitrite transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730343.1 protein_id gnl|my_center|LOCUS_07440 47872 50712 gene locus_tag LOCUS_07450 gene gcvP 47872 50712 CDS product aminomethyl-transferring glycine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027754.1 protein_id gnl|my_center|LOCUS_07450 50885 52003 gene locus_tag LOCUS_07460 gene gcvT 50885 52003 CDS product glycine cleavage system aminomethyltransferase GcvT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223708.1 protein_id gnl|my_center|LOCUS_07460 52278 53774 gene locus_tag LOCUS_07470 52278 53774 CDS product L-serine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010908524.1 protein_id gnl|my_center|LOCUS_07470 54032 57538 gene locus_tag LOCUS_07480 gene rpoB 54032 57538 CDS product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029792.1 protein_id gnl|my_center|LOCUS_07480 57649 61551 gene locus_tag LOCUS_07490 57649 61551 CDS product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776388.1 protein_id gnl|my_center|LOCUS_07490 62069 64174 gene locus_tag LOCUS_07500 62069 64174 CDS product neutral/alkaline non-lysosomal ceramidase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900995.1 protein_id gnl|my_center|LOCUS_07500 64839 65213 gene locus_tag LOCUS_07510 gene rpsL 64839 65213 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003948652.1 protein_id gnl|my_center|LOCUS_07510 65213 65683 gene locus_tag LOCUS_07520 gene rpsG 65213 65683 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892787.1 protein_id gnl|my_center|LOCUS_07520 65756 67870 gene locus_tag LOCUS_07530 gene fusA 65756 67870 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776384.1 protein_id gnl|my_center|LOCUS_07530 68071 69261 gene locus_tag LOCUS_07540 gene tuf 68071 69261 CDS product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776383.1 protein_id gnl|my_center|LOCUS_07540 73267 69848 gene locus_tag LOCUS_07550 73267 69848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07550 73754 74062 gene locus_tag LOCUS_07560 gene rpsJ 73754 74062 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776378.1 protein_id gnl|my_center|LOCUS_07560 74076 74732 gene locus_tag LOCUS_07570 gene rplC 74076 74732 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776377.1 protein_id gnl|my_center|LOCUS_07570 74739 75356 gene locus_tag LOCUS_07580 gene rplD 74739 75356 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222605.1 protein_id gnl|my_center|LOCUS_07580 75356 75658 gene locus_tag LOCUS_07590 gene rplW 75356 75658 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776375.1 protein_id gnl|my_center|LOCUS_07590 75699 76535 gene locus_tag LOCUS_07600 gene rplB 75699 76535 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005055646.1 protein_id gnl|my_center|LOCUS_07600 76548 76829 gene locus_tag LOCUS_07610 gene rpsS 76548 76829 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403584.1 protein_id gnl|my_center|LOCUS_07610 76890 77255 gene locus_tag LOCUS_07620 gene rplV 76890 77255 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776372.1 protein_id gnl|my_center|LOCUS_07620 77256 78053 gene locus_tag LOCUS_07630 gene rpsC 77256 78053 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776371.1 protein_id gnl|my_center|LOCUS_07630 78054 78473 gene locus_tag LOCUS_07640 gene rplP 78054 78473 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974260.1 protein_id gnl|my_center|LOCUS_07640 78479 78718 gene locus_tag LOCUS_07650 gene rpmC 78479 78718 CDS product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403594.1 protein_id gnl|my_center|LOCUS_07650 78715 78987 gene locus_tag LOCUS_07660 gene rpsQ 78715 78987 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974258.1 protein_id gnl|my_center|LOCUS_07660 79478 82195 gene locus_tag LOCUS_07670 79478 82195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07670 83146 84336 gene locus_tag LOCUS_07680 83146 84336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07680 85018 85389 gene locus_tag LOCUS_07690 gene rplN 85018 85389 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974257.1 protein_id gnl|my_center|LOCUS_07690 85393 85728 gene locus_tag LOCUS_07700 gene rplX 85393 85728 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814523.1 protein_id gnl|my_center|LOCUS_07700 85728 86288 gene locus_tag LOCUS_07710 gene rplE 85728 86288 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974255.1 protein_id gnl|my_center|LOCUS_07710 86362 86760 gene locus_tag LOCUS_07720 gene rpsH 86362 86760 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892856.1 protein_id gnl|my_center|LOCUS_07720 86788 87324 gene locus_tag LOCUS_07730 gene rplF 86788 87324 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222612.1 protein_id gnl|my_center|LOCUS_07730 87327 87686 gene locus_tag LOCUS_07740 gene rplR 87327 87686 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776361.1 protein_id gnl|my_center|LOCUS_07740 87686 88360 gene locus_tag LOCUS_07750 gene rpsE 87686 88360 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776360.1 protein_id gnl|my_center|LOCUS_07750 88363 88569 gene locus_tag LOCUS_07760 gene rpmD 88363 88569 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974250.1 protein_id gnl|my_center|LOCUS_07760 88572 89018 gene locus_tag LOCUS_07770 gene rplO 88572 89018 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776358.1 protein_id gnl|my_center|LOCUS_07770 89299 90606 gene locus_tag LOCUS_07780 gene secY 89299 90606 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974248.1 protein_id gnl|my_center|LOCUS_07780 90603 91166 gene locus_tag LOCUS_07790 90603 91166 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776356.1 protein_id gnl|my_center|LOCUS_07790 91287 92126 gene locus_tag LOCUS_07800 gene map 91287 92126 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776355.1 protein_id gnl|my_center|LOCUS_07800 92251 93465 gene locus_tag LOCUS_07810 gene rlmN 92251 93465 CDS product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973380.1 protein_id gnl|my_center|LOCUS_07810 93752 93973 gene locus_tag LOCUS_07820 gene infA 93752 93973 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004558881.1 protein_id gnl|my_center|LOCUS_07820 94011 94211 gene locus_tag LOCUS_07830 94011 94211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07830 94392 94760 gene locus_tag LOCUS_07840 gene rpsM 94392 94760 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004105472.1 protein_id gnl|my_center|LOCUS_07840 94829 95236 gene locus_tag LOCUS_07850 gene rpsK 94829 95236 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003948617.1 protein_id gnl|my_center|LOCUS_07850 95376 96368 gene locus_tag LOCUS_07860 95376 96368 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776351.1 protein_id gnl|my_center|LOCUS_07860 96474 97127 gene locus_tag LOCUS_07870 gene rplQ 96474 97127 CDS product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003819143.1 protein_id gnl|my_center|LOCUS_07870 97301 98266 gene locus_tag LOCUS_07880 gene truA 97301 98266 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776325.1 protein_id gnl|my_center|LOCUS_07880 98632 99075 gene locus_tag LOCUS_07890 gene rplM 98632 99075 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776324.1 protein_id gnl|my_center|LOCUS_07890 99108 99599 gene locus_tag LOCUS_07900 gene rpsI 99108 99599 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776323.1 protein_id gnl|my_center|LOCUS_07900 99780 100847 gene locus_tag LOCUS_07910 gene ppk2 99780 100847 CDS product polyphosphate kinase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005082944.1 protein_id gnl|my_center|LOCUS_07910 101091 102449 gene locus_tag LOCUS_07920 gene glmM 101091 102449 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974237.1 protein_id gnl|my_center|LOCUS_07920 102993 102619 gene locus_tag LOCUS_07930 gene mscL 102993 102619 CDS product large conductance mechanosensitive channel protein MscL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815058.1 protein_id gnl|my_center|LOCUS_07930 104194 103286 gene locus_tag LOCUS_07940 104194 103286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07940 105313 104357 gene locus_tag LOCUS_07950 gene coaA 105313 104357 CDS product type I pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776319.1 protein_id gnl|my_center|LOCUS_07950 105498 107381 gene locus_tag LOCUS_07960 gene glmS 105498 107381 CDS product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015000.1 protein_id gnl|my_center|LOCUS_07960 107660 108100 gene locus_tag LOCUS_07970 107660 108100 CDS product holo-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974229.1 protein_id gnl|my_center|LOCUS_07970 108186 109772 gene locus_tag LOCUS_07980 108186 109772 CDS product bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029833.1 protein_id gnl|my_center|LOCUS_07980 111480 109999 gene locus_tag LOCUS_07990 111480 109999 CDS product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803920.1 protein_id gnl|my_center|LOCUS_07990 112772 111990 gene locus_tag LOCUS_08000 112772 111990 CDS product phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976029.1 protein_id gnl|my_center|LOCUS_08000 114063 112801 gene locus_tag LOCUS_08010 gene mshA 114063 112801 CDS product D-inositol-3-phosphate glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742053.1 protein_id gnl|my_center|LOCUS_08010 114202 115515 gene locus_tag LOCUS_08020 gene alr 114202 115515 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029835.1 protein_id gnl|my_center|LOCUS_08020 115515 116114 gene locus_tag LOCUS_08030 115515 116114 CDS product bifunctional tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE/phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776314.1 protein_id gnl|my_center|LOCUS_08030 116138 116965 gene locus_tag LOCUS_08040 gene tsaB 116138 116965 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776313.1 protein_id gnl|my_center|LOCUS_08040 116966 117475 gene locus_tag LOCUS_08050 gene rimI 116966 117475 CDS product ribosomal protein S18-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029840.1 protein_id gnl|my_center|LOCUS_08050 117620 118720 gene locus_tag LOCUS_08060 gene tsaD 117620 118720 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029841.1 protein_id gnl|my_center|LOCUS_08060 120037 118889 gene locus_tag LOCUS_08070 120037 118889 CDS product glutamate--cysteine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224327.1 protein_id gnl|my_center|LOCUS_08070 121832 120357 gene locus_tag LOCUS_08080 121832 120357 CDS product 50S ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804479.1 protein_id gnl|my_center|LOCUS_08080 122059 122346 gene locus_tag LOCUS_08090 gene groES 122059 122346 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004559922.1 protein_id gnl|my_center|LOCUS_08090 122452 124038 gene locus_tag LOCUS_08100 gene groL 122452 124038 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804492.1 protein_id gnl|my_center|LOCUS_08100 124348 125865 gene locus_tag LOCUS_08110 gene guaB 124348 125865 CDS product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804497.1 protein_id gnl|my_center|LOCUS_08110 126011 127141 gene locus_tag LOCUS_08120 126011 127141 CDS product GuaB3 family IMP dehydrogenase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813354.1 protein_id gnl|my_center|LOCUS_08120 >Feature sequence07 <1 2049 gene locus_tag LOCUS_08130 <1 2049 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015776827.1:cbb3-type cytochrome c oxidase subunit I 2052 2894 gene locus_tag LOCUS_08140 2052 2894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776826.1 protein_id gnl|my_center|LOCUS_08140 3182 3955 gene locus_tag LOCUS_08150 3182 3955 CDS product slipin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776825.1 protein_id gnl|my_center|LOCUS_08150 6176 4431 gene locus_tag LOCUS_08160 6176 4431 CDS product bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013399395.1 protein_id gnl|my_center|LOCUS_08160 8359 6611 gene locus_tag LOCUS_08170 8359 6611 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230757.1 protein_id gnl|my_center|LOCUS_08170 10247 8361 gene locus_tag LOCUS_08180 10247 8361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08180 10698 13298 gene locus_tag LOCUS_08190 10698 13298 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222778.1 protein_id gnl|my_center|LOCUS_08190 13422 14855 gene locus_tag LOCUS_08200 13422 14855 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707224.1 protein_id gnl|my_center|LOCUS_08200 16164 14962 gene locus_tag LOCUS_08210 16164 14962 CDS product TerC/Alx family metal homeostasis membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_179943937.1 protein_id gnl|my_center|LOCUS_08210 17343 16492 gene locus_tag LOCUS_08220 17343 16492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08220 19625 17457 gene locus_tag LOCUS_08230 gene uvrB 19625 17457 CDS product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028069.1 protein_id gnl|my_center|LOCUS_08230 21092 19776 gene locus_tag LOCUS_08240 21092 19776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08240 21988 21302 gene locus_tag LOCUS_08250 21988 21302 CDS product YigZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014898.1 protein_id gnl|my_center|LOCUS_08250 22048 22689 gene locus_tag LOCUS_08260 22048 22689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08260 24347 22893 gene locus_tag LOCUS_08270 gene rpsA 24347 22893 CDS product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805100.1 protein_id gnl|my_center|LOCUS_08270 28089 25087 gene locus_tag LOCUS_08280 gene polA 28089 25087 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467407.1 protein_id gnl|my_center|LOCUS_08280 28577 29854 gene locus_tag LOCUS_08290 28577 29854 CDS product dicarboxylate/amino acid:cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870329.1 protein_id gnl|my_center|LOCUS_08290 29992 30498 gene locus_tag LOCUS_08300 29992 30498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08300 30625 30873 gene locus_tag LOCUS_08310 30625 30873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08310 31784 31173 gene locus_tag LOCUS_08320 31784 31173 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805096.1 protein_id gnl|my_center|LOCUS_08320 32221 33123 gene locus_tag LOCUS_08330 32221 33123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08330 34311 33262 gene locus_tag LOCUS_08340 34311 33262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08340 34772 35683 gene locus_tag LOCUS_08350 34772 35683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08350 35893 36789 gene locus_tag LOCUS_08360 35893 36789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08360 37577 36876 gene locus_tag LOCUS_08370 37577 36876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08370 39016 37910 gene locus_tag LOCUS_08380 gene ftsY 39016 37910 CDS product signal recognition particle-docking protein FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164278219.1 protein_id gnl|my_center|LOCUS_08380 39216 39028 gene locus_tag LOCUS_08390 39216 39028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08390 39200 40618 gene locus_tag LOCUS_08400 39200 40618 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014146.1 protein_id gnl|my_center|LOCUS_08400 41922 41107 gene locus_tag LOCUS_08410 gene trpC 41922 41107 CDS product indole-3-glycerol phosphate synthase TrpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805091.1 protein_id gnl|my_center|LOCUS_08410 43547 41937 gene locus_tag LOCUS_08420 43547 41937 CDS product anthranilate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805087.1 protein_id gnl|my_center|LOCUS_08420 44321 43845 gene locus_tag LOCUS_08430 gene ribH 44321 43845 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977385.1 protein_id gnl|my_center|LOCUS_08430 45149 44379 gene locus_tag LOCUS_08440 45149 44379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08440 46450 45158 gene locus_tag LOCUS_08450 46450 45158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08450 48026 46716 gene locus_tag LOCUS_08460 gene ribD 48026 46716 CDS product bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803669.1 protein_id gnl|my_center|LOCUS_08460 48758 48027 gene locus_tag LOCUS_08470 gene pnuC 48758 48027 CDS product nicotinamide riboside transporter PnuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805208.1 protein_id gnl|my_center|LOCUS_08470 51682 50411 gene locus_tag LOCUS_08480 51682 50411 CDS product beta-ketoacyl-[acyl-carrier-protein] synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775710.1 protein_id gnl|my_center|LOCUS_08480 52144 51902 gene locus_tag LOCUS_08490 52144 51902 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775709.1 protein_id gnl|my_center|LOCUS_08490 53373 52348 gene locus_tag LOCUS_08500 53373 52348 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775708.1 protein_id gnl|my_center|LOCUS_08500 54390 53491 gene locus_tag LOCUS_08510 54390 53491 CDS product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775707.1 protein_id gnl|my_center|LOCUS_08510 55763 54642 gene locus_tag LOCUS_08520 55763 54642 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728395.1 protein_id gnl|my_center|LOCUS_08520 57764 56052 gene locus_tag LOCUS_08530 57764 56052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08530 59480 57942 gene locus_tag LOCUS_08540 59480 57942 CDS product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804630.1 protein_id gnl|my_center|LOCUS_08540 59950 59480 gene locus_tag LOCUS_08550 59950 59480 CDS product YraN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804629.1 protein_id gnl|my_center|LOCUS_08550 60595 60269 gene locus_tag LOCUS_08560 60595 60269 CDS product DUF2469 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005056986.1 protein_id gnl|my_center|LOCUS_08560 61524 60694 gene locus_tag LOCUS_08570 61524 60694 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029414600.1 protein_id gnl|my_center|LOCUS_08570 62682 61531 gene locus_tag LOCUS_08580 62682 61531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08580 63224 62877 gene locus_tag LOCUS_08590 gene rplS 63224 62877 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414717.1 protein_id gnl|my_center|LOCUS_08590 63387 63211 gene locus_tag LOCUS_08600 63387 63211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08600 63978 63442 gene locus_tag LOCUS_08610 63978 63442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08610 64340 65236 gene locus_tag LOCUS_08620 64340 65236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08620 65419 65344 gene locus_tag LOCUS_t00160 65419 65344 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 67200 65527 gene locus_tag LOCUS_08630 gene mptB 67200 65527 CDS product polyprenol phosphomannose-dependent alpha 1,6 mannosyltransferase MptB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010907824.1 protein_id gnl|my_center|LOCUS_08630 68037 68136 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 68377 68451 gene locus_tag LOCUS_t00170 68377 68451 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 68680 69252 gene locus_tag LOCUS_08640 68680 69252 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003862894.1 protein_id gnl|my_center|LOCUS_08640 69961 70752 gene locus_tag LOCUS_08650 gene yaaA 69961 70752 CDS product peroxide stress protein YaaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976516.1 protein_id gnl|my_center|LOCUS_08650 71128 72198 gene locus_tag LOCUS_08660 71128 72198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08660 72495 72292 gene locus_tag LOCUS_08670 72495 72292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08670 72690 74681 gene locus_tag LOCUS_08680 72690 74681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08680 74916 78155 gene locus_tag LOCUS_08690 74916 78155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08690 78471 80417 gene locus_tag LOCUS_08700 78471 80417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08700 80760 82739 gene locus_tag LOCUS_08710 80760 82739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08710 83159 84991 gene locus_tag LOCUS_08720 83159 84991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08720 85447 86331 gene locus_tag LOCUS_08730 85447 86331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08730 86667 88625 gene locus_tag LOCUS_08740 86667 88625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08740 88941 90476 gene locus_tag LOCUS_08750 88941 90476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08750 90765 92336 gene locus_tag LOCUS_08760 90765 92336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08760 93459 92515 gene locus_tag LOCUS_08770 93459 92515 CDS product Nif3-like dinuclear metal center hexameric protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389779.1 protein_id gnl|my_center|LOCUS_08770 93557 94078 gene locus_tag LOCUS_08780 gene msrA 93557 94078 CDS product peptide-methionine (S)-S-oxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257533.1 protein_id gnl|my_center|LOCUS_08780 94293 95069 gene locus_tag LOCUS_08790 94293 95069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08790 95210 96001 gene locus_tag LOCUS_08800 95210 96001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08800 96239 97003 gene locus_tag LOCUS_08810 96239 97003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08810 97311 98081 gene locus_tag LOCUS_08820 97311 98081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08820 98331 99083 gene locus_tag LOCUS_08830 98331 99083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08830 99124 99909 gene locus_tag LOCUS_08840 99124 99909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08840 100016 100789 gene locus_tag LOCUS_08850 100016 100789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08850 101023 101733 gene locus_tag LOCUS_08860 101023 101733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08860 101925 102629 gene locus_tag LOCUS_08870 101925 102629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08870 102803 103645 gene locus_tag LOCUS_08880 102803 103645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08880 104195 104122 gene locus_tag LOCUS_t00180 104195 104122 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 106697 104502 gene locus_tag LOCUS_08890 106697 104502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08890 >Feature sequence08 <1 713 gene locus_tag LOCUS_08900 <1 713 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003976232.1:leucine--tRNA ligase 909 1976 gene locus_tag LOCUS_08910 909 1976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08910 2499 3503 gene locus_tag LOCUS_08920 gene gap 2499 3503 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224666.1 protein_id gnl|my_center|LOCUS_08920 3846 5069 gene locus_tag LOCUS_08930 3846 5069 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224667.1 protein_id gnl|my_center|LOCUS_08930 5497 6087 gene locus_tag LOCUS_08940 5497 6087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08940 6167 6955 gene locus_tag LOCUS_08950 6167 6955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08950 7223 14110 gene locus_tag LOCUS_08960 7223 14110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08960 14164 14919 gene locus_tag LOCUS_08970 14164 14919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08970 14934 15800 gene locus_tag LOCUS_08980 14934 15800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08980 15859 16461 gene locus_tag LOCUS_08990 15859 16461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08990 16464 17345 gene locus_tag LOCUS_09000 16464 17345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09000 17415 17987 gene locus_tag LOCUS_09010 17415 17987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09010 18232 19008 gene locus_tag LOCUS_09020 gene tpiA 18232 19008 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976873.1 protein_id gnl|my_center|LOCUS_09020 19235 19699 gene locus_tag LOCUS_09030 19235 19699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09030 19808 20065 gene locus_tag LOCUS_09040 gene secG 19808 20065 CDS product preprotein translocase subunit SecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813271.1 protein_id gnl|my_center|LOCUS_09040 20256 21665 gene locus_tag LOCUS_09050 20256 21665 CDS product SWIM zinc finger domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027699.1 protein_id gnl|my_center|LOCUS_09050 21748 24525 gene locus_tag LOCUS_09060 21748 24525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09060 24604 27555 gene locus_tag LOCUS_09070 24604 27555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09070 28011 30641 gene locus_tag LOCUS_09080 28011 30641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09080 31114 30767 gene locus_tag LOCUS_09090 31114 30767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09090 32326 31235 gene locus_tag LOCUS_09100 32326 31235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09100 33305 32319 gene locus_tag LOCUS_09110 33305 32319 CDS product glucose-6-phosphate dehydrogenase assembly protein OpcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_122823891.1 protein_id gnl|my_center|LOCUS_09110 34849 33302 gene locus_tag LOCUS_09120 gene zwf 34849 33302 CDS product glucose-6-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805125.1 protein_id gnl|my_center|LOCUS_09120 36199 35099 gene locus_tag LOCUS_09130 gene tal 36199 35099 CDS product transaldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728814.1 protein_id gnl|my_center|LOCUS_09130 38473 36371 gene locus_tag LOCUS_09140 gene tkt 38473 36371 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167022841.1 protein_id gnl|my_center|LOCUS_09140 39997 39176 gene locus_tag LOCUS_09150 39997 39176 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805060.1 protein_id gnl|my_center|LOCUS_09150 41127 39994 gene locus_tag LOCUS_09160 41127 39994 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976891.1 protein_id gnl|my_center|LOCUS_09160 41302 42162 gene locus_tag LOCUS_09170 41302 42162 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742174.1 protein_id gnl|my_center|LOCUS_09170 42360 43817 gene locus_tag LOCUS_09180 gene sufB 42360 43817 CDS product Fe-S cluster assembly protein SufB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976894.1 protein_id gnl|my_center|LOCUS_09180 43817 45091 gene locus_tag LOCUS_09190 gene sufD 43817 45091 CDS product Fe-S cluster assembly protein SufD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224698.1 protein_id gnl|my_center|LOCUS_09190 45111 45869 gene locus_tag LOCUS_09200 gene sufC 45111 45869 CDS product Fe-S cluster assembly ATPase SufC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805067.1 protein_id gnl|my_center|LOCUS_09200 45910 46239 gene locus_tag LOCUS_09210 45910 46239 CDS product metal-sulfur cluster assembly factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224702.1 protein_id gnl|my_center|LOCUS_09210 46474 47052 gene locus_tag LOCUS_09220 46474 47052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09220 47632 47132 gene locus_tag LOCUS_09230 47632 47132 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000381519.1 protein_id gnl|my_center|LOCUS_09230 48173 49027 gene locus_tag LOCUS_09240 48173 49027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09240 49781 49107 gene locus_tag LOCUS_09250 49781 49107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09250 50619 49771 gene locus_tag LOCUS_09260 50619 49771 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813870.1 protein_id gnl|my_center|LOCUS_09260 51353 50712 gene locus_tag LOCUS_09270 51353 50712 CDS product biotin transporter BioY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391691.1 protein_id gnl|my_center|LOCUS_09270 51646 53244 gene locus_tag LOCUS_09280 51646 53244 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976982.1 protein_id gnl|my_center|LOCUS_09280 54747 54019 gene locus_tag LOCUS_09290 54747 54019 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804305.1 protein_id gnl|my_center|LOCUS_09290 55164 54937 gene locus_tag LOCUS_09300 55164 54937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09300 55451 56167 gene locus_tag LOCUS_09310 gene fabG 55451 56167 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977008.1 protein_id gnl|my_center|LOCUS_09310 56240 56983 gene locus_tag LOCUS_09320 56240 56983 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776018.1 protein_id gnl|my_center|LOCUS_09320 57228 58016 gene locus_tag LOCUS_09330 57228 58016 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284427.1 protein_id gnl|my_center|LOCUS_09330 58013 58891 gene locus_tag LOCUS_09340 58013 58891 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930212.1 protein_id gnl|my_center|LOCUS_09340 59144 59398 gene locus_tag LOCUS_09350 59144 59398 CDS product type B 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858446.1 protein_id gnl|my_center|LOCUS_09350 59726 60913 gene locus_tag LOCUS_09360 59726 60913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09360 62391 61135 gene locus_tag LOCUS_09370 62391 61135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09370 65453 62781 gene locus_tag LOCUS_09380 gene pepN 65453 62781 CDS product aminopeptidase N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016326219.1 protein_id gnl|my_center|LOCUS_09380 65676 65762 gene locus_tag LOCUS_t00190 65676 65762 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 67029 65944 gene locus_tag LOCUS_09390 67029 65944 CDS product 2,3-butanediol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206671.1 protein_id gnl|my_center|LOCUS_09390 67370 68965 gene locus_tag LOCUS_09400 67370 68965 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776842.1 protein_id gnl|my_center|LOCUS_09400 69254 70213 gene locus_tag LOCUS_09410 69254 70213 CDS product L-lactate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004112440.1 protein_id gnl|my_center|LOCUS_09410 70602 70877 gene locus_tag LOCUS_09420 70602 70877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09420 71069 71920 gene locus_tag LOCUS_09430 gene recO 71069 71920 CDS product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815260.1 protein_id gnl|my_center|LOCUS_09430 72096 72887 gene locus_tag LOCUS_09440 72096 72887 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228389.1 protein_id gnl|my_center|LOCUS_09440 72957 74045 gene locus_tag LOCUS_09450 72957 74045 CDS product quinone-dependent dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977344.1 protein_id gnl|my_center|LOCUS_09450 74496 75230 gene locus_tag LOCUS_09460 74496 75230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09460 75438 76094 gene locus_tag LOCUS_09470 75438 76094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09470 76890 76261 gene locus_tag LOCUS_09480 76890 76261 CDS product DUF3043 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812622.1 protein_id gnl|my_center|LOCUS_09480 77028 78422 gene locus_tag LOCUS_09490 77028 78422 CDS product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805011.1 protein_id gnl|my_center|LOCUS_09490 78655 79008 gene locus_tag LOCUS_09500 gene erpA 78655 79008 CDS product iron-sulfur cluster insertion protein ErpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805013.1 protein_id gnl|my_center|LOCUS_09500 79211 80182 gene locus_tag LOCUS_09510 gene trpD 79211 80182 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028166.1 protein_id gnl|my_center|LOCUS_09510 80718 81167 gene locus_tag LOCUS_09520 80718 81167 CDS product NfeD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005057865.1 protein_id gnl|my_center|LOCUS_09520 81260 82276 gene locus_tag LOCUS_09530 81260 82276 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027982.1 protein_id gnl|my_center|LOCUS_09530 82466 82804 gene locus_tag LOCUS_09540 gene rbpA 82466 82804 CDS product RNA polymerase-binding protein RbpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003410601.1 protein_id gnl|my_center|LOCUS_09540 83759 83025 gene locus_tag LOCUS_09550 83759 83025 CDS product polyprenol monophosphomannose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895306.1 protein_id gnl|my_center|LOCUS_09550 85073 83895 gene locus_tag LOCUS_09560 85073 83895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09560 88413 85357 gene locus_tag LOCUS_09570 88413 85357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09570 88467 88685 gene locus_tag LOCUS_09580 88467 88685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09580 89563 88682 gene locus_tag LOCUS_09590 gene tatC 89563 88682 CDS product twin-arginine translocase subunit TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977194.1 protein_id gnl|my_center|LOCUS_09590 89942 89697 gene locus_tag LOCUS_09600 89942 89697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09600 90307 89960 gene locus_tag LOCUS_09610 90307 89960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09610 92629 90380 gene locus_tag LOCUS_09620 92629 90380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09620 93263 92868 gene locus_tag LOCUS_09630 93263 92868 CDS product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805213.1 protein_id gnl|my_center|LOCUS_09630 94436 93378 gene locus_tag LOCUS_09640 94436 93378 CDS product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068443.1 protein_id gnl|my_center|LOCUS_09640 96069 94597 gene locus_tag LOCUS_09650 gene pafA 96069 94597 CDS product Pup--protein ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226720.1 protein_id gnl|my_center|LOCUS_09650 96293 96099 gene locus_tag LOCUS_09660 96293 96099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09660 98300 96489 gene locus_tag LOCUS_09670 gene dop 98300 96489 CDS product depupylase/deamidase Dop inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775655.1 protein_id gnl|my_center|LOCUS_09670 <99121 98442 gene locus_tag LOCUS_09680 <99121 98442 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_034284603.1:proteasome ATPase >Feature sequence09 3801 430 gene locus_tag LOCUS_09690 3801 430 CDS product bifunctional [glutamine synthetase] adenylyltransferase/[glutamine synthetase]-adenylyl-L-tyrosine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028215.1 protein_id gnl|my_center|LOCUS_09690 5302 3962 gene locus_tag LOCUS_09700 gene glnA 5302 3962 CDS product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976572.1 protein_id gnl|my_center|LOCUS_09700 5789 7597 gene locus_tag LOCUS_09710 5789 7597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09710 7664 8578 gene locus_tag LOCUS_09720 gene panB 7664 8578 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223113.1 protein_id gnl|my_center|LOCUS_09720 8989 8732 gene locus_tag LOCUS_09730 8989 8732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09730 9249 10160 gene locus_tag LOCUS_09740 gene map 9249 10160 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976546.1 protein_id gnl|my_center|LOCUS_09740 10273 11124 gene locus_tag LOCUS_09750 10273 11124 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973919.1 protein_id gnl|my_center|LOCUS_09750 11717 11262 gene locus_tag LOCUS_09760 gene nrdR 11717 11262 CDS product transcriptional regulator NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804686.1 protein_id gnl|my_center|LOCUS_09760 15435 11893 gene locus_tag LOCUS_09770 gene dnaE 15435 11893 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804720.1 protein_id gnl|my_center|LOCUS_09770 16512 15526 gene locus_tag LOCUS_09780 16512 15526 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005057888.1 protein_id gnl|my_center|LOCUS_09780 17259 16594 gene locus_tag LOCUS_09790 17259 16594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09790 18140 17601 gene locus_tag LOCUS_09800 18140 17601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09800 18920 18621 gene locus_tag LOCUS_09810 18920 18621 CDS product YggT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804708.1 protein_id gnl|my_center|LOCUS_09810 19824 18931 gene locus_tag LOCUS_09820 19824 18931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09820 20911 20078 gene locus_tag LOCUS_09830 20911 20078 CDS product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224822.1 protein_id gnl|my_center|LOCUS_09830 21809 20961 gene locus_tag LOCUS_09840 gene pgeF 21809 20961 CDS product peptidoglycan editing factor PgeF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804706.1 protein_id gnl|my_center|LOCUS_09840 23140 21959 gene locus_tag LOCUS_09850 gene ftsZ 23140 21959 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976733.1 protein_id gnl|my_center|LOCUS_09850 25031 23337 gene locus_tag LOCUS_09860 25031 23337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09860 26534 25035 gene locus_tag LOCUS_09870 gene murC 26534 25035 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030625.1 protein_id gnl|my_center|LOCUS_09870 27634 26534 gene locus_tag LOCUS_09880 gene murG 27634 26534 CDS product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804702.1 protein_id gnl|my_center|LOCUS_09880 30059 27819 gene locus_tag LOCUS_09890 30059 27819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09890 31795 30209 gene locus_tag LOCUS_09900 gene murD 31795 30209 CDS product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804700.1 protein_id gnl|my_center|LOCUS_09900 33000 31795 gene locus_tag LOCUS_09910 gene mraY 33000 31795 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228040.1 protein_id gnl|my_center|LOCUS_09910 34626 33007 gene locus_tag LOCUS_09920 34626 33007 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976727.1 protein_id gnl|my_center|LOCUS_09920 36364 34619 gene locus_tag LOCUS_09930 36364 34619 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729660.1 protein_id gnl|my_center|LOCUS_09930 38398 36533 gene locus_tag LOCUS_09940 38398 36533 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804696.1 protein_id gnl|my_center|LOCUS_09940 39477 38461 gene locus_tag LOCUS_09950 39477 38461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09950 40562 39498 gene locus_tag LOCUS_09960 gene rsmH 40562 39498 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729663.1 protein_id gnl|my_center|LOCUS_09960 41095 40664 gene locus_tag LOCUS_09970 41095 40664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09970 42053 41652 gene locus_tag LOCUS_09980 42053 41652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09980 43748 42294 gene locus_tag LOCUS_09990 43748 42294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09990 43934 45166 gene locus_tag LOCUS_10000 43934 45166 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224198.1 protein_id gnl|my_center|LOCUS_10000 45637 45269 gene locus_tag LOCUS_10010 45637 45269 CDS product Rv2175c family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805032.1 protein_id gnl|my_center|LOCUS_10010 45885 47573 gene locus_tag LOCUS_10020 45885 47573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10020 49072 47708 gene locus_tag LOCUS_10030 49072 47708 CDS product 3-deoxy-7-phosphoheptulonate synthase class II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_174265947.1 protein_id gnl|my_center|LOCUS_10030 50144 49395 gene locus_tag LOCUS_10040 50144 49395 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895641.1 protein_id gnl|my_center|LOCUS_10040 50367 51233 gene locus_tag LOCUS_10050 50367 51233 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805028.1 protein_id gnl|my_center|LOCUS_10050 51384 53573 gene locus_tag LOCUS_10060 51384 53573 CDS product AMP-dependent synthetase/ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805025.1 protein_id gnl|my_center|LOCUS_10060 55158 53701 gene locus_tag LOCUS_10070 gene mtr 55158 53701 CDS product mycothione reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014816.1 protein_id gnl|my_center|LOCUS_10070 56246 55434 gene locus_tag LOCUS_10080 56246 55434 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805154.1 protein_id gnl|my_center|LOCUS_10080 57085 56438 gene locus_tag LOCUS_10090 57085 56438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10090 58574 57801 gene locus_tag LOCUS_10100 58574 57801 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027756.1 protein_id gnl|my_center|LOCUS_10100 59563 59171 gene locus_tag LOCUS_10110 gene gcvH 59563 59171 CDS product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226819.1 protein_id gnl|my_center|LOCUS_10110 63419 59928 gene locus_tag LOCUS_10120 63419 59928 CDS product proline dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197702416.1 protein_id gnl|my_center|LOCUS_10120 63931 64857 gene locus_tag LOCUS_10130 63931 64857 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775749.1 protein_id gnl|my_center|LOCUS_10130 65821 65039 gene locus_tag LOCUS_10140 65821 65039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10140 67209 65833 gene locus_tag LOCUS_10150 67209 65833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10150 68450 67503 gene locus_tag LOCUS_10160 68450 67503 CDS product sugar-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_036462291.1 protein_id gnl|my_center|LOCUS_10160 68574 70319 gene locus_tag LOCUS_10170 68574 70319 CDS product glycerol-3-phosphate dehydrogenase/oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776958.1 protein_id gnl|my_center|LOCUS_10170 70664 71461 gene locus_tag LOCUS_10180 70664 71461 CDS product MIP/aquaporin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776957.1 protein_id gnl|my_center|LOCUS_10180 71504 73060 gene locus_tag LOCUS_10190 gene glpK 71504 73060 CDS product glycerol kinase GlpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776956.1 protein_id gnl|my_center|LOCUS_10190 73732 74046 gene locus_tag LOCUS_10200 73732 74046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10200 74735 74154 gene locus_tag LOCUS_10210 74735 74154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10210 75073 75684 gene locus_tag LOCUS_10220 75073 75684 CDS product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804574.1 protein_id gnl|my_center|LOCUS_10220 75898 76686 gene locus_tag LOCUS_10230 75898 76686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10230 77191 76802 gene locus_tag LOCUS_10240 77191 76802 CDS product DUF1304 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015615.1 protein_id gnl|my_center|LOCUS_10240 79059 77437 gene locus_tag LOCUS_10250 79059 77437 CDS product L-lactate permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246465.1 protein_id gnl|my_center|LOCUS_10250 81205 79568 gene locus_tag LOCUS_10260 81205 79568 CDS product L-lactate permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246465.1 protein_id gnl|my_center|LOCUS_10260 81858 81784 gene locus_tag LOCUS_t00200 81858 81784 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 83679 82099 gene locus_tag LOCUS_10270 gene der 83679 82099 CDS product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977066.1 protein_id gnl|my_center|LOCUS_10270 84484 83792 gene locus_tag LOCUS_10280 84484 83792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10280 85708 84539 gene locus_tag LOCUS_10290 85708 84539 CDS product prephenate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805132.1 protein_id gnl|my_center|LOCUS_10290 86887 85727 gene locus_tag LOCUS_10300 86887 85727 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027963.1 protein_id gnl|my_center|LOCUS_10300 88170 87145 gene locus_tag LOCUS_10310 88170 87145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10310 87148 87247 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 89170 88163 gene locus_tag LOCUS_10320 89170 88163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_10320 90221 89361 gene locus_tag LOCUS_10330 90221 89361 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805130.1 protein_id gnl|my_center|LOCUS_10330 91635 90316 gene locus_tag LOCUS_10340 91635 90316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10340 92403 91729 gene locus_tag LOCUS_10350 92403 91729 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977050.1 protein_id gnl|my_center|LOCUS_10350 94259 92565 gene locus_tag LOCUS_10360 94259 92565 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063606961.1 protein_id gnl|my_center|LOCUS_10360 96318 94600 gene locus_tag LOCUS_10370 gene recN 96318 94600 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016325905.1 protein_id gnl|my_center|LOCUS_10370 97360 96338 gene locus_tag LOCUS_10380 97360 96338 CDS product NAD kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027973.1 protein_id gnl|my_center|LOCUS_10380 >Feature sequence10 2156 1296 gene locus_tag LOCUS_10390 gene rfbA 2156 1296 CDS product glucose-1-phosphate thymidylyltransferase RfbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803925.1 protein_id gnl|my_center|LOCUS_10390 2231 3229 gene locus_tag LOCUS_10400 gene rfbB 2231 3229 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803926.1 protein_id gnl|my_center|LOCUS_10400 3229 4653 gene locus_tag LOCUS_10410 3229 4653 CDS product bifunctional dTDP-4-dehydrorhamnose 3,5-epimerase family protein/NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803927.1 protein_id gnl|my_center|LOCUS_10410 4898 5557 gene locus_tag LOCUS_10420 4898 5557 CDS product 50S ribosomal protein L25/general stress protein Ctc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005092871.1 protein_id gnl|my_center|LOCUS_10420 5704 6291 gene locus_tag LOCUS_10430 gene pth 5704 6291 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804953.1 protein_id gnl|my_center|LOCUS_10430 6496 7794 gene locus_tag LOCUS_10440 6496 7794 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224700.1 protein_id gnl|my_center|LOCUS_10440 7861 8331 gene locus_tag LOCUS_10450 7861 8331 CDS product SUF system NifU family Fe-S cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894513.1 protein_id gnl|my_center|LOCUS_10450 8858 9355 gene locus_tag LOCUS_10460 8858 9355 CDS product adenylyltransferase/cytidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930108.1 protein_id gnl|my_center|LOCUS_10460 9998 9501 gene locus_tag LOCUS_10470 9998 9501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10470 10968 10258 gene locus_tag LOCUS_10480 10968 10258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10480 11728 11246 gene locus_tag LOCUS_10490 11728 11246 CDS product UDP-N-acetylglucosamine--LPS N-acetylglucosamine transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000686635.1 protein_id gnl|my_center|LOCUS_10490 13147 11915 gene locus_tag LOCUS_10500 13147 11915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10500 15221 13215 gene locus_tag LOCUS_10510 15221 13215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10510 16507 15218 gene locus_tag LOCUS_10520 16507 15218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10520 17541 16591 gene locus_tag LOCUS_10530 17541 16591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10530 18341 17553 gene locus_tag LOCUS_10540 18341 17553 CDS product CDP-alcohol phosphatidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803937.1 protein_id gnl|my_center|LOCUS_10540 18380 18640 gene locus_tag LOCUS_10550 18380 18640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10550 22335 18820 gene locus_tag LOCUS_10560 22335 18820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10560 23328 22456 gene locus_tag LOCUS_10570 23328 22456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10570 26141 23673 gene locus_tag LOCUS_10580 26141 23673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10580 29036 26670 gene locus_tag LOCUS_10590 29036 26670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10590 29594 33340 gene locus_tag LOCUS_10600 gene mfd 29594 33340 CDS product transcription-repair coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028772.1 protein_id gnl|my_center|LOCUS_10600 33481 34899 gene locus_tag LOCUS_10610 33481 34899 CDS product NAD(P)H-quinone dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030872192.1 protein_id gnl|my_center|LOCUS_10610 36455 35055 gene locus_tag LOCUS_10620 36455 35055 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014385.1 protein_id gnl|my_center|LOCUS_10620 38670 36850 gene locus_tag LOCUS_10630 38670 36850 CDS product acetyl/propionyl/methylcrotonyl-CoA carboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222846.1 protein_id gnl|my_center|LOCUS_10630 39528 38821 gene locus_tag LOCUS_10640 39528 38821 CDS product Maf family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776131.1 protein_id gnl|my_center|LOCUS_10640 41262 39844 gene locus_tag LOCUS_10650 41262 39844 CDS product dicarboxylate/amino acid:cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776817.1 protein_id gnl|my_center|LOCUS_10650 41671 42612 gene locus_tag LOCUS_10660 41671 42612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10660 42747 44039 gene locus_tag LOCUS_10670 42747 44039 CDS product glutathionylspermidine synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112824.1 protein_id gnl|my_center|LOCUS_10670 44203 44658 gene locus_tag LOCUS_10680 44203 44658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10680 44658 45518 gene locus_tag LOCUS_10690 44658 45518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10690 47401 45644 gene locus_tag LOCUS_10700 47401 45644 CDS product DUF885 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728748.1 protein_id gnl|my_center|LOCUS_10700 50078 47622 gene locus_tag LOCUS_10710 50078 47622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10710 51632 50556 gene locus_tag LOCUS_10720 51632 50556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10720 52340 51942 gene locus_tag LOCUS_10730 52340 51942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10730 54008 52407 gene locus_tag LOCUS_10740 54008 52407 CDS product acyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029952.1 protein_id gnl|my_center|LOCUS_10740 54602 54321 gene locus_tag LOCUS_10750 54602 54321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10750 54825 55790 gene locus_tag LOCUS_10760 54825 55790 CDS product biotin--[acetyl-CoA-carboxylase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034286032.1 protein_id gnl|my_center|LOCUS_10760 55935 56423 gene locus_tag LOCUS_10770 55935 56423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10770 56716 57867 gene locus_tag LOCUS_10780 56716 57867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10780 57864 58757 gene locus_tag LOCUS_10790 57864 58757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10790 58981 61224 gene locus_tag LOCUS_10800 gene ligA 58981 61224 CDS product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728295.1 protein_id gnl|my_center|LOCUS_10800 61921 62667 gene locus_tag LOCUS_10810 61921 62667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10810 62883 63179 gene locus_tag LOCUS_10820 gene gatC 62883 63179 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775914.1 protein_id gnl|my_center|LOCUS_10820 63195 64799 gene locus_tag LOCUS_10830 gene gatA 63195 64799 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775913.1 protein_id gnl|my_center|LOCUS_10830 64799 66304 gene locus_tag LOCUS_10840 gene gatB 64799 66304 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775912.1 protein_id gnl|my_center|LOCUS_10840 66626 66402 gene locus_tag LOCUS_10850 66626 66402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10850 69050 66873 gene locus_tag LOCUS_10860 69050 66873 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730837.1 protein_id gnl|my_center|LOCUS_10860 70499 69279 gene locus_tag LOCUS_10870 gene rsgA 70499 69279 CDS product ribosome small subunit-dependent GTPase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459864.1 protein_id gnl|my_center|LOCUS_10870 71441 70611 gene locus_tag LOCUS_10880 71441 70611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10880 72303 71443 gene locus_tag LOCUS_10890 72303 71443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10890 73286 72300 gene locus_tag LOCUS_10900 73286 72300 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004114774.1 protein_id gnl|my_center|LOCUS_10900 73840 75186 gene locus_tag LOCUS_10910 73840 75186 CDS product bifunctional o-acetylhomoserine/o-acetylserine sulfhydrylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229668.1 protein_id gnl|my_center|LOCUS_10910 75373 76701 gene locus_tag LOCUS_10920 75373 76701 CDS product homoserine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229667.1 protein_id gnl|my_center|LOCUS_10920 77056 77406 gene locus_tag LOCUS_10930 77056 77406 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905229.1 protein_id gnl|my_center|LOCUS_10930 78376 77561 gene locus_tag LOCUS_10940 78376 77561 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776341.1 protein_id gnl|my_center|LOCUS_10940 78471 79223 gene locus_tag LOCUS_10950 78471 79223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_137447494.1 protein_id gnl|my_center|LOCUS_10950 >Feature sequence11 <1 1695 gene locus_tag LOCUS_10960 <1 1695 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012804649.1:proline--tRNA ligase 1796 2467 gene locus_tag LOCUS_10970 1796 2467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10970 2577 3674 gene locus_tag LOCUS_10980 gene nusA 2577 3674 CDS product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804652.1 protein_id gnl|my_center|LOCUS_10980 3926 4267 gene locus_tag LOCUS_10990 3926 4267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10990 4487 7363 gene locus_tag LOCUS_11000 4487 7363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11000 7550 7990 gene locus_tag LOCUS_11010 gene rbfA 7550 7990 CDS product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804655.1 protein_id gnl|my_center|LOCUS_11010 7991 9085 gene locus_tag LOCUS_11020 gene truB 7991 9085 CDS product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030403.1 protein_id gnl|my_center|LOCUS_11020 9120 9281 gene locus_tag LOCUS_11030 9120 9281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11030 9278 10015 gene locus_tag LOCUS_11040 9278 10015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11040 10278 11294 gene locus_tag LOCUS_11050 10278 11294 CDS product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804658.1 protein_id gnl|my_center|LOCUS_11050 11475 11933 gene locus_tag LOCUS_11060 11475 11933 CDS product S-ribosylhomocysteine lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804934.1 protein_id gnl|my_center|LOCUS_11060 11933 12826 gene locus_tag LOCUS_11070 gene mtnN 11933 12826 CDS product 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804292.1 protein_id gnl|my_center|LOCUS_11070 13045 13383 gene locus_tag LOCUS_11080 13045 13383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11080 13636 15042 gene locus_tag LOCUS_11090 13636 15042 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269252.1 protein_id gnl|my_center|LOCUS_11090 15306 15575 gene locus_tag LOCUS_11100 gene rpsO 15306 15575 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814361.1 protein_id gnl|my_center|LOCUS_11100 15976 18195 gene locus_tag LOCUS_11110 15976 18195 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929901.1 protein_id gnl|my_center|LOCUS_11110 18396 19727 gene locus_tag LOCUS_11120 18396 19727 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973289.1 protein_id gnl|my_center|LOCUS_11120 21891 19933 gene locus_tag LOCUS_11130 21891 19933 CDS product acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068225.1 protein_id gnl|my_center|LOCUS_11130 22145 22915 gene locus_tag LOCUS_11140 gene dapB 22145 22915 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804662.1 protein_id gnl|my_center|LOCUS_11140 22925 23587 gene locus_tag LOCUS_11150 22925 23587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11150 23781 24716 gene locus_tag LOCUS_11160 gene dapA 23781 24716 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900564.1 protein_id gnl|my_center|LOCUS_11160 25105 26820 gene locus_tag LOCUS_11170 25105 26820 CDS product ribonuclease J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804669.1 protein_id gnl|my_center|LOCUS_11170 27077 30283 gene locus_tag LOCUS_11180 27077 30283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11180 30483 31130 gene locus_tag LOCUS_11190 30483 31130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11190 31234 31821 gene locus_tag LOCUS_11200 31234 31821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11200 32107 32514 gene locus_tag LOCUS_11210 32107 32514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11210 32660 32881 gene locus_tag LOCUS_11220 32660 32881 CDS product DUF3046 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005057168.1 protein_id gnl|my_center|LOCUS_11220 33286 34389 gene locus_tag LOCUS_11230 gene recA 33286 34389 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804675.1 protein_id gnl|my_center|LOCUS_11230 34428 36503 gene locus_tag LOCUS_11240 34428 36503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11240 38103 36703 gene locus_tag LOCUS_11250 38103 36703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11250 38121 39635 gene locus_tag LOCUS_11260 gene miaB 38121 39635 CDS product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930170.1 protein_id gnl|my_center|LOCUS_11260 39711 40634 gene locus_tag LOCUS_11270 gene miaA 39711 40634 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030456.1 protein_id gnl|my_center|LOCUS_11270 40707 41855 gene locus_tag LOCUS_11280 40707 41855 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042510611.1 protein_id gnl|my_center|LOCUS_11280 42016 42951 gene locus_tag LOCUS_11290 gene dapF 42016 42951 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804680.1 protein_id gnl|my_center|LOCUS_11290 43688 43065 gene locus_tag LOCUS_11300 43688 43065 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389654.1 protein_id gnl|my_center|LOCUS_11300 43832 45544 gene locus_tag LOCUS_11310 gene hflX 43832 45544 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804682.1 protein_id gnl|my_center|LOCUS_11310 45551 47623 gene locus_tag LOCUS_11320 45551 47623 CDS product ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229470.1 protein_id gnl|my_center|LOCUS_11320 48444 47770 gene locus_tag LOCUS_11330 gene lexA 48444 47770 CDS product transcriptional repressor LexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_091617684.1 protein_id gnl|my_center|LOCUS_11330 48956 49111 gene locus_tag LOCUS_11340 48956 49111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11340 49254 49910 gene locus_tag LOCUS_11350 49254 49910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11350 50030 50812 gene locus_tag LOCUS_11360 50030 50812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11360 50812 51600 gene locus_tag LOCUS_11370 gene priA 50812 51600 CDS product bifunctional 1-(5-phosphoribosyl)-5-((5-phosphoribosylamino)methylideneamino)imidazole-4-carboxamide isomerase/phosphoribosylanthranilate isomerase PriA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776203.1 protein_id gnl|my_center|LOCUS_11370 52196 51774 gene locus_tag LOCUS_11380 52196 51774 CDS product DUF1844 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929982.1 protein_id gnl|my_center|LOCUS_11380 52490 53191 gene locus_tag LOCUS_11390 gene infC 52490 53191 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027874.1 protein_id gnl|my_center|LOCUS_11390 53242 53421 gene locus_tag LOCUS_11400 53242 53421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11400 53390 53584 gene locus_tag LOCUS_11410 gene rpmI 53390 53584 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977225.1 protein_id gnl|my_center|LOCUS_11410 53699 54079 gene locus_tag LOCUS_11420 gene rplT 53699 54079 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977226.1 protein_id gnl|my_center|LOCUS_11420 54252 55199 gene locus_tag LOCUS_11430 54252 55199 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027873.1 protein_id gnl|my_center|LOCUS_11430 55292 56212 gene locus_tag LOCUS_11440 55292 56212 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028720.1 protein_id gnl|my_center|LOCUS_11440 56231 57046 gene locus_tag LOCUS_11450 56231 57046 CDS product DUF421 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002368017.1 protein_id gnl|my_center|LOCUS_11450 57063 57545 gene locus_tag LOCUS_11460 57063 57545 CDS product (deoxy)nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973876.1 protein_id gnl|my_center|LOCUS_11460 57859 58380 gene locus_tag LOCUS_11470 57859 58380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11470 58618 59745 gene locus_tag LOCUS_11480 gene pheS 58618 59745 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227844.1 protein_id gnl|my_center|LOCUS_11480 59749 62319 gene locus_tag LOCUS_11490 gene pheT 59749 62319 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027870.1 protein_id gnl|my_center|LOCUS_11490 62512 63309 gene locus_tag LOCUS_11500 62512 63309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11500 63708 64193 gene locus_tag LOCUS_11510 63708 64193 CDS product arginine repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977248.1 protein_id gnl|my_center|LOCUS_11510 64347 65951 gene locus_tag LOCUS_11520 64347 65951 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228252.1 protein_id gnl|my_center|LOCUS_11520 66086 66661 gene locus_tag LOCUS_11530 66086 66661 CDS product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383583.1 protein_id gnl|my_center|LOCUS_11530 66865 69159 gene locus_tag LOCUS_11540 66865 69159 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804687.1 protein_id gnl|my_center|LOCUS_11540 69327 70631 gene locus_tag LOCUS_11550 gene tyrS 69327 70631 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027993.1 protein_id gnl|my_center|LOCUS_11550 >Feature sequence12 4115 3063 gene locus_tag LOCUS_11560 4115 3063 CDS product 3-oxoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775776.1 protein_id gnl|my_center|LOCUS_11560 4428 7721 gene locus_tag LOCUS_11570 gene smc 4428 7721 CDS product chromosome segregation protein SMC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030315.1 protein_id gnl|my_center|LOCUS_11570 7978 9312 gene locus_tag LOCUS_11580 gene trpB 7978 9312 CDS product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284348.1 protein_id gnl|my_center|LOCUS_11580 9312 10166 gene locus_tag LOCUS_11590 gene trpA 9312 10166 CDS product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407999.1 protein_id gnl|my_center|LOCUS_11590 10166 11182 gene locus_tag LOCUS_11600 10166 11182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11600 11519 12901 gene locus_tag LOCUS_11610 11519 12901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11610 13348 14388 gene locus_tag LOCUS_11620 gene adhP 13348 14388 CDS product alcohol dehydrogenase AdhP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921783.1 protein_id gnl|my_center|LOCUS_11620 17253 15334 gene locus_tag LOCUS_11630 17253 15334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11630 18453 17881 gene locus_tag LOCUS_11640 18453 17881 CDS product flavodoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949081.1 protein_id gnl|my_center|LOCUS_11640 18976 20439 gene locus_tag LOCUS_11650 gene pyk 18976 20439 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805095.1 protein_id gnl|my_center|LOCUS_11650 20739 20657 gene locus_tag LOCUS_t00210 20739 20657 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 21101 22678 gene locus_tag LOCUS_11660 gene ffh 21101 22678 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389541.1 protein_id gnl|my_center|LOCUS_11660 22797 25706 gene locus_tag LOCUS_11670 22797 25706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11670 25719 26207 gene locus_tag LOCUS_11680 25719 26207 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_184978408.1 protein_id gnl|my_center|LOCUS_11680 26493 26915 gene locus_tag LOCUS_11690 26493 26915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11690 26918 27163 gene locus_tag LOCUS_11700 26918 27163 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103110.1 protein_id gnl|my_center|LOCUS_11700 27345 28979 gene locus_tag LOCUS_11710 27345 28979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11710 27956 28055 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 29189 29476 gene locus_tag LOCUS_11720 29189 29476 CDS product antibiotic biosynthesis monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776989.1 protein_id gnl|my_center|LOCUS_11720 30602 30186 gene locus_tag LOCUS_11730 30602 30186 CDS product MmcQ/YjbR family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000348987.1 protein_id gnl|my_center|LOCUS_11730 30696 32375 gene locus_tag LOCUS_11740 gene ettA 30696 32375 CDS product energy-dependent translational throttle protein EttA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804765.1 protein_id gnl|my_center|LOCUS_11740 32628 33203 gene locus_tag LOCUS_11750 32628 33203 CDS product DUF308 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836381.1 protein_id gnl|my_center|LOCUS_11750 34234 33326 gene locus_tag LOCUS_11760 34234 33326 CDS product acyl-CoA thioesterase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804769.1 protein_id gnl|my_center|LOCUS_11760 34439 35302 gene locus_tag LOCUS_11770 34439 35302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11770 35579 36184 gene locus_tag LOCUS_11780 35579 36184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11780 37485 36328 gene locus_tag LOCUS_11790 37485 36328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11790 40283 37734 gene locus_tag LOCUS_11800 gene pepN 40283 37734 CDS product aminopeptidase N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028475.1 protein_id gnl|my_center|LOCUS_11800 40663 41154 gene locus_tag LOCUS_11810 40663 41154 CDS product ribose-5-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037666673.1 protein_id gnl|my_center|LOCUS_11810 41273 42157 gene locus_tag LOCUS_11820 41273 42157 CDS product formamidopyrimidine-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804784.1 protein_id gnl|my_center|LOCUS_11820 42231 42302 gene locus_tag LOCUS_t00220 42231 42302 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 42595 42670 gene locus_tag LOCUS_t00230 42595 42670 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 42777 44078 gene locus_tag LOCUS_11830 gene tig 42777 44078 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804577.1 protein_id gnl|my_center|LOCUS_11830 44434 45087 gene locus_tag LOCUS_11840 44434 45087 CDS product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_115412275.1 protein_id gnl|my_center|LOCUS_11840 45099 45782 gene locus_tag LOCUS_11850 45099 45782 CDS product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930165.1 protein_id gnl|my_center|LOCUS_11850 46236 47603 gene locus_tag LOCUS_11860 gene clpX 46236 47603 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804582.1 protein_id gnl|my_center|LOCUS_11860 47779 48420 gene locus_tag LOCUS_11870 47779 48420 CDS product DsbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730011.1 protein_id gnl|my_center|LOCUS_11870 49949 48561 gene locus_tag LOCUS_11880 49949 48561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11880 49923 50123 gene locus_tag LOCUS_11890 49923 50123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11890 50536 50330 gene locus_tag LOCUS_11900 50536 50330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11900 54022 51290 gene locus_tag LOCUS_11910 gene valS 54022 51290 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804592.1 protein_id gnl|my_center|LOCUS_11910 54356 54042 gene locus_tag LOCUS_11920 54356 54042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11920 >Feature sequence13 1765 392 gene locus_tag LOCUS_11930 1765 392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11930 4045 2162 gene locus_tag LOCUS_11940 4045 2162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11940 5196 4291 gene locus_tag LOCUS_11950 5196 4291 CDS product PAC2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728558.1 protein_id gnl|my_center|LOCUS_11950 5475 5329 gene locus_tag LOCUS_11960 5475 5329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11960 5628 7124 gene locus_tag LOCUS_11970 5628 7124 CDS product leucyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028182.1 protein_id gnl|my_center|LOCUS_11970 7577 8944 gene locus_tag LOCUS_11980 gene lpdA 7577 8944 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224051.1 protein_id gnl|my_center|LOCUS_11980 9492 9591 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 9859 10041 gene locus_tag LOCUS_11990 9859 10041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11990 10038 10973 gene locus_tag LOCUS_12000 10038 10973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12000 12792 11176 gene locus_tag LOCUS_12010 12792 11176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12010 13013 13690 gene locus_tag LOCUS_12020 gene lipB 13013 13690 CDS product lipoyl(octanoyl) transferase LipB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775681.1 protein_id gnl|my_center|LOCUS_12020 13855 14862 gene locus_tag LOCUS_12030 gene lipA 13855 14862 CDS product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775682.1 protein_id gnl|my_center|LOCUS_12030 15072 15788 gene locus_tag LOCUS_12040 15072 15788 CDS product DUF4191 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976619.1 protein_id gnl|my_center|LOCUS_12040 16127 17551 gene locus_tag LOCUS_12050 gene glnA 16127 17551 CDS product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775685.1 protein_id gnl|my_center|LOCUS_12050 18247 18996 gene locus_tag LOCUS_12060 gene alsD 18247 18996 CDS product alpha-acetolactate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000215022.1 protein_id gnl|my_center|LOCUS_12060 19534 19106 gene locus_tag LOCUS_12070 19534 19106 CDS product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015240.1 protein_id gnl|my_center|LOCUS_12070 20265 19588 gene locus_tag LOCUS_12080 20265 19588 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031843.1 protein_id gnl|my_center|LOCUS_12080 20423 20887 gene locus_tag LOCUS_12090 20423 20887 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007449657.1 protein_id gnl|my_center|LOCUS_12090 22073 21153 gene locus_tag LOCUS_12100 22073 21153 CDS product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230418.1 protein_id gnl|my_center|LOCUS_12100 22969 22070 gene locus_tag LOCUS_12110 22969 22070 CDS product metal ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230419.1 protein_id gnl|my_center|LOCUS_12110 23977 22970 gene locus_tag LOCUS_12120 23977 22970 CDS product zinc ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230420.1 protein_id gnl|my_center|LOCUS_12120 25412 24330 gene locus_tag LOCUS_12130 25412 24330 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_183373870.1 protein_id gnl|my_center|LOCUS_12130 26743 25409 gene locus_tag LOCUS_12140 26743 25409 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226803.1 protein_id gnl|my_center|LOCUS_12140 27355 31011 gene locus_tag LOCUS_12150 27355 31011 CDS product multifunctional oxoglutarate decarboxylase/oxoglutarate dehydrogenase thiamine pyrophosphate-binding subunit/dihydrolipoyllysine-residue succinyltransferase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775966.1 protein_id gnl|my_center|LOCUS_12150 31232 31831 gene locus_tag LOCUS_12160 31232 31831 CDS product GDSL-type esterase/lipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775967.1 protein_id gnl|my_center|LOCUS_12160 32294 33034 gene locus_tag LOCUS_12170 gene sigR 32294 33034 CDS product RNA polymerase sigma factor SigR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973756.1 protein_id gnl|my_center|LOCUS_12170 33124 33438 gene locus_tag LOCUS_12180 33124 33438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12180 33672 35177 gene locus_tag LOCUS_12190 gene aroA 33672 35177 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013873.1 protein_id gnl|my_center|LOCUS_12190 35178 36305 gene locus_tag LOCUS_12200 gene rsgA 35178 36305 CDS product ribosome small subunit-dependent GTPase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775972.1 protein_id gnl|my_center|LOCUS_12200 36387 37328 gene locus_tag LOCUS_12210 36387 37328 CDS product histidinol-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775973.1 protein_id gnl|my_center|LOCUS_12210 38035 37442 gene locus_tag LOCUS_12220 38035 37442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12220 38644 38429 gene locus_tag LOCUS_12230 38644 38429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12230 38673 38906 gene locus_tag LOCUS_12240 38673 38906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12240 39701 39331 gene locus_tag LOCUS_tm00010 39701 39331 tmRNA product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 40964 40053 gene locus_tag LOCUS_12250 40964 40053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12250 41668 41204 gene locus_tag LOCUS_12260 41668 41204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12260 42317 41823 gene locus_tag LOCUS_12270 gene smpB 42317 41823 CDS product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975846.1 protein_id gnl|my_center|LOCUS_12270 43464 42337 gene locus_tag LOCUS_12280 gene prfB 43464 42337 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776050.1 protein_id gnl|my_center|LOCUS_12280 44328 43726 gene locus_tag LOCUS_12290 44328 43726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12290 44764 44315 gene locus_tag LOCUS_12300 44764 44315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12300 45257 44802 gene locus_tag LOCUS_12310 45257 44802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12310 45484 45257 gene locus_tag LOCUS_12320 45484 45257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12320 46525 45593 gene locus_tag LOCUS_12330 46525 45593 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776056.1 protein_id gnl|my_center|LOCUS_12330 47376 46522 gene locus_tag LOCUS_12340 47376 46522 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776057.1 protein_id gnl|my_center|LOCUS_12340 48638 47376 gene locus_tag LOCUS_12350 48638 47376 CDS product ATPase, T2SS/T4P/T4SS family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776058.1 protein_id gnl|my_center|LOCUS_12350 49918 49145 gene locus_tag LOCUS_12360 49918 49145 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776098.1 protein_id gnl|my_center|LOCUS_12360 50804 49923 gene locus_tag LOCUS_12370 50804 49923 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776099.1 protein_id gnl|my_center|LOCUS_12370 <51916 50801 gene locus_tag LOCUS_12380 <51916 50801 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015776100.1:glycosyltransferase >Feature sequence14 752 1213 gene locus_tag LOCUS_12390 752 1213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12390 2461 1232 gene locus_tag LOCUS_12400 2461 1232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12400 3423 2476 gene locus_tag LOCUS_12410 3423 2476 CDS product NADP-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978080.1 protein_id gnl|my_center|LOCUS_12410 3725 3651 gene locus_tag LOCUS_t00240 3725 3651 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 3800 5464 gene locus_tag LOCUS_12420 gene argS 3800 5464 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730214.1 protein_id gnl|my_center|LOCUS_12420 5547 7067 gene locus_tag LOCUS_12430 gene lysA 5547 7067 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775960.1 protein_id gnl|my_center|LOCUS_12430 7368 8657 gene locus_tag LOCUS_12440 7368 8657 CDS product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229542.1 protein_id gnl|my_center|LOCUS_12440 8814 9914 gene locus_tag LOCUS_12450 gene thrC 8814 9914 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973642.1 protein_id gnl|my_center|LOCUS_12450 10038 11006 gene locus_tag LOCUS_12460 gene thrB 10038 11006 CDS product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030204.1 protein_id gnl|my_center|LOCUS_12460 11520 13658 gene locus_tag LOCUS_12470 gene rho 11520 13658 CDS product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030205.1 protein_id gnl|my_center|LOCUS_12470 13799 14881 gene locus_tag LOCUS_12480 gene prfA 13799 14881 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973637.1 protein_id gnl|my_center|LOCUS_12480 15034 15942 gene locus_tag LOCUS_12490 gene prmC 15034 15942 CDS product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973636.1 protein_id gnl|my_center|LOCUS_12490 16112 17329 gene locus_tag LOCUS_12500 16112 17329 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775947.1 protein_id gnl|my_center|LOCUS_12500 18454 17453 gene locus_tag LOCUS_12510 18454 17453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12510 18884 20848 gene locus_tag LOCUS_12520 18884 20848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12520 20848 22806 gene locus_tag LOCUS_12530 20848 22806 CDS product nucleoside-diphosphate sugar epimerase/dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066564050.1 protein_id gnl|my_center|LOCUS_12530 23059 24345 gene locus_tag LOCUS_12540 23059 24345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12540 24345 24911 gene locus_tag LOCUS_12550 24345 24911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12550 24940 25200 gene locus_tag LOCUS_12560 24940 25200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12560 25312 26103 gene locus_tag LOCUS_12570 gene atpB 25312 26103 CDS product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229528.1 protein_id gnl|my_center|LOCUS_12570 26247 26450 gene locus_tag LOCUS_12580 26247 26450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12580 26502 27059 gene locus_tag LOCUS_12590 26502 27059 CDS product F0F1 ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229526.1 protein_id gnl|my_center|LOCUS_12590 27059 27871 gene locus_tag LOCUS_12600 27059 27871 CDS product F0F1 ATP synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016327277.1 protein_id gnl|my_center|LOCUS_12600 28059 29684 gene locus_tag LOCUS_12610 gene atpA 28059 29684 CDS product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775940.1 protein_id gnl|my_center|LOCUS_12610 29760 30701 gene locus_tag LOCUS_12620 29760 30701 CDS product F0F1 ATP synthase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973625.1 protein_id gnl|my_center|LOCUS_12620 30758 32221 gene locus_tag LOCUS_12630 gene atpD 30758 32221 CDS product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775938.1 protein_id gnl|my_center|LOCUS_12630 32224 32481 gene locus_tag LOCUS_12640 32224 32481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12640 33443 32730 gene locus_tag LOCUS_12650 gene nucS 33443 32730 CDS product endonuclease NucS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775934.1 protein_id gnl|my_center|LOCUS_12650 33724 34050 gene locus_tag LOCUS_12660 33724 34050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229480.1 protein_id gnl|my_center|LOCUS_12660 34135 34953 gene locus_tag LOCUS_12670 34135 34953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12670 36424 35138 gene locus_tag LOCUS_12680 36424 35138 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225393.1 protein_id gnl|my_center|LOCUS_12680 36731 37744 gene locus_tag LOCUS_12690 36731 37744 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775931.1 protein_id gnl|my_center|LOCUS_12690 38061 39077 gene locus_tag LOCUS_12700 38061 39077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12700 39053 40729 gene locus_tag LOCUS_12710 39053 40729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068786.1 protein_id gnl|my_center|LOCUS_12710 41026 41325 gene locus_tag LOCUS_12720 41026 41325 CDS product DUF3039 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776029.1 protein_id gnl|my_center|LOCUS_12720 41633 43420 gene locus_tag LOCUS_12730 41633 43420 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929967.1 protein_id gnl|my_center|LOCUS_12730 44031 45455 gene locus_tag LOCUS_12740 44031 45455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12740 46597 45971 gene locus_tag LOCUS_12750 46597 45971 CDS product isochorismatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015162.1 protein_id gnl|my_center|LOCUS_12750 47984 46686 gene locus_tag LOCUS_12760 47984 46686 CDS product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028662.1 protein_id gnl|my_center|LOCUS_12760 48235 48555 gene locus_tag LOCUS_12770 gene clpS 48235 48555 CDS product ATP-dependent Clp protease adapter ClpS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776026.1 protein_id gnl|my_center|LOCUS_12770 48555 49172 gene locus_tag LOCUS_12780 48555 49172 CDS product DUF2017 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776025.1 protein_id gnl|my_center|LOCUS_12780 49327 50379 gene locus_tag LOCUS_12790 gene murI 49327 50379 CDS product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066567685.1 protein_id gnl|my_center|LOCUS_12790 50370 51263 gene locus_tag LOCUS_12800 50370 51263 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776023.1 protein_id gnl|my_center|LOCUS_12800 >Feature sequence15 425 2047 gene locus_tag LOCUS_12810 425 2047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12810 2047 3300 gene locus_tag LOCUS_12820 2047 3300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12820 3580 3900 gene locus_tag LOCUS_12830 3580 3900 CDS product 2Fe-2S iron-sulfur cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775686.1 protein_id gnl|my_center|LOCUS_12830 3903 4859 gene locus_tag LOCUS_12840 3903 4859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12840 5594 5007 gene locus_tag LOCUS_12850 5594 5007 CDS product malonic semialdehyde reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973928.1 protein_id gnl|my_center|LOCUS_12850 5736 11288 gene locus_tag LOCUS_12860 5736 11288 CDS product ATP-dependent helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727880.1 protein_id gnl|my_center|LOCUS_12860 12167 11583 gene locus_tag LOCUS_12870 12167 11583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12870 12738 13904 gene locus_tag LOCUS_12880 12738 13904 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977201.1 protein_id gnl|my_center|LOCUS_12880 14068 15330 gene locus_tag LOCUS_12890 14068 15330 CDS product glycoside hydrolase family 76 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230849.1 protein_id gnl|my_center|LOCUS_12890 15502 16440 gene locus_tag LOCUS_12900 15502 16440 CDS product Dyp-type peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107658.1 protein_id gnl|my_center|LOCUS_12900 16625 17935 gene locus_tag LOCUS_12910 gene tgt 16625 17935 CDS product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776643.1 protein_id gnl|my_center|LOCUS_12910 17968 18477 gene locus_tag LOCUS_12920 17968 18477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12920 19307 18600 gene locus_tag LOCUS_12930 19307 18600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12930 20653 19538 gene locus_tag LOCUS_12940 20653 19538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12940 21277 20765 gene locus_tag LOCUS_12950 21277 20765 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804770.1 protein_id gnl|my_center|LOCUS_12950 23128 21623 gene locus_tag LOCUS_12960 23128 21623 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777134.1 protein_id gnl|my_center|LOCUS_12960 24814 23360 gene locus_tag LOCUS_12970 24814 23360 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777134.1 protein_id gnl|my_center|LOCUS_12970 25650 24922 gene locus_tag LOCUS_12980 25650 24922 CDS product queuosine precursor transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003863385.1 protein_id gnl|my_center|LOCUS_12980 25998 26936 gene locus_tag LOCUS_12990 25998 26936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12990 27046 27741 gene locus_tag LOCUS_13000 27046 27741 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230202.1 protein_id gnl|my_center|LOCUS_13000 28207 27884 gene locus_tag LOCUS_13010 28207 27884 CDS product type II toxin-antitoxin system VapB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895874.1 protein_id gnl|my_center|LOCUS_13010 28415 28327 gene locus_tag LOCUS_t00250 28415 28327 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 28521 28721 gene locus_tag LOCUS_13020 28521 28721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13020 28862 28774 gene locus_tag LOCUS_t00260 28862 28774 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 29434 29533 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 29835 32636 gene locus_tag LOCUS_13030 29835 32636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13030 32827 33969 gene locus_tag LOCUS_13040 32827 33969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13040 34162 35457 gene locus_tag LOCUS_13050 34162 35457 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975324.1 protein_id gnl|my_center|LOCUS_13050 35684 36154 gene locus_tag LOCUS_13060 35684 36154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13060 36148 36576 gene locus_tag LOCUS_13070 36148 36576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13070 36845 37795 gene locus_tag LOCUS_13080 36845 37795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226805.1 protein_id gnl|my_center|LOCUS_13080 37918 38169 gene locus_tag LOCUS_13090 gene purS 37918 38169 CDS product phosphoribosylformylglycinamidine synthase subunit PurS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776336.1 protein_id gnl|my_center|LOCUS_13090 38175 38987 gene locus_tag LOCUS_13100 gene purQ 38175 38987 CDS product phosphoribosylformylglycinamidine synthase subunit PurQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974894.1 protein_id gnl|my_center|LOCUS_13100 39013 41331 gene locus_tag LOCUS_13110 gene purL 39013 41331 CDS product phosphoribosylformylglycinamidine synthase subunit PurL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974893.1 protein_id gnl|my_center|LOCUS_13110 42133 41471 gene locus_tag LOCUS_13120 42133 41471 CDS product biliverdin-producing heme oxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804503.1 protein_id gnl|my_center|LOCUS_13120 42370 44733 gene locus_tag LOCUS_13130 42370 44733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13130 44917 46080 gene locus_tag LOCUS_13140 44917 46080 CDS product hemin ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003859750.1 protein_id gnl|my_center|LOCUS_13140 46080 47159 gene locus_tag LOCUS_13150 46080 47159 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003859752.1 protein_id gnl|my_center|LOCUS_13150 47156 47926 gene locus_tag LOCUS_13160 47156 47926 CDS product heme ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028243.1 protein_id gnl|my_center|LOCUS_13160 48201 50759 gene locus_tag LOCUS_13170 48201 50759 CDS product HAD-IC family P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028834.1 protein_id gnl|my_center|LOCUS_13170 >Feature sequence16 338 1138 gene locus_tag LOCUS_13180 338 1138 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804604.1 protein_id gnl|my_center|LOCUS_13180 1683 3491 gene locus_tag LOCUS_13190 1683 3491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13190 4221 6206 gene locus_tag LOCUS_13200 4221 6206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13200 6504 8309 gene locus_tag LOCUS_13210 6504 8309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13210 8750 10588 gene locus_tag LOCUS_13220 8750 10588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13220 10927 12534 gene locus_tag LOCUS_13230 10927 12534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13230 12731 15550 gene locus_tag LOCUS_13240 12731 15550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13240 15634 16374 gene locus_tag LOCUS_13250 15634 16374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13250 16803 16477 gene locus_tag LOCUS_13260 gene nirD 16803 16477 CDS product nitrite reductase small subunit NirD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197730.1 protein_id gnl|my_center|LOCUS_13260 17349 20018 gene locus_tag LOCUS_13270 gene nirB 17349 20018 CDS product nitrite reductase large subunit NirB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111865.1 protein_id gnl|my_center|LOCUS_13270 20020 20931 gene locus_tag LOCUS_13280 gene cobA 20020 20931 CDS product uroporphyrinogen-III C-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022972.1 protein_id gnl|my_center|LOCUS_13280 22121 21168 gene locus_tag LOCUS_13290 22121 21168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13290 23409 22456 gene locus_tag LOCUS_13300 23409 22456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13300 24865 28206 gene locus_tag LOCUS_13310 gene ileS 24865 28206 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804609.1 protein_id gnl|my_center|LOCUS_13310 28340 30010 gene locus_tag LOCUS_13320 28340 30010 CDS product folylpolyglutamate synthase/dihydrofolate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485025.1 protein_id gnl|my_center|LOCUS_13320 30425 31102 gene locus_tag LOCUS_13330 30425 31102 CDS product TenA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009993682.1 protein_id gnl|my_center|LOCUS_13330 31438 32106 gene locus_tag LOCUS_13340 31438 32106 CDS product vitamin K epoxide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728325.1 protein_id gnl|my_center|LOCUS_13340 32427 32666 gene locus_tag LOCUS_13350 32427 32666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13350 32935 33126 gene locus_tag LOCUS_13360 32935 33126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13360 33260 37042 gene locus_tag LOCUS_13370 33260 37042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13370 37569 37880 gene locus_tag LOCUS_13380 gene rplU 37569 37880 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775855.1 protein_id gnl|my_center|LOCUS_13380 37921 38178 gene locus_tag LOCUS_13390 gene rpmA 37921 38178 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976205.1 protein_id gnl|my_center|LOCUS_13390 38373 39980 gene locus_tag LOCUS_13400 gene obgE 38373 39980 CDS product GTPase ObgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775853.1 protein_id gnl|my_center|LOCUS_13400 40351 41100 gene locus_tag LOCUS_13410 gene nadD 40351 41100 CDS product nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485033.1 protein_id gnl|my_center|LOCUS_13410 41093 42160 gene locus_tag LOCUS_13420 41093 42160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13420 42227 42664 gene locus_tag LOCUS_13430 gene rsfS 42227 42664 CDS product ribosome silencing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976226.1 protein_id gnl|my_center|LOCUS_13430 42911 42984 gene locus_tag LOCUS_t00270 42911 42984 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 43096 44061 gene locus_tag LOCUS_13440 43096 44061 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011067981.1 protein_id gnl|my_center|LOCUS_13440 44363 45763 gene locus_tag LOCUS_13450 44363 45763 CDS product glutaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003860838.1 protein_id gnl|my_center|LOCUS_13450 46121 47095 gene locus_tag LOCUS_13460 46121 47095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13460 47144 47413 gene locus_tag LOCUS_13470 47144 47413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13470 47796 48017 gene locus_tag LOCUS_13480 47796 48017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13480 49025 48285 gene locus_tag LOCUS_13490 gene frnE 49025 48285 CDS product protein disulfide isomerase FrnE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887304.1 protein_id gnl|my_center|LOCUS_13490 50366 49245 gene locus_tag LOCUS_13500 50366 49245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13500 >Feature sequence17 435 253 gene locus_tag LOCUS_13510 435 253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13510 2295 586 gene locus_tag LOCUS_13520 2295 586 CDS product ABC transporter family substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389694.1 protein_id gnl|my_center|LOCUS_13520 4432 2738 gene locus_tag LOCUS_13530 4432 2738 CDS product ABC transporter family substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389694.1 protein_id gnl|my_center|LOCUS_13530 6574 4841 gene locus_tag LOCUS_13540 6574 4841 CDS product ABC transporter family substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389694.1 protein_id gnl|my_center|LOCUS_13540 8643 6943 gene locus_tag LOCUS_13550 8643 6943 CDS product ABC transporter family substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389694.1 protein_id gnl|my_center|LOCUS_13550 11167 9074 gene locus_tag LOCUS_13560 11167 9074 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812442.1 protein_id gnl|my_center|LOCUS_13560 12168 11167 gene locus_tag LOCUS_13570 12168 11167 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812440.1 protein_id gnl|my_center|LOCUS_13570 13160 12165 gene locus_tag LOCUS_13580 13160 12165 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812438.1 protein_id gnl|my_center|LOCUS_13580 15403 13676 gene locus_tag LOCUS_13590 15403 13676 CDS product MDR family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003859734.1 protein_id gnl|my_center|LOCUS_13590 16206 15535 gene locus_tag LOCUS_13600 16206 15535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13600 16320 17798 gene locus_tag LOCUS_13610 16320 17798 CDS product phospholipase D-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003853689.1 protein_id gnl|my_center|LOCUS_13610 19081 17981 gene locus_tag LOCUS_13620 19081 17981 CDS product YdcF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011922483.1 protein_id gnl|my_center|LOCUS_13620 20509 19313 gene locus_tag LOCUS_13630 20509 19313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13630 20780 21058 gene locus_tag LOCUS_13640 20780 21058 CDS product putative quinol monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212818.1 protein_id gnl|my_center|LOCUS_13640 22215 21181 gene locus_tag LOCUS_13650 22215 21181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13650 24312 22468 gene locus_tag LOCUS_13660 gene ilvD 24312 22468 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775910.1 protein_id gnl|my_center|LOCUS_13660 24625 24392 gene locus_tag LOCUS_13670 24625 24392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13670 24727 26559 gene locus_tag LOCUS_13680 gene treC 24727 26559 CDS product alpha,alpha-phosphotrehalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011100943.1 protein_id gnl|my_center|LOCUS_13680 27681 26716 gene locus_tag LOCUS_13690 27681 26716 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049743594.1 protein_id gnl|my_center|LOCUS_13690 28384 27686 gene locus_tag LOCUS_13700 28384 27686 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776966.1 protein_id gnl|my_center|LOCUS_13700 29167 28388 gene locus_tag LOCUS_13710 29167 28388 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776967.1 protein_id gnl|my_center|LOCUS_13710 30108 29164 gene locus_tag LOCUS_13720 30108 29164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13720 30364 30291 gene locus_tag LOCUS_t00280 30364 30291 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 30511 30437 gene locus_tag LOCUS_t00290 30511 30437 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 30652 30579 gene locus_tag LOCUS_t00300 30652 30579 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 31591 31734 gene locus_tag LOCUS_13730 31591 31734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13730 31777 32172 gene locus_tag LOCUS_13740 31777 32172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13740 33943 32540 gene locus_tag LOCUS_13750 33943 32540 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804380.1 protein_id gnl|my_center|LOCUS_13750 34622 34257 gene locus_tag LOCUS_13760 34622 34257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13760 35250 34801 gene locus_tag LOCUS_13770 35250 34801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13770 35993 35247 gene locus_tag LOCUS_13780 35993 35247 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001194969.1 protein_id gnl|my_center|LOCUS_13780 37973 36003 gene locus_tag LOCUS_13790 37973 36003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13790 38321 39787 gene locus_tag LOCUS_13800 38321 39787 CDS product NCS2 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230209.1 protein_id gnl|my_center|LOCUS_13800 40099 41547 gene locus_tag LOCUS_13810 40099 41547 CDS product NCS2 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230209.1 protein_id gnl|my_center|LOCUS_13810 >Feature sequence18 <1 693 gene locus_tag LOCUS_13820 <1 693 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003975906.1:ribonuclease PH 732 1388 gene locus_tag LOCUS_13830 gene rdgB 732 1388 CDS product RdgB/HAM1 family non-canonical purine NTP pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028655.1 protein_id gnl|my_center|LOCUS_13830 1696 2925 gene locus_tag LOCUS_13840 1696 2925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13840 3229 5331 gene locus_tag LOCUS_13850 3229 5331 CDS product DNA topoisomerase IV subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805040.1 protein_id gnl|my_center|LOCUS_13850 5877 7448 gene locus_tag LOCUS_13860 5877 7448 CDS product cytochrome ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222114.1 protein_id gnl|my_center|LOCUS_13860 7470 8540 gene locus_tag LOCUS_13870 gene cydB 7470 8540 CDS product cytochrome d ubiquinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222115.1 protein_id gnl|my_center|LOCUS_13870 8755 9687 gene locus_tag LOCUS_13880 8755 9687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13880 9736 10863 gene locus_tag LOCUS_13890 9736 10863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13890 10860 13103 gene locus_tag LOCUS_13900 10860 13103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13900 13279 17259 gene locus_tag LOCUS_13910 13279 17259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13910 20030 17505 gene locus_tag LOCUS_13920 20030 17505 CDS product DNA topoisomerase IV subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929932.1 protein_id gnl|my_center|LOCUS_13920 20317 20910 gene locus_tag LOCUS_13930 20317 20910 CDS product DUF5998 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030492.1 protein_id gnl|my_center|LOCUS_13930 20956 22236 gene locus_tag LOCUS_13940 20956 22236 CDS product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030493.1 protein_id gnl|my_center|LOCUS_13940 23547 22378 gene locus_tag LOCUS_13950 23547 22378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13950 23874 24173 gene locus_tag LOCUS_13960 23874 24173 CDS product DUF4193 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805050.1 protein_id gnl|my_center|LOCUS_13960 24414 24860 gene locus_tag LOCUS_13970 gene dut 24414 24860 CDS product dUTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224478.1 protein_id gnl|my_center|LOCUS_13970 24938 25735 gene locus_tag LOCUS_13980 24938 25735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13980 25735 26274 gene locus_tag LOCUS_13990 25735 26274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13990 26264 27070 gene locus_tag LOCUS_14000 26264 27070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14000 27837 27184 gene locus_tag LOCUS_14010 27837 27184 CDS product TrkA family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003413921.1 protein_id gnl|my_center|LOCUS_14010 28710 27838 gene locus_tag LOCUS_14020 28710 27838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14020 28906 31047 gene locus_tag LOCUS_14030 28906 31047 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_181825004.1 protein_id gnl|my_center|LOCUS_14030 31237 32874 gene locus_tag LOCUS_14040 31237 32874 CDS product class I SAM-dependent RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030522.1 protein_id gnl|my_center|LOCUS_14040 33100 35172 gene locus_tag LOCUS_14050 gene dxs 33100 35172 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972908.1 protein_id gnl|my_center|LOCUS_14050 35863 35336 gene locus_tag LOCUS_14060 35863 35336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14060 37338 36073 gene locus_tag LOCUS_14070 37338 36073 CDS product ribonuclease D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972895.1 protein_id gnl|my_center|LOCUS_14070 38015 37539 gene locus_tag LOCUS_14080 gene msrB 38015 37539 CDS product peptide-methionine (R)-S-oxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894168.1 protein_id gnl|my_center|LOCUS_14080 38612 38103 gene locus_tag LOCUS_14090 gene ybaK 38612 38103 CDS product Cys-tRNA(Pro)/Cys-tRNA(Cys) deacylase YbaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000186633.1 protein_id gnl|my_center|LOCUS_14090 >Feature sequence19 123 1349 gene locus_tag LOCUS_14100 123 1349 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775774.1 protein_id gnl|my_center|LOCUS_14100 2623 1526 gene locus_tag LOCUS_14110 gene mutM 2623 1526 CDS product bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223692.1 protein_id gnl|my_center|LOCUS_14110 3388 2699 gene locus_tag LOCUS_14120 gene rnc 3388 2699 CDS product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414820.1 protein_id gnl|my_center|LOCUS_14120 3608 3405 gene locus_tag LOCUS_14130 3608 3405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14130 4163 3639 gene locus_tag LOCUS_14140 4163 3639 CDS product DUF177 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973424.1 protein_id gnl|my_center|LOCUS_14140 4960 4484 gene locus_tag LOCUS_14150 gene coaD 4960 4484 CDS product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858828.1 protein_id gnl|my_center|LOCUS_14150 5716 5072 gene locus_tag LOCUS_14160 gene rsmD 5716 5072 CDS product 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775870.1 protein_id gnl|my_center|LOCUS_14160 9496 5807 gene locus_tag LOCUS_14170 9496 5807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14170 10776 9493 gene locus_tag LOCUS_14180 10776 9493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14180 12447 11041 gene locus_tag LOCUS_14190 12447 11041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14190 14277 12487 gene locus_tag LOCUS_14200 14277 12487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14200 15907 14789 gene locus_tag LOCUS_14210 15907 14789 CDS product D-alanine--D-alanine ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973434.1 protein_id gnl|my_center|LOCUS_14210 17252 16134 gene locus_tag LOCUS_14220 17252 16134 CDS product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030308.1 protein_id gnl|my_center|LOCUS_14220 18207 17350 gene locus_tag LOCUS_14230 18207 17350 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973436.1 protein_id gnl|my_center|LOCUS_14230 19640 18207 gene locus_tag LOCUS_14240 gene murA 19640 18207 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013399439.1 protein_id gnl|my_center|LOCUS_14240 20330 21778 gene locus_tag LOCUS_14250 20330 21778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14250 22551 21958 gene locus_tag LOCUS_14260 gene leuD 22551 21958 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893754.1 protein_id gnl|my_center|LOCUS_14260 24020 22578 gene locus_tag LOCUS_14270 gene leuC 24020 22578 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775884.1 protein_id gnl|my_center|LOCUS_14270 24432 25319 gene locus_tag LOCUS_14280 24432 25319 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775885.1 protein_id gnl|my_center|LOCUS_14280 27335 25449 gene locus_tag LOCUS_14290 27335 25449 CDS product 50S ribosome-binding GTPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776426.1 protein_id gnl|my_center|LOCUS_14290 29330 27408 gene locus_tag LOCUS_14300 29330 27408 CDS product dynamin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776427.1 protein_id gnl|my_center|LOCUS_14300 30258 30812 gene locus_tag LOCUS_14310 30258 30812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14310 31081 32268 gene locus_tag LOCUS_14320 31081 32268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14320 32535 33362 gene locus_tag LOCUS_14330 32535 33362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14330 33469 34419 gene locus_tag LOCUS_14340 33469 34419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14340 34592 34314 gene locus_tag LOCUS_14350 34592 34314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14350 34537 35307 gene locus_tag LOCUS_14360 34537 35307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14360 >Feature sequence20 283 444 gene locus_tag LOCUS_14370 283 444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14370 1115 639 gene locus_tag LOCUS_14380 1115 639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14380 1410 2381 gene locus_tag LOCUS_14390 1410 2381 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208318.1 protein_id gnl|my_center|LOCUS_14390 4425 2620 gene locus_tag LOCUS_14400 gene malL 4425 2620 CDS product oligo-1,6-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000415176.1 protein_id gnl|my_center|LOCUS_14400 6369 4555 gene locus_tag LOCUS_14410 6369 4555 CDS product alpha-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102265.1 protein_id gnl|my_center|LOCUS_14410 7321 6443 gene locus_tag LOCUS_14420 7321 6443 CDS product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000670818.1 protein_id gnl|my_center|LOCUS_14420 7786 9390 gene locus_tag LOCUS_14430 gene malP 7786 9390 CDS product PTS maltose transporter subunit IIBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233606.1 protein_id gnl|my_center|LOCUS_14430 9661 10479 gene locus_tag LOCUS_14440 9661 10479 CDS product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015613407.1 protein_id gnl|my_center|LOCUS_14440 10567 11025 gene locus_tag LOCUS_14450 10567 11025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14450 11114 15112 gene locus_tag LOCUS_14460 11114 15112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14460 15105 15401 gene locus_tag LOCUS_14470 15105 15401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14470 15676 15491 gene locus_tag LOCUS_14480 15676 15491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14480 16576 15902 gene locus_tag LOCUS_14490 16576 15902 CDS product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706539.1 protein_id gnl|my_center|LOCUS_14490 16928 17836 gene locus_tag LOCUS_14500 gene galU 16928 17836 CDS product UTP--glucose-1-phosphate uridylyltransferase GalU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975635.1 protein_id gnl|my_center|LOCUS_14500 18139 19749 gene locus_tag LOCUS_14510 18139 19749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14510 20244 20744 gene locus_tag LOCUS_14520 20244 20744 CDS product VTT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775742.1 protein_id gnl|my_center|LOCUS_14520 20841 22025 gene locus_tag LOCUS_14530 20841 22025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14530 22052 22561 gene locus_tag LOCUS_14540 22052 22561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14540 22561 23739 gene locus_tag LOCUS_14550 22561 23739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14550 23746 24969 gene locus_tag LOCUS_14560 23746 24969 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456922.1 protein_id gnl|my_center|LOCUS_14560 25363 25097 gene locus_tag LOCUS_14570 25363 25097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14570 26731 25430 gene locus_tag LOCUS_14580 gene xseA 26731 25430 CDS product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776296.1 protein_id gnl|my_center|LOCUS_14580 26888 28111 gene locus_tag LOCUS_14590 26888 28111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14590 28139 29224 gene locus_tag LOCUS_14600 28139 29224 CDS product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776295.1 protein_id gnl|my_center|LOCUS_14600 >Feature sequence21 1569 2543 gene locus_tag LOCUS_14610 1569 2543 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804749.1 protein_id gnl|my_center|LOCUS_14610 3905 2634 gene locus_tag LOCUS_14620 3905 2634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14620 5644 3914 gene locus_tag LOCUS_14630 5644 3914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14630 6371 6144 gene locus_tag LOCUS_14640 6371 6144 CDS product DUF3107 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010907944.1 protein_id gnl|my_center|LOCUS_14640 7852 6590 gene locus_tag LOCUS_14650 7852 6590 CDS product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776650.1 protein_id gnl|my_center|LOCUS_14650 8074 9255 gene locus_tag LOCUS_14660 gene hemE 8074 9255 CDS product uroporphyrinogen decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776651.1 protein_id gnl|my_center|LOCUS_14660 9394 10944 gene locus_tag LOCUS_14670 gene hemG 9394 10944 CDS product protoporphyrinogen oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776652.1 protein_id gnl|my_center|LOCUS_14670 11079 11900 gene locus_tag LOCUS_14680 11079 11900 CDS product chlorite dismutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224514.1 protein_id gnl|my_center|LOCUS_14680 11897 13336 gene locus_tag LOCUS_14690 11897 13336 CDS product ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776654.1 protein_id gnl|my_center|LOCUS_14690 13523 14656 gene locus_tag LOCUS_14700 13523 14656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14700 14662 15570 gene locus_tag LOCUS_14710 14662 15570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14710 15626 16627 gene locus_tag LOCUS_14720 gene hemB 15626 16627 CDS product porphobilinogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013646.1 protein_id gnl|my_center|LOCUS_14720 17888 16716 gene locus_tag LOCUS_14730 17888 16716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14730 19136 17943 gene locus_tag LOCUS_14740 19136 17943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14740 20469 19291 gene locus_tag LOCUS_14750 20469 19291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14750 21851 20502 gene locus_tag LOCUS_14760 gene hemL 21851 20502 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776658.1 protein_id gnl|my_center|LOCUS_14760 23429 22062 gene locus_tag LOCUS_14770 23429 22062 CDS product threonine/serine exporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_123926043.1 protein_id gnl|my_center|LOCUS_14770 24277 23591 gene locus_tag LOCUS_14780 24277 23591 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030642.1 protein_id gnl|my_center|LOCUS_14780 >Feature sequence22 1378 785 gene locus_tag LOCUS_14790 1378 785 CDS product protoglobin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022833.1 protein_id gnl|my_center|LOCUS_14790 2712 1477 gene locus_tag LOCUS_14800 2712 1477 CDS product IS256-like element IS1081 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003901078.1 protein_id gnl|my_center|LOCUS_14800 3436 3360 gene locus_tag LOCUS_t00310 3436 3360 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 6885 3772 gene locus_tag LOCUS_14810 6885 3772 CDS product UPF0182 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068258.1 protein_id gnl|my_center|LOCUS_14810 8382 7159 gene locus_tag LOCUS_14820 8382 7159 CDS product PDZ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804763.1 protein_id gnl|my_center|LOCUS_14820 8703 10166 gene locus_tag LOCUS_14830 8703 10166 CDS product zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973777.1 protein_id gnl|my_center|LOCUS_14830 10944 10321 gene locus_tag LOCUS_14840 10944 10321 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030867997.1 protein_id gnl|my_center|LOCUS_14840 12886 10928 gene locus_tag LOCUS_14850 12886 10928 CDS product ATP-dependent DNA helicase UvrD2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173668762.1 protein_id gnl|my_center|LOCUS_14850 13225 14226 gene locus_tag LOCUS_14860 13225 14226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14860 20056 15302 gene locus_tag LOCUS_14870 20056 15302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14870 <21833 20136 gene locus_tag LOCUS_14880 <21833 20136 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013223038.1:ATP-dependent DNA helicase >Feature sequence23 443 583 gene locus_tag LOCUS_14890 443 583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14890 1652 681 gene locus_tag LOCUS_14900 gene rarD 1652 681 CDS product EamA family transporter RarD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029749.1 protein_id gnl|my_center|LOCUS_14900 3178 1841 gene locus_tag LOCUS_14910 3178 1841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14910 3459 4793 gene locus_tag LOCUS_14920 3459 4793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14920 5498 4908 gene locus_tag LOCUS_14930 5498 4908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14930 5693 5956 gene locus_tag LOCUS_14940 5693 5956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14940 6096 6980 gene locus_tag LOCUS_14950 gene htpX 6096 6980 CDS product zinc metalloprotease HtpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974338.1 protein_id gnl|my_center|LOCUS_14950 7673 7182 gene locus_tag LOCUS_14960 7673 7182 CDS product YajQ family cyclic di-GMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974333.1 protein_id gnl|my_center|LOCUS_14960 7815 8201 gene locus_tag LOCUS_14970 7815 8201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14970 8439 8521 gene locus_tag LOCUS_t00320 8439 8521 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 8933 9310 gene locus_tag LOCUS_14980 gene trxA 8933 9310 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027416.1 protein_id gnl|my_center|LOCUS_14980 10435 9407 gene locus_tag LOCUS_14990 10435 9407 CDS product DNA-3-methyladenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400956.1 protein_id gnl|my_center|LOCUS_14990 10876 12738 gene locus_tag LOCUS_15000 10876 12738 CDS product DUF2079 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929884.1 protein_id gnl|my_center|LOCUS_15000 13386 15599 gene locus_tag LOCUS_15010 13386 15599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15010 15885 15957 gene locus_tag LOCUS_t00330 15885 15957 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 15995 16069 gene locus_tag LOCUS_t00340 15995 16069 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 16070 16142 gene locus_tag LOCUS_t00350 16070 16142 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 17302 16301 gene locus_tag LOCUS_15020 17302 16301 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768139.1 protein_id gnl|my_center|LOCUS_15020 17504 17956 gene locus_tag LOCUS_15030 17504 17956 CDS product MaoC family dehydratase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034285884.1 protein_id gnl|my_center|LOCUS_15030 17956 18417 gene locus_tag LOCUS_15040 17956 18417 CDS product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029785.1 protein_id gnl|my_center|LOCUS_15040 18664 19770 gene locus_tag LOCUS_15050 18664 19770 CDS product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776154.1 protein_id gnl|my_center|LOCUS_15050 20847 19888 gene locus_tag LOCUS_15060 20847 19888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15060 <21511 20982 gene locus_tag LOCUS_15070 <21511 20982 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003855060.1:MFS transporter >Feature sequence24 201 1154 gene locus_tag LOCUS_15080 201 1154 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049878179.1 protein_id gnl|my_center|LOCUS_15080 1225 1983 gene locus_tag LOCUS_15090 1225 1983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15090 2124 3380 gene locus_tag LOCUS_15100 2124 3380 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228376.1 protein_id gnl|my_center|LOCUS_15100 3508 4140 gene locus_tag LOCUS_15110 3508 4140 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228375.1 protein_id gnl|my_center|LOCUS_15110 4437 5522 gene locus_tag LOCUS_15120 gene ychF 4437 5522 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014061.1 protein_id gnl|my_center|LOCUS_15120 5674 7470 gene locus_tag LOCUS_15130 5674 7470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15130 7863 7651 gene locus_tag LOCUS_15140 7863 7651 CDS product molybdopterin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071920.1 protein_id gnl|my_center|LOCUS_15140 8205 8573 gene locus_tag LOCUS_15150 8205 8573 CDS product zinc ribbon domain-containing protein YjdM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856918.1 protein_id gnl|my_center|LOCUS_15150 8981 8724 gene locus_tag LOCUS_15160 8981 8724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15160 9573 9181 gene locus_tag LOCUS_15170 9573 9181 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804266.1 protein_id gnl|my_center|LOCUS_15170 10833 10057 gene locus_tag LOCUS_15180 10833 10057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15180 11109 11609 gene locus_tag LOCUS_15190 gene tpx 11109 11609 CDS product thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776224.1 protein_id gnl|my_center|LOCUS_15190 12732 11818 gene locus_tag LOCUS_15200 12732 11818 CDS product AzlC family ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111777.1 protein_id gnl|my_center|LOCUS_15200 13077 12742 gene locus_tag LOCUS_15210 13077 12742 CDS product AzlD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005081319.1 protein_id gnl|my_center|LOCUS_15210 14343 13537 gene locus_tag LOCUS_15220 14343 13537 CDS product AzlC family ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111777.1 protein_id gnl|my_center|LOCUS_15220 14549 15061 gene locus_tag LOCUS_15230 14549 15061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15230 15370 16863 gene locus_tag LOCUS_15240 15370 16863 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190875.1 protein_id gnl|my_center|LOCUS_15240 18669 17002 gene locus_tag LOCUS_15250 18669 17002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15250 18924 19448 gene locus_tag LOCUS_15260 18924 19448 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_078330934.1 protein_id gnl|my_center|LOCUS_15260 19597 20184 gene locus_tag LOCUS_15270 19597 20184 CDS product TIGR00730 family Rossman fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005067248.1 protein_id gnl|my_center|LOCUS_15270 20227 20949 gene locus_tag LOCUS_15280 gene pcp 20227 20949 CDS product pyroglutamyl-peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390168.1 protein_id gnl|my_center|LOCUS_15280 >Feature sequence25 1269 259 gene locus_tag LOCUS_15290 1269 259 CDS product YeiH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000009146.1 protein_id gnl|my_center|LOCUS_15290 1506 1369 gene locus_tag LOCUS_15300 1506 1369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15300 2282 1545 gene locus_tag LOCUS_15310 2282 1545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15310 3059 2331 gene locus_tag LOCUS_15320 3059 2331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15320 3839 3108 gene locus_tag LOCUS_15330 3839 3108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15330 4818 4027 gene locus_tag LOCUS_15340 4818 4027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15340 5941 5213 gene locus_tag LOCUS_15350 5941 5213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15350 6681 7730 gene locus_tag LOCUS_15360 gene zapE 6681 7730 CDS product cell division protein ZapE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485435.1 protein_id gnl|my_center|LOCUS_15360 11004 7855 gene locus_tag LOCUS_15370 11004 7855 CDS product CRISPR-associated helicase/endonuclease Cas3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674070.1 protein_id gnl|my_center|LOCUS_15370 11381 13072 gene locus_tag LOCUS_15380 11381 13072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15380 13065 13679 gene locus_tag LOCUS_15390 13065 13679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15390 13708 14829 gene locus_tag LOCUS_15400 gene cas7e 13708 14829 CDS product type I-E CRISPR-associated protein Cas7/Cse4/CasC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004138505.1 protein_id gnl|my_center|LOCUS_15400 14829 15578 gene locus_tag LOCUS_15410 gene cas5e 14829 15578 CDS product type I-E CRISPR-associated protein Cas5/CasD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229113.1 protein_id gnl|my_center|LOCUS_15410 15575 16255 gene locus_tag LOCUS_15420 gene cas6e 15575 16255 CDS product type I-E CRISPR-associated protein Cas6/Cse3/CasE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674074.1 protein_id gnl|my_center|LOCUS_15420 16369 17313 gene locus_tag LOCUS_15430 gene cas1e 16369 17313 CDS product type I-E CRISPR-associated endonuclease Cas1e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674075.1 protein_id gnl|my_center|LOCUS_15430 17313 17651 gene locus_tag LOCUS_15440 17313 17651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15440 17746 20459 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtgttccccgcgcgagcggggatgagccc >Feature sequence26 237 2315 gene locus_tag LOCUS_15450 237 2315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15450 2494 3540 gene locus_tag LOCUS_15460 2494 3540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15460 3684 4877 gene locus_tag LOCUS_15470 3684 4877 CDS product iron chelate uptake ABC transporter family permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082397.1 protein_id gnl|my_center|LOCUS_15470 4750 4849 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 4874 5710 gene locus_tag LOCUS_15480 gene fepG 4874 5710 CDS product iron-enterobactin ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817186.1 protein_id gnl|my_center|LOCUS_15480 5710 6552 gene locus_tag LOCUS_15490 5710 6552 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027975.1 protein_id gnl|my_center|LOCUS_15490 7102 8520 gene locus_tag LOCUS_15500 7102 8520 CDS product esterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167382115.1 protein_id gnl|my_center|LOCUS_15500 8790 10490 gene locus_tag LOCUS_15510 8790 10490 CDS product (2,3-dihydroxybenzoyl)adenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243083.1 protein_id gnl|my_center|LOCUS_15510 10544 10771 gene locus_tag LOCUS_15520 10544 10771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15520 11056 15366 gene locus_tag LOCUS_15530 11056 15366 CDS product non-ribosomal peptide synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053385512.1 protein_id gnl|my_center|LOCUS_15530 15773 16129 gene locus_tag LOCUS_15540 15773 16129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15540 16228 17097 gene locus_tag LOCUS_15550 16228 17097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15550 19913 17181 gene locus_tag LOCUS_15560 gene aceE 19913 17181 CDS product pyruvate dehydrogenase (acetyl-transferring), homodimeric type inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804451.1 protein_id gnl|my_center|LOCUS_15560 20391 20465 gene locus_tag LOCUS_t00360 20391 20465 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence27 2627 1140 gene locus_tag LOCUS_15570 gene putP 2627 1140 CDS product sodium/proline symporter PutP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730456.1 protein_id gnl|my_center|LOCUS_15570 4034 3009 gene locus_tag LOCUS_15580 gene gluQRS 4034 3009 CDS product tRNA glutamyl-Q(34) synthetase GluQRS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803860.1 protein_id gnl|my_center|LOCUS_15580 4312 5220 gene locus_tag LOCUS_15590 4312 5220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15590 6348 5329 gene locus_tag LOCUS_15600 6348 5329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15600 8455 6626 gene locus_tag LOCUS_15610 gene menD 8455 6626 CDS product 2-succinyl-5-enolpyruvyl-6-hydroxy-3-cyclohexene-1-carboxylic-acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466562.1 protein_id gnl|my_center|LOCUS_15610 9589 8534 gene locus_tag LOCUS_15620 9589 8534 CDS product o-succinylbenzoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727412.1 protein_id gnl|my_center|LOCUS_15620 9871 11550 gene locus_tag LOCUS_15630 9871 11550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15630 11718 12095 gene locus_tag LOCUS_15640 11718 12095 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003861911.1 protein_id gnl|my_center|LOCUS_15640 12346 13179 gene locus_tag LOCUS_15650 12346 13179 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905879.1 protein_id gnl|my_center|LOCUS_15650 14060 13281 gene locus_tag LOCUS_15660 14060 13281 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878183.1 protein_id gnl|my_center|LOCUS_15660 14897 14094 gene locus_tag LOCUS_15670 14897 14094 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230771.1 protein_id gnl|my_center|LOCUS_15670 15890 15051 gene locus_tag LOCUS_15680 gene artP 15890 15051 CDS product arginine ABC transporter substrate-binding protein ArtP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398706.1 protein_id gnl|my_center|LOCUS_15680 16167 16898 gene locus_tag LOCUS_15690 16167 16898 CDS product demethylmenaquinone methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974389.1 protein_id gnl|my_center|LOCUS_15690 16953 18014 gene locus_tag LOCUS_15700 16953 18014 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974364.1 protein_id gnl|my_center|LOCUS_15700 >Feature sequence28 108 21 gene locus_tag LOCUS_t00370 108 21 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 897 277 gene locus_tag LOCUS_15710 897 277 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227922.1 protein_id gnl|my_center|LOCUS_15710 3582 976 gene locus_tag LOCUS_15720 3582 976 CDS product YhgE/Pip domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966852.1 protein_id gnl|my_center|LOCUS_15720 4496 3585 gene locus_tag LOCUS_15730 4496 3585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15730 5323 4796 gene locus_tag LOCUS_15740 5323 4796 CDS product nucleoside deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390371.1 protein_id gnl|my_center|LOCUS_15740 7540 5366 gene locus_tag LOCUS_15750 7540 5366 CDS product RecQ family ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775917.1 protein_id gnl|my_center|LOCUS_15750 7803 7606 gene locus_tag LOCUS_15760 7803 7606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15760 7878 8534 gene locus_tag LOCUS_15770 7878 8534 CDS product VTT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727167.1 protein_id gnl|my_center|LOCUS_15770 9282 8671 gene locus_tag LOCUS_15780 9282 8671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15780 10081 9422 gene locus_tag LOCUS_15790 10081 9422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15790 11210 10407 gene locus_tag LOCUS_15800 11210 10407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15800 12296 11427 gene locus_tag LOCUS_15810 12296 11427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15810 14067 12388 gene locus_tag LOCUS_15820 14067 12388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15820 14740 14147 gene locus_tag LOCUS_15830 14740 14147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15830 15654 14851 gene locus_tag LOCUS_15840 15654 14851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15840 16517 15846 gene locus_tag LOCUS_15850 16517 15846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15850 17028 16519 gene locus_tag LOCUS_15860 17028 16519 CDS product asparaginase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036092.1 protein_id gnl|my_center|LOCUS_15860 17271 17198 gene locus_tag LOCUS_t00380 17271 17198 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 17467 18150 gene locus_tag LOCUS_15870 17467 18150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013364002.1 protein_id gnl|my_center|LOCUS_15870 >Feature sequence29 1059 892 gene locus_tag LOCUS_15880 1059 892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15880 1434 2762 gene locus_tag LOCUS_15890 1434 2762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15890 3581 2934 gene locus_tag LOCUS_15900 3581 2934 CDS product uracil-DNA glycosylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017022.1 protein_id gnl|my_center|LOCUS_15900 4050 3583 gene locus_tag LOCUS_15910 4050 3583 CDS product tRNA (cytidine(34)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226777.1 protein_id gnl|my_center|LOCUS_15910 4218 5465 gene locus_tag LOCUS_15920 4218 5465 CDS product cysteine desulfurase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030274.1 protein_id gnl|my_center|LOCUS_15920 5654 6877 gene locus_tag LOCUS_15930 gene mnmA 5654 6877 CDS product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973510.1 protein_id gnl|my_center|LOCUS_15930 6979 7368 gene locus_tag LOCUS_15940 6979 7368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15940 7519 8826 gene locus_tag LOCUS_15950 7519 8826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15950 8882 9583 gene locus_tag LOCUS_15960 gene mtrA 8882 9583 CDS product two-component system response regulator MtrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013867.1 protein_id gnl|my_center|LOCUS_15960 9738 11369 gene locus_tag LOCUS_15970 gene mtrB 9738 11369 CDS product MtrAB system histidine kinase MtrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776080.1 protein_id gnl|my_center|LOCUS_15970 11604 13310 gene locus_tag LOCUS_15980 gene lpqB 11604 13310 CDS product MtrAB system accessory lipoprotein LpqB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005088448.1 protein_id gnl|my_center|LOCUS_15980 13533 14273 gene locus_tag LOCUS_15990 13533 14273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15990 14483 15124 gene locus_tag LOCUS_16000 gene raiA 14483 15124 CDS product ribosome-associated translation inhibitor RaiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776077.1 protein_id gnl|my_center|LOCUS_16000 >Feature sequence30 2136 949 gene locus_tag LOCUS_16010 gene glf 2136 949 CDS product UDP-galactopyranose mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776101.1 protein_id gnl|my_center|LOCUS_16010 2744 7372 gene locus_tag LOCUS_16020 2744 7372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16020 7878 7438 gene locus_tag LOCUS_16030 7878 7438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16030 8352 8600 gene locus_tag LOCUS_16040 8352 8600 CDS product WhiB family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973730.1 protein_id gnl|my_center|LOCUS_16040 10329 8755 gene locus_tag LOCUS_16050 10329 8755 CDS product histidine kinase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776067.1 protein_id gnl|my_center|LOCUS_16050 12384 10711 gene locus_tag LOCUS_16060 12384 10711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16060 13073 12381 gene locus_tag LOCUS_16070 13073 12381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16070 13437 13670 gene locus_tag LOCUS_16080 13437 13670 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776072.1 protein_id gnl|my_center|LOCUS_16080 14524 13862 gene locus_tag LOCUS_16090 14524 13862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16090 14739 15671 gene locus_tag LOCUS_16100 14739 15671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16100 15781 16434 gene locus_tag LOCUS_16110 15781 16434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16110 <17255 16548 gene locus_tag LOCUS_16120 <17255 16548 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003975807.1:preprotein translocase subunit SecA >Feature sequence31 2078 627 gene locus_tag LOCUS_16130 2078 627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16130 2665 4137 gene locus_tag LOCUS_16140 2665 4137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16140 4195 5061 gene locus_tag LOCUS_16150 4195 5061 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013399561.1 protein_id gnl|my_center|LOCUS_16150 5552 5235 gene locus_tag LOCUS_16160 5552 5235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16160 8499 5743 gene locus_tag LOCUS_16170 8499 5743 CDS product FtsX-like permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009994141.1 protein_id gnl|my_center|LOCUS_16170 9270 8503 gene locus_tag LOCUS_16180 9270 8503 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975722.1 protein_id gnl|my_center|LOCUS_16180 11151 9607 gene locus_tag LOCUS_16190 gene metG 11151 9607 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012296388.1 protein_id gnl|my_center|LOCUS_16190 11783 11710 gene locus_tag LOCUS_t00390 11783 11710 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 13023 11995 gene locus_tag LOCUS_16200 gene ilvC 13023 11995 CDS product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775904.1 protein_id gnl|my_center|LOCUS_16200 13787 13287 gene locus_tag LOCUS_16210 gene ilvN 13787 13287 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003080760.1 protein_id gnl|my_center|LOCUS_16210 15589 13787 gene locus_tag LOCUS_16220 15589 13787 CDS product acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775906.1 protein_id gnl|my_center|LOCUS_16220 16052 16591 gene locus_tag LOCUS_16230 16052 16591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16230 >Feature sequence32 113 319 gene locus_tag LOCUS_16240 113 319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16240 1320 415 gene locus_tag LOCUS_16250 1320 415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16250 2331 1621 gene locus_tag LOCUS_16260 2331 1621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16260 4284 2887 gene locus_tag LOCUS_16270 4284 2887 CDS product chloride channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000254652.1 protein_id gnl|my_center|LOCUS_16270 4648 4499 gene locus_tag LOCUS_16280 4648 4499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16280 4611 5456 gene locus_tag LOCUS_16290 gene proC 4611 5456 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114890.1 protein_id gnl|my_center|LOCUS_16290 6260 5598 gene locus_tag LOCUS_16300 6260 5598 CDS product TrkA family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776430.1 protein_id gnl|my_center|LOCUS_16300 7872 6253 gene locus_tag LOCUS_16310 7872 6253 CDS product potassium transporter TrkG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776429.1 protein_id gnl|my_center|LOCUS_16310 8293 9525 gene locus_tag LOCUS_16320 8293 9525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16320 9621 11669 gene locus_tag LOCUS_16330 9621 11669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16330 12187 12876 gene locus_tag LOCUS_16340 12187 12876 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222430.1 protein_id gnl|my_center|LOCUS_16340 13442 12987 gene locus_tag LOCUS_16350 13442 12987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16350 14459 13545 gene locus_tag LOCUS_16360 14459 13545 CDS product 1,4-dihydroxy-2-naphthoate polyprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402865.1 protein_id gnl|my_center|LOCUS_16360 15945 14584 gene locus_tag LOCUS_16370 gene menE 15945 14584 CDS product o-succinylbenzoate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742122.1 protein_id gnl|my_center|LOCUS_16370 >Feature sequence33 296 1387 gene locus_tag LOCUS_16380 296 1387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16380 1389 3536 gene locus_tag LOCUS_16390 1389 3536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16390 4404 3688 gene locus_tag LOCUS_16400 4404 3688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16400 4853 5650 gene locus_tag LOCUS_16410 gene rpsB 4853 5650 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_106517497.1 protein_id gnl|my_center|LOCUS_16410 5805 6635 gene locus_tag LOCUS_16420 gene tsf 5805 6635 CDS product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804635.1 protein_id gnl|my_center|LOCUS_16420 6832 7575 gene locus_tag LOCUS_16430 gene pyrH 6832 7575 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052755.1 protein_id gnl|my_center|LOCUS_16430 7870 8427 gene locus_tag LOCUS_16440 gene frr 7870 8427 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973383.1 protein_id gnl|my_center|LOCUS_16440 8515 9342 gene locus_tag LOCUS_16450 8515 9342 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857552.1 protein_id gnl|my_center|LOCUS_16450 9547 10134 gene locus_tag LOCUS_16460 9547 10134 CDS product DivIVA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804641.1 protein_id gnl|my_center|LOCUS_16460 10289 11614 gene locus_tag LOCUS_16470 gene dxr 10289 11614 CDS product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973332.1 protein_id gnl|my_center|LOCUS_16470 12047 12928 gene locus_tag LOCUS_16480 12047 12928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16480 13345 14700 gene locus_tag LOCUS_16490 13345 14700 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804643.1 protein_id gnl|my_center|LOCUS_16490 >Feature sequence34 92 17 gene locus_tag LOCUS_t00400 92 17 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 592 2442 gene locus_tag LOCUS_16500 592 2442 CDS product phosphoenolpyruvate carboxykinase (GTP) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726783.1 protein_id gnl|my_center|LOCUS_16500 2803 3273 gene locus_tag LOCUS_16510 2803 3273 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002724669.1 protein_id gnl|my_center|LOCUS_16510 3918 5099 gene locus_tag LOCUS_16520 3918 5099 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971715.1 protein_id gnl|my_center|LOCUS_16520 6691 5255 gene locus_tag LOCUS_16530 6691 5255 CDS product phosphomannomutase/phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028721.1 protein_id gnl|my_center|LOCUS_16530 6799 7986 gene locus_tag LOCUS_16540 gene manA 6799 7986 CDS product mannose-6-phosphate isomerase, class I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111913.1 protein_id gnl|my_center|LOCUS_16540 8284 8553 gene locus_tag LOCUS_16550 8284 8553 CDS product ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721327.1 protein_id gnl|my_center|LOCUS_16550 8597 9919 gene locus_tag LOCUS_16560 8597 9919 CDS product PFL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989505.1 protein_id gnl|my_center|LOCUS_16560 11191 10049 gene locus_tag LOCUS_16570 11191 10049 CDS product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776597.1 protein_id gnl|my_center|LOCUS_16570 11904 11188 gene locus_tag LOCUS_16580 11904 11188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16580 12064 13266 gene locus_tag LOCUS_16590 12064 13266 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015376.1 protein_id gnl|my_center|LOCUS_16590 13315 13632 gene locus_tag LOCUS_16600 13315 13632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16600 >Feature sequence35 856 614 gene locus_tag LOCUS_16610 856 614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16610 1458 1207 gene locus_tag LOCUS_16620 1458 1207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16620 3508 1691 gene locus_tag LOCUS_16630 3508 1691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16630 4268 3462 gene locus_tag LOCUS_16640 4268 3462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16640 6848 4380 gene locus_tag LOCUS_16650 6848 4380 CDS product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027807.1 protein_id gnl|my_center|LOCUS_16650 8097 6883 gene locus_tag LOCUS_16660 gene metK 8097 6883 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005057696.1 protein_id gnl|my_center|LOCUS_16660 10196 8256 gene locus_tag LOCUS_16670 gene uvrC 10196 8256 CDS product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005082304.1 protein_id gnl|my_center|LOCUS_16670 10881 10399 gene locus_tag LOCUS_16680 10881 10399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16680 10899 10998 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence36 1014 1 gene locus_tag LOCUS_16690 gene galE 1014 1 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001156530.1 protein_id gnl|my_center|LOCUS_16690 2100 1216 gene locus_tag LOCUS_16700 2100 1216 CDS product DUF4253 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016498.1 protein_id gnl|my_center|LOCUS_16700 3335 2379 gene locus_tag LOCUS_16710 gene dapD 3335 2379 CDS product 2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930176.1 protein_id gnl|my_center|LOCUS_16710 3446 4624 gene locus_tag LOCUS_16720 gene dapE 3446 4624 CDS product succinyl-diaminopimelate desuccinylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030079.1 protein_id gnl|my_center|LOCUS_16720 4714 5121 gene locus_tag LOCUS_16730 4714 5121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16730 5127 6494 gene locus_tag LOCUS_16740 5127 6494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16740 6678 7055 gene locus_tag LOCUS_16750 6678 7055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16750 8346 7144 gene locus_tag LOCUS_16760 8346 7144 CDS product P-loop NTPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029104279.1 protein_id gnl|my_center|LOCUS_16760 9289 8336 gene locus_tag LOCUS_16770 9289 8336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16770 10610 9282 gene locus_tag LOCUS_16780 10610 9282 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030088.1 protein_id gnl|my_center|LOCUS_16780 10741 11748 gene locus_tag LOCUS_16790 10741 11748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16790 >Feature sequence37 1699 3870 gene locus_tag LOCUS_16800 1699 3870 CDS product acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776647.1 protein_id gnl|my_center|LOCUS_16800 4098 5030 gene locus_tag LOCUS_16810 4098 5030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16810 5241 7154 gene locus_tag LOCUS_16820 gene typA 5241 7154 CDS product translational GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804730.1 protein_id gnl|my_center|LOCUS_16820 7496 8845 gene locus_tag LOCUS_16830 7496 8845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16830 9346 9666 gene locus_tag LOCUS_16840 9346 9666 CDS product ferredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083029.1 protein_id gnl|my_center|LOCUS_16840 9863 11002 gene locus_tag LOCUS_16850 gene dapC 9863 11002 CDS product succinyldiaminopimelate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804734.1 protein_id gnl|my_center|LOCUS_16850 >Feature sequence38 <1 956 gene locus_tag LOCUS_16860 <1 956 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_038967757.1:alpha/beta hydrolase 1153 2244 gene locus_tag LOCUS_16870 1153 2244 CDS product S-(hydroxymethyl)mycothiol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027326.1 protein_id gnl|my_center|LOCUS_16870 2254 2901 gene locus_tag LOCUS_16880 2254 2901 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978121.1 protein_id gnl|my_center|LOCUS_16880 4625 3036 gene locus_tag LOCUS_16890 4625 3036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16890 7957 4691 gene locus_tag LOCUS_16900 7957 4691 CDS product SMC family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027705.1 protein_id gnl|my_center|LOCUS_16900 9159 7954 gene locus_tag LOCUS_16910 9159 7954 CDS product exonuclease SbcCD subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284170.1 protein_id gnl|my_center|LOCUS_16910 9598 10743 gene locus_tag LOCUS_16920 9598 10743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16920 >Feature sequence39 437 222 gene locus_tag LOCUS_16930 437 222 CDS product RNA-binding S4 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728864.1 protein_id gnl|my_center|LOCUS_16930 669 2048 gene locus_tag LOCUS_16940 669 2048 CDS product glycine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775737.1 protein_id gnl|my_center|LOCUS_16940 2186 3163 gene locus_tag LOCUS_16950 2186 3163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16950 3488 4570 gene locus_tag LOCUS_16960 gene dusB 3488 4570 CDS product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775729.1 protein_id gnl|my_center|LOCUS_16960 4708 6834 gene locus_tag LOCUS_16970 4708 6834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16970 7049 7122 gene locus_tag LOCUS_t00410 7049 7122 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 7857 8729 gene locus_tag LOCUS_16980 7857 8729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16980 9038 10243 gene locus_tag LOCUS_16990 9038 10243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16990 10362 10436 gene locus_tag LOCUS_t00420 10362 10436 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence40 1017 49 gene locus_tag LOCUS_17000 gene fmt 1017 49 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728792.1 protein_id gnl|my_center|LOCUS_17000 1620 1024 gene locus_tag LOCUS_17010 1620 1024 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727226.1 protein_id gnl|my_center|LOCUS_17010 2781 1933 gene locus_tag LOCUS_17020 2781 1933 CDS product PD-(D/E)XK nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775690.1 protein_id gnl|my_center|LOCUS_17020 2962 2888 gene locus_tag LOCUS_t00430 2962 2888 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 3415 3342 gene locus_tag LOCUS_t00440 3415 3342 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 3509 3437 gene locus_tag LOCUS_t00450 3509 3437 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 4037 3962 gene locus_tag LOCUS_t00460 4037 3962 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 4736 4302 gene locus_tag LOCUS_17030 4736 4302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17030 6250 4739 gene locus_tag LOCUS_17040 gene gltX 6250 4739 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775887.1 protein_id gnl|my_center|LOCUS_17040 7060 6308 gene locus_tag LOCUS_17050 7060 6308 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775888.1 protein_id gnl|my_center|LOCUS_17050 8406 7309 gene locus_tag LOCUS_17060 8406 7309 CDS product branched-chain amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036086.1 protein_id gnl|my_center|LOCUS_17060 <9517 8763 gene locus_tag LOCUS_17070 <9517 8763 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003811990.1:3-isopropylmalate dehydrogenase >Feature sequence41 1946 186 gene locus_tag LOCUS_17080 1946 186 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975390.1 protein_id gnl|my_center|LOCUS_17080 2046 2492 gene locus_tag LOCUS_17090 2046 2492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17090 2796 5615 gene locus_tag LOCUS_17100 gene topA 2796 5615 CDS product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776591.1 protein_id gnl|my_center|LOCUS_17100 5863 6834 gene locus_tag LOCUS_17110 5863 6834 CDS product Ppx/GppA phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028926.1 protein_id gnl|my_center|LOCUS_17110 7034 8113 gene locus_tag LOCUS_17120 7034 8113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17120 >Feature sequence42 426 353 gene locus_tag LOCUS_t00470 426 353 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 626 1102 gene locus_tag LOCUS_17130 gene bcp 626 1102 CDS product thioredoxin-dependent thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730061.1 protein_id gnl|my_center|LOCUS_17130 1288 1370 gene locus_tag LOCUS_t00480 1288 1370 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 1615 3711 gene locus_tag LOCUS_17140 1615 3711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17140 3860 4024 gene locus_tag LOCUS_17150 3860 4024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17150 4036 5517 gene locus_tag LOCUS_17160 4036 5517 CDS product malate:quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003686866.1 protein_id gnl|my_center|LOCUS_17160 5796 7160 gene locus_tag LOCUS_17170 5796 7160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17170 >Feature sequence43 1562 576 gene locus_tag LOCUS_17180 gene rlmB 1562 576 CDS product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814978.1 protein_id gnl|my_center|LOCUS_17180 3070 1658 gene locus_tag LOCUS_17190 gene cysS 3070 1658 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030868385.1 protein_id gnl|my_center|LOCUS_17190 3641 3159 gene locus_tag LOCUS_17200 gene ispF 3641 3159 CDS product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804549.1 protein_id gnl|my_center|LOCUS_17200 4474 3731 gene locus_tag LOCUS_17210 gene ispD 4474 3731 CDS product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419436.1 protein_id gnl|my_center|LOCUS_17210 5173 4490 gene locus_tag LOCUS_17220 gene regX 5173 4490 CDS product two-component sensory transduction protein RegX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011742113.1 protein_id gnl|my_center|LOCUS_17220 6342 5215 gene locus_tag LOCUS_17230 6342 5215 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974746.1 protein_id gnl|my_center|LOCUS_17230 7260 6523 gene locus_tag LOCUS_17240 7260 6523 CDS product phosphoglyceromutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052347.1 protein_id gnl|my_center|LOCUS_17240 >Feature sequence44 26 2110 gene locus_tag LOCUS_17250 26 2110 CDS product glucose PTS transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390207.1 protein_id gnl|my_center|LOCUS_17250 2278 3303 gene locus_tag LOCUS_17260 2278 3303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17260 5219 3516 gene locus_tag LOCUS_17270 5219 3516 CDS product ABC transporter family substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389694.1 protein_id gnl|my_center|LOCUS_17270 <6977 5475 gene locus_tag LOCUS_17280 <6977 5475 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013389694.1:ABC transporter family substrate-binding protein >Feature sequence45 <1 1443 gene locus_tag LOCUS_17290 <1 1443 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_149560359.1:ATP-dependent RNA helicase HrpA 3195 1828 gene locus_tag LOCUS_17300 3195 1828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17300 4468 3473 gene locus_tag LOCUS_17310 4468 3473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17310 5083 5011 gene locus_tag LOCUS_t00490 5083 5011 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 5178 5107 gene locus_tag LOCUS_t00500 5178 5107 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 5298 5225 gene locus_tag LOCUS_t00510 5298 5225 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence46 812 2878 gene locus_tag LOCUS_17320 812 2878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17320 3160 3924 gene locus_tag LOCUS_17330 3160 3924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17330 >Feature sequence47 2073 3113 gene locus_tag LOCUS_17340 2073 3113 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084052.1 protein_id gnl|my_center|LOCUS_17340 >Feature sequence48 1525 191 gene locus_tag LOCUS_17350 1525 191 CDS product pyrimidine permease RutG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729472.1 protein_id gnl|my_center|LOCUS_17350 2867 1782 gene locus_tag LOCUS_17360 2867 1782 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005115250.1 protein_id gnl|my_center|LOCUS_17360 3422 2898 gene locus_tag LOCUS_17370 3422 2898 CDS product DUF4242 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005079458.1 protein_id gnl|my_center|LOCUS_17370 >Feature sequence49 939 772 gene locus_tag LOCUS_17380 939 772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17380 1969 932 gene locus_tag LOCUS_17390 1969 932 CDS product HAD-IIA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227824.1 protein_id gnl|my_center|LOCUS_17390 3293 2157 gene locus_tag LOCUS_17400 3293 2157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17400 >Feature sequence50 <1 729 gene locus_tag LOCUS_17410 <1 729 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_066567803.1:cysteine synthase A 1052 1636 gene locus_tag LOCUS_17420 gene cysE 1052 1636 CDS product serine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006286028.1 protein_id gnl|my_center|LOCUS_17420 <3337 1846 gene locus_tag LOCUS_17430 <3337 1846 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005091773.1:NADP-dependent phosphogluconate dehydrogenase >Feature sequence51 358 1653 gene locus_tag LOCUS_17440 358 1653 CDS product Bcr/CflA family multidrug efflux MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004538642.1 protein_id gnl|my_center|LOCUS_17440 1696 2346 gene locus_tag LOCUS_17450 1696 2346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17450 >Feature sequence52 <1 1169 gene locus_tag LOCUS_17460 <1 1169 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_034284254.1:flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase 1351 2604 gene locus_tag LOCUS_17470 1351 2604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17470 >Feature sequence53 <1 762 gene locus_tag LOCUS_17480 <1 762 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012296596.1:transcription antitermination factor NusB 817 1518 gene locus_tag LOCUS_17490 gene rpe 817 1518 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805209.1 protein_id gnl|my_center|LOCUS_17490 >Feature sequence54 1050 217 gene locus_tag LOCUS_17500 1050 217 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011921898.1 protein_id gnl|my_center|LOCUS_17500 2082 1078 gene locus_tag LOCUS_17510 2082 1078 CDS product NADP-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011921897.1 protein_id gnl|my_center|LOCUS_17510 2587 2153 gene locus_tag LOCUS_17520 2587 2153 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012774961.1 protein_id gnl|my_center|LOCUS_17520 >Feature sequence55 >Feature sequence56 975 253 gene locus_tag LOCUS_17530 975 253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17530 1993 1160 gene locus_tag LOCUS_17540 1993 1160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17540 >Feature sequence57 1148 636 gene locus_tag LOCUS_17550 1148 636 CDS product PTS glucose transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989640.1 protein_id gnl|my_center|LOCUS_17550 1484 2065 gene locus_tag LOCUS_17560 1484 2065 CDS product arsenic metallochaperone ArsD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804467.1 protein_id gnl|my_center|LOCUS_17560 >Feature sequence58 775 134 gene locus_tag LOCUS_17570 775 134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17570 1451 999 gene locus_tag LOCUS_17580 1451 999 CDS product CrcB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389414.1 protein_id gnl|my_center|LOCUS_17580 1852 1451 gene locus_tag LOCUS_17590 1852 1451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17590 >Feature sequence59 1711 131 gene locus_tag LOCUS_17600 1711 131 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027264.1 protein_id gnl|my_center|LOCUS_17600 >Feature sequence60 1563 763 gene locus_tag LOCUS_17610 1563 763 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804604.1 protein_id gnl|my_center|LOCUS_17610 >Feature sequence61 >Feature sequence62 1524 694 gene locus_tag LOCUS_17620 1524 694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17620 >Feature sequence63 <1459 615 gene locus_tag LOCUS_17630 <1459 615 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013230130.1:4'-phosphopantetheinyl transferase superfamily protein >Feature sequence64 >Feature sequence65 863 872 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence66 618 403 gene locus_tag LOCUS_17640 618 403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17640